Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene
2014-01-01
The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expre...
DEFF Research Database (Denmark)
Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup
2014-01-01
overexpression led to faster cell spreading. The final total numbers of attached cells did, however, not differ between cultures of PiT1 overexpressing cells and control cells of neither cell type. We suggest that the PiT1-mediated fast adhesion potentials allow the cells to go faster out of G0/G1 and thereby......The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells......, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expression supports that cells utilize the PiT1 levels to control proliferation, with non-proliferating cells showing...
Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru
2018-05-15
Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Bøttger, Pernille; Pedersen, Lene
2011-01-01
-keeping functions. Alignment of protein sequences representing PiT family members from all kingdoms reveals the presence of conserved amino acids and that bacterial phosphate permeases and putative phosphate permeases from archaea lack substantial parts of the protein sequence when compared to the mammalian Pi...... PiT2 histidine, H502, and the human PiT1 glutamate, E70, - both conserved in eukaryotic PiT family members - are critical for Pi transport function. Noticeably, human PiT2 H502 is located in the C-terminal PiT family signature sequence, and human PiT1 E70 is located in ProDom domains characteristic....... Conclusions The results suggest that the overall structure of the Pi-transporting unit of the PiT family proteins has remained unchanged during evolution. Moreover, in combination, our studies of the gene structure of the human PiT1 and PiT2 genes (SLC20A1 and SLC20A2, respectively) and alignment of protein...
Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice
Directory of Open Access Journals (Sweden)
Kaifeng Yin
2017-05-01
Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.
DEFF Research Database (Denmark)
Jensen, N.; Schroder, H. D.; Hejbol, E. K.
2013-01-01
Familial idiopathic basal ganglia calcification (FIBGC) is a neurodegenerative disorder with neuropsychiatric and motor symptoms. Deleterious mutations in SLC20A2, encoding the type III sodium-dependent phosphate transporter 2 (PiT2), were recently linked to FIBGC in almost 50% of the families...... reported worldwide. Here, we show that knockout of Slc20a2 in mice causes calcifications in the thalamus, basal ganglia, and cortex, demonstrating that reduced PiT2 expression alone can cause brain calcifications....
Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode
2017-10-26
Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath
2007-01-01
Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...
NELL-1 increases pre-osteoblast mineralization using both phosphate transporter Pit1 and Pit2
Energy Technology Data Exchange (ETDEWEB)
Cowan, Catherine M. [Department of Bioengineering, University of California, Los Angeles, 420 Westwood Plaza,7523 Boelter Hall, Los Angeles, CA 90095 (United States); Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Zhang, Xinli; James, Aaron W.; Mari Kim, T.; Sun, Nichole [Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Wu, Benjamin [Department of Bioengineering, University of California, Los Angeles, 420 Westwood Plaza,7523 Boelter Hall, Los Angeles, CA 90095 (United States); Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Ting, Kang [Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Soo, Chia, E-mail: bsoo@ucla.edu [UCLA and Orthopaedic Hospital Department of Orthopaedic Surgery and the Orthopaedic, Hospital Research Center, University of California, Los Angeles, 2641 Charles E. Young Dr. South, Los Angeles, CA 90095 (United States)
2012-06-08
Highlights: Black-Right-Pointing-Pointer NELL-1 accelerates extracellular matrix mineralization in MC3T3-E1 pre-osteoblasts. Black-Right-Pointing-Pointer NELL-1 significantly increases intracellular inorganic phosphate levels. Black-Right-Pointing-Pointer NELL-1 positively regulates osteogenesis but not proliferation in MC3T3-E1 cells. Black-Right-Pointing-Pointer NELL-1 regulates inorganic phosphate transporter activity. -- Abstract: NELL-1 is a potent osteoinductive molecule that enhances bone formation in multiple animal models through currently unidentified pathways. In the present manuscript, we hypothesized that NELL-1 may regulate osteogenic differentiation accompanied by alteration of inorganic phosphate (Pi) entry into the osteoblast via sodium dependent phosphate (NaPi) transporters. To determine this, MC3T3-E1 pre-osteoblasts were cultured in the presence of recombinant human (rh)NELL-1 or rhBMP-2. Analysis was performed for intracellular Pi levels through malachite green staining, Pit-1 and Pit-2 expression, and forced upregulation of Pit-1 and Pit-2. Results showed rhNELL-1 to increase MC3T3-E1 matrix mineralization and Pi influx associated with activation of both Pit-1 and Pit-2 channels, with significantly increased Pit-2 production. In contrast, Pi transport elicited by rhBMP-2 showed to be associated with increased Pit-1 production only. Next, neutralizing antibodies against Pit-1 and Pit-2 completely abrogated the Pi influx effect of rhNELL-1, suggesting rhNELL-1 is dependent on both transporters. These results identify one potential mechanism of action for rhNELL-1 induced osteogenesis and highlight a fundamental difference between NELL-1 and BMP-2 signaling.
NELL-1 increases pre-osteoblast mineralization using both phosphate transporter Pit1 and Pit2
International Nuclear Information System (INIS)
Cowan, Catherine M.; Zhang, Xinli; James, Aaron W.; Mari Kim, T.; Sun, Nichole; Wu, Benjamin; Ting, Kang; Soo, Chia
2012-01-01
Highlights: ► NELL-1 accelerates extracellular matrix mineralization in MC3T3-E1 pre-osteoblasts. ► NELL-1 significantly increases intracellular inorganic phosphate levels. ► NELL-1 positively regulates osteogenesis but not proliferation in MC3T3-E1 cells. ► NELL-1 regulates inorganic phosphate transporter activity. -- Abstract: NELL-1 is a potent osteoinductive molecule that enhances bone formation in multiple animal models through currently unidentified pathways. In the present manuscript, we hypothesized that NELL-1 may regulate osteogenic differentiation accompanied by alteration of inorganic phosphate (Pi) entry into the osteoblast via sodium dependent phosphate (NaPi) transporters. To determine this, MC3T3-E1 pre-osteoblasts were cultured in the presence of recombinant human (rh)NELL-1 or rhBMP-2. Analysis was performed for intracellular Pi levels through malachite green staining, Pit-1 and Pit-2 expression, and forced upregulation of Pit-1 and Pit-2. Results showed rhNELL-1 to increase MC3T3-E1 matrix mineralization and Pi influx associated with activation of both Pit-1 and Pit-2 channels, with significantly increased Pit-2 production. In contrast, Pi transport elicited by rhBMP-2 showed to be associated with increased Pit-1 production only. Next, neutralizing antibodies against Pit-1 and Pit-2 completely abrogated the Pi influx effect of rhNELL-1, suggesting rhNELL-1 is dependent on both transporters. These results identify one potential mechanism of action for rhNELL-1 induced osteogenesis and highlight a fundamental difference between NELL-1 and BMP-2 signaling.
Directory of Open Access Journals (Sweden)
Onkar Singh
Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.
Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.
Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun
2018-06-15
Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.
OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.
Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy
2017-05-30
Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.
Subsidence of the pit slab at SLC experimental hall
International Nuclear Information System (INIS)
Inaba, J.; Himeno, Yoichi; Katsura, Yutaka
1992-01-01
Detectors installed at particle accelerator facilities are quite heavy, weighing thousands of tons. On the other hand, ground subsidence caused by the installation of a detector adversely affects the beam line alignment of the collider. It becomes, therefore, very important to figure out the expected amount of ground settlement by means of adequate evaluation methods in advance. At Stanford Linear Accelerator Center (SLAC), a 1700 mT (metric tons) Mark II detector was replaced with a 4000 mT SLD detector in Stanford Linear Collider (SLC). The exchange started in December 1990 and lasted until March 1991, and the amount of ground settlement was measured by SLAC during that period. We performed simulation studies to evaluate the subsidence of the pit slab using several analysis methods. Parameters used for the analyses were decided based on the information of the SLC structure and the ground conditions at the SLAC area. The objective of this study is to verify the applicability of several simulation methods by comparing the analytical results with the actual subsidence data obtained by SLAC
Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U
2013-01-01
Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.
LENUS (Irish Health Repository)
Murphy, Therese M
2012-02-01
BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.
SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.
Directory of Open Access Journals (Sweden)
Chi-Jiunn Pan
Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.
Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi
2017-01-01
The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.
Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A
2016-11-01
Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.
Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying
2017-04-01
The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.
Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.
Lean, Choo Bee; Lee, Edmund Jon Deoon
2009-01-01
MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.
Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.
2012-01-01
Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097
The renal urate transporter SLC17A1 locus: confirmation of association with gout.
Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R
2012-04-27
Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.
Suazo, José; Castillo, Silvia; Martin, Luz Maria; Rojas, Francisca; Santos, José Luis; Rotter, Karin; Solar, Margarita; Tapia, Eva
2013-01-01
Obese/diabetic mothers present a higher risk to develop offspring with myelomeningocele (MM), evidence supporting the role of energy homeostasis-related genes in neural tube defects. Using polymerase chain reaction–restriction fragment length polymorphism, we have genotyped SLC2A1, HK1, and LEPR single-nucleotide polymorphisms in 105 Chilean patients with MM and their parents in order to evaluate allele–phenotype associations by means of allele/haplotype transmission test (TDT) and parent-of-origin effects. We detected an undertransmission for the SLC2A1 haplotype T-A (rs710218-rs2229682; P = .040), which was not significant when only lower MM (90% of the cases) was analyzed. In addition, the leptin receptor rs1137100 G allele showed a significant increase in the risk of MM for maternal-derived alleles in the whole sample (2.43-fold; P = .038) and in lower MM (3.20-fold; P = .014). Our results support the role of genes involved in energy homeostasis in the risk of developing MM, thus sustaining the hypothesis of diverse pathways and genetic mechanisms acting in the expression of such birth defect. PMID:23427181
MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.
Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet
2016-11-01
A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).
The role of SLC2A1 in early onset and childhood absence epilepsies
DEFF Research Database (Denmark)
Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg
2013-01-01
Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...
S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model
Directory of Open Access Journals (Sweden)
Pingting Liu
2017-01-01
Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.
Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.
Thurtle-Schmidt, Bryan H; Stroud, Robert M
2016-09-20
Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.
Directory of Open Access Journals (Sweden)
Daniela Paccagnini
2009-09-01
Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.
ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production
Directory of Open Access Journals (Sweden)
Etienne Masle-Farquhar
2017-05-01
Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.
Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa
2011-03-01
The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
DEFF Research Database (Denmark)
Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...
Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi
2018-01-01
The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.
PCR-RFLP analyses for studying the diversity of GH and Pit-1 genes in Slovak Simmental cattle
Directory of Open Access Journals (Sweden)
Anna Trakovická
2013-10-01
Full Text Available The aim of this study was evaluation of growth hormone (GH and specific pituitary transcription factor (Pit-1 genes diversity in population of 353 Slovak Simmental cows. The analyses were based on single nucleotide polymorphisms GH/AluI and Pit-1/HinfI detections. A polymorphic site of GH gene (AluI has been linked to differences in circulating metabolites, metabolic hormones and milk yield. Bovine Pit-1 is responsible for pituitary development and hormone secreting gene expression, including GH gene. The Pit-1/HinfI locus was associated with growth, milk production and reproduction performance in cattle. Samples of genomic DNA were analyzed by PCR-RFLP method. Digestion of GH gene PCR products with restriction enzyme AluI revealed allele L and V with frequency 0.695 and 0.305, respectively. The digested Pit-1 gene PCR products with enzyme HinfI revealed alleles A (0.249 and B (0.751. Dominant genotypes were for GH gene heterozygous LV (0.47 and for Pit-1 gene homozygous BB (0.56 animals. The observed heterozygosity, effective allele numbers and polymorphism information content of GH/AluI and Pit-1/HinfI bovine loci population were 0.42/0.37, 1.73/1.59 and 0.33/0.30, respectively. The median polymorphic information content of loci was also transferred to the higher observed homozygosity in population (0.58/0.63. Keywords: cattle, growth hormone, leptin, PCR, Pit-1, polymorphism.
Directory of Open Access Journals (Sweden)
Mark W Neff
Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.
Archer, N S; Nassif, N T; O'Brien, B A
2015-06-01
A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.
Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V
2014-01-01
We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.
Directory of Open Access Journals (Sweden)
Sughondhabirom Atapol
2007-10-01
Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.
Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K
2017-09-01
Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.
Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.
Directory of Open Access Journals (Sweden)
Deborah Cook
2008-09-01
Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.
Directory of Open Access Journals (Sweden)
Amy J Osborne
Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.
Directory of Open Access Journals (Sweden)
Naila Al Mahmuda
2016-05-01
Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.
AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.
Directory of Open Access Journals (Sweden)
2005-09-01
= 250.44, p = 0.011. Similarly, significant association was observed between Tridimensional Personality Questionnaire Reward Dependence scores and AVPR1a RS1 (chi-square = 20.16, p = 0.01. Two-locus analysis (RS1 and RS3 conditional on HTTLPR and VNTR was highly significant (LRS = 162.95, p = 0.001. Promoter repeat regions in the AVPR1a gene have been robustly demonstrated to play a role in molding a range of social behaviors in many vertebrates and, more recently, in humans. Additionally, serotonergic neurotransmission in some human studies appears to mediate human religious and spiritual experiences. We therefore hypothesize that the association between AVPR1a and SLC6A4 reflects the social communication, courtship, and spiritual facets of the dancing phenotype rather than other aspects of this complex phenotype, such as sensorimotor integration.
AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.
Directory of Open Access Journals (Sweden)
Rachel Bachner-Melman
2005-09-01
= 250.44, p = 0.011. Similarly, significant association was observed between Tridimensional Personality Questionnaire Reward Dependence scores and AVPR1a RS1 (chi-square = 20.16, p = 0.01. Two-locus analysis (RS1 and RS3 conditional on HTTLPR and VNTR was highly significant (LRS = 162.95, p = 0.001. Promoter repeat regions in the AVPR1a gene have been robustly demonstrated to play a role in molding a range of social behaviors in many vertebrates and, more recently, in humans. Additionally, serotonergic neurotransmission in some human studies appears to mediate human religious and spiritual experiences. We therefore hypothesize that the association between AVPR1a and SLC6A4 reflects the social communication, courtship, and spiritual facets of the dancing phenotype rather than other aspects of this complex phenotype, such as sensorimotor integration.
Directory of Open Access Journals (Sweden)
Mizuno T
2015-07-01
Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury
Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing
2017-07-03
Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT
Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio
2015-06-01
Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".
DEFF Research Database (Denmark)
Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob
2015-01-01
The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...
Genetic variation of Pit-1 gene in Chinese indigenous and Western ...
African Journals Online (AJOL)
STORAGESEVER
2009-07-20
Jul 20, 2009 ... regulates pituitary development and expression of the growth hormone, prolactin and thyrotropin β- submit genes. Pit-1 ... mice (Camper et al., 1990), as well as including the .... logy Company, Shanghai, China). Statistical ...
Wolf, Marlene; Clark-Lewis, Ian; Buri, Caroline; Langen, Hanno; Lis, Maddalena; Mazzucchelli, Luca
2003-01-01
Cathepsin D (Cath-D) expression in human primary breast cancer has been associated with a poor prognosis. In search of a better understanding of the Cath-D substrates possibly involved in cancer invasiveness and metastasis, we investigated the potential interactions between this protease and chemokines. Here we report that purified Cath-D, as well as culture supernatants from the human breast carcinoma cell lines MCF-7 and T47D, selectively degrade macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and SLC (CCL21). Proteolysis was totally blocked by the protease inhibitor pepstatin A, and specificity of Cath-D cleavage was demonstrated using a large chemokine panel. Whereas MIP-1α and MIP-1β degradation was rapid and complete, cleavage of SLC was slow and not complete. Mass spectrometry analysis showed that Cath-D cleaves the Leu58 to Trp59 bond of SLC producing two functionally inactive fragments. Analysis of Cath-D proteolysis of a series of monocyte chemoattractant protein-3/MIP-1β hybrids indicated that processing of MIP-1β might start by cleaving off amino acids located in the C-terminal domain. In situ hybridization studies revealed MIP-1α, MIP-1β, and Cath-D gene expression mainly in the stromal compartment of breast cancers whereas SLC transcripts were found in endothelial cells of capillaries and venules within the neoplastic tissues. Cath-D production in the breast carcinoma cell lines MCF-7 and T47D, as assessed by enzyme-linked immunosorbent assay of culture supernatants and cell lysates, was not affected by stimulation with chemokines such as interleukin-8 (CXCL8), SDF-1 (CXCL12), and SLC. These data suggest that inactivation of chemokines by Cath-D possibly influences regulatory mechanisms in the tumoral extracellular microenvironment that in turn may affect the generation of the antitumoral immune response, the migration of cancer cells, or both processes. PMID:12651610
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul
Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K
2016-10-01
Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue
Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M
2017-10-19
The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.
Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A
2017-10-01
This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.
Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.
Rao, Suryadevara S; Hildebrand, David
2009-10-01
The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.
A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.
Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane
2017-01-01
Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
Analysis of two Pit-1 gene polymorphisms: Single nucleotide ...
African Journals Online (AJOL)
Pit-1 is a pituitary-specific transcription factor responsible for pituitary development and hormone expression in mammals. Pit-1 is a member of the POU domain containing proteins, a group of transcriptional regulators with a critical role in cell differentiation and proliferation. It was shown that this group of proteins control the ...
Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião
2011-10-01
About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.
Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification
Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús
2014-01-01
Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463
Anti-PIT-1 antibody syndrome; a novel clinical entity leading to hypopituitarism.
Bando, Hironori; Iguchi, Genzo; Yamamoto, Masaaki; Hidaka-Takeno, Ryoko; Takahashi, Yutaka
2015-03-01
Various hypothalamic-pituitary diseases cause hypopituitarism. Inflammation related to autoimmunity also causes hypopituitarism. Hypophysitis is a representative disease caused by autoimmunity. Generally, anterior pituitary hormones are non-specifically impaired in this condition, but specific hormone defects have been reported in some cases. Anti-PIT-1 (pituitary-specific transcription factor 1) antibody syndrome is a novel clinical entity that presents an acquired combined pituitary hormone deficiency characterized by a specific defect in growth hormone, prolactin, and thyroid-stimulating hormone. Circulating anti-PIT-1 antibody along with various autoantibodies are detected with multiple endocrine organopathy, meeting the definition of autoimmune polyglandular syndrome. Mechanistically, cytotoxic T lymphocytes that specifically react with PIT-1 protein play an important role in the development of this syndrome.
Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius
2017-01-01
Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227
Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying
2015-01-01
Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.
A stochastic analysis of the effect of hydrostatic pressure on the pit corrosion of Fe-20Cr alloy
International Nuclear Information System (INIS)
Zhang Tao; Yang Yange; Shao Yawei; Meng, Guozhe; Wang, Fuhui
2009-01-01
The effect of hydrostatic pressure on the pit corrosion behavior of Fe-20Cr alloy was investigated in 3.5% NaCl solution by means of potentiodynamic polarization and potentiostatic technology, and the experiment data was analyzed based on stochastic theory. With the increase of hydrostatic pressure, the pit corrosion resistance of Fe-20Cr alloy was deteriorated, which was distinguished by the decrease of critical pit potential (E cirt ) and the increase of passive current density. The results also demonstrated that there exist two effects of hydrostatic pressure on the corrosion behavior of Fe-20Cr alloy: (1) the pit generation rate was evidently increased compared to that under lower hydrostatic pressure, and the metastable pits become faster and larger. However, it seemed that pit generation mechanism shows no hydrostatic pressure dependence; (2) the probability of pit growth increased with the increase of hydrostatic pressure, which implied that the metastable pit on Fe-20Cr alloy exhibited higher probability to become larger pit cavity during shorter time interval than that under lower hydrostatic pressure.
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495
Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan
2017-01-01
ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822
International Nuclear Information System (INIS)
Spalding, B.P.; Bogle, M.A.; Cline, S.R.; Naney, M.T.; Gu, B.
1997-12-01
A treatability study was initiated in October 1993, initially encompassing the application of in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was to have supported a possible Interim Record of Decision (IROD) or removal action for closure of one or more of the seepage pits and trenches as early as FY 1997. The Remedial Investigation/Feasibility Study for Waste Area Grouping (WAG) 7, which contains these seven seepage pits and trenches, will probably not begin until after the year 2000. This treatability study will establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability to overlap melt settings that are necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of 137 Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. This report summarizes the site characterization information gathered through the end of September 1996 which supports the planning and assessment of ISV for Pit 1 (objective 4 above)
Energy Technology Data Exchange (ETDEWEB)
Spalding, B.P.; Bogle, M.A.; Cline, S.R.; Naney, M.T.; Gu, B.
1997-12-01
A treatability study was initiated in October 1993, initially encompassing the application of in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was to have supported a possible Interim Record of Decision (IROD) or removal action for closure of one or more of the seepage pits and trenches as early as FY 1997. The Remedial Investigation/Feasibility Study for Waste Area Grouping (WAG) 7, which contains these seven seepage pits and trenches, will probably not begin until after the year 2000. This treatability study will establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability to overlap melt settings that are necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of {sup 137}Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. This report summarizes the site characterization information gathered through the end of September 1996 which supports the planning and assessment of ISV for Pit 1 (objective 4 above).
Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha
2015-09-01
Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.
International Nuclear Information System (INIS)
Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi
2009-01-01
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura
2018-04-12
Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.
Energy Technology Data Exchange (ETDEWEB)
Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2009-11-20
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan
2012-06-01
Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.
Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A
2017-07-01
Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Keller, L.P.
1982-01-01
Work on a one interaction-region, push-pull conceptual design for the SLC is described. The concept which has received the most attention is described. It is a below-ground hall - a 15 m deep rectangular pit covered by a surface building which houses counting rooms, power supplies, cryogenics and other auxiliary equipment
Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel
2009-10-15
3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.
Cañibano, Carmen; Rodriguez, Noela L; Saez, Carmen; Tovar, Sulay; Garcia-Lavandeira, Montse; Borrello, Maria Grazia; Vidal, Anxo; Costantini, Frank; Japon, Miguel; Dieguez, Carlos; Alvarez, Clara V
2007-04-18
Somatotrophs are the only pituitary cells that express Ret, GFRalpha1 and GDNF. This study investigated the effects of Ret in a somatotroph cell line, in primary pituitary cultures and in Ret KO mice. Ret regulates somatotroph numbers by inducing Pit-1 overexpression, leading to increased p53 expression and apoptosis, both of which can be prevented with Ret or Pit-1 siRNA. The Pit-1 overexpression is mediated by sustained activation of PKCdelta, JNK, c/EBPalpha and CREB induced by a complex of Ret, caspase 3 and PKCdelta. In the presence of GDNF, Akt is activated, and the Pit-1 overexpression and resulting apoptosis are blocked. The adenopituitary of Ret KO mice is larger than normal, showing Pit-1 and somatotroph hyperplasia. In normal animals, activation of the Ret/Pit-1/p53 pathway by retroviral introduction of Ret blocked tumor growth in vivo. Thus, somatotrophs have an intrinsic mechanism for controlling Pit-1/GH production through an apoptotic/survival pathway. Ret might be of value for treatment of pituitary adenomas.
Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J
2015-06-11
ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.
Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun
2017-04-01
Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.
Directory of Open Access Journals (Sweden)
Clifford Jacobs
2014-06-01
Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.
Mustapha, Mirna; Fang, Qing; Gong, Tzy-Wen; Dolan, David F.; Raphael, Yehoash; Camper, Sally A.; Duncan, R. Keith
2012-01-01
The absence of thyroid hormone (TH) during late gestation and early infancy can cause irreparable deafness in both humans and rodents. A variety of rodent models have been utilized in an effort to identify the underlying molecular mechanism. Here, we characterize a mouse model of secondary hypothyroidism, pituitary transcription factor 1 (Pit1dw), which has profound, congenital deafness that is rescued by oral TH replacement. These mutants have tectorial membrane abnormalities, including a prominent Hensen's stripe, elevated β-tectorin composition, and disrupted striated-sheet matrix. They lack distortion product otoacoustic emissions and cochlear microphonic responses, and exhibit reduced endocochlear potentials, suggesting defects in outer hair cell function and potassium recycling. Auditory system and hair cell physiology, histology and anatomy studies reveal novel defects of hormone deficiency related to deafness: (1) permanently impaired expression of KCNJ10 in the stria vascularis of Pit1dw mice, which likely contributes to the reduced endocochlear potential, (2) significant outer hair cell loss in the mutants, which may result from cellular stress induced by the lower KCNQ4 expression and current levels in Pit1dw mutant outer hair cells and (3) sensory and strial cell deterioration, which may have implications for thyroid hormone dysregulation in age related hearing impairment. In summary, we suggest that these defects in outer hair cell and strial cell function are important contributors to the hearing impairment in Pit1dw mice. PMID:19176829
Structural and functional studies on the pituitary-specific transcription factor Pit-1
Augustijn, K.D.
2002-01-01
Pit-1 is a pituitary specific transcription factor that plays a central role in the development and maintenance of a number of cell lineages in the anterior pituitary gland. In these cell lineages, Pit-1 is required for the selective expression of the growth hormone (GH), prolactin (PRL) and the
Directory of Open Access Journals (Sweden)
Karen M Vernau
Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.
Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A
2016-11-01
The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.
Anticipation in a family with primary familial brain calcification caused by an SLC20A2 variant.
Konno, Takuya; Blackburn, Patrick R; Rozen, Todd D; van Gerpen, Jay A; Ross, Owen A; Atwal, Paldeep S; Wszolek, Zbigniew K
2018-04-11
To describe a family with primary familial brain calcification (PFBC) due to SLC20A2 variant showing possible genetic anticipation. We conducted historical, genealogical, clinical, and radiologic studies of a family with PFBC. Clinical evaluations including neurological examination and head computed tomography (CT) scans of a proband and her father were performed. They provided additional information regarding other family members. To identify a causative gene variant, we performed whole-exome sequencing for the proband followed by segregation analysis in other affected members using direct sequencing. In this family, nine affected members were identified over four generations. The proband suffered from chronic daily headache including thunderclap headache. We identified an SLC20A2 (c.509delT, p.(Leu170*)) variant in three affected members over three generations. Interestingly, the age of onset became younger as the disease passed through successive generations, suggestive of genetic anticipation. For clinical purpose, it is important to consider thunderclap headache and genetic anticipation in PFBC caused by SLC20A2 variants. Further investigation is required to validate our observation. Copyright © 2018 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.
Directory of Open Access Journals (Sweden)
Paige A Winkler
Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.
International Nuclear Information System (INIS)
Spalding, B.P.; Naney, M.T.; Cline, S.R.; Bogle, M.A.
1997-12-01
A treatability study was initiated in October 1993 to apply in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was later extended to include all of Pit 1 and was performed to support a possible Interim Record of Decision or removal action for closure of one or more of the seepage pits and trenches beginning as early as FY 1997. This treatability study was carried out to establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability for the overlap of melt settings which will be necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of 137 Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. In April 1996 an expulsion of an estimated 10% of the 196 Mg (216 tons) melt body occurred resulting in significant damage to ISV equipment and, ultimately, led to an indefinite suspension of further ISV operations at Pit 1. This report summarizes the technical accomplishments and status of the project in fulfilling these objectives through September 1997
Energy Technology Data Exchange (ETDEWEB)
Spalding, B.P.; Naney, M.T.; Cline, S.R.; Bogle, M.A. [Oak Ridge National Lab., TN (United States). Environmental Sciences Div.; Tixier, J.S. [Pacific Northwest National Lab., Richland, WA (United States)
1997-12-01
A treatability study was initiated in October 1993 to apply in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was later extended to include all of Pit 1 and was performed to support a possible Interim Record of Decision or removal action for closure of one or more of the seepage pits and trenches beginning as early as FY 1997. This treatability study was carried out to establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability for the overlap of melt settings which will be necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of {sup 137}Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. In April 1996 an expulsion of an estimated 10% of the 196 Mg (216 tons) melt body occurred resulting in significant damage to ISV equipment and, ultimately, led to an indefinite suspension of further ISV operations at Pit 1. This report summarizes the technical accomplishments and status of the project in fulfilling these objectives through September 1997.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT
Software Modules for the Proximity-1 Space Link Interleaved Time Synchronization (PITS) Protocol
Woo, Simon S.; Veregge, John R.; Gao, Jay L.; Clare, Loren P.; Mills, David
2012-01-01
The Proximity-1 Space Link Interleaved Time Synchronization (PITS) protocol provides time distribution and synchronization services for space systems. A software prototype implementation of the PITS algorithm has been developed that also provides the test harness to evaluate the key functionalities of PITS with simulated data source and sink. PITS integrates time synchronization functionality into the link layer of the CCSDS Proximity-1 Space Link Protocol. The software prototype implements the network packet format, data structures, and transmit- and receive-timestamp function for a time server and a client. The software also simulates the transmit and receive-time stamp exchanges via UDP (User Datagram Protocol) socket between a time server and a time client, and produces relative time offsets and delay estimates.
DEFF Research Database (Denmark)
Pullen, Timothy J; Sylow, Lykke; Sun, Gao
2012-01-01
Exercise-induced hyperinsulinism (EIHI) is an autosomal dominant disorder characterized by inappropriate insulin secretion in response to vigorous physical exercise or pyruvate injection. Activating mutations in the monocarboxylate transporter-1 (MCT1, SLC16A1) promoter have been linked to EIHI....... Expression of this pyruvate transporter is specifically repressed (disallowed) in pancreatic ß-cells, despite nearly universal expression across other tissues. It has been impossible to determine, however, whether EIHI mutations cause MCT1 expression in patient ß-cells. The hypothesis that MCT1 expression...... in ß-cells is sufficient to cause EIHI by allowing entry of pyruvate and triggering insulin secretion thus remains unproven. Therefore, we generated a transgenic mouse capable of doxycycline-induced, ß-cell-specific overexpression of MCT1 to test this model directly. MCT1 expression caused isolated...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA
Association of SLC11A1 gene polymorphism with caprine ...
Indian Academy of Sciences (India)
Navya
2017-01-16
Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...
DEFF Research Database (Denmark)
Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H
2012-01-01
BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...
Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.
Characterization of SLC transporters in human skin
Directory of Open Access Journals (Sweden)
Marion Alriquet
2015-03-01
Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.
DEFF Research Database (Denmark)
Lundorf, Mikkel D.; Pedersen, Finn Skou; O'Hara, Bryan
1998-01-01
Pit1 is the human receptor for gibbon ape leukemia virus (GALV) and feline leukemia virus subgroup B (FeLV-B), while the related human protein Pit2 is a receptor for amphotropic murine leukemia virus (A-MuLV). The A-MuLV-related isolate 10A1 can utilize both Pit1 and Pit2 as receptors. A stretch...
De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico
2013-07-01
Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA
Pits and adatoms at the interface of 1-ML C84/Ag (111)
International Nuclear Information System (INIS)
Wang Peng; Zhang Han-Jie; Li Yan-Jun; Sheng Chun-Qi; Li Wen-Jie; Xing Xiu-Na; Li Hai-Yang; He Pi-Mo; Bao Shi-Ning; Li Hong-Nian
2013-01-01
We prepare a well-defined C 84 monolayer on the surface of Ag (111) and study the geometric structure by scanning tunneling microscopy (STM). The C 84 molecules form a nearly close-packed incommensurate R30° lattice. The lattice is long-distance ordered with numerous local disorders. The monolayer exhibits complex bright/dim contrast; the largest height difference between the molecules can be greater than 0.4 nm. Annealing the monolayer at 380 °C can desorb part of the molecules, but more than sixty percent molecules stay on the Ag (111) surface even after the sample has been annealed at 650 °C. Our analyses reveal that the 7-atom pits form beneath many molecules. Some other molecules sit at the 1-atom pits. Ag adatoms (those removed substrate atoms, accompanying the pit formation) play a very important role in this system. The adatoms can either stabilize or destabilize the monolayer, depending on the distribution manner of the adatoms at the interface. The distribution manner is determined by the co-play of the following factors: the dimension of the interstitial regions of the C 84 overlayer, the number of the adatoms, and the long-distance migration of part adatoms. (condensed matter: structural, mechanical, and thermal properties)
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS
DEFF Research Database (Denmark)
Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D
2013-01-01
The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4
Dynamic Interactions between Pit-1 and C/EBPα in the Pituitary Cell Nucleus▿
Demarco, Ignacio A.; Voss, Ty C.; Booker, Cynthia F.; Day, Richard N.
2006-01-01
The homeodomain (HD) transcription factors are a structurally conserved family of proteins that, through networks of interactions with other nuclear proteins, control patterns of gene expression during development. For example, the network interactions of the pituitary-specific HD protein Pit-1 control the development of anterior pituitary cells and regulate the expression of the hormone products in the adult cells. Inactivating mutations in Pit-1 disrupt these processes, giving rise to the s...
Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko
2017-01-01
We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4
200 West Area Ash Pit Demolition Site closure plan. Revision 1
International Nuclear Information System (INIS)
Ruck, F.R.
1994-01-01
The Ash Pit Demolition Site had two known demolition events, the first occurred in November of 1984, and the second occurred in June of 1986. These demolition events were a form of thermal treatment for discarded explosive chemical products. Because the Ash Pit Demolition Site will no longer be used for this thermal activity, the site will be closed. Closure will be conducted pursuant to the requirements of the Washington State Department of Ecology (Ecology) ''Dangerous Waste Regulations'', Washington Administrative Code (WAC) 173-303-610 and 40 Code of Federal Regulations (CFR) 270.1. The 200 West Area Ash Pit Demolition Site Closure Plan consists of a Part A, Form 3, Dangerous Waste Permit Application (Revision 4) and a closure plan. An explanation of the Part A, Form 3, submitted with this closure plan is provided at the beginning of the Part A Section. The closure plan consists of nine chapters and five appendices. This closure plan presents a description of the Ash,Pit Demolition Site, the history of the waste treated, and the approach that will be followed to close the Ash Pit Demolition Site. Because there were no radioactively contaminated chemicals involved in the demolitions, the information on radionuclides is provided for ''information only''. Remediation of any radioactive contamination is not within the scope of this closure plan. Only dangerous constituents derived from Ash Pit Demolition Site operations will be addressed in this closure plan in accordance with WAC 173-303-610(2)(b)(i)
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG
DEFF Research Database (Denmark)
Huppke, Peter; Brendel, Cornelia; Kalscheuer, Vera
2012-01-01
or compound heterozygous mutations for all affected subjects in SLC33A1 encoding a highly conserved acetylCoA transporter (AT-1) required for acetylation of multiple gangliosides and glycoproteins. The mutations were found to cause reduced or absent AT-1 expression and abnormal intracellular localization...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA
Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya
2018-03-05
Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.
Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V
2014-11-01
Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in
Modeling and management of pit lake water chemistry 1: Theory
International Nuclear Information System (INIS)
Castendyk, D.N.; Eary, L.E.; Balistrieri, L.S.
2015-01-01
Highlights: • Review of pit lake literature in the context of pit lake predictions. • Review of approaches used to predict pit wall-rock runoff and leachate. • Review of approaches used to generate a pit lake water balance. • Review of approaches used to generate a hydrodynamic prediction. • Review of approaches used to generate a geochemical prediction of a future pit lake. - Abstract: Pit lakes are permanent hydrologic/landscape features that can result from open pit mining for metals, coal, uranium, diamonds, oil sands, and aggregates. Risks associated with pit lakes include local and regional impacts to water quality and related impacts to aquatic and terrestrial ecosystems. Stakeholders rely on predictive models of water chemistry to prepare for and manage these risks. This paper is the first of a two part series on the modeling and management of pit lakes. Herein, we review approaches that have been used to quantify wall-rock runoff geochemistry, wall-rock leachate geochemistry, pit lake water balance, pit lake limnology (i.e. extent of vertical mixing), and pit lake water quality, and conclude with guidance on the application of models within the mine life cycle. The purpose of this paper is to better prepare stakeholders, including future modelers, mine managers, consultants, permitting agencies, land management agencies, regulators, research scientists, academics, and other interested parties, for the challenges of predicting and managing future pit lakes in un-mined areas
Ellestad, Laura E; Porter, Tom E
2013-01-01
Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5'-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5'-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland.
Directory of Open Access Journals (Sweden)
Dale W Hailey
Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.
Cleanup Verification Package for the 126-F-1, 184-F Powerhouse Ash Pit
International Nuclear Information System (INIS)
Clark, S.W.; Sulloway, H.M.
2007-01-01
This cleanup verification package documents completion of remedial action for the 126-F-1, 184-F Powerhouse Ash Pit. This waste site received coal ash from the 100-F Area coal-fired steam plant. Leakage of process effluent from the 116-F-14 , 107-F Retention Basins flowed south into the ash pit, contaminating the northern portion
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4
Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel
2009-01-01
Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4
Pereira, Bernardo Dias; Raimundo, Luísa; Mete, Ozgur; Oliveira, Ana; Portugal, Jorge; Asa, Sylvia L
2016-03-01
Thyrotropin (TSH)-secreting pituitary adenomas are exceedingly rare at the pediatric age and no cases of co-secretion with other pituitary hormones in these tumors have been described in this age range. We present a case of a monomorphous plurihormonal pituitary adenoma that co-secreted TSH and GH in a pediatric patient. A 13-year-old male presented with increasing height velocity (17.75 cm/year, 9.55SD), weight loss, and visual impairment. Initial biochemical evaluations revealed secondary hyperthyroidism. A giant pituitary tumor compressing the surrounding structures was detected by magnetic resonance, and a transsphenoidal surgery was initially performed. Pathological examinations revealed an atypical, monomorphous plurihormonal Pit-1 lineage tumor with mixed features of silent subtype 3 adenoma and acidophil stem cell adenoma. In the postoperative period, secondary hyperthyroidism recurred with high levels of both GH and IGF1. In addition, due to tumor re-growth, a multimodality treatment plan was undertaken including surgery, somatostatin analogs, and radiotherapy. We report the first pediatric case of a plurihormonal TSH- and GH-secreting pituitary adenoma, further expanding the clinical manifestations of pediatric pituitary tumors. Comprehensive pathological evaluation and close follow-up surveillance are crucial to the prompt delivery of the best therapeutic options in the context of this particularly aggressive pituitary tumor.
Jensen, Lars R; Chen, Wei; Moser, Bettina; Lipkowitz, Bettina; Schroeder, Christopher; Musante, Luciana; Tzschach, Andreas; Kalscheuer, Vera M; Meloni, Ilaria; Raynaud, Martine; van Esch, Hilde; Chelly, Jamel; de Brouwer, Arjan P M; Hackett, Anna; van der Haar, Sigrun; Henn, Wolfram; Gecz, Jozef; Riess, Olaf; Bonin, Michael; Reinhardt, Richard; Ropers, Hans-Hilger; Kuss, Andreas W
2011-01-01
X-linked intellectual disability (XLID), also known as X-linked mental retardation, is a highly genetically heterogeneous condition for which mutations in >90 different genes have been identified. In this study, we used a custom-made sequencing array based on the Affymetrix 50k platform for mutation screening in 17 known XLID genes in patients from 135 families and found eight single-nucleotide changes that were absent in controls. For four mutations affecting ATRX (p.1761M>T), PQBP1 (p.155R>X) and SLC6A8 (p.390P>L and p.477S>L), we provide evidence for a functional involvement of these changes in the aetiology of intellectual disability. PMID:21267006
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0
Nicolas, Gaël; Charbonnier, Camille; de Lemos, Roberta Rodrigues; Richard, Anne-Claire; Guillin, Olivier; Wallon, David; Legati, Andrea; Geschwind, Daniel; Coppola, Giovanni; Frebourg, Thierry; Campion, Dominique; de Oliveira, João Ricardo Mendes; Hannequin, Didier
2015-10-01
Primary Familial Brain Calcification (PFBC) is a dominantly inherited cerebral microvascular calcifying disorder with diverse neuropsychiatric expression. Three causative genes have been identified: SLC20A2, PDGFRB and, recently, PDGFB, whose associated phenotype has not yet been extensively studied. We included in the largest published case series of genetically confirmed PFBC, 19 PDGFB (including three new mutations), 24 SLC20A2 (including 4 new mutations), and 14 PDGFRB mutation carriers, from two countries (France and Brazil). We studied clinical features and applied our visual rating scale on all 49 available CT scans. Among the symptomatic mutation carriers (33/57, 58%), the three most frequently observed categories of clinical features were psychiatric signs (72.7%, 76.5%, and 80% for PDGFB, SLC20A2, and PDGFRB, respectively), movement disorders (45.5%, 76.5%, and 40%), and cognitive impairment (54.6%, 64.7%, and 40%). The median age of clinical onset was 31 years, 25% had an early onset (before 18) and 25% a later onset (after 53). Patients with an early clinical onset exhibited mostly isolated psychiatric or cognitive signs, while patients with a later onset exhibited mostly movement disorders, especially in association with other clinical features. CT scans rating allowed identifying four patterns of calcification. The total calcification score was best predicted by the combined effects of gene (SLC20A2 > PDGFB > PDGFRB mutations), sex (male), and (increasing) age, defining three risk classes, which correlated with the four patterns of calcification. These calcification patterns could reflect the natural history of the calcifying process, with distinct risk classes characterized by different age at onset or rate of progression. © 2015 Wiley Periodicals, Inc.
Analyses of SLC13A5-epilepsy patients reveal perturbations of TCA cycle.
Bainbridge, Matthew N; Cooney, Erin; Miller, Marcus; Kennedy, Adam D; Wulff, Jacob E; Donti, Taraka; Jhangiani, Shalini N; Gibbs, Richard A; Elsea, Sarah H; Porter, Brenda E; Graham, Brett H
2017-08-01
To interrogate the metabolic profile of five subjects from three families with rare, nonsense and missense mutations in SLC13A5 and Early Infantile Epileptic Encephalopathies (EIEE) characterized by severe, neonatal onset seizures, psychomotor retardation and global developmental delay. Mass spectrometry of plasma, CSF and urine was used to identify consistently dysregulated analytes in our subjects. Distinctive elevations of citrate and dysregulation of citric acid cycle intermediates, supporting the hypothesis that loss of SLC13A5 function alters tricarboxylic acid cycle (TCA) metabolism and may disrupt metabolic compartmentation in the brain. Our results indicate that analysis of plasma citrate and other TCA analytes in SLC13A5 deficient patients define a diagnostic metabolic signature that can aid in diagnosing children with this disease. Copyright © 2017 Elsevier Inc. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4
Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N
2013-01-01
To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4
Anchordoquy, J P; Anchordoquy, J M; Pascua, A M; Nikoloff, N; Peral-García, P; Furnus, C C
2017-07-15
Adequate dietary intake of copper (Cu) is required for normal reproductive performance in cattle. The objective of this study was to investigate the pregnancy rates from cattle with deficient, marginal and adequate Cu plasma concentration at the beginning of artificial insemination protocol. Moreover, we determined Cu concentrations present in bovine oviductal fluid (OF), and the effects of Cu on fertilizing ability of bovine spermatozoa. Also, the presence of Cu transporter, SLC31A1 (also known as CTR1), in spermatozoa and in vitro matured oocyte were investigated. We found no differences in pregnancy rates among animals with adequate, marginal, and deficient Cu concentrations measured in plasma at the beginning of fixed-time artificial insemination (FTAI) protocol. Copper concentrations in OF were 38.3 ± 2.17 μg/dL (mean ± SEM) regardless of cupremia levels. The addition of 40 μg/dL Cu to IVF medium enhanced total and progressive motility, sperm viability, functional sperm membrane integrity (HOST), sperm-zona binding, and pronuclear formation. On the other hand, the presence of Cu in IVF medium did not modify acrosome integrity and cleavage rates after IVF, but impaired blastocyst rates. Cu transporter SLC31A1 was detected in bovine spermatozoa in the apical segment of acrosome, and in the oocyte matured in vitro. In conclusion, the results obtained in the present study determined that cupremia levels at the beginning of FTAI protocol did not influence the pregnancy rates at 60 d after insemination. The presence of CTR1 in bovine mature oocyte and spermatozoa, as well as the beneficial effect of Cu on sperm quality would suggest an important role of this mineral during the fertilization process. Copyright © 2017 Elsevier Inc. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni
2017-08-01
The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( + ) -sensitive dye 2',7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein, mink lung epithelial cell (MLEC) assay, and chromatin immunoprecipitation. Activation of TGF-β signaling significantly upregulated transcript, protein, and surface expression of NBCe1. These effects were TGF-β receptor-mediated and suppressed following inhibition of JNK and Smad signaling. Moreover, 4-aminopyridine (4AP)-dependent NBCe1 regulation requires TGF-β. TGF-β increased the rate and amplitude of intracellular H + changes upon challenging NBCe1 in wild-type astrocytes but not in cortical astrocytes from Slc4a4-deficient mice. A Smad4 binding sequence was identified in the NBCe1 promoter and Smad4 binding increased after activation of TGF-β signaling. The data show for the first time that NBCe1 is a direct target of TGF-β/Smad4 signaling. Through activation of the canonical pathway TGF-β acts directly on NBCe1 by binding of Smad4 to the NBCe1 promoter and regulating its transcription, followed by increased protein expression and transport activity. © 2017 The Authors GLIA Published by Wiley Periodicals, Inc.
Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen
2014-01-01
Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4
Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina
2017-01-01
Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125
Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.
Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa
2012-10-15
Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.
Bao, Zhao-Shi; Chen, Hui-Min; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang; Su, Xiao-Dong; Chen, Clark C; Jiang, Tao
2014-11-01
Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. © 2014 Bao et al.; Published by Cold Spring Harbor Laboratory Press.
Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi
2012-01-01
Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...
Directory of Open Access Journals (Sweden)
Hsin-Chou Yang
Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to
SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.
Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten
2015-12-03
SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Fabio Coppedè
2014-01-01
Full Text Available Alzheimer’s disease (AD is the most common neurodegenerative disorder and the primary form of dementia in the elderly. Polymorphisms of genes involved in folate metabolism have been frequently suggested as risk factors for sporadic AD. A common c.80G>A polymorphism (rs1051266 in the gene coding for the reduced folate carrier (SLC19A1 gene, commonly known as RFC-1 gene was investigated as AD risk factor in Asian populations, yielding conflicting results. We screened a Caucasian population of Italian origin composed of 192 sporadic AD patients and 186 healthy matched controls, for the presence of the RFC-1 c.80G>A polymorphism, and searched for correlation with circulating levels of folate, homocysteine, and vitamin B12. No difference in the distribution of allele and genotype frequencies was observed between AD patients and controls. No correlation was observed among the genotypes generated by the RFC-1 c.80G>A polymorphism and circulating levels of folate, homocysteine, and vitamin B12 either in the whole cohort of subjects or after stratification into clinical subtypes. Present results do not support a role for the RFC-1 c.80G>A polymorphism as independent risk factor for sporadic AD in Italian Caucasians.
Katzir, Z; Nardi, N; Geffen, I; Fuhrer, C; Henis, Y I
1994-08-26
Lateral mobility studies comparing native and mutated membrane proteins, combined with treatments that alter clathrin lattice structure, can measure membrane protein-coated pit interactions in intact cells (Fire, E., Zwart, D., Roth, M. G., and Henis, Y. I. (1991) J. Cell Biol. 115, 1585-1594). We applied this approach to study the interactions of the H1 and H2 human asialoglycoprotein receptor subunits with coated pits. The lateral mobilities of singly expressed and coexpressed H1 and H2B (the H2 species that reaches the cell surface) were measured by fluorescence photobleaching recovery. They were compared with mutant proteins, H1(5A) (Tyr-5 replaced by Ala) and H2(5A) (Phe-5 replaced by Ala). While the mobile fractions of H1, H2B, and their mutants were similar, the lateral diffusion rate (measured by D, the lateral diffusion coefficient) was significantly slower for H1, whether expressed alone or with H2B. Coexpression with H1 reduced D of H2B to that of H1. Disruption of the clathrin lattices by hypertonic medium elevated D of H1, H1(5A), H2B, and H2(5A) to the same final level, without affecting their mobile fractions. Cytosol acidification, which retains altered clathrin lattices attached to the membrane and prevents coated vesicle formation, immobilized part of the H1 molecules, reflecting stable entrapment in "frozen" coated pits. H1(5A), H2B, and H2(5A) were not affected; however, coexpression of H2B with H1 conferred the sensitivity to cytosol acidification on H2B. Our results suggest that H1 lateral mobility is inhibited by dynamic interactions with coated pits in which Tyr-5 is involved. H2B resembles H1(5A) rather than H1, and its interactions with coated pits are weaker; efficient interaction of H2B with coated pits depends on complex formation with H1.
Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong
2016-10-01
The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese
Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.
Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan
2016-01-01
To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.
Cell-Type Specific Determinants of NRAMP1 Expression in Professional Phagocytes
Directory of Open Access Journals (Sweden)
Mathieu F. M. Cellier
2013-01-01
Full Text Available The Natural resistance-associated macrophage protein 1 (Nramp1 or Solute carrier 11 member 1, Slc11a1 transports divalent metals across the membrane of late endosomes and lysosomes in professional phagocytes. Nramp1 represents an ancient eukaryotic cell-autonomous defense whereas the gene duplication that yielded Nramp1 and Nramp2 predated the origin of Sarcopterygians (lobe-finned fishes and tetrapods. SLC11A1 genetic polymorphisms associated with human resistance to tuberculosis consist of potential regulatory variants. Herein, current knowledge of the regulation of SLC11A1 gene expression is reviewed and comprehensive analysis of ENCODE data available for hematopoietic cell-types suggests a hypothesis for the regulation of SLC11A1 expression during myeloid development and phagocyte functional polarization. SLC11A1 is part of a 34.6 kb CTCF-insulated locus scattered with predicted regulatory elements: a 3' enhancer, a large 5' enhancer domain and four elements spread around the transcription start site (TSS, including several C/EBP and PU.1 sites. SLC11A1 locus ends appear mobilized by ETS-related factors early during myelopoiesis; activation of both 5' and 3' enhancers in myelo-monocytic cells correlate with transcription factor binding at the TSS. Characterizing the corresponding cis/trans determinants functionally will establish the mechanisms involved and possibly reveal genetic variation that impacts susceptibility to infectious or immune diseases.
Masumoto, Asuka; Sonou, Tomohiro; Ohya, Masaki; Yashiro, Mitsuru; Nakashima, Yuri; Okuda, Kouji; Iwashita, Yuko; Mima, Toru; Negi, Shigeo; Shigematsu, Takashi
2017-07-01
Vascular calcification (VC) is a risk factor of cardiovascular and all-cause mortality in patients with chronic kidney disease (CKD). CKD-mineral and bone metabolism disorder is an important problem in patients with renal failure. Abnormal levels of serum phosphate and calcium affect CKD-mineral and bone metabolism disorder and contribute to bone disease, VC, and cardiovascular disease. Hypercalcemia is a contributing factor in progression of VC in patients with CKD. However, the mechanisms of how calcium promotes intracellular calcification are still unclear. This study aimed to examine the mechanisms underlying calcium-induced calcification in a rat aortic tissue culture model. Aortic segments from 7-week-old male Sprague-Dawley rats were cultured in serum-supplemented medium for 10 days. We added high calcium (HiCa; calcium 3.0 mM) to high phosphate (HPi; phosphate 3.8 mM) medium to accelerate phosphate and calcium-induced VC. We used phosphonoformic acid and the calcimimetic R-568 to determine whether the mechanism of calcification involves Pit-1 or the calcium-sensing receptor. Medial VC was significantly augmented by HPi+HiCa medium compared with HPi alone (300%, p<0.05), and was associated with upregulation of Pit-1 protein. Pit-1 protein concentrations in HPi+HiCa medium were greater than those in HPi medium. Phosphonoformic acid completely negated the augmentation of medial VC induced by HPi+HiCa. R-568 had no additive direct effect on medial VC. These results indicated that exposure to HPi+HiCa accelerates medial VC, and this is mediated through Pit-1, not the calcium-sensing receptor.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Directory of Open Access Journals (Sweden)
Anna Rita Cappello
2018-04-01
Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza
2018-04-01
The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd
2018-04-01
The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.
Ochiai, Yusuke; Uchida, Yasuo; Ohtsuki, Sumio; Tachikawa, Masanori; Aizawa, Sanshiro; Terasaki, Tetsuya
2017-05-01
We purposed to clarify the contribution of fatty acid transport protein 1 (FATP1/SLC 27A1) to the supply of docosahexaenoic acid (DHA) to the brain across the blood-brain barrier in this study. Transport experiments showed that the uptake rate of [ 14 C]-DHA in human FATP1-expressing HEK293 cells was significantly greater than that in empty vector-transfected (mock) HEK293 cells. The steady-state intracellular DHA concentration was nearly 2-fold smaller in FATP1-expressing than in mock cells, suggesting that FATP1 works as not only an influx, but also an efflux transporter for DHA. [ 14 C]-DHA uptake by a human cerebral microvascular endothelial cell line (hCMEC/D3) increased in a time-dependent manner, and was inhibited by unlabeled DHA and a known FATP1 substrate, oleic acid. Knock-down of FATP1 in hCMEC/D3 cells with specific siRNA showed that FATP1-mediated uptake accounts for 59.2-73.0% of total [ 14 C]-DHA uptake by the cells. Insulin treatment for 30 min induced translocation of FATP1 protein to the plasma membrane in hCMEC/D3 cells and enhanced [ 14 C]-DHA uptake. Immunohistochemical analysis of mouse brain sections showed that FATP1 protein is preferentially localized at the basal membrane of brain microvessel endothelial cells. We found that two neuroprotective substances, taurine and biotin, in addition to DHA, undergo FATP1-mediated efflux. Overall, our results suggest that FATP1 localized at the basal membrane of brain microvessels contributes to the transport of DHA, taurine and biotin into the brain, and insulin rapidly increases DHA supply to the brain by promoting translocation of FATP1 to the membrane. Read the Editorial Comment for this article on page 324. © 2016 International Society for Neurochemistry.
Expression of RFC/SLC19A1 is associated with tumor type in bladder cancer patients.
Directory of Open Access Journals (Sweden)
Alyaa M Abdel-Haleem
Full Text Available Urinary bladder cancer (UBC ranks ninth in worldwide cancer. In Egypt, the pattern of bladder cancer is unique in that both the transitional and squamous cell types prevail. Despite much research on the topic, it is still difficult to predict tumor progression, optimal therapy and clinical outcome. The reduced folate carrier (RFC/SLC19A1 is the major transport system for folates in mammalian cells and tissues. RFC is also the primary means of cellular uptake for antifolate cancer chemotherapeutic drugs, however, membrane transport of antifolates by RFC is considered as limiting to antitumor activity. The purpose of this study was to compare the mRNA expression level of RFC/SLC19A1 in urothelial and non-urothelial variants of bladder carcinomas. Quantification of RFC mRNA in the mucosa of 41 untreated bladder cancer patients was performed using RT-qPCR. RFC mRNA steady-state levels were ∼9-fold higher (N = 39; P<0.0001 in bladder tumor specimens relative to normal bladder mRNA. RFC upregulation was strongly correlated with tumor type (urothelial vs. non-urothelial; p<0.05 where median RFC mRNA expression was significantly (p<0.05 higher in the urothelial (∼14-fold compared to the non-urothelial (∼4-fold variant. This may account for the variation in response to antifolate-containing regimens used in the treatment of either type. RFC mRNA levels were not associated with tumor grade (I, II and III or stage (muscle-invasive vs. non-muscle invasive implying that RFC cannot be used for prognostic purposes in bladder carcinomas and its increased expression is an early event in human bladder tumors pathogenesis. Further, RFC can be considered as a potential marker for predicting response to antifolate chemotherapy in urothelial carcinomas.
Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin
2016-09-01
The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.
Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger
2012-11-01
Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.
Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao
2015-12-01
To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Epsin 1 is involved in recruitment of ubiquitinated EGF receptors into clathrin-coated pits
DEFF Research Database (Denmark)
Kazazic, Maja; Bertelsen, Vibeke; Pedersen, Ketil Winther
2008-01-01
. Furthermore, RNAi-mediated knock down of epsin 1 was found to inhibit internalization of the EGFR, while having no effect on endocytosis of the transferrin receptor. Additionally, upon knock down of epsin 1, translocation of the EGFR to central parts of clathrin-coated pits was inhibited. This supports...
P-OTX: a PIT-1-interacting homeodomain factor expressed during anterior pituitary gland development.
Szeto, D P; Ryan, A K; O'Connell, S M; Rosenfeld, M G
1996-01-01
A novel OTX-related homeodomain transcription factor has been identified on the basis of its ability to interact with the transactivation domain of the pituitary-specific POU domain protein, Pit-1. This factor, referred to as P-OTX (pituitary OTX-related factor), is expressed in primordial Rathke's pouch, oral epithelium, first bronchial arch, duodenum, and hindlimb. In the developing anterior pituitary, it is expressed in all regions from which cells with distinct phenotypes will emerge in t...
Mycotoxin occurrence on baled and pit silages collected in Co. Meath
Directory of Open Access Journals (Sweden)
McElhinney C.
2015-12-01
Full Text Available Recent studies of baled silages produced in Ireland have identified considerable filamentous fungal contamination. Many of these fungi are toxigenic, capable of producing secondary metabolites, namely mycotoxins. Mycotoxins are potentially detrimental to livestock health and some can pose a risk to consumers of animal products. Baled (n=20 and pit (n=18 silages from a sample of farms (n=38 in Co. Meath were examined to assess the occurrence of mycotoxins and ascertain whether sampling position within the pit silos (feed face vs. 3 m behind the feed face has an effect on mycotoxin content or other chemical compositional variables. Of the 20 mycotoxins assayed, baled silages contained [mean of positive values (no. of values in mean] mycotoxin concentrations (μg/kg dry matter of beauvericin 36 (2, enniatin (enn. A 9.3 (3, enn. A1 54 (8, enn. B 351 (9, enn. B1 136 (10, mycophenolic acid (MPA 11,157 (8 and roquefortine C (Roq. C 1037 (8 and pit silages contained beauvericin 25 (2 enn. A1 18 (2, enn. B 194 (9, enn. B1 57 (3, MPA 287 (6, Roq. C 3649 (6 and zearalenone 76 (1. There was no difference (P>0.05 observed in the mycotoxin concentrations between baled and pit silages, and 11 of the 20 mycotoxins assayed were below the limits of detection. The position of sampling had no effect on the mycotoxin concentration detected in pit silages. It is concluded that mycotoxin concentrations detected in these pit and baled silages in Co. Meath did not exceed EU regulation or guidance limits, and that similar chemical composition and mycotoxin concentration values occurred at the pit silage feed face and 3 m behind this feed face.
AHAR: Part 1 - PIT Estimates of Homelessness
Department of Housing and Urban Development — This report outlines the key findings of the 2014 Point-In-Time (PIT) and Housing Inventory (HIC) counts conducted in January 2014. Specifically, this report...
SLC-2000: A luminosity upgrade for the SLC
International Nuclear Information System (INIS)
Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.
1996-01-01
We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)
Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.
Mackenzie, Bryan; Erickson, Jeffrey D
2004-02-01
The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.
Treatment of a mud pit by bioremediation.
Avdalović, Jelena; Đurić, Aleksandra; Miletić, Srdjan; Ilić, Mila; Milić, Jelena; Vrvić, Miroslav M
2016-08-01
The mud generated from oil and natural gas drilling, presents a considerable ecological problem. There are still insufficient remedies for the removal and minimization of these very stable emulsions. Existing technologies that are in use, more or less successfully, treat about 20% of generated waste drilling mud, while the rest is temporarily deposited in so-called mud pits. This study investigated in situ bioremediation of a mud pit. The bioremediation technology used in this case was based on the use of naturally occurring microorganisms, isolated from the contaminated site, which were capable of using the contaminating substances as nutrients. The bioremediation was stimulated through repeated inoculation with a zymogenous microbial consortium, along with mixing, watering and biostimulation. Application of these bioremediation techniques reduced the concentration of total petroleum hydrocarbons from 32.2 to 1.5 g kg(-1) (95% degradation) during six months of treatment. © The Author(s) 2016.
Estradiol-induced regulation of GLUT4 in 3T3-L1 cells: involvement of ESR1 and AKT activation.
Campello, Raquel S; Fátima, Luciana A; Barreto-Andrade, João Nilton; Lucas, Thais F; Mori, Rosana C; Porto, Catarina S; Machado, Ubiratan F
2017-10-01
Impaired insulin-stimulated glucose uptake involves reduced expression of the GLUT4 (solute carrier family 2 facilitated glucose transporter member 4, SLC2A4 gene). 17β-estradiol (E 2 ) modulates SLC2A4 /GLUT4 expression, but the involved mechanisms are unclear. Although E 2 exerts biological effects by binding to estrogen receptors 1/2 (ESR1/2), which are nuclear transcriptional factors; extranuclear effects have also been proposed. We hypothesize that E 2 regulates GLUT4 through an extranuclear ESR1 mechanism. Thus, we investigated the effects of E 2 upon (1) subcellular distribution of ESRs and the proto-oncogene tyrosine-protein kinases (SRC) involvement; (2) serine/threonine-protein kinase (AKT) activation; (3) Slc2a4 /GLUT4 expression and (4) GLUT4 subcellular distribution and glucose uptake in 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were cultivated or not with E 2 for 24 h, and additionally treated or not with ESR1-selective agonist (PPT), ESR1-selective antagonist (MPP) or selective SRC inhibitor (PP2). Subcellular distribution of ESR1, ESR2 and GLUT4 was analyzed by immunocytochemistry; Slc2a4 mRNA and GLUT4 were quantified by qPCR and Western blotting, respectively; plasma membrane GLUT4 translocation and glucose uptake were analyzed under insulin stimulus for 20 min or not. E 2 induced (1) translocation of ESR1, but not of ESR2, from nucleus to plasma membrane and AKT phosphorylation, effects mimicked by PPT and blocked by MPP and PP2; (2) increased Slc2a4 /GLUT4 expression and (3) increased insulin-stimulated GLUT4 translocation and glucose uptake. In conclusion, E 2 treatment promoted a SRC-mediated nucleus-plasma membrane shuttle of ESR1, and increased AKT phosphorylation, Slc2a4 /GLUT4 expression and plasma membrane GLUT4 translocation; consequently, improving insulin-stimulated glucose uptake. These results unravel mechanisms through which estrogen improves insulin sensitivity. © 2017 Society for Endocrinology.
Directory of Open Access Journals (Sweden)
Mychaleckyj Josyf C
2005-12-01
Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.
Directory of Open Access Journals (Sweden)
Veerachat Muangsombut
2017-08-01
Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence
NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse
Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.
2014-01-01
During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate
International Nuclear Information System (INIS)
Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.
1987-02-01
Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
Wire breakage in SLC wire profile monitors
International Nuclear Information System (INIS)
Field, C.; McCormick, D.; Raimondi, P.; Ross, M.
1998-05-01
Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures
Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib
2014-02-01
Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.
Brodersen, Craig; Jansen, Steven; Choat, Brendan; Rico, Christopher; Pittermann, Jarmila
2014-01-01
Plant water transport occurs through interconnected xylem conduits that are separated by partially digested regions in the cell wall known as pit membranes. These structures have a dual function. Their porous construction facilitates water movement between conduits while limiting the spread of air that may enter the conduits and render them dysfunctional during a drought. Pit membranes have been well studied in woody plants, but very little is known about their function in more ancient lineages such as seedless vascular plants. Here, we examine the relationships between conduit air seeding, pit hydraulic resistance, and pit anatomy in 10 species of ferns (pteridophytes) and two lycophytes. Air seeding pressures ranged from 0.8 ± 0.15 MPa (mean ± sd) in the hydric fern Athyrium filix-femina to 4.9 ± 0.94 MPa in Psilotum nudum, an epiphytic species. Notably, a positive correlation was found between conduit pit area and vulnerability to air seeding, suggesting that the rare-pit hypothesis explains air seeding in early-diverging lineages much as it does in many angiosperms. Pit area resistance was variable but averaged 54.6 MPa s m−1 across all surveyed pteridophytes. End walls contributed 52% to the overall transport resistance, similar to the 56% in angiosperm vessels and 64% in conifer tracheids. Taken together, our data imply that, irrespective of phylogenetic placement, selection acted on transport efficiency in seedless vascular plants and woody plants in equal measure by compensating for shorter conduits in tracheid-bearing plants with more permeable pit membranes. PMID:24777347
TU-FG-209-07: Medical Physics 1.0 Versus Medical Physics 2.0: A Case Study
Energy Technology Data Exchange (ETDEWEB)
Carver, D; Willis, C; Stauduhar, P; Nishino, T [University of Texas MD Anderson Cancer Center, Houston, TX (United States); Wells, J; Samei, E [Duke University Medical Center, Durham, NC (United States)
2016-06-15
Purpose: To illustrate how performance analytics can identify performance decrement in digital radiography systems. Methods: Subsequent to a radiologist’s image quality complaint, four different advanced methods contributed to root cause analysis. Our system was a GE Revolution XQi digital radiography unit. Initially, we reviewed weekly GE Quality Assurance Procedures (QAP) results in a database dating from 2001. Next, we evaluated objective image quality metrics of individual PA Chest radiographs acquired. These images were anonymized, securely transferred, and analyzed by the Duke University Clinical Imaging Physics Group with software previously described{sup 1} and validated{sup 2}. Third, we compared the exposure-dependent SNR{sup 2} (NEQ) of the unit with previously established confidence limits{sup 3}. Finally, we explored our service database to reveal events that might affect detector performance. Results: QAP reported a decrease in CNR reflected in a significant increase in lung noise(Ln), mediastinum noise(Mn), and subdiaphragm-lung contrast(Slc) with a significant decrease in lung grey level(Lgl) after detector replacement. Most change occurred during week 1, before the QAP indicated one-half the ultimate decrease in CNR. After detector recalibration, QAP CNR improved, but was not restored to previous levels. Lgl and Slc were no longer significantly different from before, however Ln and Mn remained significantly different. Exposure-dependent SNR2 show the detector to be operating within limits in October 2006 but subsequently became miscalibrated sometime before acquisition of the 2011–2014 data. Service records revealed catastrophic failure of the Image Detection Controller that contained the 2007 calibration. Traditional metrics did not indicate that the system was performing outside of normal limits. Conclusion: Performance analytics are powerful tools whose proper application could allow early intervention in degraded system performance. The
Directory of Open Access Journals (Sweden)
Kotnik Barbara Faganel
2017-09-01
Full Text Available We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL and non Hodgkin malignant lymphoma (NHML.
Ramya, S.; Nanda Gopala Krishna, D.; Mudali, U. Kamachi
2018-01-01
In-situ Raman and X-ray photoelectron spectroscopic studies were performed for the identification of native and corroded surface oxide layers of modified 9Cr-1Mo steel. The Raman data obtained for native oxide layer of modified 9Cr-1Mo steel revealed that it was mainly composed of oxides of Fe and Cr. The presence of alloying element Mo was found to be less significant in the native oxide film. The oxides of Cr were dominant at the surface and were found to be decreasing closer to metal/oxide layer interface. The changes in the chemical composition of the native films upon in-situ pitting during potentiostatic polarization experiment were characterized by in-situ Raman analysis. The corrosion products of potentiostatically polarized modified 9Cr-1Mo steel was composed of dominant Fe (III) phases viz., γ- Fe2O3, α and γ - FeOOH along with the oxides of chromium. The results from Raman analysis were corroborated with the XPS experiments on as received and pitted samples of modified 9Cr-1Mo steel specimens. It was observed that the oxides of Cr and Mo contributed for the stability of the surface layer by forming Cr2O3 and MoO3. Also, the study attempted to find out the intermediate corrosion products inside the metastable pits to account for the pseudo passive behavior of modified 9Cr-1Mo steel in 0.1 M NaCl solution.
Acid Pit Stabilization Project (Volume 1 - Cold Testing) and (Volume 2 - Hot Testing)
International Nuclear Information System (INIS)
Loomis, G. G.; Zdinak, A. P.; Ewanic, M. A.; Jessmore, J. J.
1998-01-01
During the summer and fall of Fiscal Year 1997, a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) Treatability Study was performed at the Idaho National Engineering and Environmental Laboratory. The study involved subsurface stabilization of a mixed waste contaminated soil site called the Acid Pit. This study represents the culmination of a successful technology development effort that spanned Fiscal Years 1994-1996. Research and development of the in situ grout stabilization technique was conducted. Hardware and implementation techniques are currently documented in a patent pending with the United States Patent and Trademark Office. The stabilization technique involved using jet grouting of an innovative grouting material to form a monolith out of the contamination zone. The monolith simultaneously provides a barrier to further contaminant migration and closes voids in the soil structure against further subsidence. This is accomplished by chemical incorporation of contaminants into less soluble species and achieving a general reduction in hydraulic conductivity within the monolith. The grout used for this study was TECT-HG, a relatively dense iron oxide-based cementitious grout. The treatability study involved cold testing followed by in situ stabilization of the Acid Pit. Volume 1 of this report discusses cold testing, performed as part of a ''Management Readiness Assessment'' in preparation for going hot. Volume 2 discusses the results of the hot Acid Pit Stabilization phase of this project. Drilling equipment was specifically rigged to reduce the spread of contamination, and all grouting was performed under a concrete block containing void space to absorb any grout returns. Data evaluation included examination of implementability of the grouting process and an evaluation of the contaminant spread during grouting. Following curing of the stabilized pit, cores were obtained and evaluated for toxicity characteristic leach ing
Identification of Pit-1 Gen Using PCR-RFLP of Padjadjaran Sheep and Evaluate of Growth Rate
Prajoga, S. B. K.; Andriani, L.; Subhandiana, H.
2018-02-01
The objectives of this research were to evaluate variation of Pit-1 gen of Padjadjaran Sheep and evaluate of their growth rate. The data comprised of 15 lambs female and 15 lambs male records of 0 - 12 mouths old lambs. Variation of Padjadjaran Sheep PIT-1 gen was analyzed using PCR-RFLP and used primer by 5’-GAGGGATAATTACAAATGGTCC-3’ and 5’-TGTTAACAGCTGTGGGACACAC-3’, length fragment analyse using HinfI restriction enzyme. Presence or absence of deference bands in a PCR fragment of the result can be distinguished by differences in the electrophoretic migration of the fragment. The result showed that the variation Pit1 gene showed that there was in the position 345 bp, 137 bp and 115 bp. In this experiment the difference migration did occur in all samples (monomorphic), that was amplificated with reverse and forward primer. The average male birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.29 ±0.42kg 8.96 ±1,89 kg and 30.12 ±5,65 kg. The average female birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.33 ±0.49 kg; 8.23 ±1.99 kg and 26.11 ±5.50 kg. Correlation value between age and body weight was 0,99 for female and 0,97 for male. The highest body weight gain per month was 2.85 kg for female at the age of six months and 3.4 kg for male at the age of one year. The best equition of growth rate was Ŷ = 1,862 + 0,127X1 0,076X2
Directory of Open Access Journals (Sweden)
Fabian R. Reimold
2015-06-01
Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.
Relevance of sodium/glucose cotransporter-1 (SGLT1) to diabetes mellitus and obesity in dogs.
Batchelor, D J; German, A J; Shirazi-Beechey, S P
2013-04-01
Glucose transport across the enterocyte brush border membrane by sodium/glucose cotransporter-1 (SGLT1, coded by Slc5a1) is the rate-limiting step for intestinal glucose transport. The relevance of SGLT1 expression in predisposition to diabetes mellitus and to obesity was investigated in dogs. Cultured Caco-2/TC7 cells were shown to express SGLT1 in vitro. A 2-kbp fragment of the Slc5a1 5' flanking region was cloned from canine genomic DNA, ligated into reporter gene plasmids, and shown to drive reporter gene expression in these cells above control (P obesity (Labrador retriever and cocker spaniel). The Slc5a1 5' flanking region was amplified from 10 healthy individuals of each of these breeds by high-fidelity PCR with the use of breed-labeled primers and sequenced by pyrosequencing. The sequence of the Slc5a1 5' flanking region in all individuals of all breeds tested was identical. On this evidence, variations in Slc5a1 promoter sequence between dogs do not influence the pathogenesis of diabetes mellitus or obesity in these breeds. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Berislav šebečić
2003-12-01
Full Text Available In central Croatia at the beginning of 20th century, clay pits were mostly managed by individual entrepreneurs, and less by joint stock companies and municipal or district local authorities. Majority of clay pit met the local and regional requirements i.e. demands, and quality products were exported. Exploitation of brickwork clay was carried out from open pits, while potter's, stove-maker's and porcelain clays were exploited from mining shafts and tunnels. From the clay raw material, annual production of minor brickyards amounted to 200-300,000 bricks, and that of major ones was 1-2,000,000 pieces of bricks or roofing-tiles. The number of workers in brickyards and cement works was growing in the first decade of 20th century, while that of potter's and stove-maker's crafts was decreasing. Pottery became a secondary trade in the majority of Croatian and Slavonian counties (the paper is published in Croatian.
SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland
Directory of Open Access Journals (Sweden)
Hassen Hadj-Kacem
2010-01-01
Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.
SLC2A9 is a high-capacity urate transporter in humans.
Directory of Open Access Journals (Sweden)
Mark J Caulfield
2008-10-01
] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.
International Nuclear Information System (INIS)
Palmer, E.
1996-01-01
The purpose of this plan is to describe the preferred alternative for addressing the Central Shops Burning/Rubble Pit 631-6G (BRP6G) located at SRS, in northwestern Barnwell County, South Carolina and to provide an opportunity for public input into the remedial action selection process. Arsenic, beryllium, iron, and octachloro-dibenzo-p-dioxin isomers (OCDD) concentrations in the pit soil are at levels consistent with those found in the background. Therefore, the only contamination attributable to actions in BRP6G is PCB-1254. After the risk contributions of these chemicals are eliminated, the only remaining risk attributable to the pit soil is from PCB-1254 (about 2 x 10 -6 via ingestion of vegetables grown on-site). The maximum concentration of PCB-1254 detected in the pit was 0.115 mg/kg, approximately 10% of the residential action level for PCBs of 1 mg/kg. Based on the results of the remedial investigation and the BRA, it is proposed that No Action be performed for the BRP6G. Considering the low levels of residual contamination present principally below 1.2 meters (4 feet) within the pit and the associated risks (about 2 x 10 -6 ) within the lower level of EPA's target risk range, action is not warranted for this unit
Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.
2013-01-01
Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905
DEFF Research Database (Denmark)
Lehre, A C; Rowley, N M; Zhou, Y
2011-01-01
of the GAT1 by the clinically available anti-epileptic drug tiagabine has been an effective strategy for the treatment of some patients with partial seizures. Recently, the investigational drug EF1502, which inhibits both GAT1 and BGT1, was found to exert an anti-convulsant action synergistic...... to that of tiagabine, supposedly due to inhibition of BGT1. The present study addresses the role of BGT1 in seizure control and the effect of EF1502 by developing and exploring a new mouse line lacking exons 3-5 of the BGT1 (slc6a12) gene. The deletion of this sequence abolishes the expression of BGT1 mRNA. However......, homozygous BGT1-deficient mice have normal development and show seizure susceptibility indistinguishable from that in wild-type mice in a variety of seizure threshold models including: corneal kindling, the minimal clonic and minimal tonic extension seizure threshold tests, the 6Hz seizure threshold test...
Sugita, Atsushi; Kawai, Shinji; Hayashibara, Tetsuyuki; Amano, Atsuo; Ooshima, Takashi; Michigami, Toshimi; Yoshikawa, Hideki; Yoneda, Toshiyuki
2011-01-28
Disturbed endochondral ossification in X-linked hypophosphatemia indicates an involvement of P(i) in chondrogenesis. We studied the role of the sodium-dependent P(i) cotransporters (NPT), which are a widely recognized regulator of cellular P(i) homeostasis, and the downstream events in chondrogenesis using Hyp mice, the murine homolog of human X-linked hypophosphatemia. Hyp mice showed reduced apoptosis and mineralization in hypertrophic cartilage. Hyp chondrocytes in culture displayed decreased apoptosis and mineralization compared with WT chondrocytes, whereas glycosaminoglycan synthesis, an early event in chondrogenesis, was not altered. Expression of the type III NPT Pit-1 and P(i) uptake were diminished, and intracellular ATP levels were also reduced in parallel with decreased caspase-9 and caspase-3 activity in Hyp chondrocytes. The competitive NPT inhibitor phosphonoformic acid and ATP synthesis inhibitor 3-bromopyruvate disturbed endochondral ossification with reduced apoptosis in vivo and suppressed apoptosis and mineralization in conjunction with reduced P(i) uptake and ATP synthesis in WT chondrocytes. Overexpression of Pit-1 in Hyp chondrocytes reversed P(i) uptake and ATP synthesis and restored apoptosis and mineralization. Our results suggest that cellular ATP synthesis consequent to P(i) uptake via Pit-1 plays an important role in chondrocyte apoptosis and mineralization, and that chondrogenesis is ATP-dependent.
Regulators of Slc4 bicarbonate transporter activity
Directory of Open Access Journals (Sweden)
Ian M. Thornell
2015-06-01
Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.
DEFF Research Database (Denmark)
Nielsen, Lotte B; Vaziri-Sani, Fariba; Pörksen, Sven
2011-01-01
Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact...
Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand
2014-11-01
Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.
DEFF Research Database (Denmark)
Nielsen, L. B.; Vaziri-Sani, F.; Porksen, S.
2011-01-01
Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact......8 gene is associated with preserved beta-cell function in type 1 diabetes patients. The genetic determination of the rs13266634 variant on the ZnT8Ab specificity is sustained the first 12 months after the diagnosis of type 1 diabetes in a pediatric cohort....
Seedling and Sapling Dynamics of Treefall Pits in Puerto Rico1
Lawrence R. Walker
2000-01-01
Seedling and sapling dynamics in a Puerto Rican rain forest were compared between forest understory and soil pits created by the uprooting of 27 trees during Hurricane Hugo. Soil N and P, organic matter, and soil moisture were lower and bulk densities were higher in the disturbed mineral soils of the pits than in undisturbed forest soils ten months after the hurricane...
Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J
2001-09-01
Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.
Making electron beams for the SLC linac
International Nuclear Information System (INIS)
Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.
1984-01-01
A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table
Directory of Open Access Journals (Sweden)
Bianca Maria Rotoli
2018-03-01
Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.
Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R
2017-06-07
The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.
Directory of Open Access Journals (Sweden)
J. Noelia Dufay
2017-06-01
Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.
PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells
International Nuclear Information System (INIS)
Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.
2008-01-01
The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed
International Nuclear Information System (INIS)
Boehlecke, Robert
2004-01-01
This Corrective Action Decision Document (CADD) has been prepared for Corrective Action Unit (CAU) 140: Waste Dumps, Burn Pits, and Storage Area, Nevada Test Site (NTS), Nevada, in accordance with the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit 140 is located within Areas 5, 22, and 23 of the NTS and is comprised of the following corrective action sites (CASs): 05-08-01, Detonation Pits; 05-08-02, Debris Pits; 05-17-01, Hazardous Waste Accumulation Site (Buried); 05-19-01, Waste Disposal Site; 05-23-01, Gravel Gertie; 05-35-01, Burn Pit; 05-99-04, Burn Pit; 22-99-04, Radioactive Waste Dump; and 23-17-01, Hazardous Waste Storage Area. The purpose of this CADD is to identify and provide a rationale for the recommendation of a corrective action alternative for each CAS within CAU 140. Corrective action investigation activities were performed from November 13 through December 11, 2002. Additional sampling to delineate the extent of contaminants of concern (COCs) was conducted on February 4 and March 18 and 19, 2003. Corrective action investigation activities were performed as set forth in the Corrective Action Investigation Plan for CAU 140. Analytes detected during the corrective action investigation were evaluated against appropriate preliminary action levels to identify COCs for each CAS. Assessment of the data generated from investigation activities revealed the following: (1) CAS 05-08-01 contains the COCs lead and the radioisotope thorium-234 in the surface soil at sample location A05. (2) CAS 05-23-01 did not have any COCs identified during the field investigation; however, based on historical knowledge of activities at this site, the interior of the Gravel Gertie is considered contaminated with uranium. (3) CAS 23-17-01 contains the COC total petroleum hydrocarbons (diesel-range organics) at location J20 at a depth of 9 to 10 feet below ground surface. (4) No COCs were identified at CASs 05-08-02, 05-17-01, 05-19-01, 05
Directory of Open Access Journals (Sweden)
Guanghou Shui
Full Text Available BACKGROUND: Phosphatidic acid (PA is a key regulated intermediate and precursor for de novo biosynthesis of all glycerophospholipids. PA can be synthesized through the acylation of lysophosphatidic acid (LPA by 1-acyl-3-phosphate acyltransferase (also called lysophosphatidic acid acyltransferase, LPAAT. Recent findings have substantiated the essential roles of acyltransferases in various biological functions. METHODOLOGIES/PRINCIPAL FINDINGS: We used a flow-injection-based lipidomic approach with approximately 200 multiple reaction monitoring (MRM transitions to pre-screen fatty acyl composition of phospholipids in the yeast Saccharomyces cerevisiae mutants. Dramatic changes were observed in fatty acyl composition in some yeast mutants including Slc1p, a well-characterized LPAAT, and Cst26p, a recently characterized phosphatidylinositol stearoyl incorporating 1 protein and putative LPAAT in S. cerevisiae. A comprehensive high-performance liquid chromatography-based multi-stage MRM approach (more than 500 MRM transitions was developed and further applied to quantify individual phospholipids in both strains to confirm these changes. Our data suggest potential fatty acyl substrates as well as fatty acyls that compensate for defects in both Cst26p and Slc1p mutants. These results were consistent with those from a non-radioactive LPAAT enzymatic assay using C17-LPA and acyl-CoA donors as substrates. CONCLUSIONS: We found that Slc1p utilized fatty acid (FA 18:1 and FA 14:0 as substrates to synthesize corresponding PAs; moreover, it was probably the only acyltransferase responsible for acylation of saturated short-chain fatty acyls (12:0 and 10:0 in S. cerevisiae. We also identified FA 18:0, FA 16:0, FA 14:0 and exogenous FA 17:0 as preferred substrates for Cst26p because transformation with a GFP-tagged CST26 restored the phospholipid profile of a CST26 mutant. Our current findings expand the enzymes and existing scope of acyl-CoA donors for
Energy Technology Data Exchange (ETDEWEB)
Gueray, R T; Oezkan, N; Yalcin, C [Kocaeli University, Kocaeli (Turkey); Goerres, J; DeBoer, R; Palumbo, A; Tan, W P; Wiescher, M [University of Notre Dame, (United States); Fueloep, Zs; Somorjai, E [Institute of Nuclear Research ATOMKI (Hungary); Lee, H Y [Argonne National Laboratory (United States)
2009-07-01
Astrophysical S-factors for the {sup 1}20Te(p,{gamma}){sup 1}21I and {sup 1}20Te(p,n){sup 1}20I reactions have been measured in the effective center-of-mass energies between 2.47 MeV and 7.93 MeV. Experimental data have been compared with the Hauser-Fesbach statistical model calculations obtained with the model codes NON-SMOKER and TALYS. The discrepancies between the experimental results and calculations can mainly be attributed to the optical model potentials used in the codes.
Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.
2013-01-01
Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...
Directory of Open Access Journals (Sweden)
Liu Huang
Full Text Available Rapid response to chemotherapy in metastatic colorectal cancer (mCRC patients (response within 12 weeks of chemotherapy may increase the chance of complete resection and improved survival. Few molecular markers predict irinotecan-induced rapid response and survival. Single-nucleotide polymorphisms (SNPs in solute carrier genes are reported to correlate with the variable pharmacokinetics of irinotecan and folate in cancer patients. This study aims to evaluate the predictive role of 3 SNPs in mCRC patients treated with irinotecan and fluoropyrimidine-containing regimens.Three SNPs were selected and genotyped in 137 mCRC patients from a Chinese prospective multicenter trial (NCT01282658. The chi-squared test, univariate and multivariable logistic regression model, and receiver operating characteristic analysis were used to evaluate correlations between the genotypes and rapid response. Kaplan-Meier survival analysis and Cox proportional hazard models were used to evaluate the associations between genotypes and survival outcomes. Benjamini and Hochberg False Discovery Rate correction was used in multiple testing.Genotype GA/AA of SNP rs2306283 of the gene SLCO1B1 and genotype GG of SNP rs1051266 of the gene SLC19A1 were associated with a higher rapid response rate (odds ratio [OR] =3.583 and 3.521, 95%CI =1.301-9.871 and 1.271-9.804, p=0.011 and p=0.013, respectively. The response rate was 70% in patients with both genotypes, compared with only 19.7% in the remaining patients (OR = 9.489, 95%CI = 2.191-41.093, Fisher's exact test p=0.002. Their significances were all maintained even after multiple testing (all p c < 0.05. The rs2306283 GA/AA genotype was also an independent prognostic factor of longer progression-free survival (PFS (hazard ratio = 0.402, 95%CI = 0.171-0.945, p=0.037. None of the SNPs predicted overall survival.Polymorphisms of solute carriers' may be useful to predict rapid response to irinotecan plus fluoropyrimidine and PFS in m
Measurement of electron beam polarization at the SLC
International Nuclear Information System (INIS)
Steiner, H.; California Univ., Berkeley
1988-01-01
One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)
International Nuclear Information System (INIS)
Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.
1993-01-01
The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC
Directory of Open Access Journals (Sweden)
Ivan Sestari
2009-07-01
Full Text Available Experimentos foram conduzidos com objetivo de avaliar a eficiência de métodos para predição da ocorrência de bitter pit em maçãs 'Fuji' e 'Braeburn' em duas épocas de amostragem. Os frutos, provenientes de seis pomares distintos, três para cada cultivar, foram coletados antecipadamente (20 dias em relação à colheita e na data prevista para a colheita comercial. Os métodos de predição utilizados foram: a infiltração dos frutos com solução 0,10M MgCl2 mais 0,01% Tween-20 e 0,4M de sorbitol; b imersão dos frutos em solução com 2500nL L-1 de ethephon mais 0,01% Tween-20. Os frutos foram armazenados em atmosfera controlada (AC por cinco meses mais 12 dias, a 20°C, simulando a incidência real de bitter pit em armazenamento comercial. Cada tratamento foi constituído por quatro repetições de 25 frutos. A incidência e severidade de bitter pit, prevista por ambos os métodos foi semelhante à ocorrência real de bitter pit após o armazenamento em atmosfera controlada para cada uma das cultivares utilizadas, quando os frutos foram amostrados antecipadamente em relação à colheita comercial. Na avaliação realizada com frutos amostrados na colheita comercial, nenhum dos métodos foi capaz de prever a incidência de bitter pit após o armazenamento de maneira confiável. Para ambas as cultivares, a infiltração com magnésio e a imersão dos frutos em ethephon só são eficientes na predição da incidência de bitter pit em frutos coletados 20 dias antes da colheita comercial.Experiments were carried out with objective to evaluate the efficiency of methods for bitter pit prediction in 'Fuji' and 'Braeburn' apples sampled at two harvest dates. Fruits from 6 orchards, three for each cultivar, were sampled earlier (20 days before harvest and at commercial harvest date. The prediction methods assessed were: infiltration of apples with 0.10M MgCl2 solution containing 0.01% Tween-20 and 0.4M sorbitol; and immersion of fruits in 2
Upregulation of the Creatine Transporter Slc6A8 by Klotho
Directory of Open Access Journals (Sweden)
Ahmad Almilaji
2014-11-01
Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.
PIT 9 Project: A private sector initiative
International Nuclear Information System (INIS)
Macdonald, D.W.; Hughes, F.P.; Burton, B.N.
1993-01-01
The Pit 9 Comprehensive Demonstration is intended to demonstrate a cost-effective approach to remediate an Idaho National Engineering Lab. (INEL) waste disposal pit through a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) Interim Action. The remediation will include additional requirements, if needed, to provide high confidence that only minor additional work would be necessary to accomplish the final closure as part of the overall final closure strategy for the INEL's Subsurface Disposal Area (SDA). Pit 9 is an inactive waste disposal pit located in the northeastern corner of the SDA at the INEL's Radioactive Waste Management Complex (RWMC). It covers approximately 1 acre. The waste within Pit 9 is primarily transuranic waste generated at the Rocky Flats Plant and additional wastes, both hazardous and low-level radioactive, from generators at the INEL
Tresnadi, Hidir
2011-01-01
In Coal Mine Pit 1, Bangko Barat, Tanjung Enim, South Sumatera mine activity lowered the water pH in the effluent water of the mine. So the Mine Environmet Managemet of PTBA try to raise the pH to meet Kep Men Neg LH No 113 Tahun 2003. This study attempt to characterize the performance of the water treatment,which managed by acid-mine dranage management of the PTBA. Some water samples was taken in the study area, such as the passive treatment in Pit 1 Bangko Barat, rainwater pond near by, lak...
Tresnadi, Hidir
2008-01-01
In Coal Mine Pit 1, Bangko Barat, Tanjung Enim, South Sumatera mine activity lowered the water pH in the effluent water of the mine. So the Mine Environmet Managemet of PTBA try to raise the pH to meet Kep Men Neg LH No 113 Tahun 2003. This study attempt to characterize the performance of the water treatment,which managed by acid-mine dranage management of the PTBA. Some water samples was taken in the study area, such as the passive treatment in Pit 1 Bangko Barat, rainwater pond near by, lak...
Directory of Open Access Journals (Sweden)
Thomas Lundåsen
Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.
International Nuclear Information System (INIS)
Morri, J.
1989-01-01
A previous study of the impact fretting wear characteristics of PE16 + impacting 20/25 Nb SS (carried out on the BNL twin vibrator rig) identified a pitting-transfer form of wear at 480 0 C. This behaviour was thought to be dependent upon the temperature difference ΔT(ΔT = T 20/25 -T PE 16 ) between the two specimens. In that series of tests, however, no localised temperature control over the specimens was possible and specimen temperature effects could only be assessed by interchanging their positions in the rig. The introduction of locally positioned auxilliary heaters permitted a degree of control over the specimen temperature difference. The effect of ΔT upon pitting and transfer of the PE16 and 20/25 was then assessed and is reported in this paper. The study confirmed that the pitting transfer process was dependent on the temperature difference between the two surfaces. The direction and size of the transfer/pitting effect was independent of the material. Under the particular set of conditions employed in the test, pitting occurred only when the magnitude of ΔT exceeded 20 0 C. At high ΔT the initial period of high friction was extended and was associated with the tendency for gross transfer and pitting. (author)
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081
Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells
Directory of Open Access Journals (Sweden)
Kayo Ikeda
2017-11-01
Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter
Directory of Open Access Journals (Sweden)
Maider Ibarrola-Villava
Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.
International Nuclear Information System (INIS)
Ross, M.
1993-04-01
The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines
Cleanup Verification Package for the 100-F-20, Pacific Northwest Laboratory Parallel Pits
International Nuclear Information System (INIS)
Appel, M.J.
2007-01-01
This cleanup verification package documents completion of remedial action for the 100-F-20, Pacific Northwest Laboratory Parallel Pits waste site. This waste site consisted of two earthen trenches thought to have received both radioactive and nonradioactive material related to the 100-F Experimental Animal Farm
Perrier, Frédéric; Le Mouël, Jean-Louis
2016-04-15
The transition zone between free and underground atmospheres hosts spectacular phenomena, as demonstrated by temperature measurements performed in the 4.6m diameter and 20m deep vertical access pit of an abandoned underground quarry located in Vincennes, near Paris. In summer, a stable stratification of the atmosphere is maintained, with coherent temperature variations associated with atmospheric pressure changes, with a barometric tide S2 larger than 0.1°C peak to peak. When the winter regime of turbulent cold air avalanches is initiated, stratification with pressure induced signals can be restored transiently in the upper part of the pit, while the lower part remains fully mixed and insensitive to pressure variations. The amplitude of the pressure to temperature transfer function increases with frequency below 5×10(-4)Hz, with values at 3×10(-5)Hz varying from 0.1°C·hPa(-1) at the bottom up to 2°C·hPa(-1) towards the top of the pit. These temperature variations are accounted for by cave breathing, which is pressure induced motion of air amplified by the large volume of the quarry. This understanding is supported by a numerical model including advective heat transport, heat diffusion, and heat exchange with the pit walls. Mean lifetime in the pit is of the order of 9 to 13h, and barometric pumping results in an effective ventilation rate of the quarry of the order of 10(-7)s(-1). This study illustrates the important role of barometric pumping in heat and matter transport between atmosphere and lithosphere. The resulting stationary and transient states, revealed in this pit, are probably a general feature of functioning interface systems, and therefore are an important aspect to consider in problems of contaminant transport, or the preservation of precious heritage such as rare ecosystems or painted caves. Copyright © 2016 Elsevier B.V. All rights reserved.
218-E-8 Borrow Pit Demolition Site closure plan. Revision 1
International Nuclear Information System (INIS)
Ruck, F.R.
1994-01-01
The 218-E-8 Demolition Site was the site of a single demolition event in November of 1984. This demolition event was a form of thermal treatment for discarded explosive chemical products. Because the 218-E-8 Demolition Site will no longer be used for this thermal activity, the site will be closed. Closure will be conducted pursuant to the requirements of the Washington State Department of Ecology (Ecology) ''Dangerous Waste Regulations,'' Washington Administrative Code (WAC) 173-303-610 and 40 Code of Federal Regulations (CFR) 270.1. The 218-E-8 Borrow Pit Demolition Site Closure Plan consists of a Hanford Facility Dangerous Waste Part A Permit Application, Form 3, Revision 4, and a closure plan. An explanation of the Part A Form 3, submitted with this closure plan is provided at the beginning of the Part A Section. The closure plan consists of nine chapters and five appendices. This closure plan presents a description of the 218-E-8 Demolition Site, the history of the waste treated, and the approach that will be followed to close the 218-E-8 Demolition Site. Because there were no radioactively contaminated chemicals involved in t he demolitions at the 218-E-8 Borrow Pit site, the information on radionuclides is provided for ''information only.'' Remediation of any radioactive contamination is not within the scope of this closure plan. Only dangerous constituents derived from 218-E-8 Demolition Site operations will be addressed in this closure plan in accordance with WAC 173-303-610(2)(b)(i)
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-11-28
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Open Pit Water Control Safety A Case Of Nchanga Open Pit Mine Zambia
Directory of Open Access Journals (Sweden)
Silwamba C
2015-08-01
Full Text Available Abstract Mining in Chingola Zambia started underground in 1931 and was catastrophically flooded and closed. The present Nchanga Underground Mine NUG started in 1937. The Nchanga Open Pit NOP mine started in 1955 situated to the west of NUG and partially overlying it. Open pit water control safety operations in the Nchanga-Chingola area have successfully enabled the safe extraction of millions of tonnes of copper ore annually over the past 60 years from NUG mining as well as the NOP. At the start Nchanga mining license surface already had NUG and many watershed divides with the Nchanga and Chingola streams being the main streams feeding into Zambias second largest river Kafue river and 42 of the year was characterised by heavy rains ranging between 800mm to 1300mm per annum. In this paper the presence of very significant amounts of seasonal rain and subsurface water in the mining area was identified as both a curse and a blessing. An excess in seasonal rain and subsurface water would disrupt both open pit and underground mining operations. In order for NOP to be operated successfully stable and free from flooding coping water management tactics were adopted from 1955 to 2015 including 1. Underground mine pump chamber pumping system 2. Piezometer instrumented boreholes 3. Underground mine 1500-ft sub-haulage east borehole dewatering beneath the open pit 4. Nchanga and Chingola stream diversionary tunnel and open drains 5. Nchanga stream causeway and embankment dam in the Matero School Golf Club area 6. Pit perimeter borehole pumping 7. Outer and inner pit perimeter drains and bund walls 8. In-pit ramp side drains 9. In-pit sub-horizontal borehole geo-drains and water and 10. Pit bottom sump pumps. Application of grout curtains along the Vistula River Poland was noted as a possibility in the right circumstances although it had never been used at Nchanga Open Pit. An additional conclusion was that forward health safety and environmental end
(SLC45A2, SLC24A5, MC1R and TYRP1) among eleven
Indian Academy of Sciences (India)
2013-04-10
Apr 10, 2013 ... and TYRP1) among eleven endogamous populations of India ... individuals from different populations (five caste and six tribal) of India, belonging to ... ried out on a 7500 Real-Time PCR System using the fol- lowing cycling ...
Lee, Seong-Ki; Boron, Walter F; Parker, Mark D
2013-04-01
In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.
Directory of Open Access Journals (Sweden)
Wu Bailin
2008-11-01
Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the
Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C
2008-01-01
Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to
Statement of Basis/Proposed Plan for the F-Area Burning/Rubble Pits (231-F, 231-1F, and 231-2F)
International Nuclear Information System (INIS)
Palmer, E.
1996-08-01
The purpose of this source unit Statement of Basis/Proposed Plan is to describe the preferred alternative for addressing the F-Area Burning/Rubble Pits (231-F and 231-1F) and Rubble Pit (231-2F) (FBRP) source unit located at SRS, in southwestern Aiken County, South Carolina and to provide an opportunity for public input into the remedial action selection process
International Nuclear Information System (INIS)
Spalding, B.P.
1994-07-01
A treatability study is described that encompasses the application of in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage pit 1 by the end of fiscal year 1995. This treatability study will establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability for the overlapping melt settings that are necessary to achieve fused melt segments; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of 137 Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. The initial step of this treatability study will be to gather the required site characterization data about pit 1 so that the in situ vitrification can be effectively and safely planned. The second phase will be the field ISV operations at pit 1 employing at least two settings to achieve overlapping and fused melts. Such field operations are likely to require 6 to 8 weeks. Following termination of ISV melting operations at pit 1 and demobilization of portable ISV equipment and the off-gas hood, posttest characterization activities will begin
Bahrami, Saeed; Doulati Ardejani, Faramarz; Aslani, Soheyla; Baafi, Ernest
2014-12-01
The groundwater inflow into a mine during its life and after ceasing operations is one of the most important concerns of the mining industry. This paper presents a hydrogeological assessment of the Irankuh Zn-Pb mine at 20 km south of Esfahan and 1 km northeast of Abnil in west-Central Iran. During mine excavation, the upper impervious bed of a confined aquifer was broken and water at high-pressure flowed into an open pit mine associated with the Kolahdarvazeh deposit. The inflow rates were 6.7 and 1.4 m(3)/s at the maximum and minimum quantities, respectively. Permeability, storage coefficient, thickness and initial head of the fully saturated confined aquifer were 3.5 × 10(-4) m/s, 0.2, 30 m and 60 m, respectively. The hydraulic heads as a function of time were monitored at four observation wells in the vicinity of the pit over 19 weeks and at an observation well near a test well over 21 h. In addition, by measuring the rate of pumping out from the pit sump, at a constant head (usually equal to height of the pit floor), the real inflow rates to the pit were monitored. The main innovations of this work were to make comparison between numerical modelling using a finite element software called SEEP/W and actual data related to inflow and extend the applicability of the numerical model. This model was further used to estimate the hydraulic heads at the observation wells around the pit over 19 weeks during mining operations. Data from a pump-out test and observation wells were used for model calibration and verification. In order to evaluate the model efficiency, the modelling results of inflow quantity and hydraulic heads were compared to those from analytical solutions, as well as the field data. The mean percent error in relation to field data for the inflow quantity was 0.108. It varied between 1.16 and 1.46 for hydraulic head predictions, which are much lower values than the mean percent errors resulted from the analytical solutions (from 1.8 to 5
Proposed plan for the K-Area Bingham Pump Outage Pit (643-1G)
International Nuclear Information System (INIS)
Palmer, E.
1997-06-01
This Proposed Plan is issued by the U.S. Department of Energy (DOE), which functions as the lead agency for SRS remedial activities, and with concurrence by the U.S. Environmental Protection Agency (EPA) and the South Carolina Department of Health and Environmental Control (SCDHEC). The purpose of this Proposed Plan is to describe the preferred remedial alternative for addressing the K-Area Bingham Pump Outage Pit (643-1G) (K BPOP) located at the Savannah River Site (SRS) in Aiken, South Carolina and to solicit public comments on the preferred alternative
Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem
2016-11-01
Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
1995-07-01
This Quality Assurance Project Plan (QAPjP) establishes the quality assurance procedures and requirements to be implemented for the control of quality-related activities for Phase 3 of the Treatability Study (TS) of In Situ Vitrification (ISV) of Seepage Pit 1, ORNL Waste Area Grouping 7. This QAPjP supplements the Quality Assurance Plan for Oak Ridge National Laboratory Environmental Restoration Program by providing information specific to the ISV-TS. Phase 3 of the TS involves the actual ISV melt operations and posttest monitoring of Pit 1 and vicinity. Previously, Phase 1 activities were completed, which involved determining the boundaries of Pit 1, using driven rods and pipes and mapping the distribution of radioactivity using logging tools within the pipes. Phase 2 involved sampling the contents, both liquid and solids, in and around seepage Pit 1 to determine their chemical and radionuclide composition and the spatial distribution of these attributes. A separate QAPjP was developed for each phase of the project. A readiness review of the Phase 3 activities presented QAPjP will be conducted prior to initiating field activities, and an Operational Acceptance, Test (OAT) will also be conducted with no contamination involved. After, the OAT is complete, the ISV process will be restarted, and the melt will be allowed to increase with depth and incorporate the radionuclide contamination at the bottom of Pit 1. Upon completion of melt 1, the equipment will be shut down and mobilized to an adjacent location at which melt 2 will commence
Directory of Open Access Journals (Sweden)
Sofie V Hellsten
Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.
Marques, T; Patente, T A; Monteiro, M B; Cavaleiro, A M; Queiroz, M S; Nery, M; de Azevedo, M J; Canani, L H; Parisi, M C; Moura-Neto, A; Passarelli, M; Giannella-Neto, D; Machado, U F; Corrêa-Giannella, M L
2015-04-15
Mesangial cells subject to high extracellular glucose concentrations, as occur in hyperglycaemic states, are unable to down regulate glucose influx, resulting in intracellular activation of deleterious biochemical pathways. A high expression of GLUT1 participates in the development of diabetic glomerulopathy. Variants in the gene encoding GLUT1 (SLC2A1) have been associated to this diabetic complication. The aim of this study was to test whether polymorphisms in SLC2A1 confer susceptibility to diabetic nephropathy (DN) in Brazilian type 1 diabetes patients. Four polymorphisms (rs3820589, rs1385129, rs841847 and rs841848) were genotyped in a Brazilian cohort comprised of 452 patients. A prospective analysis was performed in 155 patients. Mean duration of follow-up was 5.6 ± 2.4 years and the incidence of renal events was 18.0%. The rs3820589 presented an inverse association with the prevalence of incipient DN (OR: 0.36, 95% CI: 0.16 - 0.80, p=0.01) and with progression to renal events (HR: 0.20; 95% CI: 0.03 - 0.70; p=0.009). AGGT and AGAC haplotypes were associated with the prevalence of incipient DN and the AGAC haplotype was also associated with the prevalence of established/advanced DN. In conclusion, rs3820589 in the SLC2A1 gene modulates the risk to DN in Brazilian patients with inadequate type 1 diabetes control. Copyright © 2015 Elsevier B.V. All rights reserved.
Sub-surface structures and collapse mechanisms of summit pit craters
Roche, O.; van Wyk de Vries, B.; Druitt, T. H.
2001-01-01
Summit pit craters are found in many types of volcanoes and are generally thought to be the product of collapse into an underpressured reservoir caused by magma withdrawal. We investigate the mechanisms and structures associated with summit pit crater formation by scaled analogue experiments and make comparisons with natural examples. Models use a sand plaster mixture as analogue rock over a cylinder of silicone simulating an underpressured magma reservoir. Experiments are carried out using different roof aspect ratios (roof thickness/roof width) of 0.2-2. They reveal two basic collapse mechanisms, dependant on the roof aspect ratio. One occurs at low aspect ratios (≤1), as illustrated by aspect ratios of 0.2 and 1. Outward dipping reverse faults initiated at the silicone margins propagates through the entire roof thickness and cause subsidence of a coherent block. Collapse along the reverse faults is accommodated by marginal flexure of the block and tension fractures at the surface (aspect ratio of 0.2) or by the creation of inward dipping normal faults delimiting a terrace (aspect ratio of 1). At an aspect ratio of 1, overhanging pit walls are the surface expressions of the reverse faults. Experiments at high aspect ratio (>1.2) reveal a second mechanism. In this case, collapse occurs by stopping, which propagates upwards by a complex pattern of both reverse faults and tension fractures. The initial underground collapse is restricted to a zone above the reservoir and creates a cavity with a stable roof above it. An intermediate mechanism occurs at aspect ratios of 1.1-1.2. In this case, stopping leads to the formation of a cavity with a thin and unstable roof, which collapses suddenly. The newly formed depression then exhibits overhanging walls. Surface morphology and structure of natural examples, such as the summit pit craters at Masaya Volcano, Nicaragua, have many of the features created in the models, indicating that the internal structural geometry of
Fukuzato, Yoko; Matsuura, Tetsuro; Ozaki, Kiyokazu; Matsuura, Masahiro; Sano, Tomoya; Nakahara, Yutaka; Kodama, Yasushi; Nakagawa, Akihito; Okamura, Sumie; Suido, Hirohisa; Torii, Kayo; Makino, Taketoshi; Narama, Isao
2009-10-01
In our previous studies, WBN/KobSlc was characterized as a rat strain in which only males began to develop pancreatitis, and then presented with diabetic symptoms. In the course of studying their pancreatic inflammation, we detected molar caries in prediabetic males feeding on a standard diet (CRF-1) widely used for experimental animals. The purpose of this study is to confirm whether the WBN/KobSlc strain is caries-susceptible to the diet reported to be non-cariogenic, and to examine the effect of a prediabetic condition on their dental caries. For a morphological study, 25 male WBN/KobSlc rats aged 3.2-7.8 months and 24 females of the same strain aged 3.3-6.6 months were used, along with 10 males and 10 females of 8.2-month-old F344 rats. Marked dental caries were detected in the mandibular molars of male and female WBN/KobSlc rats regardless of pancreatitis, although no similar changes were observed in any teeth of the F344 strain fed the same diet. Soft X-ray examination revealed that the caries began in the crown and progressed horizontally and vertically, and that a severe radiolucent lesion extensively expanded to the entire crown, corresponding to a macroscopically deleted molar. The caries had gradually developed mainly in the second mandibular molar from more than 3.5 months of age, while none were seen in any rats before that time. The WBN/KobSlc rats were caries-susceptible even to the standard laboratory diet, and pancreatitis was not directly associated with the onset of dental caries in this strain.
Effect of Equal-Channel Angular Pressing on Pitting Corrosion of Pure Aluminum
Directory of Open Access Journals (Sweden)
Injoon Son
2012-01-01
Full Text Available The effect of equal-channel angular pressing (ECAP on the pitting corrosion of pure Al was investigated using electrochemical techniques in solutions containing 0.1 m mol·dm−3 of Na2SO4 and 8.46 mol·dm−3 of NaCl (300 ppm Cl− and followed by surface analysis. The potential for pitting corrosion of pure Al was clearly shifted in the noble direction by the ECAP process indicating that this process improves resistance to pitting corrosion. The time dependence of corrosion potential and the anodic potential at 1 A·m−2 revealed that the rate of formation of Al oxide films increased due to a decrease in the grain size of the Al after ECAP. Since there exists a negligible amount of impurity precipitates in pure Al, the improvement in pitting corrosion resistance of pure Al by ECAP appears to be attributable to an increase in the rate of formation of Al oxide films.
Kicker thyratron experience from SLC
International Nuclear Information System (INIS)
Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.
1991-05-01
The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs
Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko
2014-09-18
SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.
Pitting corrosion and crevice corrosion of an advanced chromium-based stainless steel
International Nuclear Information System (INIS)
Kohler, M.
1999-01-01
Alloy 33 is a (wt. %) 33 Cr-32Fe-31Ni-1.6Mo-0.6CU-0.4N austenitic stainless steel combining high yield strength of min. 380 N/mm 2 (55 KSI) with high resistance to local corrosion and superior resistance to stress corrosion cracking. Ranking the material according to its PRE (pitting resistance equivalent) value, the new alloy fits in between the advanced 6% Mo superaustenitics and the nickel-base Alloy 625 but due to the balanced chemical composition the alloy shows a lot less sensitivity to segregation in the base material as well as in welded structures. It is recommended to weld the material with matching filler. The critical pitting temperature of such joints in the 10% FeCl 3 · 6H 2 O solution is reduced by only 10 C in comparison to the base material. Corrosion tests in artificial seawater (20 g/l Cl - ) with additions of chloride up to 37 g/l as well as in a NaCl-CaCl 2 , solution with 62 g/l Cl - --revealed that the critical pitting temperature does not differentiate from the 6% Mo austenitic steel Alloy 926. With respect to crevice corrosion the depassivation pH value has been determined in 1 M NaCl solution according to Crolet and again there was no difference between Alloy 33 and Alloy 926. SCC tests performed on Alloy 33 in the solution annealed condition as well as after heavy cold work up to R PO,2 ∼ 1,100--1,200 N/mm 2 (160--174 KSI) indicate the high resistance to stress corrosion cracking in hot sodium chloride solutions
Large heterogeneities in comet 67P as revealed by active pits from sinkhole collapse.
Vincent, Jean-Baptiste; Bodewits, Dennis; Besse, Sébastien; Sierks, Holger; Barbieri, Cesare; Lamy, Philippe; Rodrigo, Rafael; Koschny, Detlef; Rickman, Hans; Keller, Horst Uwe; Agarwal, Jessica; A'Hearn, Michael F; Auger, Anne-Thérèse; Barucci, M Antonella; Bertaux, Jean-Loup; Bertini, Ivano; Capanna, Claire; Cremonese, Gabriele; Da Deppo, Vania; Davidsson, Björn; Debei, Stefano; De Cecco, Mariolino; El-Maarry, Mohamed Ramy; Ferri, Francesca; Fornasier, Sonia; Fulle, Marco; Gaskell, Robert; Giacomini, Lorenza; Groussin, Olivier; Guilbert-Lepoutre, Aurélie; Gutierrez-Marques, P; Gutiérrez, Pedro J; Güttler, Carsten; Hoekzema, Nick; Höfner, Sebastian; Hviid, Stubbe F; Ip, Wing-Huen; Jorda, Laurent; Knollenberg, Jörg; Kovacs, Gabor; Kramm, Rainer; Kührt, Ekkehard; Küppers, Michael; La Forgia, Fiorangela; Lara, Luisa M; Lazzarin, Monica; Lee, Vicky; Leyrat, Cédric; Lin, Zhong-Yi; Lopez Moreno, Josè J; Lowry, Stephen; Magrin, Sara; Maquet, Lucie; Marchi, Simone; Marzari, Francesco; Massironi, Matteo; Michalik, Harald; Moissl, Richard; Mottola, Stefano; Naletto, Giampiero; Oklay, Nilda; Pajola, Maurizio; Preusker, Frank; Scholten, Frank; Thomas, Nicolas; Toth, Imre; Tubiana, Cecilia
2015-07-02
Pits have been observed on many cometary nuclei mapped by spacecraft. It has been argued that cometary pits are a signature of endogenic activity, rather than impact craters such as those on planetary and asteroid surfaces. Impact experiments and models cannot reproduce the shapes of most of the observed cometary pits, and the predicted collision rates imply that few of the pits are related to impacts. Alternative mechanisms like explosive activity have been suggested, but the driving process remains unknown. Here we report that pits on comet 67P/Churyumov-Gerasimenko are active, and probably created by a sinkhole process, possibly accompanied by outbursts. We argue that after formation, pits expand slowly in diameter, owing to sublimation-driven retreat of the walls. Therefore, pits characterize how eroded the surface is: a fresh cometary surface will have a ragged structure with many pits, while an evolved surface will look smoother. The size and spatial distribution of pits imply that large heterogeneities exist in the physical, structural or compositional properties of the first few hundred metres below the current nucleus surface.
Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.
Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel
2013-12-05
Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Lessons from the SLC for future LC control systems
International Nuclear Information System (INIS)
Humphrey, R.
1992-01-01
The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)
Final Remediation Report for the K-Area Bingham Pump Outage Pit (643-1G); FINAL
International Nuclear Information System (INIS)
Morganstern, M.
2002-01-01
The K-Area Bingham Pump Outage Pit (K BPOP) Building Number 643-1G, is situated immediately south and outside the K-Reactor fence line and is approximately 400 feet in length and 60 feet in width. For the K BPOP operable unit, the Land Use Control (LUC) objectives are to prevent contact, removal, or excavation of buried waste in the area and to preclude residential use of the area
Directory of Open Access Journals (Sweden)
Irene Flønes
Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.
Energy Technology Data Exchange (ETDEWEB)
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D. (Scripps)
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
2010-01-01
... 1 General Provisions 1 2010-01-01 2010-01-01 false Organization. 20.3 Section 20.3 General... DOCUMENTS HANDLING OF THE UNITED STATES GOVERNMENT MANUAL STATEMENTS § 20.3 Organization. (a) Information about lines of authority and organization may be reflected in a chart if the chart clearly delineates...
Spontaneous Resolution of Optic Disc Pit Maculopathy
Tripathy, Koushik
2017-01-01
I read with interest the article reporting spontaneous resolution of optic disc pit maculopathy in a boy.1 Though the presence of an optic disc pit and associated macular involvement is undoubted in the presented case, the provided optical coherence tomography (OCT) does not clearly show typical intraretinal schisis (Figure 1B)1 at multiple retinal levels which may communicate with the pit. Instead, it shows a sub-internal limiting membrane (sub-ILM) cavity. Such cavities are known to occur f...
International Nuclear Information System (INIS)
Lasry, Inbal; Berman, Bluma; Glaser, Fabian; Jansen, Gerrit; Assaraf, Yehuda G.
2009-01-01
The proton-coupled folate transporter (PCFT/SLC46A1) mediates intestinal folate uptake at acidic pH. Some loss of folic acid (FA) transport mutations in PCFT from hereditary folate malabsorption (HFM) patients cluster in R113, thereby suggesting a functional role for this residue. Herein, unlike non-conservative substitutions, an R113H mutant displayed 80-fold increase in the FA transport Km while retaining parental Vmax, hence indicating a major fall in folate substrate affinity. Furthermore, consistent with the preservation of 9% of parental transport activity, R113H transfectants displayed a substantial decrease in the FA growth requirement relative to mock transfectants. Homology modeling based on the crystal structures of the Escherichia coli transporter homologues EmrD and glycerol-3-phosphate transporter revealed that the R113H rotamer properly protrudes into the cytoplasmic face of the minor cleft normally occupied by R113. These findings constitute the first demonstration that a basic amino acid at position 113 is required for folate substrate binding.
Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas
Directory of Open Access Journals (Sweden)
Alberto Azzalin
2017-04-01
Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.
Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy
Directory of Open Access Journals (Sweden)
Yangzom D. Bhutia
2017-02-01
Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy
Directory of Open Access Journals (Sweden)
B Frank Eames
2011-08-01
Full Text Available Differentiating cells interact with their extracellular environment over time. Chondrocytes embed themselves in a proteoglycan (PG-rich matrix, then undergo a developmental transition, termed "maturation," when they express ihh to induce bone in the overlying tissue, the perichondrium. Here, we ask whether PGs regulate interactions between chondrocytes and perichondrium, using zebrafish mutants to reveal that cartilage PGs inhibit chondrocyte maturation, which ultimately dictates the timing of perichondral bone development. In a mutagenesis screen, we isolated a class of mutants with decreased cartilage matrix and increased perichondral bone. Positional cloning identified lesions in two genes, fam20b and xylosyltransferase1 (xylt1, both of which encode PG synthesis enzymes. Mutants failed to produce wild-type levels of chondroitin sulfate PGs, which are normally abundant in cartilage matrix, and initiated perichondral bone formation earlier than their wild-type siblings. Primary chondrocyte defects might induce the bone phenotype secondarily, because mutant chondrocytes precociously initiated maturation, showing increased and early expression of such markers as runx2b, collagen type 10a1, and ihh co-orthologs, and ihha mutation suppressed early perichondral bone in PG mutants. Ultrastructural analyses demonstrated aberrant matrix organization and also early cellular features of chondrocyte hypertrophy in mutants. Refining previous in vitro reports, which demonstrated that fam20b and xylt1 were involved in PG synthesis, our in vivo analyses reveal that these genes function in cartilage matrix production and ultimately regulate the timing of skeletal development.
The role of SCL2A1 in Early Onset and Childhood Absence Epilepsies
DEFF Research Database (Denmark)
Brusgaard, Klaus
brother and the paternal grandmother. Conclusion: Our study confirmed the role of SLC2A1 mutation carriers in EOAE and demonstrated that SLC2A1 do not seem to play a major role in CAE and JAE. Since ketogenic diet is a well known treatment option in GLUT-1-deficiency, pediatricians as well as neurologists...
Energy Technology Data Exchange (ETDEWEB)
Bendell, L.I., E-mail: bendell@sfu.ca
2011-02-15
Archived samples of blue grouse (Dendragapus obscurus) gizzard contents, inclusive of grit, collected yearly between 1959 and 1970 were analyzed for cadmium, lead, zinc, and copper content. Approximately halfway through the 12-year sampling period, an open-pit copper mine began activities, then ceased operations 2 years later. Thus the archived samples provided a unique opportunity to determine if avian gizzard contents, inclusive of grit, could reveal patterns in the anthropogenic deposition of trace metals associated with mining activities. Gizzard concentrations of cadmium and copper strongly coincided with the onset of opening and the closing of the pit mining activity. Gizzard zinc and lead demonstrated significant among year variation; however, maximum concentrations did not correlate to mining activity. The archived gizzard contents did provide a useful tool for documenting trends in metal depositional patterns related to an anthropogenic activity. Further, blue grouse ingesting grit particles during the time of active mining activity would have been exposed to toxicologically significant levels of cadmium. Gizzard lead concentrations were also of toxicological significance but not related to mining activity. This type of 'pulse' toxic metal exposure as a consequence of open-pit mining activity would not necessarily have been revealed through a 'snap-shot' of soil, plant or avian tissue trace metal analysis post-mining activity. - Research Highlights: {yields} Archived gizzard samples reveals mining history. {yields} Grit ingestion exposes grouse to cadmium and lead. {yields} Grit selection includes particles enriched in cadmium. {yields} Cadmium enriched particles are of toxicological significance.
Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan
2011-07-29
Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.
Use of landsat ETM+ SLC-off segment-based gap-filled imagery for crop type mapping
Maxwell, S.K.; Craig, M.E.
2008-01-01
Failure of the Scan Line Corrector (SLC) on the Landsat ETM+ sensor has had a major impact on many applications that rely on continuous medium resolution imagery to meet their objectives. The United States Department of Agriculture (USDA) Cropland Data Layer (CDL) program uses Landsat imagery as the primary source of data to produce crop-specific maps for 20 states in the USA. A new method has been developed to fill the image gaps resulting from the SLC failure to support the needs of Landsat users who require coincident spectral data, such as for crop type mapping and monitoring. We tested the new gap-filled method for a CDL crop type mapping project in eastern Nebraska. Scan line gaps were simulated on two Landsat 5 images (spring and late summer 2003) and then gap-filled using landscape boundary models, or segment models, that were derived from 1992 and 2002 Landsat images (used in the gap-fill process). Various date combinations of original and gap-filled images were used to derive crop maps using a supervised classification process. Overall kappa values were slightly higher for crop maps derived from SLC-off gap-filled images compared to crop maps derived from the original imagery (0.3–1.3% higher). Although the age of the segment model used to derive the SLC-off gap-filled product did not negatively impact the overall agreement, differences in individual cover type agreement did increase (−0.8%–1.6% using the 2002 segment model to −5.0–5.1% using the 1992 segment model). Classification agreement also decreased for most of the classes as the size of the segment used in the gap-fill process increased.
Microstructure analyses and thermoelectric properties of Ag1−xPb18Sb1+yTe20
International Nuclear Information System (INIS)
Perlt, S.; Höche, Th.; Dadda, J.; Müller, E.; Bauer Pereira, P.; Hermann, R.; Sarahan, M.; Pippel, E.; Brydson, R.
2012-01-01
This study reports microstructural investigations of long-term annealed Ag 1−x Pb m Sb 1+y Te 2+m (m=18, x=y=0, hereinafter referred to as AgPb 18 SbTe 20 ) (Lead–Antimony–Silver–Tellurium, LAST-18) as well as of Ag 1−x Pb 18 Sb 1+y Te 20 , i.e. Ag-deficient and Sb-excess LAST-18 (x≠0,y≠0), respectively. Two different length scales are explored. The micrometer scale was evaluated by SEM to analyze the volume fraction and the number of secondary phases as well as the impact of processing parameters on the homogeneity of bulk samples. For AgPb 18 SbTe 20 , site-specific FIB liftout of TEM lamellae from thermoelectrically characterized samples was accomplished to investigate the structure on the nanometer scale. High-resolution TEM and energy-filtered TEM were performed to reveal shape and size distribution of nanoprecipitates, respectively. A hypothesis concerning the structure–property relationship is set out within the frame of a gradient annealing experiment. This study is completed by results dealing with inhomogeneities on the micrometer scale of Ag 1−x Pb 18 Sb 1+y Te 20 and its electronic properties. Highlights: ► SEM and TEM microstructure investigation of long-term annealed AgPb 18 SbTe 20 . ► SEM and thermoelectric studies on Ag 1−x Pb 18 Sb 1+y Te 20 . ► Discussion concerning structure–property relationship in long-term annealed AgPb 18 SbTe 20 . ► Correlation between Ag 1−x Pb 18 Sb 1+y Te 20 microscale structure and electronic properties.
International Nuclear Information System (INIS)
Morri, J.
1987-11-01
This report describes impact wear experiments on 9Cr1Mo finned boiler tube specimens in 3 different heat treated forms. The objective of the tests was to establish whether a high temperature, high wear rate, pitting form of wear was dependent upon the residual microstructure and hardness. Although a x2 reduction in specific wear rate was achieved for the martensitic structure, the pitting characteristic remained. It is concluded that modifying the as-received 9Cr microstructure has not suppressed the high temperature severe form of wear. (author)
Shepard, A R; Zhang, W; Eberhardt, N L
1994-01-21
We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT
SLC9B1 methylation predicts fetal intolerance of labor.
Knight, Anna K; Conneely, Karen N; Kilaru, Varun; Cobb, Dawayland; Payne, Jennifer L; Meilman, Samantha; Corwin, Elizabeth J; Kaminsky, Zachary A; Dunlop, Anne L; Smith, Alicia K
2018-01-01
Fetal intolerance of labor is a common indication for delivery by Caesarean section. Diagnosis is based on the presence of category III fetal heart rate tracing, which is an abnormal heart tracing associated with increased likelihood of fetal hypoxia and metabolic acidemia. This study analyzed data from 177 unique women who, during their prenatal visits (7-15 weeks and/or 24-32 weeks) to Atlanta area prenatal care clinics, consented to provide blood samples for DNA methylation (HumanMethylation450 BeadChip) and gene expression (Human HT-12 v4 Expression BeadChip) analyses. We focused on 57 women aged 18-36 (mean 25.4), who had DNA methylation data available from their second prenatal visit. DNA methylation patterns at CpG sites across the genome were interrogated for associations with fetal intolerance of labor. Four CpG sites (P value intolerance of labor. DNA methylation and gene expression were negatively associated when examined longitudinally during pregnancy using a linear mixed-effects model. Positive predictive values of methylation of these four sites ranged from 0.80 to 0.89, while negative predictive values ranged from 0.91 to 0.92. The four CpG sites were also associated with fetal intolerance of labor in an independent cohort (the Johns Hopkins Prospective PPD cohort). Therefore, fetal intolerance of labor could be accurately predicted from maternal blood samples obtained between 24-32 weeks gestation. Fetal intolerance of labor may be accurately predicted from maternal blood samples obtained between 24-32 weeks gestation by assessing DNA methylation patterns of SLC9B1. The identification of pregnant women at elevated risk for fetal intolerance of labor may allow for the development of targeted treatments or management plans.
Extensive Characterization of the 1 mm PIT Nb$_{3}$Sn strand for the 13-T FRESCA2 Magnet
Bordini, B; Mondonico, G; Oberli, L; Richter, D; Seeber, B; Senatore, C; Takala, E; Valentinis, D
2012-01-01
In the framework of the EuCARD program, CERN is participating in the development of a 13 T 100-mm-aperture dipole magnet to upgrade the superconducting cable test facility FRESCA at CERN. The conductor candidates for building this magnet are two 1-mm Nb$_{3}$Sn strands: the Powder In Tube (PIT) produced by Bruker-EAS and the 132/169 RRP by Oxford Superconducting Technology (OST). Recently the PIT strand has been extensively characterized by CERN in collaboration with the University of Geneva (UniGe). The critical current dependence on the magnetic field and on the axial strain e has been measured at different temperatures. Furthermore, the strand magnetization has been measured at different temperature using a vibrating sample magnetometer. Finally the magneto-thermal stability of this strand was studied by measuring the quench current between 0 T and 12 T at 1.9 K and 4.3 K. The experimental results are compared with an optimized scaling law for the critical current of Nb$_{3}$Sn strands. In this paper the r...
Bendell, L I
2011-02-15
Archived samples of blue grouse (Dendragapus obscurus) gizzard contents, inclusive of grit, collected yearly between 1959 and 1970 were analyzed for cadmium, lead, zinc, and copper content. Approximately halfway through the 12-year sampling period, an open-pit copper mine began activities, then ceased operations 2 years later. Thus the archived samples provided a unique opportunity to determine if avian gizzard contents, inclusive of grit, could reveal patterns in the anthropogenic deposition of trace metals associated with mining activities. Gizzard concentrations of cadmium and copper strongly coincided with the onset of opening and the closing of the pit mining activity. Gizzard zinc and lead demonstrated significant among year variation; however, maximum concentrations did not correlate to mining activity. The archived gizzard contents did provide a useful tool for documenting trends in metal depositional patterns related to an anthropogenic activity. Further, blue grouse ingesting grit particles during the time of active mining activity would have been exposed to toxicologically significant levels of cadmium. Gizzard lead concentrations were also of toxicological significance but not related to mining activity. This type of "pulse" toxic metal exposure as a consequence of open-pit mining activity would not necessarily have been revealed through a "snap-shot" of soil, plant or avian tissue trace metal analysis post-mining activity. Copyright © 2010 Elsevier B.V. All rights reserved.
Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Ines; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Della Marina, Adela; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michel A.
Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex
W.G. Leen (Wilhelmina); J. Klepper (Joerg); M.M. Verbeek (Marcel); M. Leferink (Maike); T. Hofste (Tom); B.G.M. van Engelen (Baziel); R.A. Wevers (Ron); T. Arthur (Todd); N. Bahi-Buisson (Nadia); D. Ballhausen (Diana); J. Bekhof (Jolita); P. van Bogaert (Patrick); I. Carrilho (Inês); B. Chabrol (Brigitte); M.P. Champion (Michael); J. Coldwell (James); P. Clayton (Peter); E. Donner (Elizabeth); A. Evangeliou (Athanasios); F. Ebinger (Friedrich); K. Farrell (Kevin); R.J. Forsyth (Rob); C.G.E.L. de Goede (Christian); S. Gross (Stephanie); S. Grünewald (Sonja); H. Holthausen (Hans); S. Jayawant (Sandeep); K. Lachlan (Katherine); V. Laugel (Vincent); K. Leppig (Kathy); M.J. Lim (Ming); G.M.S. Mancini (Grazia); A.D. Marina; L. Martorell (Loreto); J. McMenamin (Joe); M.E.C. Meuwissen (Marije); H. Mundy (Helen); N.O. Nilsson (Nils); A. Panzer (Axel); B.T. Poll-The; C. Rauscher (Christian); C.M.R. Rouselle (Christophe); I. Sandvig (Inger); T. Scheffner (Thomas); E. Sheridan (Eamonn); N. Simpson (Neil); P. Sykora (Parol); R. Tomlinson (Richard); J. Trounce (John); D.W.M. Webb (David); B. Weschke (Bernhard); H. Scheffer (Hans); M.A. Willemsen (Michél)
2010-01-01
textabstractGlucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing
Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Inês; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Marina, Adela Della; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michél A.
2010-01-01
Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex
Leen, W.G.; Klepper, J.; Verbeek, M.M.; Leferink, M.; Hofste, T.; Engelen, B.G.M. van; Wevers, R.A.; Arthur, T.; Bahi-Buisson, N.; Ballhausen, D.; Bekhof, J.; Bogaert, P. van; Carrilho, I.; Chabrol, B.; Champion, M.P.; Coldwell, J.; Clayton, P.; Donner, E.; Evangeliou, A.; Ebinger, F.; Farrell, K.; Forsyth, R.J.; Goede, C.G. de; Gross, S.; Grunewald, S.; Holthausen, H.; Jayawant, S.; Lachlan, K.; Laugel, V.; Leppig, K.; Lim, M.J.; Mancini, G.; Marina, A.D.; Martorell, L.; McMenamin, J.; Meuwissen, M.E.; Mundy, H.; Nilsson, N.O.; Panzer, A.; Poll-The, B.T.; Rauscher, C.; Rouselle, C.M.; Sandvig, I.; Scheffner, T.; Sheridan, E.; Simpson, N.; Sykora, P.; Tomlinson, R.; Trounce, J.; Webb, D.; Weschke, B.; Scheffer, H.; Willemsen, M.A.A.P.
2010-01-01
Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex
PITTING CORROSION IN EROSIVE CONDITION OF AGED 550°C CU10NI-3AL-1,3FE ALLOY IN 0,01 M NA2 SO4
Directory of Open Access Journals (Sweden)
Rodrigo Nascimento Liberto
2012-09-01
Full Text Available This study evaluates the effect of aging at 550°C on pitting corrosion of Cu10Ni-3Al-1.3Fe alloy, after potentiodynamic polarization test in 0.01 M Na2 SO4 in erosive condition. Cold rolled sheet specimens were solution treated at 900°C for 1 hour, and aged at 550°C until 1,032 hours. The investigation was carried out by potentiodynamic polarization in electrolyte consisted of 0.01 M Na2 SO4 with 10 wt. (% of Al2 O3 abrasive particles. After the polarization tests, specimens were analyzed by optical microscopy and scanning electron microscopy techniques to examine the morphology of the corroded regions. Result show that all samples present a passivity break potential (Eq that characterizes the initiation of pitting corrosion. However, it is not observed any significant change in the value of passivity break potential as a function of aging time. The mechanism of pitting corrosion in the studied alloys can be the passivity breakdown by the action of sulfate ion, followed by growth of pit by galvanic action or dissolution of the copper in cupric and cuprous ions and membrane formation of cuprous oxide over the pit
SLC and SLD: Experimental experience with a linear collider
International Nuclear Information System (INIS)
Breidenbach, M.
1993-08-01
The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described
Jiang, Ke; Zhang, Peng
2011-01-01
TRPA1 is a calcium ion channel protein recently identified as the infrared receptor in pit organ-containing snakes. Therefore, understanding the molecular evolution of TRPA1 may help to illuminate the origin of “heat vision” in snakes and reveal the molecular mechanism of infrared sensitivity for TRPA1. To this end, we sequenced the infrared sensory gene TRPA1 in 24 snake species, representing nine snake families and multiple non-snake outgroups. We found that TRPA1 is under strong positive selection in the pit-bearing snakes studied, but not in other non-pit snakes and non-snake vertebrates. As a comparison, TRPV1, a gene closely related to TRPA1, was found to be under strong purifying selection in all the species studied, with no difference in the strength of selection between pit-bearing snakes and non-pit snakes. This finding demonstrates that the adaptive evolution of TRPA1 specifically occurred within the pit-bearing snakes and may be related to the functional modification for detecting infrared radiation. In addition, by comparing the TRPA1 protein sequences, we identified 11 amino acid sites that were diverged in pit-bearing snakes but conserved in non-pit snakes and other vertebrates, 21 sites that were diverged only within pit-vipers but conserved in the remaining snakes. These specific amino acid substitutions may be potentially functional important for infrared sensing. PMID:22163322
Mcph1-deficient mice reveal a role for MCPH1 in otitis media.
Directory of Open Access Journals (Sweden)
Jing Chen
Full Text Available Otitis media is a common reason for hearing loss, especially in children. Otitis media is a multifactorial disease and environmental factors, anatomic dysmorphology and genetic predisposition can all contribute to its pathogenesis. However, the reasons for the variable susceptibility to otitis media are elusive. MCPH1 mutations cause primary microcephaly in humans. So far, no hearing impairment has been reported either in the MCPH1 patients or mouse models with Mcph1 deficiency. In this study, Mcph1-deficient (Mcph1(tm1a (/tm1a mice were produced using embryonic stem cells with a targeted mutation by the Sanger Institute's Mouse Genetics Project. Auditory brainstem response measurements revealed that Mcph1(tm1a (/tm1a mice had mild to moderate hearing impairment with around 70% penetrance. We found otitis media with effusion in the hearing-impaired Mcph1(tm1a (/tm1a mice by anatomic and histological examinations. Expression of Mcph1 in the epithelial cells of middle ear cavities supported its involvement in the development of otitis media. Other defects of Mcph1(tm1a (/tm1a mice included small skull sizes, increased micronuclei in red blood cells, increased B cells and ocular abnormalities. These findings not only recapitulated the defects found in other Mcph1-deficient mice or MCPH1 patients, but also revealed an unexpected phenotype, otitis media with hearing impairment, which suggests Mcph1 is a new gene underlying genetic predisposition to otitis media.
Vitrectomy for optic disk pit with macular schisis and outer retinal dehiscence.
Shukla, Dhananjay; Kalliath, Jay; Tandon, Manish; Vijayakumar, Balakrishnan
2012-07-01
To describe the outcomes of vitrectomy for optic disc pit-related maculopathy with central outer retinal dehiscence. This prospective interventional case series included seven patients with optic disc pit with macular schisis and central outer retinal dehiscence who underwent vitrectomy with internal limiting membrane peeling, barrage laser photocoagulation, and gas tamponade and were followed for at least 6 months. The surgical outcomes in terms of restoration of macular anatomy and visual improvement were recorded at each visit by fundus photography and optical coherence tomography. The mean age of the patients was 21.3 ± 8.6 years (range, 10-35 years), and the mean duration of defective vision was 6.7 ± 8.5 months (range, 1-24 months). Preoperatively, the median best-corrected visual acuity (BCVA) was 20/60 (range, 20/40 to 20/120). Full-thickness macular holes were noticed in 4 patients 1 month postoperatively. Gas tamponade was repeated in two patients with large macular holes. By the final follow-up, macular holes had closed and BCVA improved in all patients except one. Final mean central macular thickness was 176.83 ± 55.74 μ, the range being 109 μ to 256 μ. The median postoperative BCVA was 20/30 (range, 20/20 to 20/80). Six of 7 patients (85.7%) had improvement in BCVA postoperatively (mean, +2 lines; range, 1-4 lines). Five patients (71%) achieved a postoperative BCVA of ≥20/30. Best-corrected visual acuity dropped by one line in the patient with persistent macular hole. Vitrectomy with internal limiting membrane peeling can achieve excellent final surgical outcomes in optic pit maculopathy with outer retinal dehiscence despite the potential for macular hole formation.
46 CFR 190.20-1 - Application.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Application. 190.20-1 Section 190.20-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS CONSTRUCTION AND ARRANGEMENT Accomodations for Officers, Crew, and Scientific Personnel § 190.20-1 Application. (a) Except as...
Directory of Open Access Journals (Sweden)
Yongfang Huang
2017-04-01
Full Text Available For pre-corroded aluminum alloy 7075-T6, the interacting effects of two neighboring pits on the stress concentration are comprehensively analyzed by considering various relative position parameters (inclination angle θ and dimensionless spacing parameter λ and pit depth (d with the finite element method. According to the severity of the stress concentration, the critical corrosion regions, bearing high susceptibility to fatigue damage, are determined for intersecting and adjacent pits, respectively. A straightforward approach is accordingly proposed to conservatively estimate the combined stress concentration factor induced by two neighboring pits, and a concrete application example is presented. It is found that for intersecting pits, the normalized stress concentration factor Ktnor increases with the increase of θ and λ and always reaches its maximum at θ = 90°, yet for adjacent pits, Ktnor decreases with the increase of λ and the maximum value appears at a slight asymmetric location. The simulations reveal that Ktnor follows a linear and an exponential relationship with the dimensionless depth parameter Rd for intersecting and adjacent cases, respectively.
The Polymorphism of Pituitary Factor 1 (POU1F1 in Cattle
Directory of Open Access Journals (Sweden)
Teodora Crina Carsai
2012-05-01
Full Text Available The development and function of mammary gland is mainly controlled by growth hormone and prolactin, twoprotein hormones secreted by the anterior pituitary gland. Their synthesis is under regulatory influence of pituitaryfactor 1 (PIT1 or POU1F1, a protein factor produced in hypothalamic nuclei. In cattle, it was shown that a HinfIpolymorphism located in exon 6 of PIT1 gene may have significant influence on milk quantity. In particular A allelewas associated with a higher milk yield and could be a valuable genetic marker for improving milk quantity in cattle.In an effort to better understand the possible influence of this polymorphism on mammary gland development andfunction in cattle, we have studied the frequency this polymorphism in Romanian Black and White breed, a highmilk production cattle breed versus Romanian Grey Steppe breed, a primitive breed with very low milk production.In both breeds the frequency of B allele is much higher as compared with the frequency of A allele. The study ofPIT1 polymorphism in Romanian cattle breeds is a part of a more complex study targeting several key genesinvolved in mammary gland function.
Abd Rahman, Shaffinaz; Schirra, Horst Joachim; Lichanska, Agnieszka M; Huynh, Tony; Leong, Gary M
2013-01-01
Growth hormone (GH) is a protein hormone with important roles in growth and metabolism. The objective of this study was to investigate the metabolism of a human subject with severe GH deficiency (GHD) due to a PIT-1 gene mutation and the metabolic effects of GH therapy using Nuclear Magnetic Resonance (NMR)-based metabonomics. NMR-based metabonomics is a platform that allows the metabolic profile of biological fluids such as urine to be recorded, and any alterations in the profile modulated by GH can potentially be detected. Urine samples were collected from a female subject with severe GHD before, during and after GH therapy, and from healthy age- and sex-matched controls and analysed with NMR-based metabonomics. The samples were collected at a hospital and the study was performed at a research facility. We studied a 17 year old female adolescent with severe GHD secondary to PIT-1 gene mutation who had reached final adult height and who had ceased GH therapy for over 3 years. The subject was subsequently followed for 5 years with and without GH therapy. Twelve healthy age-matched female subjects acted as control subjects. The GH-deficient subject re-commenced GH therapy at a dose of 1 mg/day to normalise serum IGF-1 levels. Urine metabolic profiles were recorded using NMR spectroscopy and analysed with multivariate statistics to distinguish the profiles at different time points and identify significant metabolites affected by GH therapy. NMR-based metabonomics revealed that the metabolic profile of the GH-deficient subject altered with GH therapy and that her profile was different from healthy controls before, and during withdrawal of GH therapy. This study illustrates the potential use of NMR-based metabonomics for monitoring the effects of GH therapy on metabolism by profiling the urine of GH-deficient subjects. Further controlled studies in larger numbers of GH-deficient subjects are required to determine the clinical benefits of NMR-based metabonomics in
Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).
Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M
2015-12-07
The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.
Directory of Open Access Journals (Sweden)
Zhao Jiandong
2012-05-01
Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.
Tank Riser Pit Decontamination System (Pit Viper) Return on Investment and Break-Even Analysis
International Nuclear Information System (INIS)
Young, Joan K.; Weimar, Mark R.; Balducci, Patrick J.; Fassbender, Linda L.; Hernandez, Melissa
2003-01-01
This study assessed the cost benefit of Pit Viper deployment for 80 tank farm pits between October 1, 2003 and September 30, 2012 under the technical baseline for applicable double-shell tank (DST) and single-shell tank (SST) projects. After this assessment had been completed, the U.S. Department of Energy (DOE) Richland Operations Office (RL) and Office of River Protection (ORP) published the Hanford Performance Management Plan (August 2003), which accelerated the schedule for SST retrieval. Then, DOE/CH2M HILL contract modification M064 (October 2002) and The Integrated Mission Acceleration Plan (March 2003) further accelerated SST retrieval and closure schedules. Twenty-six to 40 tanks must be retrieved by 2006. Thus the schedule for SST pit entries is accelerated and the number of SST pit entries is increased. This study estimates the return on investment (ROI) and the number of pits where Pit Viper deployment would break even or save money over current manual practices. The results of the analysis indicate a positive return on the federal investment for deployment of the Pit Viper provided it is used on a sufficient number of pits
2010-04-01
... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Annuities. 20.2039-1 Section 20.2039-1 Internal...; ESTATES OF DECEDENTS DYING AFTER AUGUST 16, 1954 Gross Estate § 20.2039-1 Annuities. (a) In general. A decedent's gross estate includes under section 2039(a) and (b) the value of an annuity or other payment...
Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.
Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B
2016-08-08
Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.
Evolution of mud-capped dredge pits following excavation: sediment trapping and slope instability
Obelcz, J.; Xu, K.; Bentley, S. J.; Li, C.; Miner, M. D.; O'Connor, M. C.; Wang, J.
2016-02-01
Many fluvial channels incised the Northern Gulf of Mexico inner continental shelf during the late Quaternary. Mud-capped dredge pits (MCDPs), which are generally elongate and deep (8-10 m) excavations, target sandy fluvial channel deposits for coastal restoration projects. The morphological evolution of dredge excavations in noncohesive sandy substrate is well studied, but MCDPs have up to a several-meter-thick veneer of Holocene shelf mud overlying sandy channel deposits. This stratigraphy is hypothesized to result in more complex post-dredge morphology than pit walls simply slumping to the angle of repose shortly after excavation. Numerical modeling of MCDP post-dredge response conducted prior to excavation indicates pit walls may retrogressively fail, which is accounted for in pit design by assigning no-dredge setback buffers from pipelines or cultural and environmental resources. To validate model results and test effectiveness of setback buffers, a geophysical survey of the Sandy Point MCDP (20 km west of the Mississippi River Delta in 10m deep water), where 1.7 million m3 of sandy sediment was excavated in 2012, was conducted May 2015. A total of 84 line-km of high-resolution chirp subbottom and a 27 km2 grid of swath bathymetry and sidescan sonar were collected. The data indicate the dredge pit walls are differentially slumping, with the western pit wall in a more active state of failure than the eastern wall. The western failures morphologically resemble features observed along the muddy Mississippi River Delta Front at water depths of 20-100 m, including bowl-shaped collapse failures and retrogressive stair-stepped slumps; these failures may play a key role in evaluating the distance of setback buffer zone to pipelines. These features indicate the cohesive mud overlying the sandy infill has a prominent role in pit wall stability. A 0.5-1 m thick acoustically transparent package overlies the entire pit floor (interpreted as a possible fluid mud layer
Mauri, Lucia; Barone, Luca; Al Oum, Muna; Del Longo, Alessandra; Piozzi, Elena; Manfredini, Emanuela; Stanzial, Franco; Benedicenti, Francesco; Penco, Silvana; Patrosso, Maria Cristina
2014-01-01
Oculocutaneous Albinism (OCA) is a heterogeneous group of inherited diseases involving hair, skin and eyes. To date, six forms are recognized on the effects of different melanogenesis genes. OCA4 is caused by mutations in SLC45A2 showing a heterogeneous phenotype ranging from white hair, blue irides and nystagmus to brown/black hair, brown irides and no nystagmus. The high clinic variety often leads to misdiagnosis. Our aim is to contribute to OCA4 diagnosis defining SLC45A2 genetic variants in Italian patients with OCA without any TYR, OCA2 and TYRP1 gene defects. After the clinical diagnosis of OCA, all patients received genetic counseling and genetic test. Automatic sequencing of TYR, OCA2, and TYRP1 genes was performed on DNA of 117 albino patients. Multiplex Ligation-dependent Probe Amplification (MLPA) was carried out on TYR and OCA2 genes to increase the mutation rate. SLC45A2 gene sequencing was then executed in the patients with a single mutation in one of the TYR, OCA2, TYRP1 genes and in the patients, which resulted negative at the screening of these genes. SLC45A2 gene analysis was performed in 41 patients and gene alterations were found in 5 patients. Four previously reported SLC45A2 mutations were found: p.G100S, p.W202C, p.A511E and c.986delC, and three novel variants were identified: p.M265L, p.H94D, and c.1156+1G>A. All the alterations have been detected in the group of patients without mutations in the other OCA genes. Three new variants were identified in OCA4 gene; the analysis allowed the classification of a patient previously misdiagnosed as OA1 because of skin and hair pigmentation presence. The molecular defects in SLC45A2 gene represent the 3.4% in this cohort of Italian patients, similar to other Caucasian populations; our data differ from those previously published by an Italian researcher group, obtained on a smaller cohort of patients. © 2013 Elsevier B.V. All rights reserved.
Sabino-Silva, R; Freitas, H S; Lamers, M L; Okamoto, M M; Santos, M F; Machado, U F
2009-03-01
Oral health complications in diabetes include decreased salivary secretion. The SLC5A1 gene encodes the Na(+)-glucose cotransporter SGLT1 protein, which not only transports glucose, but also acts as a water channel. Since SLC5A1 expression is altered in kidneys of diabetic subjects, we hypothesize that it could also be altered in salivary glands, contributing to diabetic dysfunction. The present study shows a diabetes-induced decrease (p salivary secretion, which was accompanied by enhanced (p diabetic rats revealed that SGLT1 protein expression increased in the luminal membrane of ductal cells, which can stimulate water reabsorption from primary saliva. Furthermore, SGLT1 protein was reduced in myoepithelial cells of the parotid from diabetic animals, and that, by reducing cellular contractile activity, might also be related to reduced salivary flux. Six-day insulin-treated diabetic rats reversed all alterations. In conclusion, diabetes increases SLC5A1 gene expression in salivary glands, increasing the SGLT1 protein content in the luminal membrane of ductal cells, which, by increasing water reabsorption, might explain the diabetes-induced decrease in salivary secretion.
Congenital Hypopituitarism due to POU1F1 Gene Mutation
Directory of Open Access Journals (Sweden)
Ni-Chung Lee
2011-01-01
Full Text Available POU1F1 (Pit-1; Gene ID 5449 is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome, elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S mutation. The rarity of the disease can result in delayed diagnosis and treatment.
Directory of Open Access Journals (Sweden)
Kiho Im
Full Text Available Sulcal pit analysis has been providing novel insights into brain function and development. The purpose of this study was to evaluate the reliability of sulcal pit extraction with respect to the effects of scan session, scanner, and surface extraction tool. Five subjects were scanned 4 times at 3 MRI centers and other 5 subjects were scanned 3 times at 2 MRI centers, including 1 test-retest session. Sulcal pits were extracted on the white matter surfaces reconstructed with both Montreal Neurological Institute and Freesurfer pipelines. We estimated similarity of the presence of sulcal pits having a maximum value of 1 and their spatial difference within the same subject. The tests showed high similarity of the sulcal pit presence and low spatial difference. The similarity was more than 0.90 and the spatial difference was less than 1.7 mm in most cases according to different scan sessions or scanners, and more than 0.85 and about 2.0 mm across surface extraction tools. The reliability of sulcal pit extraction was more affected by the image processing-related factors than the scan session or scanner factors. Moreover, the similarity of sulcal pit distribution appeared to be largely influenced by the presence or absence of the sulcal pits on the shallow and small folds. We suggest that our sulcal pit extraction from MRI is highly reliable and could be useful for clinical applications as an imaging biomarker.
Im, Kiho; Lee, Jong-Min; Jeon, Seun; Kim, Jong-Heon; Seo, Sang Won; Na, Duk L; Grant, P Ellen
2013-01-01
Sulcal pit analysis has been providing novel insights into brain function and development. The purpose of this study was to evaluate the reliability of sulcal pit extraction with respect to the effects of scan session, scanner, and surface extraction tool. Five subjects were scanned 4 times at 3 MRI centers and other 5 subjects were scanned 3 times at 2 MRI centers, including 1 test-retest session. Sulcal pits were extracted on the white matter surfaces reconstructed with both Montreal Neurological Institute and Freesurfer pipelines. We estimated similarity of the presence of sulcal pits having a maximum value of 1 and their spatial difference within the same subject. The tests showed high similarity of the sulcal pit presence and low spatial difference. The similarity was more than 0.90 and the spatial difference was less than 1.7 mm in most cases according to different scan sessions or scanners, and more than 0.85 and about 2.0 mm across surface extraction tools. The reliability of sulcal pit extraction was more affected by the image processing-related factors than the scan session or scanner factors. Moreover, the similarity of sulcal pit distribution appeared to be largely influenced by the presence or absence of the sulcal pits on the shallow and small folds. We suggest that our sulcal pit extraction from MRI is highly reliable and could be useful for clinical applications as an imaging biomarker.
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-01-01
The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-04-01
The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs
Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong
2009-01-01
Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751
Directory of Open Access Journals (Sweden)
MyPhuong T Le
Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.
Directory of Open Access Journals (Sweden)
Quirino Cordeiro
2010-10-01
Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,05
Clinico epidemiological study of pitted keratolysis
Directory of Open Access Journals (Sweden)
Naik Chandra
2007-01-01
Full Text Available Background: Pitted keratolysis is a common dermatological condition. However, very few studies are available on the clinical characteristics and epidemiological features of this disorder from India and abroad. Materials and Methods: Fifty patients from rural area of Kolar at Sri R.L.J.H. and S.N.R. Hospital, presenting with clinically distinctive lesions of pitted keratolysis were included in the study. Cases were interviewed with particular emphasis on triggering factors and findings were recorded. Investigations like Gram′s stain, culture studies, Wood′s ultraviolet light examination, histopathology etc, was done in selected cases to ascertain the clinical diagnosis. Results: Age of the patients varied from 20 to 40 years in 52% with male preponderance in 82% of cases. Duration of the disease varied from 15 days to five years, most of the patients were bare-footed farmers (62% of cases. Hyperhidrosis and pruritus were most frequently observed symptoms in 70% and 60% of patients. Most of the patients presented with the characteristic pits which varied from 1 to 50 in number in 56 % of cases, located predominantly on the pressure bearing areas in 92% of cases and depth of the pits varied from 1 to 2 mm in 60% of cases. Associated skin conditions recorded in present study were fissuring of soles in 38%, psoriasis 10%, dermatophyte infections in 6%, planter warts 6% and Corynebacterial triad and corn in 2% of patients each. Discussion: Affection of bare-footed individuals, male preponderance, presence of hyperhidrosis and occurrence of lesions over pressure bearing areas of soles, observed in the present study were consistent with earlier studies on the subject. However, pruritus as commonest presenting symptom reported by 60% patients in the present study, has not been documented in the previous studies. Conclusion: Pitted keratolysis is fairly common in bare footed male farmers of rural India. The condition is predominantly seen over the
Directory of Open Access Journals (Sweden)
Sofia Blazevic
Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.
Zhao, Xin; Ciovati, G.; Bieler, T. R.
2010-12-01
The performance of superconducting radio-frequency (SRF) resonant cavities made of bulk niobium is limited by nonlinear localized effects. Surface analysis of regions of higher power dissipation is thus of intense interest. Such areas (referred to as “hotspots”) were identified in a large-grain single-cell cavity that had been buffered-chemical polished and dissected for examination by high resolution electron microscopy, electron backscattered diffraction microscopy (EBSD), and optical microscopy. Pits with clearly discernible crystal facets were observed in both “hotspot” and “coldspot” specimens. The pits were found in-grain, at bicrystal boundaries, and on tricrystal junctions. They are interpreted as etch pits induced by crystal defects (e.g. dislocations). All coldspots examined had a qualitatively lower density of etch pits or relatively smooth tricrystal boundary junctions. EBSD mapping revealed the crystal orientation surrounding the pits. Locations with high pit density are correlated with higher mean values of the local average misorientation angle distributions, indicating a higher geometrically necessary dislocation content. In addition, a survey of the samples by energy dispersive x-ray analysis did not show any significant contamination of the samples’ surface. The local magnetic field enhancement produced by the sharp-edge features observed on the samples is not sufficient to explain the observed degradation of the cavity quality factor, which starts at peak surface magnetic field as low as 20 mT.
Kicker for the SLC electron damping ring
International Nuclear Information System (INIS)
Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.
1987-01-01
The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see
Jussila, Kirsi; Rissanen, Sirkka; Aminoff, Anna; Wahlström, Jens; Vaktskjold, Arild; Talykova, Ljudmila; Remes, Jouko; Mänttäri, Satu; Rintamäki, Hannu
2017-12-07
Workers in the Arctic open-pit mines are exposed to harsh weather conditions. Employers are required to provide protective clothing for workers. This can be the outer layer, but sometimes also inner or middle layers are provided. This study aimed to determine how Arctic open-pit miners protect themselves against cold and the sufficiency, and the selection criteria of the garments. Workers' cold experiences and the clothing in four Arctic open-pit mines in Finland, Sweden, Norway and Russia were evaluated by a questionnaire (n=1,323). Basic thermal insulation (I cl ) of the reported clothing was estimated (ISO 9920). The I cl of clothing from the mines were also measured by thermal manikin (standing/walking) in 0.3 and 4.0 m/s wind. The questionnaire showed that the I cl of the selected clothing was on average 1.2 and 1.5 clo in mild (-5 to +5°C) and dry cold (-20 to -10°C) conditions, respectively. The I cl of the clothing measured by thermal manikin was 1.9-2.3 clo. The results show that the Arctic open-pit miners' selected their clothing based on occupational (time outdoors), environmental (temperature, wind, moisture) and individual factors (cold sensitivity, general health). However, the selected clothing was not sufficient to prevent cooling completely at ambient temperatures below -10°C.
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 227.1 Section 227.1 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT COMPUTING SUPPLEMENTAL ANNUITIES § 227.1 Introduction. This part explains how to compute a supplemental annuity. A supplemental...
Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming
2016-08-01
The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.
Directory of Open Access Journals (Sweden)
Xin Wen
Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.
Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter
2017-07-01
Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.
Hyde, Thomas M; Lipska, Barbara K; Ali, Towhid; Mathew, Shiny V; Law, Amanda J; Metitiri, Ochuko E; Straub, Richard E; Ye, Tianzhang; Colantuoni, Carlo; Herman, Mary M; Bigelow, Llewellyn B; Weinberger, Daniel R; Kleinman, Joel E
2011-07-27
GABA signaling molecules are critical for both human brain development and the pathophysiology of schizophrenia. We examined the expression of transcripts derived from three genes related to GABA signaling [GAD1 (GAD67 and GAD25), SLC12A2 (NKCC1), and SLC12A5 (KCC2)] in the prefrontal cortex (PFC) and hippocampal formation of a large cohort of nonpsychiatric control human brains (n = 240) across the lifespan (from fetal week 14 to 80 years) and in patients with schizophrenia (n = 30-31), using quantitative RT-PCR. We also examined whether a schizophrenia risk-associated promoter SNP in GAD1 (rs3749034) is related to expression of these transcripts. Our studies revealed that development and maturation of both the PFC and hippocampal formation are characterized by progressive switches in expression from GAD25 to GAD67 and from NKCC1 to KCC2. Previous studies have demonstrated that the former leads to GABA synthesis, and the latter leads to switching from excitatory to inhibitory neurotransmission. In the hippocampal formation, GAD25/GAD67 and NKCC1/KCC2 ratios are increased in patients with schizophrenia, reflecting a potentially immature GABA physiology. Remarkably, GAD25/GAD67 and NKCC1/KCC2 expression ratios are associated with rs3749034 genotype, with risk alleles again predicting a relatively less mature pattern. These findings suggest that abnormalities in GABA signaling critical to brain development contribute to genetic risk for schizophrenia.
Sonou, Tomohiro; Ohya, Masaki; Yashiro, Mitsuru; Masumoto, Asuka; Nakashima, Yuri; Ito, Teppei; Mima, Toru; Negi, Shigeo; Kimura-Suda, Hiromi; Shigematsu, Takashi
2017-06-01
Previous clinical and experimental studies have indicated that magnesium may prevent vascular calcification (VC), but mechanistic characterization has not been reported. This study investigated the influence of increasing magnesium concentrations on VC in a rat aortic tissue culture model. Aortic segments from male Sprague-Dawley rats were incubated in serum-supplemented high-phosphate medium for 10 days. The magnesium concentration in this medium was increased to demonstrate its role in preventing VC, which was assessed by imaging and spectroscopy. The mineral composition of the calcification was analyzed using Fourier transform infrared (FTIR) spectroscopic imaging, scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) mapping. Magnesium supplementation of high-phosphate medium dose-dependently suppressed VC (quantified as aortic calcium content), and almost ablated it at 2.4 mm magnesium. The FTIR images and SEM-EDX maps indicated that the distribution of phosphate (as hydroxyapatite), phosphorus and Mg corresponded with calcium content in the aortic ring and VC. The inhibitory effect of magnesium supplementation on VC was partially reduced by 2-aminoethoxy-diphenylborate, an inhibitor of TRPM7. Furthermore, phosphate transporter-1 (Pit-1) protein expression was increased in tissues cultured in HP medium and was gradually-and dose dependently-decreased by magnesium. We conclude that a mechanism involving TRPM7 and Pit-1 underpins the magnesium-mediated reversal of high-phosphate-associated VC.
A Bayesian approach to modeling and predicting pitting flaws in steam generator tubes
International Nuclear Information System (INIS)
Yuan, X.-X.; Mao, D.; Pandey, M.D.
2009-01-01
Steam generators in nuclear power plants have experienced varying degrees of under-deposit pitting corrosion. A probabilistic model to accurately predict pitting damage is necessary for effective life-cycle management of steam generators. This paper presents an advanced probabilistic model of pitting corrosion characterizing the inherent randomness of the pitting process and measurement uncertainties of the in-service inspection (ISI) data obtained from eddy current (EC) inspections. A Markov chain Monte Carlo simulation-based Bayesian method, enhanced by a data augmentation technique, is developed for estimating the model parameters. The proposed model is able to predict the actual pit number, the actual pit depth as well as the maximum pit depth, which is the main interest of the pitting corrosion model. The study also reveals the significance of inspection uncertainties in the modeling of pitting flaws using the ISI data: Without considering the probability-of-detection issues and measurement errors, the leakage risk resulted from the pitting corrosion would be under-estimated, despite the fact that the actual pit depth would usually be over-estimated.
Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing
2018-01-01
A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .
Precise system stabilization at SLC using dither techniques
International Nuclear Information System (INIS)
Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.
1993-01-01
A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation
46 CFR 167.20-1 - Construction.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Construction. 167.20-1 Section 167.20-1 Shipping COAST... Requirements, Construction and Arrangement of Nautical School Ships § 167.20-1 Construction. Except as otherwise provided by law or regulations in this subpart, the following standards for construction are...
Limitations of interaction-point spot-size tuning at the SLC
International Nuclear Information System (INIS)
Emma, P.; Hendrickson, L.J.; Zimmermann, F.; Raimondi, P.
1997-05-01
At the Stanford Linear Collider (SLC), the interaction-point spot size is minimized by repeatedly correcting, for both beams, various low-order optical aberrations, such as dispersion, waist position or coupling. These corrections are performed about every 8 hours, by minimizing the IP spot size while exciting different orthogonal combinations of final-focus magnets. The spot size itself is determined by measuring the beam deflection angle as a function of the beam-beam separation. Additional information is derived from the energy loss due to beamstrahlung and from luminosity-related signals. In the 1996 SLC run, the typical corrections were so large as to imply a 20-40% average luminosity loss due to residual uncompensated or fluctuating tunable aberrations. In this paper, the authors explore the origin of these large tuning corrections and study possible mitigations for the next SLC run
Gose, Tomoka; Nakanishi, Takeo; Kamo, Shunsuke; Shimada, Hiroaki; Otake, Katsumasa; Tamai, Ikumi
2016-01-01
Eicosapentaenoic acid (EPA)-derived prostaglandin E3 (PGE3) possesses an anti-inflammatory effect; however, information for transporters that regulate its peri-cellular concentration is limited. The present study, therefore, aimed to clarify transporters involved in local disposition of PGE3. PGE3 uptake was assessed in HEK293 cells transfected with OATP2A1/SLCO2A1, OATP1B1/SLCO1B1, OATP2B1/SLCO2B1, OAT1/SLC22A6, OCT1/SLC22A1 or OCT2/SLC22A2 genes, compared with HEK293 cells transfected with plasmid vector alone (Mock). PGE3 uptake by OATP2A1-expressing HEK293 cells (HEK/2A1) was the highest and followed by HEK/1B1, while no significantly higher uptake of PGE3 than Mock cells was detected by other transporters. Saturation kinetics in PGE3 uptake by HEK/2A1 estimated the Km as 7.202 ± 0.595 μM, which was 22 times higher than that of PGE2 (Km=0.331 ± 0.131 μM). Furthermore, tissue disposition of PGE3 was examined in wild-type (WT) and Slco2a1-deficient (Slco2a1(-/-)) mice after oral administration of EPA ethyl ester (EPA-E) when they underwent intraperitoneal injection of endotoxin (e.g., lipopolysaccharide). PGE3 concentration was significantly higher in the lung, and tended to increase in the colon, stomach, and kidney of Slco2a1(-/-), compared to WT mice. Ratio of PGE2 metabolite 15-keto PGE2 over PGE2 concentration was significantly lower in the lung and colon of Slco2a1(-/-) than that of WT mice, suggesting that PGE3 metabolism is downregulated in Slco2a1(-/-) mice. In conclusion, PGE3 was found to be a substrate of OATP2A1, and local disposition of PGE3 could be regulated by OATP2A1 at least in the lung. Copyright © 2015 Elsevier Inc. All rights reserved.
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 222.1 Section 222.1 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT FAMILY RELATIONSHIPS General § 222.1 Introduction. This part sets forth and describes the family relationships that may make a...
Pitting corrosion as a mixed system: coupled deterministic-probabilistic simulation of pit growth
Ibrahim, Israr B. M.; Fonna, S.; Pidaparti, R.
2018-05-01
Stochastic behavior of pitting corrosion poses a unique challenge in its computational analysis. However, it also stems from electrochemical activity causing general corrosion. In this paper, a framework for corrosion pit growth simulation based on the coupling of the Cellular Automaton (CA) and Boundary Element Methods (BEM) is presented. The framework assumes that pitting corrosion is controlled by electrochemical activity inside the pit cavity. The BEM provides the prediction of electrochemical activity given the geometrical data and polarization curves, while the CA is used to simulate the evolution of pit shapes based on electrochemical activity provided by BEM. To demonstrate the methodology, a sample case of local corrosion cells formed in pitting corrosion with varied dimensions and polarization functions is considered. Results show certain shapes tend to grow in certain types of environments. Some pit shapes appear to pose a higher risk by being potentially significant stress raisers or potentially increasing the rate of corrosion under the surface. Furthermore, these pits are comparable to commonly observed pit shapes in general corrosion environments.
Ng, Fu Liang; Boedtkjer, Ebbe; Witkowska, Kate; Ren, Meixia; Zhang, Ruoxin; Tucker, Arthur; Aalkj?r, Christian; Caulfield, Mark J.; Ye, Shu
2017-01-01
Abstract Genome-wide association studies have revealed an association between variation at the SLC4A7 locus and blood pressure. SLC4A7 encodes the electroneutral Na+/ HCO 3 ? co-transporter NBCn1 which regulates intracellular pH (pH i ). We conducted a functional study of variants at this locus in primary cultures of vascular smooth muscle and endothelial cells. In both cell types, we found genotype-dependent differences for rs13082711 in DNA-nuclear protein interactions, where the risk allel...
A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.
Caduff, M; Bauer, A; Jagannathan, V; Leeb, T
2017-10-01
Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.
Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao
2014-11-01
Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.
Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.
Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J
2017-07-01
To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.
Mistry, Divya; Wise, Roger P; Dickerson, Julie A
2017-01-01
Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 322.1 Section 322.1 Employees... § 322.1 Introduction. The Railroad Unemployment Insurance Act provides benefits for a qualified employee... payable or accrues to the employee for such day. In computing the amount of benefits payable to an...
Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F
2012-02-01
We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others
1995-12-10
The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.
A preliminary pit slope stability study Kvanefjeld, South Greenland
International Nuclear Information System (INIS)
Kalvig, P.
1983-11-01
On the basis of 1300 field measurements of joint planes, four individual structural regions have been outlined in the Kvanefjeld area. Potential failure planes and planes which are unlikely to be involved in slope failures are identified. Failures seem, not likely to occur on walls dipping SW or NE respectively, but may occur on walls dipping NM. The factors of safety for each region are calculated in order to determine the sensibility of the overall slope to different overall slope angles. The factors of safety does only exceed the required factor of safety of 1.5 in one of the structural regions. Changing the overall pit slope inclination from 55deg to 45deg improves the security, but even still not satisfactorily for two of the regions. At 45deg overall pit slope in parts of the pit implies additional 14.3 x 10 6 tonnes of non-mineralized material to be mined, thus resulting in a total mineralized- to non-mineralized material ratio about 1.0: 1.7. (author)
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Modelling assessment of oil sands pit lakes turn-over potential
International Nuclear Information System (INIS)
Mackenzie, I.; Vandenberg, J.; Lauzon, N.; Takyi, A.
2006-01-01
Pit lakes form when surface mining operations are discontinued and dewatering is terminated. Their use as a treatment step for oil sands surface mining reclamation waters was discussed. The goal of the End Pit Lake Subgroup of the Cumulative Environmental Management Association is to establish guidelines that will enable operators to achieve acceptable water quality for these lakes. Although both biological and physical processes affect turn-over potential, this presentation focused on the size of pit lakes, their depth, starting lake salinity concentrations, inflow rates and inflow salinity flux. These parameters where selected because of their influence on density gradients and turn-over potential. One-dimensional and two-dimensional modelling simulations were performed to examine turnover potential for a large range of pit lake configurations and conditions. The pit lake scenarios chosen for this modelling study included a wide range of changes in 3 lake sizes (1, 4 and 8 km 2 ), 3 lake depths (5, 20 and 50 m), 2 lake starting salinities (1 and 5 parts per thousand), 2 inflow rates (2 and 10 million m 3 per year), 3 starting inflow salinity concentrations (1, 2 and 4 parts per thousand) and 2 rates of influent salinity decrease (6- and 28- year half-life). Simulations showed that autumn is the governing season for determining turn-over potential. For the scenarios examined in this study, the expelling of salt from saline water upon ice formation and the effect of fresh water loading during spring melt events were not found to be significant factors governing turn-over potential. This presentation reviewed the DYRESM, CE-QUAL-W2, and RMA models used in this study. The conclusions reached by each model was also reviewed along with ongoing follow-up work
Isochronous 180 degree turns for the SLC positron system
International Nuclear Information System (INIS)
Helm, R.H.; Clendenin, J.E.; Ecklund, S.D.; Kulikov, A.V.; Pitthan, R.
1991-05-01
The design of the compact, achromatic, second order isochronous 180 degrees turn for the SLC positron transport system will be described. Design criteria require an energy range of 200±20 MeV, energy acceptance of ±5%, transverse admittance of 25π mm-mr, and minimal lengthening of the 3 to 4 mm (rms) positron bunch. The devices had to fit within a maximum height or width of about 10 ft. Optics specifications and theoretical performance are presented and compared to experimental results based on streak camera measurements of bunch length immediately after the first isochronous turn (200 MeV) and positron beam energy spread after S-band acceleration to 1.15 GeV. 5 refs., 7 figs
2010-04-01
... 270 of this chapter). The Board is responsible for making this decision. ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 221.1 Section 221.1 Employees... Security Administration or the Railroad Retirement Board will pay benefits to a railroad employee, and his...
Directory of Open Access Journals (Sweden)
Xin Zhao
2010-12-01
Full Text Available The performance of superconducting radio-frequency (SRF resonant cavities made of bulk niobium is limited by nonlinear localized effects. Surface analysis of regions of higher power dissipation is thus of intense interest. Such areas (referred to as “hotspots” were identified in a large-grain single-cell cavity that had been buffered-chemical polished and dissected for examination by high resolution electron microscopy, electron backscattered diffraction microscopy (EBSD, and optical microscopy. Pits with clearly discernible crystal facets were observed in both “hotspot” and “coldspot” specimens. The pits were found in-grain, at bicrystal boundaries, and on tricrystal junctions. They are interpreted as etch pits induced by crystal defects (e.g. dislocations. All coldspots examined had a qualitatively lower density of etch pits or relatively smooth tricrystal boundary junctions. EBSD mapping revealed the crystal orientation surrounding the pits. Locations with high pit density are correlated with higher mean values of the local average misorientation angle distributions, indicating a higher geometrically necessary dislocation content. In addition, a survey of the samples by energy dispersive x-ray analysis did not show any significant contamination of the samples’ surface. The local magnetic field enhancement produced by the sharp-edge features observed on the samples is not sufficient to explain the observed degradation of the cavity quality factor, which starts at peak surface magnetic field as low as 20 mT.
Congenital hypopituitarism due to POU1F1 gene mutation.
Lee, Ni-Chung; Tsai, Wen-Yu; Peng, Shinn-Forng; Tung, Yi-Ching; Chien, Yin-Hsiu; Hwu, Wuh-Liang
2011-01-01
POU1F1 (Pit-1; Gene ID 5449) is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome), elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S) mutation. The rarity of the disease can result in delayed diagnosis and treatment. Copyright © 2011 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cassandro Vidal Talamini do Amarante
2009-12-01
Full Text Available O "bitter pit" é considerado um dos principais distúrbios fisiológicos pós-colheita que ocorrem em maçãs. A análise nutricional dos frutos (concentrações de Ca, Mg, K e N, normalmente utilizada na avaliação do risco de ocorrência de "bitter pit", apresenta custo elevado e tem-se mostrado pouco eficiente para este fim. Isto tem estimulado o desenvolvimento de métodos alternativos para a predição em pré-colheita do risco de ocorrência pós-colheita de "bitter pit". Este trabalho foi conduzido com o objetivo de avaliar a viabilidade de utilização do método de infiltração de maçãs 'Gala'com magnésio (Mg, na predição do risco de ocorrência de "bitter pit" durante o armazenamento refrigerado. Em adição a isto, os valores de Ca na casca e na polpa (mg kg-1 de peso fresco, relacionados aos diferentes níveis de severidade e incidência de "bitter pit", em frutos infiltrados com Mg ou armazenados em câmara fria, foram representados graficamente, com o objetivo de predizer o risco de "bitter pit" com base nas concentrações de Ca. Os frutos foram colhidos em pomar com histórico de elevada incidência de "bitter pit", em Lages (SC, na safra 2003/2004, de 20 plantas previamente marcadas aleatoriamente. Os frutos utilizados para a infiltração (30 frutos por planta foram colhidos 20 dias antes da maturação comercial, enquanto os frutos armazenados em câmaras frigoríficas (100 frutos por planta foram colhidos na maturação comercial. Os valores de Ca nos frutos, acima dos quais houve baixo risco de ocorrência de "bitter pit", foram similares entre frutos infiltrados e não infiltrados com Mg, correspondendo a 55 e 192 mg kg-1, na polpa e na casca, respectivamente. A concentração de Ca quantificada no tecido da casca mostrou-se melhor indicador do risco de "bitter pit" em relação ao tecido da polpa. Os dados obtidos demonstram que o método de infiltração com Mg representa uma alternativa viável visando a avaliar
2010-04-01
... illness or injury. With respect to a female employee, a “day of sickness” also includes any calendar day... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false General. 335.1 Section 335.1 Employees... payment of sickness benefits to a qualified railroad employee for days of sickness within a period of...
Installation Restoration Program, Phase 1. Records Search, Wheeler Air Force Base, Oahu, Hawaii
1983-07-01
the 3vegetation was already exotic, consisting of trees such as guava , koa haole, eucalyptus and silver oak, and shrubs and 3 grasses including lantana...Alkalioo Soap 5 gal GrounOd S~r Of f Base Fire Pit fir.Pit Of f Base PmecI" CoCAClo 20$ P 680 1S Sa.L Cro-..d tAint 10-20 gal 8w L..dt±u Off km. Thinmar
Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.
Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay
2017-07-05
Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Definitions. 501.1 Section 501.1 Employees' Benefits EMPLOYEES' COMPENSATION APPEALS BOARD, DEPARTMENT OF LABOR RULES OF PROCEDURE § 501.1 Definitions. (a) FECA means the Federal Employees' Compensation Act, 5 U.S.C. 8101 et seq. and any statutory...
Spontaneous Resolution of Optic Disc Pit Maculopathy
Directory of Open Access Journals (Sweden)
Koushik Tripathy
2017-06-01
Full Text Available I read with interest the article reporting spontaneous resolution of optic disc pit maculopathy in a boy.1 Though the presence of an optic disc pit and associated macular involvement is undoubted in the presented case, the provided optical coherence tomography (OCT does not clearly show typical intraretinal schisis (Figure 1B1 at multiple retinal levels which may communicate with the pit. Instead, it shows a sub-internal limiting membrane (sub-ILM cavity. Such cavities are known to occur following the resolution of sub-ILM bleed due to various cause including Valsalva retinopathy,2 Terson syndrome, and also in some retinitis3 cases.4 In fact, some of these cavities may simulate a neurosensory retinal detachment or central serous chorioretinopathy on cursory clinical examination.5 To confirm that the features of the current patient1 are indeed related to the optic disc pit, it is necessary for the authors to provide an OCT scan which shows a connection of the presented cavity with the optic disc pit. Also, clear OCT scans of the fovea, both at presentation and at final follow-up would help our understanding of the visual recovery of the patient. The interval between the presenting (28 June 2012 OCT and final OCT (30 Nov 2012 is 5 months and not 6 months as described in the manuscript. For an effective comparison, both the presenting and final OCT scans should have been taken using either horizontal or vertical orientation over the macula. Though the spontaneous resolution of optic disc pit maculopathy is possible, visual recovery in usually unlikely and in such cases an alternate diagnosis needs to be excluded.
Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families
Directory of Open Access Journals (Sweden)
Hemant Kulkarni
2016-01-01
Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.
International Nuclear Information System (INIS)
Lee, C.P.; Chen, Y.Y.; Hsu, C.Y.; Yeh, J.W.; Shih, H.C.
2008-01-01
High-entropy alloys are a newly developed family of multi-component alloys that comprise various major alloying elements. Each element in the alloy system is present in between 5 and 35 at.%. The crystal structures and physical properties of high-entropy alloys differ completely from those of conventional alloys. The electrochemical impedance spectra (EIS) of the Al x CrFe 1.5 MnNi 0.5 (x = 0, 0.3, 0.5) alloys, obtained in 0.1 M HCl solution, clearly revealed that the corrosion resistance values were determined to increase from 21 to 34 Ωcm 2 as the aluminum content increased from 0 to 0.5 mol, and were markedly lower than that of 304 stainless steel (243 Ωcm 2 ). At passive potential, the corresponding current declined with the anodizing time accounting, causing passivity by the growth of the multi-component anodized film in H 2 SO 4 solution. X-ray photoelectron spectroscopy (XPS) analyses revealed that the surface of anodized Al 0.3 CrFe 1.5 MnNi 0.5 alloy formed aluminum and chromium oxide film which was the main passivating compound on the alloy. This anodic treatment increased the corrosion resistance in the EIS measurements of the CrFe 1.5 MnNi 0.5 and Al 0.3 CrFe 1.5 MnNi 0.5 alloys by two orders of magnitude. Accordingly, the anodic treatment of the Al x CrFe 1.5 MnNi 0.5 alloys optimized their surface structures and minimized their susceptibility to pitting corrosion
Lu, Shiyou
2011-09-23
A novel mutant of Arabidopsis (Arabidopsis thaliana), having highly glossy inflorescence stems, postgenital fusion in floral organs, and reduced fertility, was isolated from an ethyl methanesulfonate-mutagenized population and designated glossyhead1 (gsd1). The gsd1 locus was mapped to chromosome 1, and the causal gene was identified as a new allele of Acetyl-Coenzyme A Carboxylase1 (ACC1), a gene encoding the main enzyme in cytosolic malonyl-coenzyme A synthesis. This, to our knowledge, is the first mutant allele of ACC1 that does not cause lethality at the seed or early germination stage, allowing for the first time a detailed analysis of ACC1 function in mature tissues. Broad lipid profiling of mature gsd1 organs revealed a primary role for ACC1 in the biosynthesis of the very-long-chain fatty acids (C 20:0 or longer) associated with cuticular waxes and triacylglycerols. Unexpectedly, transcriptome analysis revealed that gsd1 has limited impact on any lipid metabolic networks but instead has a large effect on environmental stress-responsive pathways, especially senescence and ethylene synthesis determinants, indicating a possible role for the cytosolic malonyl-coenzyme A-derived lipids in stress response signaling. © 2011 American Society of Plant Biologists. All Rights Reserved.
SLC polarized beam source electron optics design
International Nuclear Information System (INIS)
Eppley, K.R.; Lavine, T.L.; Early, R.A.; Herrmannsfeldt, W.B.; Miller, R.H.; Schultz, D.C.; Spencer, C.M.; Yeremian, A.D.
1991-05-01
This paper describes the design of the beam-line from the polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photocathode is illuminated by 3-nsec-long laser pulses. The quality of the optics for the 160-kV beam is crucial since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line consists of a differential pumping region isolated by a pair of valves. Focusing is provided by a pair of Helmholtz coils and by several iron-encased solenoidal lenses. Our optics design is based on beam transport simulations using 2 1/2-D particle-in-cell codes to model the gun and to solve the fully-relativistic time-dependent equations of motion in three dimensions for electrons in the presence of azimuthally symmetric electromagnetic fields. 6 refs., 6 figs
Impact of histone H4 lysine 20 methylation on 53BP1 responses to chromosomal double strand breaks.
Directory of Open Access Journals (Sweden)
Andrea J Hartlerode
Full Text Available Recruitment of 53BP1 to chromatin flanking double strand breaks (DSBs requires γH2AX/MDC1/RNF8-dependent ubiquitination of chromatin and interaction of 53BP1 with histone H4 methylated on lysine 20 (H4K20me. Several histone methyltransferases have been implicated in 53BP1 recruitment, but their quantitative contributions to the 53BP1 response are unclear. We have developed a multi-photon laser (MPL system to target DSBs to subfemtoliter nuclear volumes and used this to mathematically model DSB response kinetics of MDC1 and of 53BP1. In contrast to MDC1, which revealed first order kinetics, the 53BP1 MPL-DSB response is best fitted by a Gompertz growth function. The 53BP1 MPL response shows the expected dependency on MDC1 and RNF8. We determined the impact of altered H4K20 methylation on 53BP1 MPL response kinetics in mouse embryonic fibroblasts (MEFs lacking key H4K20 histone methyltransferases. This revealed no major requirement for the known H4K20 dimethylases Suv4-20h1 and Suv4-20h2 in 53BP1 recruitment or DSB repair function, but a key role for the H4K20 monomethylase, PR-SET7. The histone methyltransferase MMSET/WHSC1 has recently been implicated in 53BP1 DSB recruitment. We found that WHSC1 homozygous mutant MEFs reveal an alteration in balance of H4K20 methylation patterns; however, 53BP1 DSB responses in these cells appear normal.
Directory of Open Access Journals (Sweden)
Mauro José Lahm Cardoso
2013-10-01
Full Text Available Electrocardiography (ECG is an essential examination for evaluation of patient with heart disease is great importance the diagnosis of arrhythmias. The examination can determine source f rhythm and frequency depolarization heart, providing information in clinical status myocardium, since deflections P-QRS-T tracing can be altered by disease or physiological factor. With advancement of computer technology, computerized electrocardiography has been used in human medicine as auxiliary diagnostic method and currently is being increasingly used in veterinary medicine. The objectives this study were to study e computerized electrocardiographic parameters in dogs breed American Pit Bull Terrier, comparing them with patterns species. In present study, we evaluated electrocardiographic examinations 42 dogs the breed American Pit Bull clinically healthy, 22 males and 20 females, aged between 1 and 6 years. Sinus rhythm was observed in 57% of dogs showed sinus rhythm and only 26% were wandering pacemaker. The electrocardiographic values obtained from these dogs computerized ECG were within the normal range of species, except the duration of the P wave which had longer than 0.04 seconds in 24% of dogs. We conclude that the dogs of the breed American Pit Bull Terrier have the same electrocardiographic values obtained in other breeds by the computerized method, except for the increase in P-wave duration. A eletrocardiografia (ECG é um exame essencial para avaliação do paciente com doença cardíaca, sendo de grande importância para o diagnóstico das arritmias. O exame pode determinar a origem do ritmo e a freqüência de despolarização do coração, fornecendo informações do estado clínico do miocárdio, uma vez que as deflexões P-QRS-T do traçado podem ser alteradas por uma enfermidade ou fator fisiológico. Com o avanço da informática, a eletrocardiografia computadorizada tem sido utilizada na medicina humana e veterinária como método de
Newall Glacier Snow Pit and Ice Core, 1987 to 1989, Version 1
National Aeronautics and Space Administration — Snow pit and ice core data from the Newall Glacier (location - 162 30' East, 77 35' South) were collected during 1987 and 1988. These include information on...
Meta-Analysis Reveals Significant Association of the 3'-UTR VNTR in SLC6A3 with Alcohol Dependence.
Ma, Yunlong; Fan, Rongli; Li, Ming D
2016-07-01
Although many studies have analyzed the association of 3'-untranslated region variable-number tandem repeat (VNTR) polymorphism in SLC6A3 with alcohol dependence (AD), the results remain controversial. This study aimed to determine whether this variant indeed has any genetic effect on AD by integrating 17 reported studies with 5,929 participants included. The A9-dominant genetic model that considers A9-repeat and non-A9 repeat as 2 genotypes and compared their frequencies in alcoholics with that in controls was adopted. Considering the potential influence of ethnicity, differences in diagnostic criteria of AD, and alcoholic subgroups, stratified meta-analyses were conducted. There existed no evidence for the presence of heterogeneity among the studied samples, indicating the results under the fixed-effects model are acceptable. We found a significant association of VNTR A9 genotypes with AD in all ethnic populations (pooled odds ratio [OR] 1.12; 95% confidence interval [CI] 1.00, 1.25; p = 0.045) and the Caucasian population (pooled OR 1.15; 95% CI 1.01, 1.31; p = 0.036). We also found VNTR A9 genotypes to be significantly associated with alcoholism as defined by the DSM-IV criteria (pooled OR 1.18; 95% CI 1.03, 1.36; p = 0.02). Further, we found a significant association between VNTR A9 genotypes and alcoholism associated with alcohol withdrawal seizure or delirium tremens (pooled OR 1.55; 95% CI 1.24, 1.92; p = 1.0 × 10(-4) ). In all these meta-analyses, no evidence of publication bias was detected. We concluded that the VNTR polymorphism has an important role in the etiology of AD, and individuals with at least 1 A9 allele are more likely to be dependent on alcohol than persons carrying the non-A9 allele. Copyright © 2016 by the Research Society on Alcoholism.
46 CFR 61.20-1 - Steering gear.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Steering gear. 61.20-1 Section 61.20-1 Shipping COAST... Periodic Tests of Machinery and Equipment § 61.20-1 Steering gear. (a) The marine inspector must inspect the steering gear at each inspection for certification for vessels whose Certificate of Inspections...
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 226.1 Section 226.1 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT COMPUTING EMPLOYEE, SPOUSE, AND DIVORCED SPOUSE ANNUITIES General § 226.1 Introduction. This part explains how employee, spouse...
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-01-01
This Corrective Action Investigation Plan (CAIP) contains a detailed description and plan for an environmental investigation of the Area 2 Photo Skid 16 Wastewater Pit. The site is located in Area 2 of the Nevada Test Site. The Photo Skid Wastewater Pit was used for disposal of photochemical process waste, and there is a concern that such disposal may have released photochemicals and metals to the soil beneath the pit and adjacent to it. The purpose of this investigation is to identify the presence and nature of contamination present in and adjacent to the wastewater pit and to determine the appropriate course of environmental response action for the site. The potential courses of action for the site are clean closure through remediation, closure in place (with or without remediation), or no further action.
Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G
2011-02-01
We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Valor, A.; Caleyo, F.; Alfonso, L.; Rivas, D.; Hallen, J.M.
2007-01-01
In this work, a new stochastic model capable of simulating pitting corrosion is developed and validated. Pitting corrosion is modeled as the combination of two stochastic processes: pit initiation and pit growth. Pit generation is modeled as a nonhomogeneous Poisson process, in which induction time for pit initiation is simulated as the realization of a Weibull process. In this way, the exponential and Weibull distributions can be considered as the possible distributions for pit initiation time. Pit growth is simulated using a nonhomogeneous Markov process. Extreme value statistics is used to find the distribution of maximum pit depths resulting from the combination of the initiation and growth processes for multiple pits. The proposed model is validated using several published experiments on pitting corrosion. It is capable of reproducing the experimental observations with higher quality than the stochastic models available in the literature for pitting corrosion
Energy Technology Data Exchange (ETDEWEB)
Valor, A. [Facultad de Fisica, Universidad de La Habana, San Lazaro y L, Vedado, 10400 Havana (Cuba); Caleyo, F. [Departamento de Ingenieria, Metalurgica, IPN-ESIQIE, UPALM Edif. 7, Zacatenco, Mexico DF 07738 (Mexico)]. E-mail: fcaleyo@gmail.com; Alfonso, L. [Departamento de Ingenieria, Metalurgica, IPN-ESIQIE, UPALM Edif. 7, Zacatenco, Mexico DF 07738 (Mexico); Rivas, D. [Departamento de Ingenieria, Metalurgica, IPN-ESIQIE, UPALM Edif. 7, Zacatenco, Mexico DF 07738 (Mexico); Hallen, J.M. [Departamento de Ingenieria, Metalurgica, IPN-ESIQIE, UPALM Edif. 7, Zacatenco, Mexico DF 07738 (Mexico)
2007-02-15
In this work, a new stochastic model capable of simulating pitting corrosion is developed and validated. Pitting corrosion is modeled as the combination of two stochastic processes: pit initiation and pit growth. Pit generation is modeled as a nonhomogeneous Poisson process, in which induction time for pit initiation is simulated as the realization of a Weibull process. In this way, the exponential and Weibull distributions can be considered as the possible distributions for pit initiation time. Pit growth is simulated using a nonhomogeneous Markov process. Extreme value statistics is used to find the distribution of maximum pit depths resulting from the combination of the initiation and growth processes for multiple pits. The proposed model is validated using several published experiments on pitting corrosion. It is capable of reproducing the experimental observations with higher quality than the stochastic models available in the literature for pitting corrosion.
Near infrared photoimmunotherapy with avelumab, an anti-programmed death-ligand 1 (PD-L1) antibody.
Nagaya, Tadanobu; Nakamura, Yuko; Sato, Kazuhide; Harada, Toshiko; Choyke, Peter L; Hodge, James W; Schlom, Jeffrey; Kobayashi, Hisataka
2017-01-31
Near Infrared-Photoimmunotherapy (NIR-PIT) is a highly selective tumor treatment that employs an antibody-photo-absorber conjugate (APC). Programmed cell death protein-1 ligand (PD-L1) is emerging as a molecular target. Here, we describe the efficacy of NIR-PIT, using fully human IgG1 anti-PD-L1 monoclonal antibody (mAb), avelumab, conjugated to the photo-absorber, IR700DX, in a PD-L1 expressing H441 cell line, papillary adenocarcinoma of lung. Avelumab-IR700 showed specific binding and cell-specific killing was observed after exposure of the cells to NIR in vitro. In the in vivo study, avelumab-IR700 showed high tumor accumulation and high tumor-background ratio. Tumor-bearing mice were separated into 4 groups: (1) no treatment; (2) 100 μg of avelumab-IR700 i.v.; (3) NIR light exposure only, NIR light was administered; (4) 100 μg of avelumab-IR700 i.v., NIR light was administered. Tumor growth was significantly inhibited by NIR-PIT treatment compared with the other groups (p avelumab, is suitable as an APC for NIR-PIT. Furthermore, NIR-PIT with avelumab-IR700 is a promising candidate of the treatment of PD-L1-expressing tumors that could be readily translated to humans.
Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters
Directory of Open Access Journals (Sweden)
Markus Grube
2018-04-01
Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.
Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.
Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David
2014-04-01
Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 225.1 Section 225.1 Employees... DETERMINATIONS General § 225.1 Introduction. This part discusses Primary Insurance Amount, which is referred to... types of earnings. However, the formulas for computing any PIA are prescribed in section 215 of the...
Directory of Open Access Journals (Sweden)
Thomas F Gallegos
Full Text Available Proper physiological function in the pre- and post-natal proximal tubule of the kidney depends upon the acquisition of selective permeability, apical-basolateral epithelial polarity and the expression of key transporters, including those involved in metabolite, toxin and drug handling. Particularly important are the SLC22 family of transporters, including the organic anion transporters Oat1 (originally identified as NKT and Oat3 as well as the organic cation transporter Oct1. In ex vivo cultures of metanephric mesenchyme (MM; the embryonic progenitor tissue of the nephron Oat function was evident before completion of nephron segmentation and corresponded with the maturation of tight junctions as measured biochemically by detergent extractability of the tight junction protein, ZO-1. Examination of available time series microarray data sets in the context of development and differentiation of the proximal tubule (derived from both in vivo and in vitro/ex vivo developing nephrons allowed for correlation of gene expression data to biochemically and functionally defined states of development. This bioinformatic analysis yielded a network of genes with connectivity biased toward Hnf4α (but including Hnf1α, hyaluronic acid-CD44, and notch pathways. Intriguingly, the Oat1 and Oat3 genes were found to have strong temporal co-expression with Hnf4α in the cultured MM supporting the notion of some connection between the transporters and this transcription factor. Taken together with the ChIP-qPCR finding that Hnf4α occupies Oat1, Oat3, and Oct1 proximal promoters in the in vivo differentiating rat kidney, the data suggest a network of genes with Hnf4α at its center plays a role in regulating the terminal differentiation and capacity for drug and toxin handling by the nascent proximal tubule of the kidney.
Inspecting a research reactor's control rod surface for pitting using a machine vision
International Nuclear Information System (INIS)
Tokuhiro, Akira T.; Vadakattu, Shreekanth
2005-01-01
Inspection for pits on the control rod is performed to study the degradation of the control rod material which helps estimating the service life of the control rod at UMR nuclear reactor (UMRR). This inspection task is visually inspected and recorded subjectively. The conventional visual inspection to identify pits on the control rod surface can be automated using machine vision technique. Since the in-service control rods were not available to capture images and measure number of pits and size of the pits, the applicability of machine vision method was applied on SAE 1018 steel coupons immersed in oxygen saturated de-ionized water at 30deg, 50deg and 70deg. Images were captured after each test cycle at different light intensity to reveal surface topography of the coupon surface and analyzed for number of pits and pit size using EPIX XCAP-Std software. The captured and analyzed images provided quantitative results for the steel coupons and demonstrated that the method can be applied for identifying pits on control rod surface in place of conventional visual inspection. (author)
Daniels, Geoff; Ballif, Bryan A; Helias, Virginie; Saison, Carole; Grimsley, Shane; Mannessier, Lucienne; Hustinx, Hein; Lee, Edmond; Cartron, Jean-Pierre; Peyrard, Thierry; Arnaud, Lionel
2015-06-04
The Augustine-negative alias At(a-) blood type, which seems to be restricted to people of African ancestry, was identified half a century ago but remains one of the last blood types with no known genetic basis. Here we report that a nonsynonymous single nucleotide polymorphism in SLC29A1 (rs45458701) is responsible for the At(a-) blood type. The resulting p.Glu391Lys variation in the last extracellular loop of the equilibrative nucleoside transporter 1 (ENT1; also called SLC29a1) is known not to alter its ability to transport nucleosides and nucleoside analog drugs. Furthermore, we identified 3 individuals of European ancestry who are homozygous for a null mutation in SLC29A1 (c.589+1G>C) and thus have the Augustine-null blood type. These individuals lacking ENT1 exhibit periarticular and ectopic mineralization, which confirms an important role for ENT1/SLC29A1 in human bone homeostasis as recently suggested by the skeletal phenotype of aging Slc29a1(-/-) mice. Our results establish Augustine as a new blood group system and place SLC29A1 as a new candidate gene for idiopathic disorders characterized with ectopic calcification/mineralization. © 2015 by The American Society of Hematology.
Directory of Open Access Journals (Sweden)
Maura Mack
2017-08-01
Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.
Herniation pits of the femur neck: incidence and radiologic findings
International Nuclear Information System (INIS)
Cho, Jae Hyun; Suh, Jin Suk; Lee, Hye Yeon
1994-01-01
In order to assess the incidence and radiologic findings of herniation pit of the femur neck in Korean. In 152 macerated femurs of 88 cadavers, and randomly selected 115 hips of 70 patients, the presence of herniation pit was determined by using fluoroscopy and radiography. It was then examined by CT for inspection of overlying surface and its opening was confirmed by inserting thin steal wire under the fluoroscopic guidance. Seventeen herniation pits in 15 macerated femurs of 13 cadavers were noted. (14.8%, 13/88). Two of 13 individuals showed bilaterality. All lesions were found only in males. Six herniation pit in 6 femurs of 6 patients (8.6%, 6/70) were also noted. All lesions were on anterosuperior aspect of femur neck. Plain radiographs of macerated femurs revealed well marginated and thin sclerosis in 15 lesions. Of all 23 lesions, CT showed cortical breakdown in 3, and overlying cortical thickening in 8. In 15 macerated femurs, roughed area of cortex was found in anterosuperior aspect of femur in all cases, and tiny openings(diameter less than 1 mm) related to cystic lesions were confirmed in 9 lesions. The incidence of herniation pits was 14.8% in 88 cadaver, and 8.6% in 70 patients. All were males
Directory of Open Access Journals (Sweden)
Joseph Andronic
Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.
Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia
2015-01-01
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neu...
2005-01-01
24 September 2005 This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows collapse pits and troughs on the lower northeast flank of the giant martian volcano, Ascraeus Mons. Layers of volcanic rock are evident in some of the pit and valley walls, and boulders the size of houses and trucks that were liberated from these walls by gravity can be seen on the floors of the depressions. Location near: 13.6oN, 102.6oW Image width: width: 3 km (1.9 mi) Illumination from: lower left Season: Northern Autumn
The origin of pits on 9P/Tempel 1 and the geologic signature of outbursts in Stardust-NExT images
Belton, Michael J. S.; Thomas, Peter; Carcich, Brian; Quick, Andrew; Veverka, Joseph; Jay Melosh, H.; A'Hearn, Michael F.; Li, Jian-Yang; Brownlee, Donald; Schultz, Peter; Klaasen, Kenneth; Sarid, Gal
2013-02-01
We consider the origin of ˜380 quasi-circular depressions (pits) seen to be distributed in a broad band across the surface of 9P/Tempel 1 and show that possibly ˜96% may be due to outburst activity. Of the rest, Lisse, C.M., Holloway, M., Rho, J. [2010]. Icarus 208, 276-292) based on IR observations of 17P.
Directory of Open Access Journals (Sweden)
Olha Hurba
Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu
2011-09-30
Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and
Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis.
Chang, Ling-Chu; Chiang, Shih-Kai; Chen, Shuen-Ei; Yu, Yung-Luen; Chou, Ruey-Hwang; Chang, Wei-Chao
2018-03-01
Ferroptosis is a form of oxidative cell death and has become a chemotherapeutic target for cancer treatment. BAY 11-7085 (BAY), which is a well-known IκBα inhibitor, suppressed viability in cancer cells via induction of ferroptotic death in an NF-κB-independent manner. Reactive oxygen species scavenging, relief of lipid peroxidation, replenishment of glutathione and thiol-containing agents, as well as iron chelation, rescued BAY-induced cell death. BAY upregulated a variety of Nrf2 target genes related to redox regulation, particularly heme oxygenase-1 (HO-1). Studies with specific inhibitors and shRNA interventions suggested that the hierarchy of induction is Nrf2-SLC7A11-HO-1. SLC7A11 inhibition by erastin, sulfasalazine, or shRNA interference sensitizes BAY-induced cell death. Overexperession of SLC7A11 attenuated BAY-inhibited cell viability. The ferroptotic process induced by hHO-1 overexpression further indicated that HO-1 is a key mediator of BAY-induced ferroptosis that operates through cellular redox regulation and iron accumulation. BAY causes compartmentalization of HO-1 into the nucleus and mitochondrion, and followed mitochondrial dysfunctions, leading to lysosome targeting for mitophagy. In this study, we first discovered that BAY induced ferroptosis via Nrf2-SLC7A11-HO-1 pathway and HO-1 is a key mediator by responding to the cellular redox status. Copyright © 2017 Elsevier B.V. All rights reserved.
2010-04-01
... Annuity), 234 (Lump-Sum Payments), and 222 (Family Relationships), certain requirements must be met before... used as evidence. Part 222 defines and explains family relationships for which evidence requirements... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 219.1 Section 219.1 Employees...
Skaat, Alon; Moroz, Iris; Moisseiev, Joseph
2013-01-01
To describe the different optical coherence tomography (OCT) patterns in macular detachment associated with an optic disc pit and their long-term evolution following vitrectomy. The data of 5 patients (9-43 years of age) with unilateral macular detachment associated with an optic disc pit, who had at least 1 year of follow-up, were compiled. Pars plana vitrectomy combined with gas tamponade was performed as the primary procedure in all patients. The OCT scans, best-corrected visual acuity (BCVA), and anatomic outcomes were documented. Two main OCT patterns were identified: a multilayer schisis pattern and a serous detachment pattern. Patients with multilayer schisis pattern were older and demonstrated worse mean preoperative (20/160) and postoperative (20/50) BCVA compared to serous detachment pattern patients (20/30 and 20/20, respectively). An average of 2.3 procedures per patient was needed in the multilayer schisis pattern compared to just one procedure in the serous detachment pattern. In 3 patients, additional pneumatic retinopexy was performed with full resolution of the subretinal fluid achieved. Two distinct OCT patterns were observed in eyes with macular detachments with an optic pit, with different clinical features and prognoses. Excellent final visual acuity was obtained in all eyes, including those that required several surgical procedures.
Directory of Open Access Journals (Sweden)
Toshiyuki Fukada
Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.
Genetic heterogeneity in patients with Bartter syndrome type 1.
Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo
2017-02-01
Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.
Detecting pits in tart cherries by hyperspectral transmission imaging
Qin, Jianwei; Lu, Renfu
2004-11-01
The presence of pits in processed cherry products causes safety concerns for consumers and imposes potential liability for the food industry. The objective of this research was to investigate a hyperspectral transmission imaging technique for detecting the pit in tart cherries. A hyperspectral imaging system was used to acquire transmission images from individual cherry fruit for four orientations before and after pits were removed over the spectral region between 450 nm and 1,000 nm. Cherries of three size groups (small, intermediate, and large), each with two color classes (light red and dark red) were used for determining the effect of fruit orientation, size, and color on the pit detection accuracy. Additional cherries were studied for the effect of defect (i.e., bruises) on the pit detection. Computer algorithms were developed using the neural network (NN) method to classify the cherries with and without the pit. Two types of data inputs, i.e., single spectra and selected regions of interest (ROIs), were compared. The spectral region between 690 nm and 850 nm was most appropriate for cherry pit detection. The NN with inputs of ROIs achieved higher pit detection rates ranging from 90.6% to 100%, with the average correct rate of 98.4%. Fruit orientation and color had a small effect (less than 1%) on pit detection. Fruit size and defect affected pit detection and their effect could be minimized by training the NN with properly selected cherry samples.
Separation of the 1+ /1- parity doublet in 20Ne
Beller, J.; Stumpf, C.; Scheck, M.; Pietralla, N.; Deleanu, D.; Filipescu, D. M.; Glodariu, T.; Haxton, W.; Idini, A.; Kelley, J. H.; Kwan, E.; Martinez-Pinedo, G.; Raut, R.; Romig, C.; Roth, R.; Rusev, G.; Savran, D.; Tonchev, A. P.; Tornow, W.; Wagner, J.; Weller, H. R.; Zamfir, N.-V.; Zweidinger, M.
2015-02-01
The (J , T) = (1 , 1) parity doublet in 20Ne at 11.26 MeV is a good candidate to study parity violation in nuclei. However, its energy splitting is known with insufficient accuracy for quantitative estimates of parity violating effects. To improve on this unsatisfactory situation, nuclear resonance fluorescence experiments using linearly and circularly polarized γ-ray beams were used to determine the energy difference of the parity doublet ΔE = E (1-) - E (1+) = - 3.2(± 0.7) stat(-1.2+0.6)sys keV and the ratio of their integrated cross sections Is,0(+) /Is,0(-) = 29(± 3) stat(-7+14)sys. Shell-model calculations predict a parity-violating matrix element having a value in the range 0.46-0.83 eV for the parity doublet. The small energy difference of the parity doublet makes 20Ne an excellent candidate to study parity violation in nuclear excitations.
2010-04-01
...-adversarial proceeding. In making a determination or decision on your claim, we conduct the administrative... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Introduction. 405.1 Section 405.1 Employees... before an administrative law judge. If you are dissatisfied with a decision made by the Federal reviewing...
Lei, Yaguo; Liu, Zongyao; Wang, Delong; Yang, Xiao; Liu, Huan; Lin, Jing
2018-06-01
Tooth damage often causes a reduction in gear mesh stiffness. Thus time-varying mesh stiffness (TVMS) can be treated as an indication of gear health conditions. This study is devoted to investigating the mesh stiffness variations of a pair of external spur gears with tooth pitting, and proposes a new model for describing tooth pitting based on probability distribution. In the model, considering the appearance and development process of tooth pitting, we model the pitting on the surface of spur gear teeth as a series of pits with a uniform distribution in the direction of tooth width and a normal distribution in the direction of tooth height, respectively. In addition, four pitting degrees, from no pitting to severe pitting, are modeled. Finally, influences of tooth pitting on TVMS are analyzed in details and the proposed model is validated by comparing with a finite element model. The comparison results show that the proposed model is effective for the TVMS evaluations of pitting gears.
Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.
Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong
2017-10-01
Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.
Adding PCs to SLC Control System
International Nuclear Information System (INIS)
Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.
1993-05-01
The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code
Graham, John M
2012-05-01
Glucose transporter-1 (GLUT1) deficiency syndrome is caused by heterozygous mutations in the SLC2A1 gene, resulting in impaired glucose transport into the brain. It is characterized by a low glucose concentration in the cerebrospinal fluid (hypoglycorrhachia) in the absence of hypoglycemia, in combination with low to normal lactate in the cerebrospinal fluid (CSF). It often results in treatment-resistant infantile epilepsy with progressive developmental disabilities and a complex movement disorder. Recognizing GLUT1 deficiency syndrome is important, since initiation of a ketogenic diet can reduce the frequency of seizures and the severity of the movement disorder. There can be a considerable delay in diagnosing GLUT1 deficiency syndrome, and this point is illustrated by the natural history of this disorder in a 21-year-old woman with severe, progressive neurological disabilities. Her encephalopathy consisted of treatment-resistant seizures, a complex movement disorder, progressive intellectual disability, and deceleration of her head growth after late infancy. Focused evaluation at age 21 revealed GLUT1 deficiency caused by a novel heterozygous missence mutation in exon 7 (c.938C > A; p.Ser313Try) in SLC2A1 as the cause for her disabilities. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Palmer, E.R. [Westinghouse Savannah River Company, AIKEN, SC (United States); Mason, J.T.
1997-02-01
The D-Area Burning/Rubble Pits (DBRP) (431-D and 431-1D) Waste Unit is listed as a Resource Conservation and Recovery Act (RCRA) 3004(U) Solid Waste Management Unit/Comprehensive Environmental Response Compensation and Liability Act (CERCLA) unit in Appendix C of the Federal Facility Agreement (FFA) for the Savannah River Site (SRS). This decision document presents the selected remedial alternative for the DBRP located at the SRS in Aiken, South Carolina.
Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao
2012-12-01
Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.
Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.
Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W
2014-04-01
Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.
Li, Changrun; Wang, Yansheng; Xie, Guopai; Peng, Bing; Zhang, Baonian; Chen, Wei; Huang, Xunduan; Wu, Hang; Zhang, Buchang
2016-02-20
Clostridium butyricum is an important fragrance-producing bacterium in the traditional Chinese flavor liquor-making industry. Here the complete genome sequence of C. butyricum JKY6D1 isolated from the pit mud of a Chinese flavor liquor-making factory is presented. The genome is 4,618,327bp with the GC content of 28.74% and a plasmid of 8060bp. This is the first complete genome sequence of C. butyricum strains available so far. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lindholm Carlström Eva
2012-05-01
Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.
Directory of Open Access Journals (Sweden)
Yan Xiaofei
2011-09-01
Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was
Directory of Open Access Journals (Sweden)
Naoya Murao
Full Text Available Incretins (GLP-1 and GIP potentiate insulin secretion through cAMP signaling in pancreatic β-cells in a glucose-dependent manner. We recently proposed a mechanistic model of incretin-induced insulin secretion (IIIS that requires two critical processes: 1 generation of cytosolic glutamate through the malate-aspartate (MA shuttle in glucose metabolism and 2 glutamate transport into insulin granules by cAMP signaling to promote insulin granule exocytosis. To directly prove the model, we have established and characterized CRISPR/Cas9-engineered clonal mouse β-cell lines deficient for the genes critical in these two processes: aspartate aminotransferase 1 (AST1, gene symbol Got1, a key enzyme in the MA shuttle, which generates cytosolic glutamate, and the vesicular glutamate transporters (VGLUT1, VGLUT2, and VGLUT3, gene symbol Slc17a7, Slc17a6, and Slc17a8, respectively, which participate in glutamate transport into secretory vesicles. Got1 knockout (KO β-cell lines were defective in cytosolic glutamate production from glucose and showed impaired IIIS. Unexpectedly, different from the previous finding that global Slc17a7 KO mice exhibited impaired IIIS from pancreatic islets, β-cell specific Slc17a7 KO mice showed no significant impairment in IIIS, as assessed by pancreas perfusion experiment. Single Slc17a7 KO β-cell lines also retained IIIS, probably due to compensatory upregulation of Slc17a6. Interestingly, triple KO of Slc17a7, Slc17a6, and Slc17a8 diminished IIIS, which was rescued by exogenously introduced wild-type Slc17a7 or Slc17a6 genes. The present study provides direct evidence for the essential roles of AST1 and VGLUTs in β-cell glutamate signaling for IIIS and also shows the usefulness of the CRISPR/Cas9 system for studying β-cells by simultaneous disruption of multiple genes.
Configuring the SLC linac for injection into PEP
International Nuclear Information System (INIS)
Bane, K.L.F.
1989-01-01
From time to time the normal SLC physics program is to be interrupted so that beam can be delivered to PEP. In order that the switch to PEP injection (and the switch back again) can be accomplished quickly and easily, the gun, the damping rings, the linac phase ramp, the energy profile of the linac klystrons for the scavenger bunch, and the entire positron production system are to be kept the same as in the SLC configuration. What mainly remains to be changed is the linac klystron profile for the leading two bunches - those going to PEP. The new klystron profile must be such that it leaves these two beams (1) with final energies that match that of the storage ring and (2) with final energy spectra that fit within the energy aperture of the PEP transfer line. The conditions that need to be met in order to achieve these two goals are discussed in this note. 1 ref., 2 figs
Directory of Open Access Journals (Sweden)
Yuan-Zong Song
Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.
Verification of the SLC wake potentials
International Nuclear Information System (INIS)
Bane, K.; Weiland, T.
1983-01-01
The accurate knowledge of the monopole, dipole, and quadrupole wake potentials is essential for SLC. These wake potentials were previously computed by the modal method. The time domain code TBCI allows independent verification of these results. This comparison shows that the two methods agree to within 10% for bunch lengths down to 1 mm. TBCI results also indicate that rounding the irises gives at least a 10% reduction in the wake potentials
Directory of Open Access Journals (Sweden)
Aniruddha Basu
2015-01-01
Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.
Why do Pit-Hours outlive the Pit?
S.R. Ozturk (Sait); M. van der Wel (Michel); D.J.C. van Dijk (Dick)
2015-01-01
markdownabstract__Abstract__ We study why a majority of trades still happen during the pit hours, i.e. when the trading pit is open, even after the pit ceased to be a liquid and informative venue. We investigate the case of 30-year U.S. Treasury futures using a ten-years-long intraday data set
Directory of Open Access Journals (Sweden)
Armando R Irizarry
Full Text Available There has been growing recognition of the essential roles of citrate in biomechanical properties of mineralized tissues, including teeth and bone. However, the sources of citrate in these tissues have not been well defined, and the contribution of citrate to the regulation of odontogenesis and osteogenesis has not been examined. Here, tooth and bone phenotypes were examined in sodium-dependent citrate transporter (NaCT Slc13a5 deficient C57BL/6 mice at 13 and 32 weeks of age. Slc13a5 deficiency led to defective tooth development, characterized by absence of mature enamel, formation of aberrant enamel matrix, and dysplasia and hyperplasia of the enamel organ epithelium that progressed with age. These abnormalities were associated with fragile teeth with a possible predisposition to tooth abscesses. The lack of mature enamel was consistent with amelogenesis imperfecta. Furthermore, Slc13a5 deficiency led to decreased bone mineral density and impaired bone formation in 13-week-old mice but not in older mice. The findings revealed the potentially important role of citrate and Slc13a5 in the development and function of teeth and bone.
Zhang, Chunxiao; Hoang, Nam; Leng, Feng; Saxena, Lovely; Lee, Logan; Alejo, Salvador; Qi, Dandan; Khal, Anthony; Sun, Hong; Lu, Fei; Zhang, Hui
2018-03-09
The pluripotency-controlling stem-cell protein SRY-box 2 (SOX2) plays a pivotal role in maintaining the self-renewal and pluripotency of embryonic stem cells and also of teratocarcinoma or embryonic carcinoma cells. SOX2 is monomethylated at lysine 119 (Lys-119) in mouse embryonic stem cells by the SET7 methyltransferase, and this methylation triggers ubiquitin-dependent SOX2 proteolysis. However, the molecular regulators and mechanisms controlling SET7-induced SOX2 proteolysis are unknown. Here, we report that in human ovarian teratocarcinoma PA-1 cells, methylation-dependent SOX2 proteolysis is dynamically regulated by the LSD1 lysine demethylase and a methyl-binding protein, PHD finger protein 20-like 1 (PHF20L1). We found that LSD1 not only removes the methyl group from monomethylated Lys-117 (equivalent to Lys-119 in mouse SOX2), but it also demethylates monomethylated Lys-42 in SOX2, a reaction that SET7 also regulated and that also triggered SOX2 proteolysis. Our studies further revealed that PHF20L1 binds both monomethylated Lys-42 and Lys-117 in SOX2 and thereby prevents SOX2 proteolysis. Down-regulation of either LSD1 or PHF20L1 promoted SOX2 proteolysis, which was prevented by SET7 inactivation in both PA-1 and mouse embryonic stem cells. Our studies also disclosed that LSD1 and PHF20L1 normally regulate the growth of pluripotent mouse embryonic stem cells and PA-1 cells by preventing methylation-dependent SOX2 proteolysis. In conclusion, our findings reveal an important mechanism by which the stability of the pluripotency-controlling stem-cell protein SOX2 is dynamically regulated by the activities of SET7, LSD1, and PHF20L1 in pluripotent stem cells. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R
2009-11-01
To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.
DEFF Research Database (Denmark)
Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob Munk
2016-01-01
The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells....... Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1......) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2...
Directory of Open Access Journals (Sweden)
Hassan Brim
Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.
The emerging physiological roles of the SLC14A family of urea transporters
Stewart, Gavin
2011-01-01
In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978
20 CFR 332.1 - Statutory provisions.
2010-04-01
..., or, with respect to a female employee, a calendar day on which, because of pregnancy, miscarriage, or... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Statutory provisions. 332.1 Section 332.1 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD UNEMPLOYMENT INSURANCE ACT...
Synthesis/literature review for determining structural layer coefficients (SLC) of bases.
2014-12-01
FDOTs current method of determining a base material structural layer coefficient (SLC) is detailed in the : Materials Manual, Chapter 2.1, Structural Layer Coefficients for Flexible Pavement Base Materials. : Currently, any new base material not a...
Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth
Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2012-01-01
Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245
Parturition pit: the bony imprint of vaginal birth
International Nuclear Information System (INIS)
McArthur, Tatum A.; Meyer, Isuzu; Jackson, Bradford; Pitt, Michael J.; Larrison, Matthew C.
2016-01-01
To retrospectively evaluate for pits along the dorsum of the pubic body in females and compare the presence/absence of these pits to vaginal birth data. We retrospectively reviewed females with vaginal birth data who underwent pelvic CT. The presence of pits along the dorsum of the pubic body, pit grade (0 = not present; 1 = faintly imperceptible; 2 = present; 3 = prominent), and the presence of osteitis condensans ilii, preauricular sulcus, and sacroiliac joint vacuum phenomenon were assessed on imaging. Musculoskeletal radiologists who were blinded to the birth data evaluated the CTs. 48 males were also evaluated for the presence of pits. 482 female patients underwent CT pelvis and 171 were excluded due to lack of vaginal birth data. Of the 311 study patients, 262 had prior vaginal birth(s) and 194 had pits on CT. Only 7 of the 49 patients without prior vaginal birth had pits. There was a statistically significant association between vaginal birth and presence of pits (p < 0.0001). Patients with more prominent pits (grades 2/3) had a greater number of vaginal births. As vaginal deliveries increased, the odds of having parturition pits greatly increased, adjusting for age and race at CT (p < 0.0001). No males had pits. Our study indicates that parturition pits are associated with prior vaginal birth and should be considered a characteristic of the female pelvis. The lytic appearance of prominent pits on imaging can simulate disease and create a diagnostic dilemma for interpreting radiologists. (orig.)
A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle
Directory of Open Access Journals (Sweden)
Beever Jonathan E
2010-05-01
Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and
International Nuclear Information System (INIS)
Nowicki, M. Anna; Velbel, Michael A.
2011-01-01
Many etch-pits on olivine grains occur as a pair of cone-shaped pits sharing a base, which consequently appear as diamond-shaped etch-pits in cross-section. Quantitative image analysis of back-scattered electron images establishes empirical dimensions of olivine etch-pits in naturally weathered samples from Hawaii and North Carolina. Images of naturally etched olivine were acquired from polished thin-sections by scanning electron microscopy. An average cone-radius-to-height ratio (r:h) of 1.78 was determined for diamond-shaped cross-sections of etch-pits occurring in naturally weathered olivine grains, largely consistent with previous qualitative results. Olivine etch-pit shape as represented by r:h varies from slightly more than half the average value to slightly more than twice the average. Etch-pit shape does not appear to vary systematically with etch-pit size.
Prediction of the net radon emission from a model open pit uranium mine
International Nuclear Information System (INIS)
Nielson, K.K.; Perkins, R.W.; Schwendiman, L.C.; Enderlin, W.I.
1979-09-01
Radon emission from a model open pit uranium mining operation has been estimated by applying radon exhalation fluxes measured in an open pit uranium mine to the various areas of the model mine. The model mine was defined by averaging uranium concentrations, mine dimensions, production and procedural statistics for eight major open pit uranium mines in the Casper, Wyoming area. The resulting emission rates were 630 Ci/RRY (1 RRY one = 1000-MW(e) reactor operating for 1 year) during mining operations and 26 Ci/RRY/y after abandoment of the mine assuming 100% recovery of U 3 O 8 from the ore, or 700 Ci/RRY and 29 Ci/RRY/y assuming 90.5% recovery
Precision electroweak physics with the SLD/SLC: The left-right polarization asymmetry
International Nuclear Information System (INIS)
Rowson, P.C.
1994-12-01
Following a brief review of a commonly used general framework for the analysis of radiative corrections and possible new physics, the recent precision results from the SLD/SLC are discussed and used to test the standard electroweak model. In the 1993 SLD/SLC run, the SLD recorded 50,000 Z events produced by the collision of longitudinally polarized electrons on unpolarized positrons at a center-of-mass energy of 91.26 GeV. The luminosity-weighted average polarization of the SLC electron beam was (63.0 ± 1.1)%. We measure the left-right cross-section asymmetry in Z boson production, A LR , to be 0.1628 ± 0.0071 (stat) ± 0.0028 (syst) which determines the effective weak mixing angle to be sin 2 θ W eff = 0.2292 ± 0.0009 (stat) ± 0.0004 (syst). When averaged with our 1992 result, we obtain sin 2 θ W eff = 0.2294 ± 0. 0010. This result differs from analogous LEP results at the level of about 2.5 σ. The world averages of electroweak data are comfortably in agreement with the standard model
Effects of Ion-Nitriding on the Pitting Behavior of Austenitic Stainless Steels Containing Mo
International Nuclear Information System (INIS)
Cho, Yong Seok; Choe, Han Cheol; Kim, Kwan Hyu
1994-01-01
Austenitic stainless steels(ASS) containing 1-4wt% Mo were ion-nitrided at 550 .deg. C for 20hrs and 30hrs, and their pitting behavior was examined by the electrochemical measurements. The formation of multiphase surface layers composed of the ε-{(Fe, Cr) 2- 3N} and the γ'-{(Fe, Cr) 4 N} phases was observed after ion-nitriding. The compound layers were approximately 50 μm thick after nitriding for 20hrs and 70 μm thick after 30hrs. Anodic polarization curves indicated that passive current density(I p ) and critical current density(I c ) increased, and corrosion potential(E corr ) decreased as a results of ion-nitriding. As the Mo content in the ion-nitrided ASS increased, passivation breakdown potential(E b ) and repassivation potential(E r ) increased, whereas I c and I p decreased. The pit nucleation time of the ASS nitrided for 20hrs was 10 minutes, while that of the 30hr nitrided samples was 3 minutes. The nucleation and growth of pits were significantly increased with the decreasing of Mo content as well as the increasing of ion-nitriding time
... Conditions Frequently Asked Questions Español Condiciones Chinese Conditions Optic Nerve Pit What is optic nerve pit? An optic nerve pit is a ... may be seen in both eyes. How is optic pit diagnosed? If the pit is not affecting ...
Energy Technology Data Exchange (ETDEWEB)
Mark Krauss
2010-07-01
This Streamlined Approach for Environmental Restoration (SAFER) Plan addresses the actions needed to achieve closure for Corrective Action Unit (CAU) 544, Cellars, Mud Pits, and Oil Spills, identified in the Federal Facility Agreement and Consent Order (FFACO). Corrective Action Unit 544 comprises the following 20 corrective action sites (CASs) located in Areas 2, 7, 9, 10, 12, 19, and 20 of the Nevada Test Site (NTS): • 02-37-08, Cellar & Mud Pit • 02-37-09, Cellar & Mud Pit • 07-09-01, Mud Pit • 09-09-46, U-9itsx20 PS #1A Mud Pit • 10-09-01, Mud Pit • 12-09-03, Mud Pit • 19-09-01, Mud Pits (2) • 19-09-03, Mud Pit • 19-09-04, Mud Pit • 19-25-01, Oil Spill • 19-99-06, Waste Spill • 20-09-01, Mud Pits (2) • 20-09-02, Mud Pit • 20-09-03, Mud Pit • 20-09-04, Mud Pits (2) • 20-09-06, Mud Pit • 20-09-07, Mud Pit • 20-09-10, Mud Pit • 20-25-04, Oil Spills • 20-25-05, Oil Spills This plan provides the methodology for field activities needed to gather the necessary information for closing each CAS. There is sufficient information and process knowledge from historical documentation and investigations of similar sites regarding the expected nature and extent of potential contaminants to recommend closure of CAU 544 using the SAFER process. Using the approach approved for previous mud pit investigations (CAUs 530–535), 14 mud pits have been identified that • are either a single mud pit or a system of mud pits, • are not located in a radiologically posted area, and • have no evident biasing factors based on visual inspections. These 14 mud pits are recommended for no further action (NFA), and further field investigations will not be conducted. For the sites that do not meet the previously approved closure criteria, additional information will be obtained by conducting a field investigation before selecting the appropriate corrective action for each CAS. The results of the field investigation will support a defensible
Energy Technology Data Exchange (ETDEWEB)
Popovic, Marta; Zaja, Roko [Laboratory for Molecular Ecotoxicology, Division for Marine and Environmental Research, Rudjer Boskovic Institute, Bijenicka 54, 10 000 Zagreb (Croatia); Fent, Karl [University of Applied Sciences Northwestern Switzerland, School of Life Sciences, Gründenstrasse 40, CH-4132 Muttenz (Switzerland); Swiss Federal Institute of Technology (ETH Zürich), Department of Environmental System Sciences, Institute of Biogeochemistry and Pollution Dynamics, CH-8092 Zürich (Switzerland); Smital, Tvrtko, E-mail: smital@irb.hr [Laboratory for Molecular Ecotoxicology, Division for Marine and Environmental Research, Rudjer Boskovic Institute, Bijenicka 54, 10 000 Zagreb (Croatia)
2014-10-01
Polyspecific transporters from the organic anion transporting polypeptide (OATP/Oatp) superfamily mediate the uptake of a wide range of compounds. In zebrafish, Oatp1d1 transports conjugated steroid hormones and cortisol. It is predominantly expressed in the liver, brain and testes. In this study we have characterized the transport of xenobiotics by the zebrafish Oatp1d1 transporter. We developed a novel assay for assessing Oatp1d1 interactors using the fluorescent probe Lucifer yellow and transient transfection in HEK293 cells. Our data showed that numerous environmental contaminants interact with zebrafish Oatp1d1. Oatp1d1 mediated the transport of diclofenac with very high affinity, followed by high affinity towards perfluorooctanesulfonic acid (PFOS), nonylphenol, gemfibrozil and 17α-ethinylestradiol; moderate affinity towards carbaryl, diazinon and caffeine; and low affinity towards metolachlor. Importantly, many environmental chemicals acted as strong inhibitors of Oatp1d1. A strong inhibition of Oatp1d1 transport activity was found by perfluorooctanoic acid (PFOA), chlorpyrifos-methyl, estrone (E1) and 17β-estradiol (E2), followed by moderate to low inhibition by diethyl phthalate, bisphenol A, 7-acetyl-1,1,3,4,4,6-hexamethyl-1,2,3,4 tetrahydronapthalene and clofibrate. In this study we identified Oatp1d1 as a first Solute Carrier (SLC) transporter involved in the transport of a wide range of xenobiotics in fish. Considering that Oatps in zebrafish have not been characterized before, our work on zebrafish Oatp1d1 offers important new insights on the understanding of uptake processes of environmental contaminants, and contributes to the better characterization of zebrafish as a model species. - Highlights: • We optimized a novel assay for determination of Oatp1d1 interactors • Oatp1d1 is the first SLC characterized fish xenobiotic transporter • PFOS, nonylphenol, diclofenac, EE2, caffeine are high affinity Oatp1d1substrates • PFOA, chlorpyrifos
International Nuclear Information System (INIS)
Popovic, Marta; Zaja, Roko; Fent, Karl; Smital, Tvrtko
2014-01-01
Polyspecific transporters from the organic anion transporting polypeptide (OATP/Oatp) superfamily mediate the uptake of a wide range of compounds. In zebrafish, Oatp1d1 transports conjugated steroid hormones and cortisol. It is predominantly expressed in the liver, brain and testes. In this study we have characterized the transport of xenobiotics by the zebrafish Oatp1d1 transporter. We developed a novel assay for assessing Oatp1d1 interactors using the fluorescent probe Lucifer yellow and transient transfection in HEK293 cells. Our data showed that numerous environmental contaminants interact with zebrafish Oatp1d1. Oatp1d1 mediated the transport of diclofenac with very high affinity, followed by high affinity towards perfluorooctanesulfonic acid (PFOS), nonylphenol, gemfibrozil and 17α-ethinylestradiol; moderate affinity towards carbaryl, diazinon and caffeine; and low affinity towards metolachlor. Importantly, many environmental chemicals acted as strong inhibitors of Oatp1d1. A strong inhibition of Oatp1d1 transport activity was found by perfluorooctanoic acid (PFOA), chlorpyrifos-methyl, estrone (E1) and 17β-estradiol (E2), followed by moderate to low inhibition by diethyl phthalate, bisphenol A, 7-acetyl-1,1,3,4,4,6-hexamethyl-1,2,3,4 tetrahydronapthalene and clofibrate. In this study we identified Oatp1d1 as a first Solute Carrier (SLC) transporter involved in the transport of a wide range of xenobiotics in fish. Considering that Oatps in zebrafish have not been characterized before, our work on zebrafish Oatp1d1 offers important new insights on the understanding of uptake processes of environmental contaminants, and contributes to the better characterization of zebrafish as a model species. - Highlights: • We optimized a novel assay for determination of Oatp1d1 interactors • Oatp1d1 is the first SLC characterized fish xenobiotic transporter • PFOS, nonylphenol, diclofenac, EE2, caffeine are high affinity Oatp1d1substrates • PFOA, chlorpyrifos
International Nuclear Information System (INIS)
Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.
1991-01-01
The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance
Directory of Open Access Journals (Sweden)
Cheng Hu
2009-10-01
Full Text Available Recent advance in genetic studies added the confirmed susceptible loci for type 2 diabetes to eighteen. In this study, we attempt to analyze the independent and joint effect of variants from these loci on type 2 diabetes and clinical phenotypes related to glucose metabolism.Twenty-one single nucleotide polymorphisms (SNPs from fourteen loci were successfully genotyped in 1,849 subjects with type 2 diabetes and 1,785 subjects with normal glucose regulation. We analyzed the allele and genotype distribution between the cases and controls of these SNPs as well as the joint effects of the susceptible loci on type 2 diabetes risk. The associations between SNPs and type 2 diabetes were examined by logistic regression. The associations between SNPs and quantitative traits were examined by linear regression. The discriminative accuracy of the prediction models was assessed by area under the receiver operating characteristic curves. We confirmed the effects of SNPs from PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX, IGF2BP2 and SLC30A8 on risk for type 2 diabetes, with odds ratios ranging from 1.114 to 1.406 (P value range from 0.0335 to 1.37E-12. But no significant association was detected between SNPs from WFS1, FTO, JAZF1, TSPAN8-LGR5, THADA, ADAMTS9, NOTCH2-ADAM30 and type 2 diabetes. Analyses on the quantitative traits in the control subjects showed that THADA SNP rs7578597 was association with 2-h insulin during oral glucose tolerance tests (P = 0.0005, empirical P = 0.0090. The joint effect analysis of SNPs from eleven loci showed the individual carrying more risk alleles had a significantly higher risk for type 2 diabetes. And the type 2 diabetes patients with more risk allele tended to have earlier diagnostic ages (P = 0.0006.The current study confirmed the association between PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX, IGF2BP2 and SLC30A8 and type 2 diabetes. These type 2 diabetes risk loci contributed to the disease additively.
Pitting of Incoloy 800 in presence of CuII
International Nuclear Information System (INIS)
Bianchi, G.L.; Alvarez, M.G.
1993-01-01
The pitting behaviour of Incoloy 800 in presence of Cu II ions, at 60 degrees C and 280 degrees C was studied by long term exposition of specimens in aqueous cupric chloride solutions. At 60 degrees C experiments were performed in aerated (7 ppm O 2 ) and deaerated solutions containing 500, 1000, 2000, 10000 and 20000 ppm CuCl 2 . At 280 degrees C experiments were performed in deaerated 20 ppm, 50 ppm and 100 ppm CuCl 2 solutions. During each experiment the open circuit potential of the alloy was measured as a function of time. After corrosion test the specimens were examined by Scanning Electron Microscopy for the presence of pits. In another set of experiments potentiodynamic anodic polarization curves were used to determine the pitting potential of Incoloy 800 in deaerated NaCl solutions at chloride concentrations and pH values corresponding to those possessed by solutions containing 20 ppm to 20000 ppm CuCl 2 . At 60 degrees C pitting was observed in those solutions where the CuCl 2 concentration is higher than 1000 ppm. At 280 degrees C pitting was found in the specimens exposed to those solutions where the CuCl 2 concentration was higher than 20 ppm. (author). 3 refs
Directory of Open Access Journals (Sweden)
Venkata Saroja eVoruganti
2013-12-01
Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.
Filling Landsat ETM+ SLC-off gaps using a segmentation model approach
Maxwell, Susan
2004-01-01
The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.
Akiyama, Hideo; Shimoda, Yukitoshi; Fukuchi, Mariko; Kashima, Tomoyuki; Mayuzumi, Hideyasu; Shinohara, Yoichiro; Kishi, Shoji
2014-02-01
To evaluate the clinical outcomes after gas tamponade without vitrectomy for retinal detachment associated with an optic disk pit using optical coherence tomography. Intravitreal gas injection was performed on 8 consecutive patients (mean age, 35.0 years; range, 15-74 years) with unilateral macular detachment associated with an optic disk pit. A 0.3-mL injection of 100% sulfur hexafluoride 6 gas was carried out without an anterior chamber tap. Patients treated with gas injection were instructed to remain facedown for 5 days. Complete retinal reattachment after only gas tamponade was achieved in four out of eight eyes. The mean number of gas injections was 1.8. The mean best-corrected visual acuity before and after the treatment with gas tamponade was approximately 30/100 and 20/20, respectively. The period required for reattachment after final gas treatment was 12 months. There were no incidences of recurrence after complete reattachment by gas tamponade in any of the cases during the 94-month average follow-up period (range, 64-132 months). Gas tamponade appears to be an effective alternative method for macular detachment associated with an optic disk pit, even though the mechanisms of optic disk pit maculopathy are still unknown.
Directory of Open Access Journals (Sweden)
Antonio Peres
2012-11-01
Full Text Available The effects of temperature on the operation of two ion-coupled cotransporters of the SLC6A family, namely rat GAT1 (SLC6A1 and KAAT1 (SLC6A19 from Manduca sexta, have been studied by electrophysiological means in Xenopus laevis oocytes expressing these proteins. The maximal transport-associated current (Imax and the apparent substrate affinity (K05 were measured. In addition to the expected increase in transport rate (Q10 = 3–6, both transporters showed greater K05 values (i.e., a decrease in apparent affinity at higher temperatures. The transport efficiency, estimated as Imax/K05, increased at negative potentials in both transporters, but did not show statistically significant differences with temperature. The observation that the apparent substrate affinity is inversely related to the transport rate suggests a kinetic regulation of this parameter. Furthermore, the present results indicate that the affinities estimated at room temperature for mammalian cotransporters may not be simply extrapolated to their physiological operating conditions.
Non Destructive Testing Measurement for Monitoring Pitting Corrosion using Dcp Techniques
International Nuclear Information System (INIS)
Atlam, A.; Omar, A.A.; Habashy, M.; Waheed, A.F.; Shafy, M.
2010-01-01
A repeatable monitoring of pit from in accessible side of a welded side of a structure is one of the hurdles in field of NT. The present work uses the DC potential drop measuring system for evaluating the response of pits in the weld joins to be detected by DC potential drop measurements. Weld joint of type 304L stainless steel welded with 308L was tested. Selected pits in different zones of the weld joint were detected by optical microscopy. The PD test shows difference in potential between pitted and non-pitted weld joints ranging from 1.3 in BM to 1.7 in HAZ. The capability of present monitoring process can be extended to evaluate the reduction in thickness for the case of thick stainless steel structure
Numerical simulation of the double pits stress concentration in a curved casing inner surface
Directory of Open Access Journals (Sweden)
Wei Yan
2016-12-01
Full Text Available Sour or sweet oil fields development is common in recent years. Casing and tubing are usually subjected to pitting corrosion because of exposure to the strong corrosion species, such as CO2, H2S, and saline water. When the corrosion pits formed in the casing inner surface, localized stress concentration will occur and the casing strength will be degraded. Thus, it is essential to evaluate the degree of stress concentration factor accurately. This article performed a numerical simulation on double pits stress concentration factor in a curved inner surface using the finite element software ABAQUS. The results show that the stress concentration factor of double pits mainly depends on the ratio of two pits distance to the pit radius (L/R. It should not be only assessed by the absolute distance between the two pits. When the two pits are close and tangent, the maximum stress concentration factor will appear on the inner tangential edges. Stress concentration increased by double pits in a curved casing inner surface is more serious than that in a flat surface. A correction factor of 1.9 was recommended in the curved inner surface double pits stress concentration factor predict model.
Burning/Rubble Pits: Environmental information document
International Nuclear Information System (INIS)
Huber, L.A.; Johnson, W.F.; Marine, I.W.
1987-03-01
The Burning/Rubble Pits, located near each of the major operating areas at the Savannah River Plant (SRP), began collecting burnable waste in 1951. The waste was incinerated monthly. All Burning/Rubble Pits are currently closed except for Burning/Rubble Pit 131-1R, which has not been backfilled but is inactive. No soil cores from the Burning/Rubble Pits have been analyzed. There are four groundwater monitoring wells located around each of the pits, which have been sampled quarterly since 1984. The closure options considered for the Burning/Rubble Pits are waste removal and closure, no waste removal and closure, and no action. Modeling calculations were made to determine the risks to human population for the three postulated closure options. An ecological assessment was conducted to predict the environmental impacts on aquatic and terrestrial biota. The relative costs for each of the closure options were estimated. An evaluation of the environmental impacts from the Burning/Rubble Pits indicates that the relative risks to human health and ecosystems for the postulated closure options are low. The ecological assessment shows that the effects of any closure activities on river water quality and wildlife would be insignificant. The cost estimates show the waste removal and closure option to be the most expensive for all of the pits. 38 refs., 35 figs., 47 tabs
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Min; Shin, Yong-Taek; Lee, Sang-Hwa; Lee, Jun-Hee; Lee, Hae-Woo [Dong-A University, Busan (Korea, Republic of); Lee, Sung-Riong [Kangwon National University, ChunCheon (Korea, Republic of); Kim, Soon-Ho [Silla University, Busan (Korea, Republic of)
2014-01-15
This paper identified the effects of Nb on microstructure. Also, it has studied on uniform and pitting corrosion resistance in a ferritic stainless steel weld metal of the automobile exhaust system. We fabricated 3 flux cored wires designed with 0-1.0 wt% Nb and performed Flux Cored Arc Welding. We observed the microstructure with the SEM/EDS and EBSD. To evaluate the uniform and pitting corrosion resistance, we performed a potentiodynamic polarization test in 0.2 M H{sub 2}SO{sub 4} and 0.1, 0.3, 0.5 M NaCl. As a result of the tests, we found that as the amount of addition of Nb rose, the amount of Cr-carbide fell. The microstructure became more refined. The specimen with 1.0%Nb added had the highest uniform and pitting corrosion resistance. After the pitting corrosion test, a pit was formed at the grain boundary that has no addition of Nb. In addition, in the specimen with added Nb, pits were formed at the inclusions.
Near infrared photoimmunotherapy with avelumab, an anti-programmed death-ligand 1 (PD-L1) antibody
Nagaya, Tadanobu; Nakamura, Yuko; Sato, Kazuhide; Harada, Toshiko; Choyke, Peter L.; Hodge, James W.; Schlom, Jeffrey; Kobayashi, Hisataka
2016-01-01
Near Infrared-Photoimmunotherapy (NIR-PIT) is a highly selective tumor treatment that employs an antibody-photo-absorber conjugate (APC). Programmed cell death protein-1 ligand (PD-L1) is emerging as a molecular target. Here, we describe the efficacy of NIR-PIT, using fully human IgG1 anti-PD-L1 monoclonal antibody (mAb), avelumab, conjugated to the photo-absorber, IR700DX, in a PD-L1 expressing H441 cell line, papillary adenocarcinoma of lung. Avelumab-IR700 showed specific binding and cell-...
Energy Technology Data Exchange (ETDEWEB)
Kesler, V.G., E-mail: kesler@isp.nsc.ru [Institute of Semiconductor Physics SB RAS, Lavrentiev av., 13, Novosibirsk 630090 (Russian Federation); Seleznev, V.A.; Kovchavtsev, A.P.; Guzev, A.A. [Institute of Semiconductor Physics SB RAS, Lavrentiev av., 13, Novosibirsk 630090 (Russian Federation)
2010-05-01
X-ray photoelectron spectroscopy and atomic force microscopy were used to examine the chemical composition and surface morphology of InAs(1 1 1)A surface chemically etched in isopropanol-hydrochloric acid solution (HCl-iPA) and subsequently annealed in vacuum in the temperature range 200-500 deg. C. Etching for 2-30 min resulted in the formation of 'pits' and 'hillocks' on the sample surface, respectively 1-2 nm deep and high, with lateral dimensions 50-100 nm. The observed local formations, whose density was up to 3 x 10{sup 8} cm{sup -2}, entirely vanished from the surface after the samples were vacuum-annealed at temperatures above 300 deg. C. Using a direct method, electron beam microanalysis, we have determined that the defects of the hillock type includes oxygen and excessive As, while the 'pits' proved to be identical in their chemical composition to InAs. Vacuum anneals were found to cause a decrease in As surface concentration relative to In on InAs surface, with a concomitant rise of surface recombination rate.
Kesler, V. G.; Seleznev, V. A.; Kovchavtsev, A. P.; Guzev, A. A.
2010-05-01
X-ray photoelectron spectroscopy and atomic force microscopy were used to examine the chemical composition and surface morphology of InAs(1 1 1)A surface chemically etched in isopropanol-hydrochloric acid solution (HCl-iPA) and subsequently annealed in vacuum in the temperature range 200-500 °C. Etching for 2-30 min resulted in the formation of "pits" and "hillocks" on the sample surface, respectively 1-2 nm deep and high, with lateral dimensions 50-100 nm. The observed local formations, whose density was up to 3 × 10 8 cm -2, entirely vanished from the surface after the samples were vacuum-annealed at temperatures above 300 °C. Using a direct method, electron beam microanalysis, we have determined that the defects of the hillock type includes oxygen and excessive As, while the "pits" proved to be identical in their chemical composition to InAs. Vacuum anneals were found to cause a decrease in As surface concentration relative to In on InAs surface, with a concomitant rise of surface recombination rate.
International Nuclear Information System (INIS)
Kesler, V.G.; Seleznev, V.A.; Kovchavtsev, A.P.; Guzev, A.A.
2010-01-01
X-ray photoelectron spectroscopy and atomic force microscopy were used to examine the chemical composition and surface morphology of InAs(1 1 1)A surface chemically etched in isopropanol-hydrochloric acid solution (HCl-iPA) and subsequently annealed in vacuum in the temperature range 200-500 deg. C. Etching for 2-30 min resulted in the formation of 'pits' and 'hillocks' on the sample surface, respectively 1-2 nm deep and high, with lateral dimensions 50-100 nm. The observed local formations, whose density was up to 3 x 10 8 cm -2 , entirely vanished from the surface after the samples were vacuum-annealed at temperatures above 300 deg. C. Using a direct method, electron beam microanalysis, we have determined that the defects of the hillock type includes oxygen and excessive As, while the 'pits' proved to be identical in their chemical composition to InAs. Vacuum anneals were found to cause a decrease in As surface concentration relative to In on InAs surface, with a concomitant rise of surface recombination rate.
SLC26A4 mutations are associated with a specific inner ear malformation.
Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa
2007-03-01
Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.
Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki
2010-01-01
The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651
Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G
2015-04-01
Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.
46 CFR 31.20-1 - Waters-TB/ALL.
2010-10-01
... 46 Shipping 1 2010-10-01 2010-10-01 false Waters-TB/ALL. 31.20-1 Section 31.20-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY TANK VESSELS INSPECTION AND CERTIFICATION Waters Operated Over § 31.20-1 Waters—TB/ALL. The certificate of inspection shall show the waters over which the tank vessel...
Vieira, Teresa C. [UNIFESP; Dias-da-Silva, Magnus Régios [UNIFESP; Cerutti, Janete Maria [UNIFESP; Brunner, Elisa [UNIFESP; Borges, M. [UNIFESP; Arnaldi, Liliane Aparecida Teixeira [UNIFESP; Kopp, P.; Abucham, Julio [UNIFESP
2003-01-01
Combined pituitary hormone deficiency (CPHD) is characterized by impaired production of GH and one or more of the other anterior pituitary hormones. Prophet of Pit-1 (PROP-1), one of the pituitary specific homeodomain transcription factors, is involved in the differentiation of the anterior pituitary cells (somatotrophs, lactotrophs, thyrotrophs, and gonadotrophs), and PROP-1 gene mutations may interfere with the development of these cells, resulting in CPHD.We performed molecular analyses of...
A Security Level Classification Method for Power Systems under N-1 Contingency
Directory of Open Access Journals (Sweden)
Zhigang Lu
2017-12-01
Full Text Available Security assessment is crucial for the reliable and secure operation of power systems. This paper proposes a security level classification (SLC method to analyze the security level of power systems both qualitatively and quantitatively. In this SLC method, security levels are graded according to a comprehensive safety index (CSI, which is defined by integrating the system margin index (SMI and load entropy. The SMI depends on the operating load and the total supply capacity (TSC under N-1 contingency, and the load entropy reflects the heterogeneity of load distribution calculated from entropy theory. In order to calculate the TSC under N-1 contingency considering both of the computational accuracy and speed, the TSC is converted into an extended conic quadratic programming (ECQP model. In addition, the load boundary vector (LBV model is established to obtain the capacity limit of each load bus, and thus detect potential risks of power systems. Finally, two modified practical power systems and the IEEE 118-bus test system are studied to validate the feasibility of the proposed SLC method.
Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans
2015-01-01
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603
Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich
2016-05-01
Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
International Nuclear Information System (INIS)
Kim, Soon-Tae; Jeon, Soon-Hyeok; Lee, In-Sung; Park, Yong-Soo
2010-01-01
To elucidate the effects of rare earth metals addition on the resistance to pitting corrosion of super duplex stainless steel, a metallographic examination, potentiodynamic and potentiostatic polarization tests, a SEM-EDS and a SAM analysis of inclusion, austenite phase and ferrite phase were conducted. The addition of rare earth metals to the base alloy led to the formation of (Mn, Cr, Si, Al, Ce) oxides and (Mn, Cr, Si, Ce) oxides, which improved the resistance to pitting corrosion and caused a decrease in the preferential interface areas for the initiation of the pitting corrosion.
Zhong, Xi Zoë; Cao, Qi; Sun, Xue
2016-01-01
Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609
PIT-tagging method for small fishes: A case study using sandeel ( Ammodytes tobianus )
DEFF Research Database (Denmark)
Jørgensen, Michelle Grace Pinto; Deurs, Mikael van; Butts, Ian
2017-01-01
Passive integrated transponder (PIT) tags are commonly used to assess fish movement for use in fisheries management. Here, we investigated physiological and behavioral effects of tagging on sandeels (Ammodytes tobianus) using PIT tags constituting 2.1 ± 0.9% of their body weight. Swimming stamina...
Rationale and concept for a lunar pit reconnaissance probe
Dorrington, G. E.
2018-04-01
Speculation on near-term scientific reasons for the exploration of lunar pits is offered alongside comments on possible longer-term human exploitation. It is proposed that in order to determine whether or not one or more of the pits offer access the large subsurface voids e.g. a non-collapsed lava tube, a preliminary reconnaissance mission solely focused on obtaining lateral images (and/or LiDAR maps) is needed. Possible concept options for such a preliminary reconnaissance mission are discussed. It is suggested that one of the best possible strategies is to employ a micro-sized probe (â¼0.3m) that would hop from a nearby main landing spacecraft to the selected pit. After the surface position of the main lander is determined accurately, the probe would perform a ballistic hop, or hover-traverse, a distance of â¼3 km over the lunar surface using existing propulsive and guidance technology capability. Once hovering above the pit, the probe or a separate tethered imaging unit would then be lowered into the pit to acquire the necessary subsurface void topology data. This data would then be transmitted back to Earth, directly, via the lander, or via a store-and-forward orbiting relay. Preliminary estimates indicate that a probe of â¼14 kg (dry mass) is viable using a conventional hydrazine monopropellant system with a propellant mass fraction of less than â¼0.2 (20%) including margins, suggesting a piggyback architecture would be feasible.
The effect of precipitated carbides on the pitting corrosion of 304 stainless steel
International Nuclear Information System (INIS)
Kwak, Jai-Hyun; Kim, Kwan-Hun
1985-01-01
In order to investigate the relation between the pitting corrosion and precipitated carbides, the heat treatment of specimens was carried out in two ways: Solution treatment and carbides precipitation treatment. The experiment was focused on the polarization curves of specimens immersed in HCL solution and on the microscopic analysis of the corroded specimens through a potentiodynamic method. It was found out that the intergranular and pitting corrosion occurred remarkably in 0.1N and 1N KCL solution when carbides were precipitated around the grain boundary of the 304 stain steel. The intergranular corrosion was noticed in the region of passivation and the pitting was prominent in the region of passivation break-down. The distribution of pits on the solution treated 304 stainless steel was random, while that of pits on carbides precipitated specimen was concentrated around the grain boundary in 0.1N and 1N HCL solution. It was ascertained that the pitting resistance of the solution treated 304 stainless steel was better than that of carbides precipitated specimen. (Author)
Separation of the 1+/1− parity doublet in 20Ne
Directory of Open Access Journals (Sweden)
J. Beller
2015-02-01
Full Text Available The (J,T=(1,1 parity doublet in 20Ne at 11.26 MeV is a good candidate to study parity violation in nuclei. However, its energy splitting is known with insufficient accuracy for quantitative estimates of parity violating effects. To improve on this unsatisfactory situation, nuclear resonance fluorescence experiments using linearly and circularly polarized γ-ray beams were used to determine the energy difference of the parity doublet ΔE=E(1−−E(1+=−3.2(±0.7stat(−1.2+0.6sys keV and the ratio of their integrated cross sections Is,0(+/Is,0(−=29(±3stat(−7+14sys. Shell-model calculations predict a parity-violating matrix element having a value in the range 0.46–0.83 eV for the parity doublet. The small energy difference of the parity doublet makes 20Ne an excellent candidate to study parity violation in nuclear excitations. Keywords: Parity doublet, Parity violation
Yang, Zixuan; Kan, Bo; Li, Jinxu; Qiao, Lijie; Volinsky, Alex A; Su, Yanjing
2017-11-14
Hydrostatic pressure effects on pitting initiation and propagation in X70 steel are investigated by evaluating metastable pitting probability using electrochemical methods and immersion corrosion tests in containing chlorine ion solution. Potentiodynamic tests indicated that hydrostatic pressure can decrease the breakdown potential and lead to a reduced transpassivity region. Metastable test results revealed that hydrostatic pressure can increase metastable pitting formation frequency and promote stabilization of metastable pitting growth. Electrochemical impedance spectroscopy (EIS) results indicate that Hydrostatic pressure decreases the charge transfer resistance and increases the dissolution rate within the cavities. Corrosion test results also indicated that pitting initiation and propagation are accelerated by hydrostatic pressure. Result validity was verified by evaluating metastable pitting to predict pitting corrosion resistance.
Physics at the SLC [SLAC Linear Collider
International Nuclear Information System (INIS)
Swartz, M.L.
1990-11-01
The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam
Aldawsari, Abdullah; Khan, Moonis Ali; Hameed, B H; Alqadami, Ayoub Abdullah; Siddiqui, Masoom Raza; Alothman, Zeid Abdullah; Ahmed, A Yacine Badjah Hadj
2017-01-01
A substantive approach converting waste date pits to mercerized mesoporous date pit activated carbon (DPAC) and utilizing it in the removal of Cd(II), Cu(II), Pb(II), and Zn(II) was reported. In general, rapid heavy metals adsorption kinetics for Co range: 25-100 mg/L was observed, accomplishing 77-97% adsorption within 15 min, finally, attaining equilibrium in 360 min. Linear and non-linear isotherm studies revealed Langmuir model applicability for Cd(II) and Pb(II) adsorption, while Freundlich model was fitted to Zn(II) and Cu(II) adsorption. Maximum monolayer adsorption capacities (qm) for Cd(II), Pb(II), Cu(II), and Zn(II) obtained by non-linear isotherm model at 298 K were 212.1, 133.5, 194.4, and 111 mg/g, respectively. Kinetics modeling parameters showed the applicability of pseudo-second-order model. The activation energy (Ea) magnitude revealed physical nature of adsorption. Maximum elution of Cu(II) (81.6%), Zn(II) (70.1%), Pb(II) (96%), and Cd(II) (78.2%) were observed with 0.1 M HCl. Thermogravimetric analysis of DPAC showed a total weight loss (in two-stages) of 28.3%. Infra-red spectral analysis showed the presence of carboxyl and hydroxyl groups over DPAC surface. The peaks at 820, 825, 845 and 885 cm-1 attributed to Zn-O, Pb-O, Cd-O, and Cu-O appeared on heavy metals saturated DPAC, confirmed their binding on DPAC during the adsorption.
National Aeronautics and Space Administration — This Level 1 (L1) dataset contains the Version 2.0 geo-located Delay Doppler Maps (DDMs) calibrated into Power Received (Watts) and Bistatic Radar Cross Section...
Polarized source performance in 1992 for SLC--SLD
International Nuclear Information System (INIS)
Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.
1993-02-01
In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met
20 CFR 718.1 - Statutory provisions.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Statutory provisions. 718.1 Section 718.1 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION, DEPARTMENT OF LABOR FEDERAL COAL MINE HEALTH AND... establish criteria for the techniques to be used to take chest roentgenograms (X-rays) in connection with a...
Directory of Open Access Journals (Sweden)
Cassandro Vidal Talamini do Amarante
2006-04-01
Full Text Available Maçãs 'Catarina', colhidas na maturação comercial em pomar no município de São Joaquim-SC, foram separadas em quatro lotes de 14 frutos, de acordo com a severidade de incidência de "bitter pit": nula (nenhuma lesão/fruto, baixa (1-2 lesões/fruto, moderada (3-5 lesões/fruto e alta (6-18 lesões/fruto. Foram determinadas as concentrações de Ca, Mg, K e N na casca e na polpa de cada fruto. Foram verificadas relação linear (P 'Catarina' apples were harvested at the commercial maturity in an orchard in São Joaquim-SC and segregated in four lots of 14 fruits with different levels of bitter pit severity: null (none pit/fruit, low (1-2 pits/fruit, moderate (3-5 pits/fruit, and high (6-18 pits/fruit. Nutritional analysis (Ca, Mg, K, and N in the skin and flesh tissues were performed on individual fruits of each severity level. The average number of pits/fruit (calculated for each lot of bitter pit severity showed a negative linear relationship (P < 0.05 with the skin Ca content, and a negative linear relationship (P < 0.05 with the ratios of Mg/Ca, (K+Mg/Ca, and (K+Mg+N/Ca in the skin. For the flesh, the increasing of bitter pit severity was accompanied by significant reduction of Ca and Mg contents. The multivariate analysis (canonical discriminant analysis showed that the Mg/Ca ratio in the skin provided the best discrimination between the lots of fruit with different levels of bitter pit severity. Therefore, for 'Catarina' apples, increasing values of the Mg/Ca ratio in the skin are indicative of fruits with increasing bitter pit susceptibility.
SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.
Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S
2017-04-01
A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through
Directory of Open Access Journals (Sweden)
Hideyuki Miyatake
Full Text Available In this study, we determined the crystal structure of N-terminal importin-β-binding domain (IBB-truncated human importin-α1 (ΔIBB-h-importin-α1 at 2.63 Å resolution. The crystal structure of ΔIBB-h-importin-α1 reveals a novel closed homodimer. The homodimer exists in an autoinhibited state in which both the major and minor nuclear localization signal (NLS binding sites are completely buried in the homodimerization interface, an arrangement that restricts NLS binding. Analytical ultracentrifugation studies revealed that ΔIBB-h-importin-α1 is in equilibrium between monomers and dimers and that NLS peptides shifted the equilibrium toward the monomer side. This finding suggests that the NLS binding sites are also involved in the dimer interface in solution. These results show that when the IBB domain dissociates from the internal NLS binding sites, e.g., by binding to importin-β, homodimerization possibly occurs as an autoinhibition state.
Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G
2015-01-01
Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971
Dzwairo, Bloodless; Hoko, Zvikomborero; Love, David; Guzha, Edward
In resource-poor and low-population-density areas, on-site sanitation is preferred to off-site sanitation and groundwater is the main source of water for domestic uses. Groundwater pollution potential from on-site sanitation in such areas conflicts with Integrated Water Resources Management (IWRM) principles that advocate for sustainable use of water resources. Given the widespread use of groundwater for domestic purposes in rural areas, maintaining groundwater quality is a critical livelihood intervention. This study assessed impacts of pit latrines on groundwater quality in Kamangira village, Marondera district, Zimbabwe. Groundwater samples from 14 monitoring boreholes and 3 shallow wells were analysed during 6 sampling campaigns, from February 2005 to May 2005. Parameters analysed were total and faecal coliforms, NH4+-N, NO3--N, conductivity, turbidity and pH, both for boreholes and shallow wells. Total and faecal coliforms both ranged 0-TNTC (too-numerous-to-count), 78% of results meeting the 0 CFU/100 ml WHO guidelines value. NH4+-N range was 0-2.0 mg/l, with 99% of results falling below the 1.5 mg/l WHO recommended value. NO3--N range was 0.0-6.7 mg/l, within 10 mg/l WHO guidelines value. The range for conductivity values was 46-370 μS/cm while the pH range was 6.8-7.9. There are no WHO guideline values for these two parameters. Turbidity ranged from 1 NTU to 45 NTU, 59% of results meeting the 5 NTU WHO guidelines limit. Depth from the ground surface to the water table for the period February 2005 to May 2005 was determined for all sampling points using a tape measure. The drop in water table averaged from 1.1 m to 1.9 m and these values were obtained by subtracting water table elevations from absolute ground surface elevation. Soil from the monitoring boreholes was classified as sandy. The soil infiltration layer was taken as the layer between the pit latrine bottom and the water table. It averaged from 1.3 m to 1.7 m above the water table for two latrines
Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel
2015-07-15
Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.
Three bunch energy stabilization for the SLC injector
International Nuclear Information System (INIS)
Sheppard, J.C.; Almog, I.; Bambade, P.S.; Clendenin, J.E.; Jobe, R.K.; Phinney, N.; Shoaee, H.; Stiening, R.F.; Thompson, K.A.
1986-09-01
Slow feedback has been developed to control the energy and energy spread of the beams which are injected into the SLC damping rings. Within a single RF pulse, two bunches of electrons and one bunch of positrons are accelerated to an energy of 1.21 GeV in the injector of the SLC. The two electron bunches are deflected into the north damping ring while the positrons are targeted into the south ring. In order to fit into the acceptance of the rings, the composite energy deviation and energy spread of the beams must be less than 2% full width. Control of the beam energy characteristics is accomplished with a set of computer controlled feedback loops which monitor the parameters of the three bunches and make adjustments to the available RF energy, RF phasing, and RF timing. This paper presents an overview of the feedback algorithms and of the special hardware developments, and reports on the operational status of the processes
Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans
2015-03-05
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Oxygen pitting failure of a bagasse boiler tube
CSIR Research Space (South Africa)
Heyes, AM
2001-04-01
Full Text Available Examination of a failed roof tube from a bagasse boiler showed transverse through-cracks and extensive pitting. The pitting was typically oxygen induced pitting and numerous fatigue cracks had started within these pits. It is highly probable...
Deterministic chaos in the pitting phenomena of passivable alloys
International Nuclear Information System (INIS)
Hoerle, Stephane
1998-01-01
It was shown that electrochemical noise recorded in stable pitting conditions exhibits deterministic (even chaotic) features. The occurrence of deterministic behaviors depend on the material/solution severity. Thus, electrolyte composition ([Cl - ]/[NO 3 - ] ratio, pH), passive film thickness or alloy composition can change the deterministic features. Only one pit is sufficient to observe deterministic behaviors. The electrochemical noise signals are non-stationary, which is a hint of a change with time in the pit behavior (propagation speed or mean). Modifications of electrolyte composition reveals transitions between random and deterministic behaviors. Spontaneous transitions between deterministic behaviors of different features (bifurcation) are also evidenced. Such bifurcations enlighten various routes to chaos. The routes to chaos and the features of chaotic signals allow to suggest the modeling (continuous and discontinuous models are proposed) of the electrochemical mechanisms inside a pit, that describe quite well the experimental behaviors and the effect of the various parameters. The analysis of the chaotic behaviors of a pit leads to a better understanding of propagation mechanisms and give tools for pit monitoring. (author) [fr
SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*
Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas
2010-01-01
Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830
MC1R gene variants involvement in human OCA phenotype
Saleha Shamim; Khan Taj Ali; Zafar Shaista
2016-01-01
Oculocutaneous albinism (OCA) is a genetic disorder of melanin synthesis that results in hypopigmentation in hair, skin and eyes. OCA has been reported in individuals from all ethnic backgrounds but it is more common among those with Europeans ancestry. OCA is heterogeneous group of disorders and seven types of OCA are caused by mutations in TYR (OCA1), OCA2 (OCA2), TYRP1 (OCA3), SLC45A2 (OCA4), SLC24A5 (OCA6) and C10oRF11 (OCA7) genes. However, MC1R gene variants have been reported that modi...
20 CFR 422.1 - Organization and functions.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Organization and functions. 422.1 Section 422.1 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ORGANIZATION AND PROCEDURES Organization and Functions of the Social Security Administration § 422.1 Organization and functions. (a) General. A complete...
Ion effects in the SLC electron damping ring under exceptionally poor vacuum conditions
International Nuclear Information System (INIS)
Zimmermann, F.; Krejcik, P.; Minty, M.; Pritzkau, D.; Raubenheimer, T.; Ross, M.; Woodley, M.
1997-10-01
In 1996, due to a catastrophic kicker chamber failure in the SLC electron damping ring, the ring vacuum system was contamianted for several months. During this time, the vertical emittance of the beam extracted from the ring was increased by a large factor (4--20). The emittance slowly decreased as the vacuum pressure gradually improved. At the same time, an intermittent vertical instability was observed. Both the emittance blow-up and the instability behavior depended strongly on beam current, ring pressure, number of bunches in the ring (1 or 2), duty cycle, store time and betatron tunes. In this report, the authors describe the observations, and compare them with predictions from classical ion-trapping and ion-instability theories
Analysis of disposal of uranium mill tailings in a mined out open pit
International Nuclear Information System (INIS)
Staub, W.P.; Triegel, E.K.
1978-08-01
Mined out open pits are presently under consideration as disposal sites for uranium mill tailings. In this method of tailings management, the escape of contaminated liquid into an adjacent aquifer is the principal environmental concern. The modified Bishop Method was used to analyze the structural stability of a clay liner along the highwall and fluid flow models were used to analyze the effect of tailings solutions on groundwater under several operating conditions. The slope stability of a clay liner was analyzed at three stages of operation: (1) near the beginning of construction, (2) when the pit is partially filled with tailings, and (3) at the end of construction. Both clay lined and unlined pits were considered in the fluid flow modeling. Finally, the seepage of tailings solutions through the clay liner was analyzed. Results of the slope stability analysis showed that it would be necessary to construct the clay liner as a modified form of engineered embankment. This embankment would be similar in construction to that of an earthfill dam. It could be constructed on a 1 : 1 slope provided the tailings slurry were managed properly. It would be necessary to maintain the freeboard height between the embankment and tailings at less than 4 m. A partially dewatered sand beach would have to be located adjacent to the embankment. Potential leakage and aquifer contamination was modeled for lined and unlined pits of various designs. Sulfate, and possibly U and Th, are the most likely contaminants. Results from the model showed the clay and soil cement lined pit to be most effective in containing the pollutants
Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice
Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo
2016-01-01
Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...
An Effective Gap Filtering Method for Landsat ETM+ SLC-Off Data
Directory of Open Access Journals (Sweden)
Seulki Lee
2016-01-01
Full Text Available The Landsat 7 Enhanced Thematic Mapper Plus (ETM+ scan line corrector (SLC failed on 31 May 2003, causing the SLC to turn off. Many gap-filled products were developed and deployed to combat this situation. The majority of these products used a primary image taken by the SLC when functioning properly in an attempt to correct SLC-off images. However, temporal atmospheric elements could not be reliably reflected using a primary image, and therefore the corrected image was not viable for use by monitoring systems. To bypass this limitation, this study has developed the Gap Interpolation and Filtering (GIF method that relies on one-dimensional interpolation filtering to conveniently recover pixels within a single image at a high level of accuracy without borrowing from images acquired at a different time or by another sensor. The GIF method was compared to two other methods—Global Linear Histogram Match (GLHM, and the Local Linear Histogram Match (LLHM—both developed by National Aeronautics and Space Administration (NASA and United States Geological Survey (USGS to determine its accuracy. The GIF method accuracy was found superior in land, sea, and cloud imaging. In particular, its sea and cloud images returned Root Mean Square Error (RMSE values close to or less than 1. We expect the GIF method developed in this research to be of invaluable aid to monitoring systems that depend heavily on Landsat imagery.
1988-08-01
su0.0001,4 from full depth of west0 wall of 23.656 lb. somple f5 , maso o~s ora atsow below exc Of test pit of teot pit. IL 4+ __ -H.~gv MASS GRADATION MASS...s * -W I * a am9 a a a 0 6 a a a a a a a a a a a Sa ~ ~ ~ o a’ a.1aa a a a a a a a a J . . a a a a acca aO a1 1 1 1 a aa a 1- a a 1 as- Is a1 a a a a
International Nuclear Information System (INIS)
Tsai, S.Y.; Peterson, J.M.; Winters, M.C.B.
1984-08-01
Results of the analysis of contaminant migration beneath the raffinate pits at the Weldon Spring Raffinate Pits site indicate that during a 10,000-year time period, the maximum concentrations in the water immediately beneath the pit bottoms would be about 4600 pCi/L of radium-226 (Pit 3) and about 12,000 pCi/L of uranium-238 (Pit 1); these concentrations would occur at the centers of the pit bottoms. Based on the assumptions used in this study, the radioactive contaminants in the pits would migrate no more than 2 m (7 ft) below the pit bottoms. Because 6 to 12 m (20 to 40 ft) of silty clays underlie the raffinate pits, the radioactive contaminants would take several tens of thousands of years to reach nearby groundwater supplies. Although the results of these analyses indicate that a high degree of confinement is provided by the four raffinate pits, it should be noted that the validity of such analyses rests on the quality of the parameter values utilized. Due to a lack of current site-specific data for some physical parameters, it has been necessary to use historical and regional data for these values. The values cited are at times inconsistent and contradictory, e.g., the wide range of values indicated for the permeability of clays underlying the pits. However, these were the only data available. The analysis reported herein indicates that within the limitations of the available data, use of the Raffinate Pits site for long-term management of radioactive materials such as those currently being stored in the four pits appears to be feasible. 24 references, 14 figures, 7 tables