WorldWideScience

Sample records for pig-a gene mutation

  1. CD48-deficient T-lymphocytes from DMBA-treated rats have de novo mutations in the endogenous Pig-a gene.

    Science.gov (United States)

    Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia

    2015-10-01

    A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.

  2. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Choi, Seong-Jun [Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Shim, Hosup, E-mail: shim@dku.edu [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Department of Physiology, Dankook University School of Medicine, Cheonan (Korea, Republic of)

    2014-10-03

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies.

  3. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    International Nuclear Information System (INIS)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung; Choi, Seong-Jun; Shim, Hosup

    2014-01-01

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies

  4. Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

    Science.gov (United States)

    Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

    2017-12-01

    We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

  5. Whole-genome resequencing reveals candidate mutations for pig prolificacy.

    Science.gov (United States)

    Li, Wen-Ting; Zhang, Meng-Meng; Li, Qi-Gang; Tang, Hui; Zhang, Li-Fan; Wang, Ke-Jun; Zhu, Mu-Zhen; Lu, Yun-Feng; Bao, Hai-Gang; Zhang, Yuan-Ming; Li, Qiu-Yan; Wu, Ke-Liang; Wu, Chang-Xin

    2017-12-20

    Changes in pig fertility have occurred as a result of domestication, but are not understood at the level of genetic variation. To identify variations potentially responsible for prolificacy, we sequenced the genomes of the highly prolific Taihu pig breed and four control breeds. Genes involved in embryogenesis and morphogenesis were targeted in the Taihu pig, consistent with the morphological differences observed between the Taihu pig and others during pregnancy. Additionally, excessive functional non-coding mutations have been specifically fixed or nearly fixed in the Taihu pig. We focused attention on an oestrogen response element (ERE) within the first intron of the bone morphogenetic protein receptor type-1B gene ( BMPR1B ) that overlaps with a known quantitative trait locus (QTL) for pig fecundity. Using 242 pigs from 30 different breeds, we confirmed that the genotype of the ERE was nearly fixed in the Taihu pig. ERE function was assessed by luciferase assays, examination of histological sections, chromatin immunoprecipitation, quantitative polymerase chain reactions, and western blots. The results suggest that the ERE may control pig prolificacy via the cis-regulation of BMPR1B expression. This study provides new insight into changes in reproductive performance and highlights the role of non-coding mutations in generating phenotypic diversity between breeds. © 2017 The Author(s).

  6. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

    Directory of Open Access Journals (Sweden)

    Simon Leuchs

    Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

  7. A splice mutation in the PHKG1 gene causes high glycogen content and low meat quality in pig skeletal muscle.

    Directory of Open Access Journals (Sweden)

    Junwu Ma

    2014-10-01

    Full Text Available Glycolytic potential (GP in skeletal muscle is economically important in the pig industry because of its effect on pork processing yield. We have previously mapped a major quantitative trait loci (QTL for GP on chromosome 3 in a White Duroc × Erhualian F2 intercross. We herein performed a systems genetic analysis to identify the causal variant underlying the phenotype QTL (pQTL. We first conducted genome-wide association analyses in the F2 intercross and an F19 Sutai pig population. The QTL was then refined to an 180-kb interval based on the 2-LOD drop method. We then performed expression QTL (eQTL mapping using muscle transcriptome data from 497 F2 animals. Within the QTL interval, only one gene (PHKG1 has a cis-eQTL that was colocolizated with pQTL peaked at the same SNP. The PHKG1 gene encodes a catalytic subunit of the phosphorylase kinase (PhK, which functions in the cascade activation of glycogen breakdown. Deep sequencing of PHKG1 revealed a point mutation (C>A in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon. The aberrant transcript induces nonsense-mediated decay, leading to lower protein level and weaker enzymatic activity in affected animals. The mutation causes an increase of 43% in GP and a decrease of>20% in water-holding capacity of pork. These effects were consistent across the F2 and Sutai populations, as well as Duroc × (Landrace × Yorkshire hybrid pigs. The unfavorable allele exists predominantly in Duroc-derived pigs. The findings provide new insights into understanding risk factors affecting glucose metabolism, and would greatly contribute to the genetic improvement of meat quality in Duroc related pigs.

  8. A splice mutation in the PHKG1 gene causes high glycogen content and low meat quality in pig skeletal muscle.

    Science.gov (United States)

    Ma, Junwu; Yang, Jie; Zhou, Lisheng; Ren, Jun; Liu, Xianxian; Zhang, Hui; Yang, Bin; Zhang, Zhiyan; Ma, Huanban; Xie, Xianhua; Xing, Yuyun; Guo, Yuanmei; Huang, Lusheng

    2014-10-01

    Glycolytic potential (GP) in skeletal muscle is economically important in the pig industry because of its effect on pork processing yield. We have previously mapped a major quantitative trait loci (QTL) for GP on chromosome 3 in a White Duroc × Erhualian F2 intercross. We herein performed a systems genetic analysis to identify the causal variant underlying the phenotype QTL (pQTL). We first conducted genome-wide association analyses in the F2 intercross and an F19 Sutai pig population. The QTL was then refined to an 180-kb interval based on the 2-LOD drop method. We then performed expression QTL (eQTL) mapping using muscle transcriptome data from 497 F2 animals. Within the QTL interval, only one gene (PHKG1) has a cis-eQTL that was colocolizated with pQTL peaked at the same SNP. The PHKG1 gene encodes a catalytic subunit of the phosphorylase kinase (PhK), which functions in the cascade activation of glycogen breakdown. Deep sequencing of PHKG1 revealed a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon. The aberrant transcript induces nonsense-mediated decay, leading to lower protein level and weaker enzymatic activity in affected animals. The mutation causes an increase of 43% in GP and a decrease of>20% in water-holding capacity of pork. These effects were consistent across the F2 and Sutai populations, as well as Duroc × (Landrace × Yorkshire) hybrid pigs. The unfavorable allele exists predominantly in Duroc-derived pigs. The findings provide new insights into understanding risk factors affecting glucose metabolism, and would greatly contribute to the genetic improvement of meat quality in Duroc related pigs.

  9. F4-related mutation and expression analysis of the aminopeptidase N gene in pigs.

    Science.gov (United States)

    Goetstouwers, T; Van Poucke, M; Nguyen, V U; Melkebeek, V; Coddens, A; Deforce, D; Cox, E; Peelman, L J

    2014-05-01

    Intestinal infections with F4 enterotoxigenic Escherichia coli (ETEC) are worldwide an important cause of diarrhea in neonatal and recently weaned pigs. Adherence of F4 ETEC to the small intestine by binding to specific receptors is mediated by F4 fimbriae. Porcine aminopeptidase N (ANPEP) was recently identified as a new F4 receptor. In this study, 7 coding mutations and 1 mutation in the 3' untranslated region (3' UTR)were identified in ANPEP by reverse transcriptase (RT-) PCR and sequencing using 3 F4 receptor-positive (F4R+) and 2 F4 receptor-negative (F4R-) pigs, which were F4 phenotyped based on the MUC4 TaqMan, oral immunization, and the in vitro villous adhesion assay. Three potential differential mutations (g.2615C > T, g.8214A > G, and g.16875C > G) identified by comparative analysis between the 3 F4R+ and 2 F4R- pigs were genotyped in 41 additional F4 phenotyped pigs. However, none of these 3 mutations could be associated with F4 ETEC susceptibility. In addition, the RT-PCR experiments did not reveal any differential expression or alternative splicing in the small intestine of F4R+ and F4R- pigs. In conclusion, we hypothesize that the difference in F4 binding to ANPEP is due to modifications in its carbohydrate moieties.

  10. Gene targeting and cloning in pigs using fetal liver derived cells.

    Science.gov (United States)

    Waghmare, Sanjeev K; Estrada, Jose; Reyes, Luz; Li, Ping; Ivary, Bess; Sidner, Richard A; Burlak, Chris; Tector, A Joseph

    2011-12-01

    Since there are no pig embryonic stem cells, pig genetic engineering is done in fetal fibroblasts that remain totipotent for only 3 to 5 wk. Nuclear donor cells that remain totipotent for longer periods of time would facilitate complicated genetic engineering in pigs. The goal of this study was to test the feasibility of using fetal liver-derived cells (FLDC) to perform gene targeting, and create a genetic knockout pig. FLDC were isolated and processed using a human liver stem cell protocol. Single copy α-1,3-galactosyl transferase knockout (GTKO) FLDCs were created using electroporation and neomycin resistant colonies were screened using PCR. Homozygous GTKO cells were created through loss of heterozygosity mutations in single GTKO FLDCs. Double GTKO FLDCs were used in somatic cell nuclear transfer (SCNT) to create GTKO pigs. FLDCs grew for more than 80 population doublings, maintaining normal karyotype. Gene targeting and loss of heterozygosity mutations produced homozygous GTKO FLDCs. FLDCs used in SCNT gave rise to homozygous GTKO pigs. FDLCs can be used in gene targeting and SCNT to produce genetically modified pigs. The increased life span in culture compared to fetal fibroblasts may facilitate genetic engineering in the pig. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only Sus scrofa chromosome 2p mutation affecting meat production and carcass traits in pigs: evidence from the effects of a cathepsin D (CTSD) gene polymorphism.

    Science.gov (United States)

    Fontanesi, L; Speroni, C; Buttazzoni, L; Scotti, E; Dall'Olio, S; Nanni Costa, L; Davoli, R; Russo, V

    2010-07-01

    The objective of this study was to evaluate the effects of mutations in 2 genes [IGF2 and cathepsin D (CTSD)] that map on the telomeric end of the p arm of SSC2. In this region, an imprinted QTL affecting muscle mass and fat deposition was reported, and the IGF2 intron3-g.3072G>A substitution was identified as the causative mutation. In the same chromosome region, we assigned, by linkage mapping, the CTSD gene, a lysosomal proteinase, for which we previously identified an SNP in the 3'-untranslated region (AM933484, g.70G>A). We have already shown strong effects of this CTSD mutation on several production traits in Italian Large White pigs, suggesting a possible independent role of this marker in fatness and meat deposition in pigs. To evaluate this hypothesis, after having refined the map position of the CTSD gene by radiation hybrid mapping, we analyzed the IGF2 and the CTSD polymorphisms in 270 Italian Large White and 311 Italian Duroc pigs, for which EBV and random residuals from fixed models were calculated for several traits. Different association analyses were carried out to distinguish the effects of the 2 close markers. In the Italian Large White pigs, the results for IGF2 were highly significant for all traits when using either EBV or random residuals (e.g., using EBV: lean cuts, P = 2.2 x 10(-18); ADG, P = 2.6 x 10(-16); backfat thickness, P = 2.2 x 10(-9); feed:gain ratio, P = 2.3 x 10(-9); ham weight, P = 1.5 x 10(-6)). No effect was observed for meat quality traits. The IGF2 intron3-g.3072G>A mutation did not show any association in the Italian Duroc pigs, probably because of the small variability at this polymorphic site for this breed. However, a significant association was evident for the CTSD marker (P production traits in Italian Duroc pigs (lean content, ADG, backfat thickness, feed:gain ratio) after excluding possible confounding effects of the IGF2 mutation. The effects of the CTSD g.70G>A mutation were also confirmed in a subset of Italian

  12. Coat colour phenotype of Qingyu pig is associated with polymorphisms of melanocortin receptor 1 gene.

    Science.gov (United States)

    Wu, Xiaoqian; Tan, Zhendong; Shen, Linyuan; Yang, Qiong; Cheng, Xiao; Liao, Kun; Bai, Lin; Shuai, Surong; Li, Mingzhou; Li, Xuewei; Zhang, Shunhua; Zhu, Li

    2017-07-01

    Qingyu pig, a Chinese indigenous pig breed, exhibits two types of coat colour phenotypes, including pure black and white with black spotting respectively. Melanocortin receptor 1 ( MC1R ) and agouti signaling protein ( ASIP ) are two widely reported pivotal genes that significantly affect the regulation of coat colour. The objectives of this study were to investigate whether the polymorphisms of these two genes are associated with coat colour and analyze the molecular mechanism of the coat colour separation in Qingyu pig. We studied the phenotype segregation and used polymerase chain reaction amplification and Sanger sequencing to investigate the polymorphism of MC1R and ASIP in 121 Qingyu pigs, consisting of 115 black and 6 white with black spotted pigs. Coat colour of Qingyu pig is associated with the polymorphisms of MC1R but not ASIP . We only found 2 haplotypes, E QY and E qy , based on the 13 observed mutations from MC1R gene. Among which, E qy presented a recessive inheritance mode in black spotted Qingyu pigs. Further analysis revealed a g.462-463CC insertion that caused a frameshift mutation and a premature stop codon, thus changed the first transmembrane domain completely and lost the remaining six transmembrane domains. Altogether, our results strongly support that the variety of Qingyu pig's coat colour is related to MC1R . Our findings indicated that black coat colour in Qingyu pig was dominant to white with black spotted phenotype and MC1R gene polymorphism was associated with coat colour separation in Qingyu pig.

  13. Coat colour phenotype of Qingyu pig is associated with polymorphisms of melanocortin receptor 1 gene

    Directory of Open Access Journals (Sweden)

    Xiaoqian Wu

    2017-07-01

    Full Text Available Objective Qingyu pig, a Chinese indigenous pig breed, exhibits two types of coat colour phenotypes, including pure black and white with black spotting respectively. Melanocortin receptor 1 (MC1R and agouti signaling protein (ASIP are two widely reported pivotal genes that significantly affect the regulation of coat colour. The objectives of this study were to investigate whether the polymorphisms of these two genes are associated with coat colour and analyze the molecular mechanism of the coat colour separation in Qingyu pig. Methods We studied the phenotype segregation and used polymerase chain reaction amplification and Sanger sequencing to investigate the polymorphism of MC1R and ASIP in 121 Qingyu pigs, consisting of 115 black and 6 white with black spotted pigs. Results Coat colour of Qingyu pig is associated with the polymorphisms of MC1R but not ASIP. We only found 2 haplotypes, EQY and Eqy, based on the 13 observed mutations from MC1R gene. Among which, Eqy presented a recessive inheritance mode in black spotted Qingyu pigs. Further analysis revealed a g.462–463CC insertion that caused a frameshift mutation and a premature stop codon, thus changed the first transmembrane domain completely and lost the remaining six transmembrane domains. Altogether, our results strongly support that the variety of Qingyu pig’s coat colour is related to MC1R. Conclusion Our findings indicated that black coat colour in Qingyu pig was dominant to white with black spotted phenotype and MC1R gene polymorphism was associated with coat colour separation in Qingyu pig.

  14. Pig model for diabetes

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a transgenic pig comprising a mutated IAPP gene and displaying a phenotype associated with diabetes. The invention also relates to a transgenic blastocyst, embryo, fetus, donor cell and/or cell nucleusderived from said transgenic pig. The invention further relates...... to use of the transgenic pig as a model system for studying therapy, treatment and/or prevention of diabetes....

  15. Complementation of essential yeast GPI mannosyltransferase mutations suggests a novel specificity for certain Trypanosoma and Plasmodium PigB proteins.

    Directory of Open Access Journals (Sweden)

    Leslie K Cortes

    Full Text Available The glycosylphosphatidylinositol (GPI anchor is an essential glycolipid that tethers certain eukaryotic proteins to the cell surface. The core structure of the GPI anchor is remarkably well conserved across evolution and consists of NH2-CH2-CH2-PO4-6Manα1,2Manα1,6Manα1,4-GlcNα1,6-myo-inositol-PO4-lipid. The glycan portion of this structure may be modified with various side-branching sugars or other compounds that are heterogeneous and differ from organism to organism. One such modification is an α(1,2-linked fourth mannose (Man-IV that is side-branched to the third mannose (Man-III of the trimannosyl core. In fungi and mammals, addition of Man-III and Man-IV occurs by two distinct Family 22 α(1,2-mannosyltransferases, Gpi10/PigB and Smp3/PigZ, respectively. However, in the five protozoan parasite genomes we examined, no genes encoding Smp3/PigZ proteins were observed, despite reports of tetramannosyl-GPI structures (Man4-GPIs being produced by some parasites. In this study, we tested the hypothesis that the Gpi10/PigB proteins produced by protozoan parasites have the ability to add both Man-III and Man-IV to GPI precursors. We used yeast genetics to test the in vivo specificity of Gpi10/PigB proteins from several Plasmodium and Trypanosoma species by examining their ability to restore viability to Saccharomyces cerevisiae strains harboring lethal defects in Man-III (gpi10Δ or Man-IV (smp3Δ addition to GPI precursor lipids. We demonstrate that genes encoding PigB enzymes from T. cruzi, T. congolense and P. falciparum are each capable of separately complementing essential gpi10Δ and smp3Δ mutations, while PIGB genes from T. vivax and T. brucei only complement gpi10Δ. Additionally, we show the ability of T. cruzi PIGB to robustly complement a gpi10Δ/smp3Δ double mutant. Our data suggest that certain Plasmodium and Trypanosoma PigB mannosyltransferases can transfer more than one mannose to GPI precursors in vivo, and suggest a novel

  16. Association of a missense mutation in the positional candidate gene glutamate receptor-interacting protein 1 with backfat thickness traits in pigs

    Directory of Open Access Journals (Sweden)

    Jae-Bong Lee

    2017-08-01

    Full Text Available Objective Previously, we reported quantitative trait loci (QTLs affecting backfat thickness (BFT traits on pig chromosome 5 (SW1482–SW963 in an F2 intercross population between Landrace and Korean native pigs. The aim of this study was to evaluate glutamate receptor-interacting protein 1 (GRIP1 as a positional candidate gene underlying the QTL affecting BFT traits. Methods Genotype and phenotype analyses were performed using the 1,105 F2 progeny. A mixed-effect linear model was used to access association between these single nucleotide polymorphism (SNP markers and the BFT traits in the F2 intercross population. Results Highly significant associations of two informative SNPs (c.2442 T>C, c.3316 C>G [R1106G] in GRIP1 with BFT traits were detected. In addition, the two SNPs were used to construct haplotypes that were also highly associated with the BFT traits. Conclusion The SNPs and haplotypes of the GRIP1 gene determined in this study can contribute to understand the genetic structure of BFT traits in pigs.

  17. [Study of gene mutation in 62 hemophilia A children].

    Science.gov (United States)

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

  18. Generation of a miniature pig disease model for human Laron syndrome.

    Science.gov (United States)

    Cui, Dan; Li, Fang; Li, Qiuyan; Li, Jia; Zhao, Yaofeng; Hu, Xiaoxiang; Zhang, Ran; Li, Ning

    2015-10-29

    Laron syndrome is a rare disease caused by mutations of the growth hormone receptor (GHR), inheriting in an autosomal manner. To better understand the pathogenesis and to develop therapeutics, we generated a miniature pig model for this disease by employing ZFNs to knock out GHR gene. Three types of F0 heterozygous pigs (GHR(+/4bp), GHR(+/2bp), GHR(+/3bp)) were obtained and in which no significant phenotypes of Laron syndrome were observed. Prior to breed heterozygous pigs to homozygosity (GHR(4bp/4bp)), pig GHR transcript with the 4 bp insert was evaluated in vitro and was found to localize to the cytoplasm rather than the membrane. Moreover, this mutated transcript lost most of its signal transduction capability, although it could bind bGH. GHR(4bp/4bp) pigs showed a small body size and reduced body weight. Biochemically, these pigs exhibited significantly elevated levels of GH and decreased levels of IGF-I. These results resemble the phenotype observed in Laron patients, suggesting that these pigs could serve as an ideal model for Laron syndrome to bridge the gaps between mouse model and human.

  19. Generation of a miniature pig disease model for human Laron syndrome

    OpenAIRE

    Dan Cui; Fang Li; Qiuyan Li; Jia Li; Yaofeng Zhao; Xiaoxiang Hu; Ran Zhang; Ning Li

    2015-01-01

    Laron syndrome is a rare disease caused by mutations of the growth hormone receptor (GHR), inheriting in an autosomal manner. To better understand the pathogenesis and to develop therapeutics, we generated a miniature pig model for this disease by employing ZFNs to knock out GHR gene. Three types of F0 heterozygous pigs (GHR+/4bp, GHR+/2bp, GHR+/3bp) were obtained and in which no significant phenotypes of Laron syndrome were observed. Prior to breed heterozygous pigs to homozygosity (GHR4bp/4...

  20. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  1. Mutation analysis with random DNA identifiers (MARDI) catalogs Pig-a mutations in heterogeneous pools of CD48-deficient T cells derived from DMBA-treated rats.

    Science.gov (United States)

    Revollo, Javier R; Crabtree, Nathaniel M; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Dobrovolsky, Vasily N

    2016-03-01

    Identification of mutations induced by xenotoxins is a common task in the field of genetic toxicology. Mutations are often detected by clonally expanding potential mutant cells and genotyping each viable clone by Sanger sequencing. Such a "clone-by-clone" approach requires significant time and effort, and sometimes is even impossible to implement. Alternative techniques for efficient mutation identification would greatly benefit both basic and regulatory genetic toxicology research. Here, we report the development of Mutation Analysis with Random DNA Identifiers (MARDI), a novel high-fidelity Next Generation Sequencing (NGS) approach that circumvents clonal expansion and directly catalogs mutations in pools of mutant cells. MARDI uses oligonucleotides carrying Random DNA Identifiers (RDIs) to tag progenitor DNA molecules before PCR amplification, enabling clustering of descendant DNA molecules and eliminating NGS- and PCR-induced sequencing artifacts. When applied to the Pig-a cDNA analysis of heterogeneous pools of CD48-deficient T cells derived from DMBA-treated rats, MARDI detected nearly all Pig-a mutations that were previously identified by conventional clone-by-clone analysis and discovered many additional ones consistent with DMBA exposure: mostly A to T transversions, with the mutated A located on the non-transcribed DNA strand. © 2015 Wiley Periodicals, Inc.

  2. Creation of miniature pig model of human Waardenburg syndrome type 2A by ENU mutagenesis.

    Science.gov (United States)

    Hai, Tang; Guo, Weiwei; Yao, Jing; Cao, Chunwei; Luo, Ailing; Qi, Meng; Wang, Xianlong; Wang, Xiao; Huang, Jiaojiao; Zhang, Ying; Zhang, Hongyong; Wang, Dayu; Shang, Haitao; Hong, Qianlong; Zhang, Rui; Jia, Qitao; Zheng, Qiantao; Qin, Guosong; Li, Yongshun; Zhang, Tao; Jin, Weiwu; Chen, Zheng-Yi; Wang, Hongmei; Zhou, Qi; Meng, Anming; Wei, Hong; Yang, Shiming; Zhao, Jianguo

    2017-11-01

    Human Waardenburg syndrome 2A (WS2A) is a dominant hearing loss (HL) syndrome caused by mutations in the microphthalmia-associated transcription factor (MITF) gene. In mouse models with MITF mutations, WS2A is transmitted in a recessive pattern, which limits the study of hearing loss (HL) pathology. In the current study, we performed ENU (ethylnitrosourea) mutagenesis that resulted in substituting a conserved lysine with a serine (p. L247S) in the DNA-binding domain of the MITF gene to generate a novel miniature pig model of WS2A. The heterozygous mutant pig (MITF +/L247S ) exhibits a dominant form of profound HL and hypopigmentation in skin, hair, and iris, accompanied by degeneration of stria vascularis (SV), fused hair cells, and the absence of endocochlear potential, which indicate the pathology of human WS2A. Besides hypopigmentation and bilateral HL, the homozygous mutant pig (MITF L247S/L247S ) and CRISPR/Cas9-mediated MITF bi-allelic knockout pigs both exhibited anophthalmia. Three WS2 patients carrying MITF mutations adjacent to the corresponding region were also identified. The pig models resemble the clinical symptom and molecular pathology of human WS2A patients perfectly, which will provide new clues for better understanding the etiology and development of novel treatment strategies for human HL.

  3. Expression studies of the obesity candidate gene FTO in pig

    DEFF Research Database (Denmark)

    Madsen, Majbritt Busk; Birck, Malene Muusfeldt; Fredholm, Merete

    2010-01-01

    Obesity is an increasing problem worldwide and research on candidate genes in good animal models is highly needed. The pig is an excellent model as its metabolism, organ size, and eating habits resemble that of humans. The present study is focused on the characterization of the fat mass and obesity...... associated gene (FTO) in pig. This gene has recently been associated with increased body mass index in several human populations. To establish information on the expression profile of FTO in the pig we performed quantitative PCR in a panel of adult pig tissues and in tissues sampled at different...... and cerebellum). Additionally, in order to see the involvement of the FTO gene in obesity, the changes in expression level were investigated in a nutritional study in brain of Gottingen minipigs under a high cholesterol diet. Significantly higher (P

  4. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

    Directory of Open Access Journals (Sweden)

    Yongda Zhao

    2018-04-01

    Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

  5. The microRNA, miR-29c, participates in muscle development through targeting the YY1 gene and is associated with postmortem muscle pH in pigs

    Directory of Open Access Journals (Sweden)

    Weiya ZHANG,Wei WEI,Yuanyuan ZHAO,Shuhong ZHAO,Xinyun LI

    2015-12-01

    Full Text Available Previous studies indicated that miR-29c is important for muscle development in mice and human, but its role in pigs is unknown. In this study, we detected the expression of miR-29c in Meishan longissimus lumborum (LL muscle. The results showed that miR-29c was gradually upregulated during development of skeletal muscle in pig. Moreover, the expression of YY1 and Akt3 genes, which were confirmed to be targeted by miR-29c in mice, was decreased along with muscle development. Furthermore, the expression level of miR-29c was significantly higher in adult Meishan pigs than Large White pigs, while the expression of YY1 and Akt3 genes was significantly lower in Meishan pigs. These results indicated that the expression pattern of miR-29c was opposite to that of YY1 and Akt3 genes in pigs. Also, the luciferase assay indicated that miR-29s can target the YY1 gene in pigs. In addition, we identified a T to C mutation in the primary transcript of miR-29c, which was associated with the postmortem muscle pH in pigs. Based on these results, we concluded that miR-29c is also important in skeletal muscle development of pigs.

  6. Mapping and annotating obesity-related genes in pig and human genomes.

    Science.gov (United States)

    Martelli, Pier Luigi; Fontanesi, Luca; Piovesan, Damiano; Fariselli, Piero; Casadio, Rita

    2014-01-01

    Background. Obesity is a major health problem in both developed and emerging countries. Obesity is a complex disease whose etiology involves genetic factors in strong interplay with environmental determinants and lifestyle. The discovery of genetic factors and biological pathways underlying human obesity is hampered by the difficulty in controlling the genetic background of human cohorts. Animal models are then necessary to further dissect the genetics of obesity. Pig has emerged as one of the most attractive models, because of the similarity with humans in the mechanisms regulating the fat deposition. Results. We collected the genes related to obesity in humans and to fat deposition traits in pig. We localized them on both human and pig genomes, building a map useful to interpret comparative studies on obesity. We characterized the collected genes structurally and functionally with BAR+ and mapped them on KEGG pathways and on STRING protein interaction network. Conclusions. The collected set consists of 361 obesity related genes in human and pig genomes. All genes were mapped on the human genome, and 54 could not be localized on the pig genome (release 2012). Only for 3 human genes there is no counterpart in pig, confirming that this animal is a good model for human obesity studies. Obesity related genes are mostly involved in regulation and signaling processes/pathways and relevant connection emerges between obesity-related genes and diseases such as cancer and infectious diseases.

  7. Molecular cloning, sequence identification and expression profile of domestic guinea pig (Cavia porcellus UGT1A1 gene

    Directory of Open Access Journals (Sweden)

    Yang Deming

    2016-01-01

    Full Text Available Domestic guinea pig is a model animal for human disease research. Uridine diphosphate glucuronosyltransferase 1 family, polypeptide A1 (UGT1A1 is an important human disease-related gene. In this study, the complete coding sequence of domestic guinea pig gene UGT1A1 was amplified by reverse transcription-polymerase chain reaction. The open reading frame of the domestic guinea pig UGT1A1 gene is 1602 bp in length and was found to encode a protein of 533 amino acids. Sequence analysis revealed that the UGT1A1 protein of domestic guinea pig shared high homology with the UGT1A1 proteins of degu (84%, damara mole-rat (84%, human (80%, northern white-cheeked gibbon (80%, Colobus angolensis palliatus (80% and golden snub-nosed monkey (79%. This gene contains five exons and four introns, as revealed by the computer-assisted analysis. The results also showed that the domestic guinea pig UGT1A1 gene had a close genetic relationship with the UGT1A1 gene of degu. The prediction of transmembrane helices showed that domestic guinea pig UGT1A1 might be a transmembrane protein. Expression profile analysis indicated that the domestic guinea pig UGT1A1 gene was differentially expressed in detected domestic guinea pig tissues. Our experiment laid a primary foundation for using the domestic guinea pig as a model animal to study the UGT1A1-related human diseases.

  8. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    OpenAIRE

    Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B

    2010-01-01

    Abstract Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multip...

  9. Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

    Science.gov (United States)

    Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

    2015-06-01

    The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

  10. DRUMS: a human disease related unique gene mutation search engine.

    Science.gov (United States)

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  11. Production of transgenic pigs over-expressing the antiviral gene Mx1

    Directory of Open Access Journals (Sweden)

    Quanmei Yan

    2014-01-01

    Full Text Available The myxovirus resistance gene (Mx1 has a broad spectrum of antiviral activities. It is therefore an interesting candidate gene to improve disease resistance in farm animals. In this study, we report the use of somatic cell nuclear transfer (SCNT to produce transgenic pigs over-expressing the Mx1 gene. These transgenic pigs express approximately 15–25 times more Mx1 mRNA than non-transgenic pigs, and the protein level of Mx1 was also markedly enhanced. We challenged fibroblast cells isolated from the ear skin of transgenic and control pigs with influenza A virus and classical swine fever virus (CFSV. Indirect immunofluorescence assay (IFA revealed a profound decrease of influenza A proliferation in Mx1 transgenic cells. Growth kinetics showed an approximately 10-fold reduction of viral copies in the transgenic cells compared to non-transgenic controls. Additionally, we found that the Mx1 transgenic cells were more resistant to CSFV infection in comparison to non-transgenic cells. These results demonstrate that the Mx1 transgene can protect against viral infection in cells of transgenic pigs and indicate that the Mx1 transgene can be harnessed to develop disease-resistant pigs.

  12. Differential gene expression profile in pig adipose tissue treated with/without clenbuterol

    Directory of Open Access Journals (Sweden)

    Deng Xue M

    2007-11-01

    Full Text Available Abstract Background Clenbuterol, a beta-agonist, can dramatically reduce pig adipose accumulation at high dosages. However, it has been banned in pig production because people who eat pig products treated with clenbuterol can be poisoned by the clenbuterol residues. To understand the molecular mechanism for this fat reduction, cDNA microarray, real-time PCR, two-dimensional electrophoresis and mass spectra were used to study the differential gene expression profiles of pig adipose tissues treated with/without clenbuterol. The objective of this research is to identify novel genes and physiological pathways that potentially facilitate clenbuterol induced reduction of adipose accumulation. Results Clenbuterol was found to improve the lean meat percentage about 10 percent (P Conclusion Pig fat accumulation was reduced dramatically with clenbuterol treatment. Histological sections and global evaluation of gene expression after administration of clenbuterol in pigs identified profound changes in adipose cells. With clenbuterol stimulation, adipose cell volumes decreased and their gene expression profile changed, which indicate some metabolism processes have been also altered. Although the biological functions of the differentially expressed genes are not completely known, higher expressions of these molecules in adipose tissue might contribute to the reduction of fat accumulation. Among these genes, five lipid metabolism related genes were of special interest for further study, including apoD and apoR. The apoR expression was increased at both the RNA and protein levels. The apoR may be one of the critical molecules through which clenbuterol reduces fat accumulation.

  13. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    Science.gov (United States)

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

  14. Understanding the molecular mechanisms of human microtia via a pig model of HOXA1 syndrome

    Directory of Open Access Journals (Sweden)

    Ruimin Qiao

    2015-06-01

    Full Text Available Microtia is a congenital malformation of the outer ears. Although both genetic and environmental components have been implicated in microtia, the genetic causes of this innate disorder are poorly understood. Pigs have naturally occurring diseases comparable to those in humans, providing exceptional opportunity to dissect the molecular mechanism of human inherited diseases. Here we first demonstrated that a truncating mutation in HOXA1 causes a monogenic disorder of microtia in pigs. We further performed RNA sequencing (RNA-Seq analysis on affected and healthy pig embryos (day 14.25. We identified a list of 337 differentially expressed genes (DEGs between the normal and mutant samples, shedding light on the transcriptional network involving HOXA1. The DEGs are enriched in biological processes related to cardiovascular system and embryonic development, and neurological, renal and urological diseases. Aberrant expressions of many DEGs have been implicated in human innate deformities corresponding to microtia-associated syndromes. After applying three prioritizing algorithms, we highlighted appealing candidate genes for human microtia from the 337 DEGs. We searched for coding variants of functional significance within six candidate genes in 147 microtia-affected individuals. Of note, we identified one EVC2 non-synonymous mutation (p.Asp1174Asn as a potential disease-implicating variant for a human microtia-associated syndrome. The findings advance our understanding of the molecular mechanisms underlying human microtia, and provide an interesting example of the characterization of human disease-predisposing variants using pig models.

  15. Mutated genes as research tool

    International Nuclear Information System (INIS)

    1981-01-01

    Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of

  16. Functional CD1d and/or NKT cell invariant chain transcript in horse, pig, African elephant and guinea pig, but not in ruminants.

    Science.gov (United States)

    Looringh van Beeck, Frank A; Reinink, Peter; Hermsen, Roel; Zajonc, Dirk M; Laven, Marielle J; Fun, Axel; Troskie, Milana; Schoemaker, Nico J; Morar, Darshana; Lenstra, Johannes A; Vervelde, Lonneke; Rutten, Victor P M G; van Eden, Willem; Van Rhijn, Ildiko

    2009-04-01

    CD1d-restricted invariant natural killer T cells (NKT cells) have been well characterized in humans and mice, but it is unknown whether they are present in other species. Here we describe the invariant TCR alpha chain and the full length CD1d transcript of pig and horse. Molecular modeling predicts that porcine (po) invariant TCR alpha chain/poCD1d/alpha-GalCer and equine (eq) invariant TCR alpha chain/eqCD1d/alpha-GalCer form complexes that are highly homologous to the human complex. Since a prerequisite for the presence of NKT cells is the expression of CD1d protein, we performed searches for CD1D genes and CD1d transcripts in multiple species. Previously, cattle and guinea pig have been suggested to lack CD1D genes. The CD1D genes of European taurine cattle (Bos taurus) are known to be pseudogenes because of disrupting mutations in the start codon and in the donor splice site of the first intron. Here we show that the same mutations are found in six other ruminants: African buffalo, sheep, bushbuck, bongo, N'Dama cattle, and roe deer. In contrast, intact CD1d transcripts were found in guinea pig, African elephant, horse, rabbit, and pig. Despite the discovery of a highly homologous NKT/CD1d system in pig and horse, our data suggest that functional CD1D and CD1d-restricted NKT cells are not universally present in mammals.

  17. X-ray induced dominant lethal mutations in mature and immature oocytes of guinea-pigs and golden hamsters

    International Nuclear Information System (INIS)

    Cox, B.D.; Lyon, M.F.

    1975-01-01

    The induction of dominant lethal mutations by doses of 100-400 rad X-rays in oocytes of the guinea-pig and golden hamster was studied using criteria of embryonic mortality. For both species higher yields were obtained from mature than from immature oocytes. Data on fertility indicated that in the golden hamster immature oocytes were more sensitive to killing by X-rays than mature oocytes but that the converse was true in the guinea-pig. The dose-response relationship for mutation to dominant lethals in pre-ovulatory oocytes of guinea-pigs and golden hamsters was linear, both when based on pre- and post-implantation loss only. The rate per unit dose was higher for the golden hamster, and the old golden hamsters were possibly slightly more sensitive than young ones

  18. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human.

    Science.gov (United States)

    Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B

    2010-07-30

    Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc) groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%), while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively). Multireplicons were found associated with all three sul genes. Sul genes were distributed widely in E. coli isolated

  19. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    Directory of Open Access Journals (Sweden)

    Hammerum Anette M

    2010-07-01

    Full Text Available Abstract Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3 in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%, while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively. Multireplicons were found associated with all three sul genes

  20. Pilot study of large-scale production of mutant pigs by ENU mutagenesis.

    Science.gov (United States)

    Hai, Tang; Cao, Chunwei; Shang, Haitao; Guo, Weiwei; Mu, Yanshuang; Yang, Shulin; Zhang, Ying; Zheng, Qiantao; Zhang, Tao; Wang, Xianlong; Liu, Yu; Kong, Qingran; Li, Kui; Wang, Dayu; Qi, Meng; Hong, Qianlong; Zhang, Rui; Wang, Xiupeng; Jia, Qitao; Wang, Xiao; Qin, Guosong; Li, Yongshun; Luo, Ailing; Jin, Weiwu; Yao, Jing; Huang, Jiaojiao; Zhang, Hongyong; Li, Menghua; Xie, Xiangmo; Zheng, Xuejuan; Guo, Kenan; Wang, Qinghua; Zhang, Shibin; Li, Liang; Xie, Fei; Zhang, Yu; Weng, Xiaogang; Yin, Zhi; Hu, Kui; Cong, Yimei; Zheng, Peng; Zou, Hailong; Xin, Leilei; Xia, Jihan; Ruan, Jinxue; Li, Hegang; Zhao, Weiming; Yuan, Jing; Liu, Zizhan; Gu, Weiwang; Li, Ming; Wang, Yong; Wang, Hongmei; Yang, Shiming; Liu, Zhonghua; Wei, Hong; Zhao, Jianguo; Zhou, Qi; Meng, Anming

    2017-06-22

    N-ethyl-N-nitrosourea (ENU) mutagenesis is a powerful tool to generate mutants on a large scale efficiently, and to discover genes with novel functions at the whole-genome level in Caenorhabditis elegans, flies, zebrafish and mice, but it has never been tried in large model animals. We describe a successful systematic three-generation ENU mutagenesis screening in pigs with the establishment of the Chinese Swine Mutagenesis Consortium. A total of 6,770 G1 and 6,800 G3 pigs were screened, 36 dominant and 91 recessive novel pig families with various phenotypes were established. The causative mutations in 10 mutant families were further mapped. As examples, the mutation of SOX10 (R109W) in pig causes inner ear malfunctions and mimics human Mondini dysplasia, and upregulated expression of FBXO32 is associated with congenital splay legs. This study demonstrates the feasibility of artificial random mutagenesis in pigs and opens an avenue for generating a reservoir of mutants for agricultural production and biomedical research.

  1. Efficient Generation of Orthologous Point Mutations in Pigs via CRISPR-assisted ssODN-mediated Homology-directed Repair

    Directory of Open Access Journals (Sweden)

    Kankan Wang

    2016-01-01

    Full Text Available Precise genome editing in livestock is of great value for the fundamental investigation of disease modeling. However, genetically modified pigs carrying subtle point mutations were still seldom reported despite the rapid development of programmable endonucleases. Here, we attempt to investigate single-stranded oligonucleotides (ssODN mediated knockin by introducing two orthologous pathogenic mutations, p.E693G for Alzheimer's disease and p.G2019S for Parkinson's disease, into porcine APP and LRRK2 loci, respectively. Desirable homology-directed repair (HDR efficiency was achieved in porcine fetal fibroblasts (PFFs by optimizing the dosage and length of ssODN templates. Interestingly, incomplete HDR alleles harboring partial point mutations were observed in single-cell colonies, which indicate the complex mechanism of ssODN-mediated HDR. The effect of mutation-to-cut distance on incorporation rate was further analyzed by deep sequencing. We demonstrated that a mutation-to-cut distance of 11 bp resulted in a remarkable difference in HDR efficiency between two point mutations. Finally, we successfully obtained one cloned piglet harboring the orthologous p.C313Y mutation at the MSTN locus via somatic cell nuclear transfer (SCNT. Our proof-of-concept study demonstrated efficient ssODN-mediated incorporation of pathogenic point mutations in porcine somatic cells, thus facilitating further development of disease modeling and genetic breeding in pigs.

  2. Test for positional candidate genes for body composition on pig chromosome 6

    Directory of Open Access Journals (Sweden)

    Pérez-Enciso Miguel

    2002-07-01

    Full Text Available Abstract One QTL affecting backfat thickness (BF, intramuscular fat content (IMF and eye muscle area (MA was previously localized on porcine chromosome 6 in an F2 cross between Iberian and Landrace pigs. This work was done to study the effect of two positional candidate genes on these traits: H-FABP and LEPR genes. The QTL mapping analysis was repeated with a regression method using genotypes for seven microsatellites and two PCR-RFLPs in the H-FABP and LEPR genes. H-FABP and LEPR genes were located at 85.4 and 107 cM respectively, by linkage analysis. The effects of the candidate gene polymorphisms were analyzed in two ways. When an animal model was fitted, both genes showed significant effects on fatness traits, the H-FABP polymorphism showed significant effects on IMF and MA, and the LEPR polymorphism on BF and IMF. But when the candidate gene effect was included in a QTL regression analysis these associations were not observed, suggesting that they must not be the causal mutations responsible for the effects found. Differences in the results of both analyses showed the inadequacy of the animal model approach for the evaluation of positional candidate genes in populations with linkage disequilibrium, when the probabilities of the parental origin of the QTL alleles are not included in the model.

  3. A novel mutation of the fibrillin gene causing Ectopia lentis

    Energy Technology Data Exchange (ETDEWEB)

    Loennqvist, L.; Kainulainen, K.; Puhakka, L.; Peltonen, L. (National Public Health Institute, Helsinki (Finland)); Child, A. (St. George' s Hospital Medical School, London (United Kingdom)); Peltonen, L. (Duncan Guthrie Institute, Glasgow, Scotland (United Kingdom))

    1994-02-01

    Ectopia lentis (EL), a dominantly inherited connective tissue disorder, has been genetically linked to the fibrillin gene on chromosome 15 (FBN1) in earlier studies. Here, the authors report the first EL mutation in the FBN1 gene confirming that EL is caused by mutations of this gene. So far, several mutations in the FBN1 gene have been reported in patients with Marfan syndrome (MFS). EL and MFS are clinically related but distinct conditions with typical manifestations in the ocular and skeletal systems, the fundamental difference between them being the absence of cardiovascular involvement in EL. They report a point mutation, cosegregating with the disease in the described family, that displays EL over four generations. The mutation changes a conserved glutamic acid residue in an EGF-like motif, which is the major structural component of the fibrillin and is repeated throughout the polypeptide. In vitro mutagenetic studies have demonstrated the necessity of an analogous glutamic acid residue for calcium binding in an EGF-like repeat of human factor IX. This provides a possible explanation for the role of this mutation in the disease pathogenesis. 32 refs., 2 figs., 1 tab.

  4. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    Directory of Open Access Journals (Sweden)

    Maryam Taghdiri

    2017-08-01

    Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  5. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

    Science.gov (United States)

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  6. Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    LYU Tingxia

    2016-08-01

    Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

  7. A selective genotyping approach identifies single nucleotide polymorphisms in porcine chromosome 2 genes associated with production and carcass traits in Italian heavy pigs

    Directory of Open Access Journals (Sweden)

    Vincenzo Russo

    2011-04-01

    Full Text Available Several studies have shown that porcine chromosome 2 (SSC2 harbors important quantitative trait loci (QTL for production traits. In particular, an imprinted QTL for muscle mass production is determined by a mutation in the IGF2 gene (intron3-g.3072G>A. We recently identified and analysed single nucleotide polymorphisms (SNPs in genes (cathepsin D, CTSD g.70G>A; cathepsin F, CTSF g.22G>C; lactate dehydrogenase A, LDHA g.46G>T localized on SSC2 (including the IGF2 intron3-g.3072G>A SNP showing association with production traits in Italian Large White pigs and/or localizing them on QTL regions. Here we analysed these markers applying a selective genotyping approach based on estimated breeding values (EBVs. Three groups of Italian Large White pigs each made by animals with the most positive (n. 50 and most negative (n. 50 EBVs for average daily gain (ADG, backfat thickness (BFT or weight of lean cuts (LC and one group of Italian Duroc pigs made by 50 animals with most positive and 50 animals with most negative EBV for visible intermuscular fat (VIF were genotyped. In Italian Large White pigs, allele frequency differences for the IGF2 intron3-g.3072G>A SNP between the two extreme tails for all groups were highly significant (considering all analysed animals: P=9.53E-20 for LC; P=3.16E-15 for BFT; P=4.41E-6 for ADG. Significant allele frequency differences were also observed for the CTSD g.70G>A (P=0.0002 for ADG; P=0.00068 and LDHA g.46G>T (P=2.32E-5 for ADG polymorphisms. These results provide further support on the effects of these polymorphisms or genes whose application on marker assisted selection programs could be envisaged.

  8. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  9. TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    T. W. Hoffman

    2016-01-01

    Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.

  10. The rate of spontaneous mutations in human myeloid cells

    International Nuclear Information System (INIS)

    Araten, David J.; Krejci, Ondrej; DiTata, Kimberly; Wunderlich, Mark; Sanders, Katie J.; Zamechek, Leah; Mulloy, James C.

    2013-01-01

    Highlights: • We provide the first measurement of the mutation rate (μ) in human myeloid cells. • μ is measured to be 3.6–23 × 10 −7 per cell division. • The AML-ETO and MLL-AF9 fusions do not seem to increase μ. • Cooperating mutations in NRAS, FLT3 and p53 not seem to increase μ. • Hypermutability may be required to explain leukemogenesis. - Abstract: The mutation rate (μ) is likely to be a key parameter in leukemogenesis, but historically, it has been difficult to measure in humans. The PIG-A gene has some advantages for the detection of spontaneous mutations because it is X-linked, and therefore only one mutation is required to disrupt its function. Furthermore, the PIG-A-null phenotype is readily detected by flow cytometry. Using PIG-A, we have now provided the first in vitro measurement of μ in myeloid cells, using cultures of CD34+ cells that are transduced with either the AML-ETO or the MLL-AF9 fusion genes and expanded with cytokines. For the AML-ETO cultures, the median μ value was ∼9.4 × 10 −7 (range ∼3.6–23 × 10 −7 ) per cell division. In contrast, few spontaneous mutations were observed in the MLL-AF9 cultures. Knockdown of p53 or introduction of mutant NRAS or FLT3 alleles did not have much of an effect on μ. Based on these data, we provide a model to predict whether hypermutability must occur in the process of leukemogenesis

  11. A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

    Directory of Open Access Journals (Sweden)

    NING Huibin

    2017-01-01

    Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

  12. Hereditary cancer genes are highly susceptible to splicing mutations

    Science.gov (United States)

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  13. Hereditary cancer genes are highly susceptible to splicing mutations.

    Directory of Open Access Journals (Sweden)

    Christy L Rhine

    2018-03-01

    Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.

  14. Effect of polymorphism in the peroxisome proliferator-activated receptor gamma gene on litter size of pigs.

    Science.gov (United States)

    Wang, Guiying; Kong, Lujun; Hu, Peng; Fu, Jinlian; Wang, Aiguo

    2011-03-01

    The association of polymorphisms in peroxisome proliferator-activated receptor γ (PPARγ) gene with litter size was studied in Large White and Landrace pig. Three SNP loci (P1, P2 and P7) on PPARγ(2) gene were determined by PCR-SSCP and the results showed that there were A → G mutations at 220 and 324 bp in 5'-regulator region and at 147 bp in exon 6, respectively. Allele frequencies were analysed in two breeds. Information on 2341 litter records from 564 sows was used to analyse the trait total number born (TNB) and number born alive (NBA). In Large White, TNB and NBA of genotype BB for P2 locus were the lowest, and the TNB and NBA of third and following parities and all parities were 0.74 and 0.51 piglets per litter less (P NBA of the first parity of genotype BB for P1 locus were 2.0 piglets per litter higher than AA (P NBA of genotype BB were 0.66 and 0.97 piglets per litter (P NBA of the second parity of genotype AA were obviously higher than those of AB (P NBA of each parity of genotype AA were both about 2 piglets per litter more than those of BB (P < 0.05). The results indicated that PPARγ gene was significantly associated with litter size in pigs.

  15. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    Science.gov (United States)

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  16. Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.

    Science.gov (United States)

    Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle

    2016-10-01

    Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.

  17. Association between selected antimicrobial resistance genes and antimicrobial exposure in Danish pig farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Hisham Beshara Halasa, Tariq; Græsbøll, Kaare

    2017-01-01

    Bacterial antimicrobial resistance (AMR) in pigs is an important public health concern due to its possible transfer to humans. We aimed at quantifying the relationship between the lifetime exposure of antimicrobials and seven antimicrobial resistance genes in Danish slaughter pig farms. AMR gene...... levels were quantified by qPCR of total-community DNA in faecal samples obtained from 681 batches of slaughter pigs. The lifetime exposure to antimicrobials was estimated at batch level for the piglet, weaner, and finisher periods individually for the sampled batches. We showed that the effect...... of antimicrobial exposure on the levels of AMR genes was complex and unique for each individual gene. Several antimicrobial classes had both negative and positive correlations with the AMR genes. From 10-42% of the variation in AMR gene levels could be explained in the final regression models, indicating...

  18. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    Science.gov (United States)

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  19. A genome-wide association study points out the causal implication of SOX9 in the sex-reversal phenotype in XX pigs.

    Directory of Open Access Journals (Sweden)

    Sarah Rousseau

    Full Text Available Among farm animals, pigs are known to show XX sex-reversal. In such cases the individuals are genetically female but exhibit a hermaphroditism, or a male phenotype. While the frequency of this congenital disease is quite low (less than 1%, the economic losses are significant for pig breeders. These losses result from sterility, urogenital infections and the carcasses being downgraded because of the risk of boar taint. It has been clearly demonstrated that the SRY gene is not involved in most cases of sex-reversal in pigs, and that autosomal recessive mutations remain to be discovered. A whole-genome scan analysis was performed in the French Large-White population to identify candidate genes: 38 families comprising the two non-affected parents and 1 to 11 sex-reversed full-sib piglets were genotyped with the PorcineSNP60 BeadChip. A Transmission Disequilibrium Test revealed a highly significant candidate region on SSC12 (most significant p-value<4.65.10(-10 containing the SOX9 gene. SOX9, one of the master genes involved in testis differentiation, was sequenced together with one of its main regulatory region Tesco. However, no causal mutations could be identified in either of the two sequenced regions. Further haplotype analyses did not identify a shared homozygous segment between the affected pigs, suggesting either a lack of power due to the SNP properties of the chip, or a second causative locus. Together with information from humans and mice, this study in pigs adds to the field of knowledge, which will lead to characterization of novel molecular mechanisms regulating sexual differentiation and dysregulation in cases of sex reversal.

  20. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  1. Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates

    Directory of Open Access Journals (Sweden)

    Soudabeh Heidari

    2013-09-01

    Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.

  2. INFLUENCE OF GENETIC POLYMORPHISM IN FABP3 AND LEPR GENES ON INTRAMUSCULAR FAT CONTENT IN PIG CARCASSES

    Directory of Open Access Journals (Sweden)

    Kristina Budimir

    2014-06-01

    Full Text Available Intensive production conditions, selection directed to increase the percentage of muscle tissue in carcasses and consumer demand have led to a reduction of intramuscular fat content in pig carcasses. Intramuscular fat is a factor affecting the flavor, juiciness and tenderness of pork meat. FABP protein family causes the differences in the content of intramuscular fat in different pig breeds. FABP3 and LEPR gene are candidate genes for intramuscular fat content and their polymorphisms explain the variability that can occur in different pig breeds. The aim of this paper is to demonstrate the influence of genes on different intramuscular fat content in pig carcasses due to pigs genotype.

  3. Loss-of-function myostatin mutation increases insulin sensitivity and browning of white fat in Meishan pigs.

    Science.gov (United States)

    Cai, Chunbo; Qian, Lili; Jiang, Shengwang; Sun, Youde; Wang, Qingqing; Ma, Dezun; Xiao, Gaojun; Li, Biao; Xie, Shanshan; Gao, Ting; Chen, Yaoxing; Liu, Jie; An, Xiaorong; Cui, Wentao; Li, Kui

    2017-05-23

    Myostatin-deficient mice showed a remarkable hypertrophy of skeletal muscle, with a decreased fat mass and enhanced insulin sensitivity. Currently, it is unclear if the inhibition of myostatin could be used as an approach to treat human obesity and insulin resistance. In this study, we investigated if the inhibition of porcine myostatin has any effect on fat deposition and insulin sensitivity using genetically engineered Meishan pigs containing a myostatin loss-of-function mutation (Mstn -/- ). Our results indicated that, when compared with wild-type pigs, the amount of subcutaneous fat and leaf fat of Mstn -/- pigs were significantly decreased mainly due to the browning of subcutaneous adipose tissue. Additionally, the serum insulin level decreased and the insulin sensitivity increased significantly in Mstn -/- pigs. Moreover, we found a significant increase in levels of insulin receptor and insulin receptor substrate proteins in skeletal muscle of Mstn -/- pigs, which then activating the insulin signaling pathway. Irisin-mediated regulation is not the only pathway for the activation of insulin signal in Mstn -/- skeletal muscle. This study provides valuable insight for the treatment of human obesity and diabetes mellitus.

  4. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  5. Mutation update for the PORCN gene

    DEFF Research Database (Denmark)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum......, the pentalogy of Cantrell and Limb-Body Wall Complex. Here we present a review of the published mutations in the PORCN gene to date and report on seven new mutations together with the corresponding clinical data. Based on the review we have created a Web-based locus-specific database that lists all identified...... variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...

  6. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    Science.gov (United States)

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  7. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...

  8. Distribution and linkage disequilibrium analysis of polymorphisms of GH1 gene in different populations of pigs associated with body size.

    Science.gov (United States)

    Cheng, Yunyun; Liu, Songcai; Su, Dan; Lu, Chao; Zhang, Xin; Wu, Qingyan; Li, Siming; Fu, Haoyu; Yu, Hao; Hao, Linlin

    2016-03-01

    Growth hormone (GH) has been considered as a candidate gene for growth and body size in pigs. In this study, polymorphisms of the GH1 gene were evaluated for associations with body size traits in 190 pig individuals. Seventeen single-nucleotide polymorphisms (SNPs) were identified in GH1 gene of the large pig breeds and miniature pig breeds using direct sequencing and genotyped by allele-specific PCR approach. Notably, six (g.237A>G, g.283T>C, g.309A>G, g.318A>G, g.540A>G and g.544A>G) of them were significantly associated with body size, of which three loci (g.283T>C, g.309A>G, g.318A>G) located in the signal-peptide coding region of GH1 gene compose a CGG haplotype for large pigs and TAA haplotype for miniature pigs (P G and g.544A>G) located in the second intron of GH1 gene compose a GG haplotype for large pigs and AA haplotype for miniature pigs (P body size of pigs providing genetic basis for pig breeding with the improved economic benefits.

  9. KMeyeDB: a graphical database of mutations in genes that cause eye diseases.

    Science.gov (United States)

    Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei

    2010-06-01

    KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.

  10. [FANCA gene mutation analysis in Fanconi anemia patients].

    Science.gov (United States)

    Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo

    2005-10-01

    To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.

  11. Splice Site Mutations in the ATP7A Gene

    DEFF Research Database (Denmark)

    Skjørringe, Tina; Tümer, Zeynep; Møller, Lisbeth Birk

    2011-01-01

    Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12...... mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation...... to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations...

  12. Glucokinase gene mutations (MODY 2) in Asian Indians.

    Science.gov (United States)

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  13. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  14. Mutated Genes in Schizophrenia Map to Brain Networks

    Science.gov (United States)

    ... Matters NIH Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks ... have a high number of spontaneous mutations in genes that form a network in the front region ...

  15. Generation of CMAHKO/GTKO/shTNFRI-Fc/HO-1 quadruple gene modified pigs.

    Science.gov (United States)

    Kim, Geon A; Lee, Eun Mi; Jin, Jun-Xue; Lee, Sanghoon; Taweechaipaisankul, Anukul; Hwang, Jong Ik; Alam, Zahid; Ahn, Curie; Lee, Byeong Chun

    2017-08-01

    As an alternative source of organs for transplantation into humans, attention has been directed to pigs due to their similarities in biological features and organ size. However, severe immune rejection has prevented successful xenotransplantation using pig organs and tissues. To overcome immune rejection, recently developed genetic engineering systems such as TALEN coupled with somatic cell nuclear transfer (SCNT) to make embryos could be used to produce pigs compatible with xenotransplantation. We used the TALEN system to target the non-Gal antigen cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene in pigs that is naturally deleted in humans. Gal-deleted cells expressing both soluble human tumor necrosis factor receptor I IgG 1 -Fc (shTNFRI-Fc) and human hemagglutinin -tagged-human heme oxygenase-1 (hHO-1) were transfected with a TALEN target for CMAH. Cells lacking CMAH were negatively selected using N-glyconeuraminic acid (Neu5Gc)/magnetic beads and the level of Neu5Gc expression of isolated cells were analyzed by FACS and DNA sequencing. Cloned embryos using 3 different genetically modified cell clones were respectively transferred into 3 recipients, with 55.6% (5/9) becoming pregnant and three cloned pigs were produced. Successful genetic disruption of the CMAH gene was confirmed by sequencing, showing lack of expression of CMAH in tail-derived fibroblasts of the cloned piglets. Besides decreased expression of Neu5Gc in piglets produced by SCNT, antibody-mediated complement-dependent cytotoxicity assays and natural antibody binding for examining immuno-reactivity of the quadruple gene modified pigs derived from endothelial cells and fibroblasts were reduced significantly compared to those of wild type animals. We conclude that by combining the TALEN system and transgenic cells, targeting of multiple genes could be useful for generating organs for xenotransplantation. We produced miniature pigs with quadruple modified genes CMAHKO

  16. ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Amit Kumar Tiwari

    2016-11-01

    Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

  17. Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

  18. Using microarrays to identify positional candidate genes for QTL: the case study of ACTH response in pigs

    DEFF Research Database (Denmark)

    Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence

    2009-01-01

    this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH) Results: Different approaches to localize the differentially expressed (DE) genes to the pig genome....... Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also...

  19. Highly efficient generation of GGTA1 biallelic knockout inbred mini-pigs with TALENs.

    Directory of Open Access Journals (Sweden)

    Jige Xin

    Full Text Available Inbred mini-pigs are ideal organ donors for future human xenotransplantations because of their clear genetic background, high homozygosity, and high inbreeding endurance. In this study, we chose fibroblast cells from a highly inbred pig line called Banna mini-pig inbred line (BMI as donor nuclei for nuclear transfer, combining with transcription activator-like effector nucleases (TALENs and successfully generated α-1,3-galactosyltransferase (GGTA1 gene biallelic knockout (KO pigs. To validate the efficiency of TALEN vectors, in vitro-transcribed TALEN mRNAs were microinjected into one-cell stage parthenogenetically activated porcine embryos. The efficiency of indel mutations at the GGTA1-targeting loci was as high as 73.1% (19/26 among the parthenogenetic blastocysts. TALENs were co-transfected into porcine fetal fibroblasts of BMI with a plasmid containing neomycin gene. The targeting efficiency reached 89.5% (187/209 among the survived cell clones after a 10 d selection. More remarkably 27.8% (58/209 of colonies were biallelic KO. Five fibroblast cell lines with biallelic KO were chosen as nuclear donors for somatic cell nuclear transfer (SCNT. Three miniature piglets with biallelic mutations of the GGTA1 gene were achieved. Gal epitopes on the surface of cells from all the three biallelic KO piglets were completely absent. The fibroblasts from the GGTA1 null piglets were more resistant to lysis by pooled complement-preserved normal human serum than those from wild-type pigs. These results indicate that a combination of TALENs technology with SCNT can generate biallelic KO pigs directly with high efficiency. The GGTA1 null piglets with inbred features created in this study can provide a new organ source for xenotransplantation research.

  20. Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Diaz-Llopis Manuel

    2011-10-01

    Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.

  1. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    Science.gov (United States)

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  2. A novel missense mutation of ADAR1 gene in a Chinese family ...

    Indian Academy of Sciences (India)

    This study was mainlyto explore the pathogenic mutation of ADAR1 gene and provide genetics counselling and prenatal diagnostic testing for childbearing individuals.Mutational analysis of ADAR1 gene was performed by polymerase chain reaction (PCR) and electrophoretic separation of PCR products by 1.5% agarose ...

  3. Efficient Gene Delivery to Pig Airway Epithelia and Submucosal Glands Using Helper-Dependent Adenoviral Vectors

    Directory of Open Access Journals (Sweden)

    Huibi Cao

    2013-01-01

    Full Text Available Airway gene delivery is a promising strategy to treat patients with life-threatening lung diseases such as cystic fibrosis (CF. However, this strategy has to be evaluated in large animal preclinical studies in order to translate it to human applications. Because of anatomic and physiological similarities between the human and pig lungs, we utilized pig as a large animal model to examine the safety and efficiency of airway gene delivery with helper-dependent adenoviral vectors. Helper-dependent vectors carrying human CFTR or reporter gene LacZ were aerosolized intratracheally into pigs under bronchoscopic guidance. We found that the LacZ reporter and hCFTR transgene products were efficiently expressed in lung airway epithelial cells. The transgene vectors with this delivery can also reach to submucosal glands. Moreover, the hCFTR transgene protein localized to the apical membrane of both ciliated and nonciliated epithelial cells, mirroring the location of wild-type CF transmembrane conductance regulator (CFTR. Aerosol delivery procedure was well tolerated by pigs without showing systemic toxicity based on the limited number of pigs tested. These results provide important insights into developing clinical strategies for human CF lung gene therapy.

  4. Diverse growth hormone receptor gene mutations in Laron syndrome.

    Science.gov (United States)

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  5. Gene mutations in children with chronic pancreatitis.

    Science.gov (United States)

    Witt, H

    2001-01-01

    In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

  6. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  7. A novel lipoprotein lipase gene missense mutation in Chinese patients with severe hypertriglyceridemia and pancreatitis

    Science.gov (United States)

    2014-01-01

    Background Alterations or mutations in the lipoprotein lipase (LPL) gene contribute to severe hypertriglyceridemia (HTG). This study reported on two patients in a Chinese family with LPL gene mutations and severe HTG and acute pancreatitis. Methods Two patients with other five family members were included in this study for DNA-sequences of hyperlipidemia-related genes (such as LPL, APOC2, APOA5, LMF1, and GPIHBP1) and 43 healthy individuals and 70 HTG subjects were included for the screening of LPL gene mutations. Results Both patients were found to have a compound heterozygote for a novel LPL gene mutation (L279V) and a known mutation (A98T). Furthermore, one HTG subject out of 70 was found to carry this novel LPL L279V mutation. Conclusions The data from this study showed that compound heterozygote mutations of A98T and L279V inactivate lipoprotein lipase enzymatic activity and contribute to severe HTG and acute pancreatitis in two Chinese patients. Further study will investigate how these LPL gene mutations genetically inactivate the LPL enzyme. PMID:24646025

  8. Characterization of pig-associated methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Li, Jun; Jiang, Nansong; Ke, Yuebin; Feßler, Andrea T; Wang, Yang; Schwarz, Stefan; Wu, Congming

    2017-03-01

    Livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) have been reported in various countries worldwide. However, although China is one of the biggest pig and pork producers, large-scale studies on pig-associated LA-MRSA from China are scarce. The aims of this study were to analyze 2420 non-duplicate samples collected from pigs at swine farms and slaughterhouses in different regions in China during 2014 for the prevalence of pig-associated MRSA and to determine the antimicrobial resistance pheno- and genotypes of the respective isolates. MRSA isolates were identified in 270 (11.2%) samples. The isolates were characterized by antimicrobial susceptibility testing, multilocus sequence typing (MLST), spa typing, pulsed-field gel electrophoresis (PFGE) and screening for resistance genes. All MRSA isolates belonged to the clonal complex 9 and spa type t899, but showed variable PFGE patterns. All isolates were non-susceptible to oxacillin, cefoxitin, clindamycin, chloramphenicol, florfenicol, ciprofloxacin, and valnemulin. High rates of resistance were also observed for tetracycline (99.6%), erythromycin (97.0%), quinupristin-dalfopristin (97.0%), and gentamicin (80.4%). Three linezolid-non-susceptible isolates containing the multi-resistance gene cfr and nine rifampicin-non-susceptible isolates with mutations in rpoB were detected. Resistance to β-lactams was exclusively associated with mecA, while phenicol resistance was mainly attributable to fexA, except in the three cfr-positive isolates. The pleuromutilin-lincosamide-streptogramin A resistance gene lsa(E) was identified in all MRSA isolates, and no other pleuromutilin resistance genes, except cfr in three isolates, were detected. Pigs are the most important hosts of LA-MRSA in China. Screening for pig-associated MRSA is necessary to monitor changes in epidemiology and characteristics of these important pathogens. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Congenital Hypothyroidism Caused by a PAX8 Gene Mutation Manifested as Sodium/Iodide Symporter Gene Defect

    Directory of Open Access Journals (Sweden)

    Wakako Jo

    2010-01-01

    Full Text Available Loss-of-function mutations of the PAX8 gene are considered to mainly cause congenital hypothyroidism (CH due to thyroid hypoplasia. However, some patients with PAX8 mutation have demonstrated a normal-sized thyroid gland. Here we report a CH patient caused by a PAX8 mutation, which manifested as iodide transport defect (ITD. Hypothyroidism was detected by neonatal screening and L-thyroxine replacement was started immediately. Although 123I scintigraphy at 5 years of age showed that the thyroid gland was in the normal position and of small size, his iodide trapping was low. The ratio of the saliva/plasma radioactive iodide was low. He did not have goiter; however laboratory findings suggested that he had partial ITD. Gene analyses showed that the sodium/iodide symporter (NIS gene was normal; instead, a mutation in the PAX8 gene causing R31H substitution was identified. The present report demonstrates that individuals with defective PAX8 can have partial ITD, and thus genetic analysis is useful for differential diagnosis.

  10. A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

    Science.gov (United States)

    Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

    2003-04-08

    We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

  11. A genome-wide association study points out the causal implication of SOX9 in the sex-reversal phenotype in XX pigs.

    Science.gov (United States)

    Rousseau, Sarah; Iannuccelli, Nathalie; Mercat, Marie-José; Naylies, Claire; Thouly, Jean-Claude; Servin, Bertrand; Milan, Denis; Pailhoux, Eric; Riquet, Juliette

    2013-01-01

    Among farm animals, pigs are known to show XX sex-reversal. In such cases the individuals are genetically female but exhibit a hermaphroditism, or a male phenotype. While the frequency of this congenital disease is quite low (less than 1%), the economic losses are significant for pig breeders. These losses result from sterility, urogenital infections and the carcasses being downgraded because of the risk of boar taint. It has been clearly demonstrated that the SRY gene is not involved in most cases of sex-reversal in pigs, and that autosomal recessive mutations remain to be discovered. A whole-genome scan analysis was performed in the French Large-White population to identify candidate genes: 38 families comprising the two non-affected parents and 1 to 11 sex-reversed full-sib piglets were genotyped with the PorcineSNP60 BeadChip. A Transmission Disequilibrium Test revealed a highly significant candidate region on SSC12 (most significant p-valueTesco. However, no causal mutations could be identified in either of the two sequenced regions. Further haplotype analyses did not identify a shared homozygous segment between the affected pigs, suggesting either a lack of power due to the SNP properties of the chip, or a second causative locus. Together with information from humans and mice, this study in pigs adds to the field of knowledge, which will lead to characterization of novel molecular mechanisms regulating sexual differentiation and dysregulation in cases of sex reversal.

  12. Mutations of alpha-galactosidase A gene in two unusual cases of Fabry disease

    NARCIS (Netherlands)

    Beyer, EM; Kopishinskaya, SV; Van Amstel, JKP; Tsvetkova, [No Value

    1999-01-01

    The mutation analysis of alpha-galactosidase A gene was carried out in two families with Fabry disease described by us earlier. In the family P. a new point mutation E341K (a G to A transition at position 10999 of the gene) was identified. The mutation causes a Glu341Lys substitution in

  13. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  14. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  15. Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

    Directory of Open Access Journals (Sweden)

    Jenifer L Marks

    2007-05-01

    Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

  16. Using microarrays to identify positional candidate genes for QTL: the case study of ACTH response in pigs.

    Science.gov (United States)

    Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence; Buitenhuis, Bart; Hornshøj, Henrik; SanCristobal, Magali; Mormède, Pierre; de Koning, D J

    2009-07-16

    Microarray studies can supplement QTL studies by suggesting potential candidate genes in the QTL regions, which by themselves are too large to provide a limited selection of candidate genes. Here we provide a case study where we explore ways to integrate QTL data and microarray data for the pig, which has only a partial genome sequence. We outline various procedures to localize differentially expressed genes on the pig genome and link this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH). Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also, differentially expressed genes underlying QTL for ACTH response were described. Using the latest version of the draft sequence, the differentially expressed genes were mapped to the pig genome. This enabled co-location of DE genes and previously studied QTL regions, but the draft genome sequence is still incomplete and will contain many errors. A further step to explore links between DE genes and QTL at the pathway level was largely unsuccessful due to the lack of annotation of the pig genome. This could be improved by further comparative mapping analyses but this would be time consuming. This paper provides a case study for the integration of QTL data and microarray data for a species with limited genome sequence information and annotation. The results illustrate the challenges that must be addressed but also provide a roadmap for future work that is applicable to other non-model species.

  17. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  18. Hemochromatosis C282Y gene mutation as a potential susceptibility ...

    African Journals Online (AJOL)

    G.M. Mokhtar

    2017-08-12

    Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

  19. [Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

    Science.gov (United States)

    Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei

    2008-06-01

    To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

  20. Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Dunham Stephen

    2009-11-01

    Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

  1. Analysis of GPR101 and AIP genes mutations in acromegaly: a multicentric study.

    Science.gov (United States)

    Ferraù, Francesco; Romeo, P D; Puglisi, S; Ragonese, M; Torre, M L; Scaroni, C; Occhi, G; De Menis, E; Arnaldi, G; Trimarchi, F; Cannavò, S

    2016-12-01

    This multicentric study aimed to investigate the prevalence of the G protein-coupled receptor 101 (GPR101) p.E308D variant and aryl hydrocarbon receptor interacting protein (AIP) gene mutations in a representative cohort of Italian patients with acromegaly. 215 patients with GH-secreting pituitary adenomas, referred to 4 Italian referral centres for pituitary diseases, have been included. Three cases of gigantism were present. Five cases were classified as FIPA. All the patients have been screened for germline AIP gene mutations and GPR101 gene p.E308D variant. Heterozygous AIP gene variants have been found in 7 patients (3.2 %). Five patients carried an AIP mutation (2.3 %; 4 females): 3 patients harboured the p.R3O4Q mutation, one had the p.R304* mutation and the last one the IVS3+1G>A mutation. The prevalence of AIP mutations was 3.3 % and 2.8 % when considering only the patients diagnosed when they were <30 or <40-year old, respectively. Furthermore, 2.0 % of the patients with a pituitary macroadenoma and 4.2 % of patients resistant to somatostatin analogues treatment were found to harbour an AIP gene mutation. None of the patients was found to carry the GPR101 p.E308D variant. The prevalence of AIP gene mutations among our sporadic and familial acromegaly cases was similar to that one reported in previous studies, but lower when considering only the cases diagnosed before 40 years of age. The GPR101 p.E308D change is unlikely to have a role in somatotroph adenomas tumorigenesis, since none of our sporadic or familial patients tested positive for this variant.

  2. Spatial patterns of antimicrobial resistance genes in a cross-sectional sample of pig farms with indoor non-organic production of finishers

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, Annette Kjær; Hisham Beshara Halasa, Tariq

    2017-01-01

    Antimicrobial resistance (AMR) in pig populations is a public health concern. There is a lack of information of spatial distributions of AMR genes in pig populations at large scales. The objective of the study was to describe the spatial pattern of AMR genes in faecal samples from pig farms...... spatial clusters were identified for ermB, ermF, sulII and tet(W). The broad spatial trends in AMR resistance evident in the risk maps were in agreement with the results of the cluster analysis. However, they also showed that there were only small scale spatial differences in the gene levels. We conclude...

  3. CRISPR-Cas9 gene editing in honeybee and pig

    DEFF Research Database (Denmark)

    Pen, Anja

    2018-01-01

    Creating animal models by using genome modification has gotten significantly more accessible thanks to the CRISPR-Cas9 technique. In this study, we aimed to the implement the CRISPR-Cas9 methodology in the European honeybee (Apis mellifera) and pig (Sus scrofa) for generation of animal models. We...... want to use these animal models to study the development of honeybees and the pathology of amyotrophic lateral sclerosis (ALS) in a pig model of human disease. In order to simplify the production of these animal models, we test the use of sperm mediated gene transfer (SMGT) in combination with CRISPR...... mechanisms of honeybee development using genome modification will aid in uncovering these complex genetic regulatory systems. In honeybees, we have attempted to induce genome modification in the cinnabar gene through microinjection and feeding of CRISPR-Cas9 components to larvae. Additionally, we tested...

  4. Subclinical hyperthyroidism due to a thyrotropin receptor (TSHR) gene mutation (S505R).

    Science.gov (United States)

    Pohlenz, Joachim; Pfarr, Nicole; Krüger, Silvia; Hesse, Volker

    2006-12-01

    To identify the molecular defect by which non-autoimmune subclinical hyperthyroidism was caused in a 6-mo-old infant who presented with weight loss. Congenital non-autoimmune hyperthyroidism is caused by activating germline mutations in the thyrotropin receptor (TSHR) gene. Therefore, the TSHR gene was sequenced directly from the patient's genomic DNA. Molecular analysis revealed a heterozygous point mutation (S505R) in the TSHR gene as the underlying defect. A constitutively activating mutation in the TSHR gene has to be considered not only in patients with severe congenital non-autoimmune hyperthyroidism, but also in children with subclinical non-autoimmune hyperthyroidism.

  5. Mutations of the Norrie gene in Korean ROP infants.

    Science.gov (United States)

    Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

    2002-12-01

    The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

  6. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  7. Mutation update for the PORCN gene

    NARCIS (Netherlands)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo; Lampe, Anne; Gabbett, Michael T.; Ousager, Lillian Bomme; van der Smagt, Jasper J.; Soller, Maria; Stattin, Eva-Lena; Mannens, Marcel A. M. M.; Smigiel, Robert; Hennekam, Raoul C.

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum,

  8. Mutation scanning of peach floral genes

    Directory of Open Access Journals (Sweden)

    Wilde H Dayton

    2011-05-01

    Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.

  9. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  10. WS1 gene mutation analysis of Wolfram syndrome in a Chinese patient and a systematic review of literatures.

    Science.gov (United States)

    Yu, Guang; Yu, Man-li; Wang, Jia-feng; Gao, Cong-rong; Chen, Zhong-jin

    2010-10-01

    Wolfram syndrome is a rare hereditary disease characterized by diabetes mellitus and optic atrophy. The outcome of this disease is always poor. WFS1 gene mutation is the main cause of this disease. A patient with diabetes mellitus, diabetes insipidus, renal tract disorder, psychiatric abnormality, and cataract was diagnosed with Wolfram syndrome. Mutations in open reading frame (ORF) of WFS1 gene was analyzed by sequencing. Mutations in WFS1 gene was also summarized by a systematic review in Pubmed and Chinese biological and medical database. Sequencing of WFS1 gene in this patient showed a new mutation, 1962G>A, and two other non-sense mutations, 2433A>G and 2565G>A. Systematic review included 219 patients in total and identified 172 WFS1 gene mutations, most of which were located in Exon 8. These mutations in WFS1 gene might be useful in prenatal diagnosis of Wolfram syndrome.

  11. A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.

    Science.gov (United States)

    Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah

    2016-05-01

    Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.

  12. Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

    Science.gov (United States)

    Nakazawa, M; Wada, Y; Tamai, M

    1998-04-01

    To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

  13. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  14. HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.

    Science.gov (United States)

    Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent

    2017-07-01

    HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.

  15. Epidural Analgesia with Ropivacaine during Labour in a Patient with a SCN5A Gene Mutation

    Directory of Open Access Journals (Sweden)

    A. L. M. J. van der Knijff-van Dortmont

    2016-01-01

    Full Text Available SCN5A gene mutations can lead to ion channel defects which can cause cardiac conduction disturbances. In the presence of specific ECG characteristics, this mutation is called Brugada syndrome. Many drugs are associated with adverse events, making anesthesia in patients with SCN5A gene mutations or Brugada syndrome challenging. In this case report, we describe a pregnant patient with this mutation who received epidural analgesia using low dose ropivacaine and sufentanil during labour.

  16. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  17. Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.

    Directory of Open Access Journals (Sweden)

    Jian Wang

    Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.

  18. The Human Gene Mutation Database: building a comprehensive mutation repository for clinical and molecular genetics, diagnostic testing and personalized genomic medicine.

    Science.gov (United States)

    Stenson, Peter D; Mort, Matthew; Ball, Edward V; Shaw, Katy; Phillips, Andrew; Cooper, David N

    2014-01-01

    The Human Gene Mutation Database (HGMD®) is a comprehensive collection of germline mutations in nuclear genes that underlie, or are associated with, human inherited disease. By June 2013, the database contained over 141,000 different lesions detected in over 5,700 different genes, with new mutation entries currently accumulating at a rate exceeding 10,000 per annum. HGMD was originally established in 1996 for the scientific study of mutational mechanisms in human genes. However, it has since acquired a much broader utility as a central unified disease-oriented mutation repository utilized by human molecular geneticists, genome scientists, molecular biologists, clinicians and genetic counsellors as well as by those specializing in biopharmaceuticals, bioinformatics and personalized genomics. The public version of HGMD (http://www.hgmd.org) is freely available to registered users from academic institutions/non-profit organizations whilst the subscription version (HGMD Professional) is available to academic, clinical and commercial users under license via BIOBASE GmbH.

  19. Gene mutations in hepatocellular adenomas

    DEFF Research Database (Denmark)

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  20. A Haplotype Information Theory Method Reveals Genes of Evolutionary Interest in European vs. Asian Pigs.

    Science.gov (United States)

    Hudson, Nicholas J; Naval-Sánchez, Marina; Porto-Neto, Laercio; Pérez-Enciso, Miguel; Reverter, Antonio

    2018-06-05

    Asian and European wild boars were independently domesticated ca. 10,000 years ago. Since the 17th century, Chinese breeds have been imported to Europe to improve the genetics of European animals by introgression of favourable alleles, resulting in a complex mosaic of haplotypes. To interrogate the structure of these haplotypes further, we have run a new haplotype segregation analysis based on information theory, namely compression efficiency (CE). We applied the approach to sequence data from individuals from each phylogeographic region (n = 23 from Asia and Europe) including a number of major pig breeds. Our genome-wide CE is able to discriminate the breeds in a manner reflecting phylogeography. Furthermore, 24,956 non-overlapping sliding windows (each comprising 1,000 consecutive SNP) were quantified for extent of haplotype sharing within and between Asia and Europe. The genome-wide distribution of extent of haplotype sharing was quite different between groups. Unlike European pigs, Asian pigs haplotype sharing approximates a normal distribution. In line with this, we found the European breeds possessed a number of genomic windows of dramatically higher haplotype sharing than the Asian breeds. Our CE analysis of sliding windows capture some of the genomic regions reported to contain signatures of selection in domestic pigs. Prominent among these regions, we highlight the role of a gene encoding the mitochondrial enzyme LACTB which has been associated with obesity, and the gene encoding MYOG a fundamental transcriptional regulator of myogenesis. The origin of these regions likely reflects either a population bottleneck in European animals, or selective targets on commercial phenotypes reducing allelic diversity in particular genes and/or regulatory regions.

  1. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    Science.gov (United States)

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  2. Thyroglobulin Gene Mutation with Cold Nodule on Thyroid Scintigraphy

    Directory of Open Access Journals (Sweden)

    Toshio Kahara

    2012-01-01

    Full Text Available Thyroglobulin gene mutation is a rare cause of congenital hypothyroidism, but thyroglobulin gene mutations are thought to be associated with thyroid cancer development. A 21-year-old Japanese man treated with levothyroxine for congenital hypothyroidism had an enlarged thyroid gland with undetectable serum thyroglobulin despite elevated serum TSH level. The patient was diagnosed with thyroglobulin gene mutation, with compound heterozygosity for Gly304Cys missense mutation and Arg432X nonsense mutation. Ultrasonography showed a hypovascular large tumor in the left lobe that appeared as a cold nodule on thyroid scintigraphy. He underwent total thyroidectomy, but pathological study did not reveal findings of thyroid carcinoma, but rather a hyperplastic nodule with hemorrhage. Strong cytoplasmic thyroglobulin immunostaining was observed, but sodium iodide symporter immunostaining was hardly detected in the hyperplastic nodule. The clinical characteristics of patients with thyroglobulin gene mutations are diverse, and some patients are diagnosed by chance on examination of goiter in adults. The presence of thyroid tumors that appear as cold nodules on thyroid scintigraphy should consider the potential for thyroid carcinoma, if the patient has relatively low serum thyroglobulin concentration in relation to the degree of TSH without thyroglobulin autoantibody.

  3. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  4. Mutations in the Norrie disease gene.

    Science.gov (United States)

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

    Science.gov (United States)

    Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

    2017-08-01

    Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

  6. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    Science.gov (United States)

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  7. A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

    Science.gov (United States)

    Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

    2014-07-01

    In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

  8. The IGF2-intron3-G3072A substitution explains a major imprinted QTL effect on backfat thickness in a Meishan x European white pig intercross

    NARCIS (Netherlands)

    Jungerius, B.J.; Laere, van A.S.; Pas, te M.F.W.; Oost, van B.A.; Andersson, L.; Groenen, M.A.M.

    2004-01-01

    A paternally expressed QTL for muscle growth and backfat thickness (BFT) has previously been identified near the IGF2 locus on the distal tip of pig chromosome 2 (SSC2p) in three experimental F-2 populations. Recently, a mutation in a regulatory element of the IGF2 gene was identified as the

  9. Advances in sarcoma gene mutations and therapeutic targets.

    Science.gov (United States)

    Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng

    2018-01-01

    Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.

  10. [Phylogenetic analysis of human/swine/avian gene reassortant H1N2 influenza A virus isolated from a pig in China].

    Science.gov (United States)

    Chen, Yixiang; Meng, Xueqiong; Liu, Qi; Huang, Xia; Huang, Shengbin; Liu, Cuiquan; Shi, Kaichuang; Guo, Jiangang; Chen, Fangfang; Hu, Liping

    2008-04-01

    Our aim in this study was to determine the genetic characterization and probable origin of the H1N2 swine influenza virus (A/Swine/Guangxi/13/2006) (Sw/GX/13/06) from lung tissue of a pig in Guangxi province, China. Eight genes of Sw/GX/13/06 were cloned and genetically analyzed. The hemagglutinin (HA), nucleoprotein (NP), matrix (M) and non-structural (NS) genes of Sw/GX/13/06 were most closely related to genes from the classical swine H1N1 influenza virus lineage. The neuraminidase (NA) and PB1 genes were most closely related to the corresponding genes from the human influenza H3N2 virus lineage. The remaining two genes PA and PB2 polymerase genes were most closely related to the genes from avian influenza virus lineage. Phylogenetic analyses revealed that Sw/GX/13/06 was a human/swine/avian H1N2 virus, and closely related to H1N2 viruses isolated from pigs in United States (1999-2001) and Korea (2002). To our knowledge, Sw/GX/13/06 was the first triple-reassortant H1N2 influenza A virus isolated from a pig in China. Whether the Sw/GX/13/06 has a potential threat to breeding farm and human health remains to be further investigated.

  11. X-Linked Hypohidrotic Ectodermal Dysplasia: New Features and a Novel EDA Gene Mutation.

    Science.gov (United States)

    Savasta, Salvatore; Carlone, Giorgia; Castagnoli, Riccardo; Chiappe, Francesca; Bassanese, Francesco; Piras, Roberta; Salpietro, Vincenzo; Brazzelli, Valeria; Verrotti, Alberto; Marseglia, Gian L

    2017-01-01

    We described a 5-year-old male with hypodontia, hypohidrosis, and facial dysmorphisms characterized by a depressed nasal bridge, maxillary hypoplasia, and protuberant lips. Chromosomal analysis revealed a normal 46,XY male karyotype. Due to the presence of clinical features of hypohidrotic ectodermal dysplasia (HED), the EDA gene, located at Xq12q13.1, of the patient and his family was sequenced. Analysis of the proband's sequence revealed a missense mutation (T to A transversion) in hemizygosity state at nucleotide position 158 in exon 1 of the EDA gene, which changes codon 53 from leucine to histidine, while heterozygosity at this position was detected in the slightly affected mother; moreover, this mutation was not found in the publically available Human Gene Mutation Database. To date, our findings indicate that a novel mutation in EDA is associated with X-linked HED, adding it to the repertoire of EDA mutations. © 2017 S. Karger AG, Basel.

  12. Evolution of an Eurasian avian-like influenza virus in naïve and vaccinated pigs.

    Directory of Open Access Journals (Sweden)

    Pablo R Murcia

    Full Text Available Influenza viruses are characterized by an ability to cross species boundaries and evade host immunity, sometimes with devastating consequences. The 2009 pandemic of H1N1 influenza A virus highlights the importance of pigs in influenza emergence, particularly as intermediate hosts by which avian viruses adapt to mammals before emerging in humans. Although segment reassortment has commonly been associated with influenza emergence, an expanded host-range is also likely to be associated with the accumulation of specific beneficial point mutations. To better understand the mechanisms that shape the genetic diversity of avian-like viruses in pigs, we studied the evolutionary dynamics of an Eurasian Avian-like swine influenza virus (EA-SIV in naïve and vaccinated pigs linked by natural transmission. We analyzed multiple clones of the hemagglutinin 1 (HA1 gene derived from consecutive daily viral populations. Strikingly, we observed both transient and fixed changes in the consensus sequence along the transmission chain. Hence, the mutational spectrum of intra-host EA-SIV populations is highly dynamic and allele fixation can occur with extreme rapidity. In addition, mutations that could potentially alter host-range and antigenicity were transmitted between animals and mixed infections were commonplace, even in vaccinated pigs. Finally, we repeatedly detected distinct stop codons in virus samples from co-housed pigs, suggesting that they persisted within hosts and were transmitted among them. This implies that mutations that reduce viral fitness in one host, but which could lead to fitness benefits in a novel host, can circulate at low frequencies.

  13. Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

    Science.gov (United States)

    Kim, Myeong Hee; Kang, So Young; Lee, Woo In

    2017-05-01

    The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

  14. Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Fernanda Veronese Oliveira

    2014-01-01

    Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

  15. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    Science.gov (United States)

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  16. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

  17. Mutation analysis of the NRXN1 gene in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Onay H

    2016-12-01

    Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

  18. Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

    Science.gov (United States)

    Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

    2001-10-01

    Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

  19. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  20. MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

    Directory of Open Access Journals (Sweden)

    D. S. Mikhaylenko

    2016-01-01

    Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

  1. Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

    Science.gov (United States)

    Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

    2014-06-01

    Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

  2. A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene

    Energy Technology Data Exchange (ETDEWEB)

    Fendri-Kriaa, Nourhene, E-mail: nourhene.fendri@gmail.com [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Hsairi, Ines [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Kifagi, Chamseddine [Laboratoire internationale associe LIA135, Centre de Biotechnologie de Sfax (Tunisia); Ellouze, Emna [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Mkaouar-Rebai, Emna [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Triki, Chahnez [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Fakhfakh, Faiza [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia)

    2011-06-03

    Highlights: {yields} Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. {yields} A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. {yields} The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 months of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.

  3. A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene

    International Nuclear Information System (INIS)

    Fendri-Kriaa, Nourhene; Hsairi, Ines; Kifagi, Chamseddine; Ellouze, Emna; Mkaouar-Rebai, Emna; Triki, Chahnez; Fakhfakh, Faiza

    2011-01-01

    Highlights: → Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. → A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. → The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 months of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.

  4. Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

    Science.gov (United States)

    Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

    2015-05-01

    This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

  5. A mutation in the mitochondrial fission gene Dnm1l leads to cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Houman Ashrafian

    2010-06-01

    Full Text Available Mutations in a number of genes have been linked to inherited dilated cardiomyopathy (DCM. However, such mutations account for only a small proportion of the clinical cases emphasising the need for alternative discovery approaches to uncovering novel pathogenic mutations in hitherto unidentified pathways. Accordingly, as part of a large-scale N-ethyl-N-nitrosourea mutagenesis screen, we identified a mouse mutant, Python, which develops DCM. We demonstrate that the Python phenotype is attributable to a dominant fully penetrant mutation in the dynamin-1-like (Dnm1l gene, which has been shown to be critical for mitochondrial fission. The C452F mutation is in a highly conserved region of the M domain of Dnm1l that alters protein interactions in a yeast two-hybrid system, suggesting that the mutation might alter intramolecular interactions within the Dnm1l monomer. Heterozygous Python fibroblasts exhibit abnormal mitochondria and peroxisomes. Homozygosity for the mutation results in the death of embryos midway though gestation. Heterozygous Python hearts show reduced levels of mitochondria enzyme complexes and suffer from cardiac ATP depletion. The resulting energy deficiency may contribute to cardiomyopathy. This is the first demonstration that a defect in a gene involved in mitochondrial remodelling can result in cardiomyopathy, showing that the function of this gene is needed for the maintenance of normal cellular function in a relatively tissue-specific manner. This disease model attests to the importance of mitochondrial remodelling in the heart; similar defects might underlie human heart muscle disease.

  6. MutaNET: a tool for automated analysis of genomic mutations in gene regulatory networks.

    Science.gov (United States)

    Hollander, Markus; Hamed, Mohamed; Helms, Volkhard; Neininger, Kerstin

    2018-03-01

    Mutations in genomic key elements can influence gene expression and function in various ways, and hence greatly contribute to the phenotype. We developed MutaNET to score the impact of individual mutations on gene regulation and function of a given genome. MutaNET performs statistical analyses of mutations in different genomic regions. The tool also incorporates the mutations in a provided gene regulatory network to estimate their global impact. The integration of a next-generation sequencing pipeline enables calling mutations prior to the analyses. As application example, we used MutaNET to analyze the impact of mutations in antibiotic resistance (AR) genes and their potential effect on AR of bacterial strains. MutaNET is freely available at https://sourceforge.net/projects/mutanet/. It is implemented in Python and supported on Mac OS X, Linux and MS Windows. Step-by-step instructions are available at http://service.bioinformatik.uni-saarland.de/mutanet/. volkhard.helms@bioinformatik.uni-saarland.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer

    Directory of Open Access Journals (Sweden)

    Youfeng Shen

    2017-11-01

    Full Text Available Abstract Background Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Methods Transcription activator-like effector nucleases (TALENs were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. Results The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19 were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean

  8. A novel missense mutation of the DDHD1 gene associated with juvenile amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Chujun Wu

    2016-12-01

    Full Text Available Background: Juvenile amyotrophic lateral sclerosis (jALS is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients.Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis.Results: We identified a novel c.1483A>G (p.Met495Val homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the data of dbSNP, ExAC and 1000G.Conclusion: The novel c.1483A>G (p.Met495Val missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS.

  9. A study on tumor suppressor genes mutations associated with different pathological colorectal lesions

    International Nuclear Information System (INIS)

    Matar, S.N.A.

    2011-01-01

    Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD

  10. Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.

    Science.gov (United States)

    Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W

    2016-05-01

    To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.

  11. Clinical study of DMD gene point mutation causing Becker muscular dystrophy

    Directory of Open Access Journals (Sweden)

    Ji-qing CAO

    2015-07-01

    Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

  12. Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

    Science.gov (United States)

    Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

    2017-01-01

    Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

  13. Novel mutations in the USH1C gene in Usher syndrome patients.

    Science.gov (United States)

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  14. Gene mutation-based and specific therapies in precision medicine.

    Science.gov (United States)

    Wang, Xiangdong

    2016-04-01

    Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  15. Naturally Occurring Deletion Mutants of the Pig-Specific, Intestinal Crypt Epithelial Cell Protein CLCA4b without Apparent Phenotype.

    Directory of Open Access Journals (Sweden)

    Stephanie Plog

    Full Text Available The human CLCA4 (chloride channel regulator, calcium-activated modulates the intestinal phenotype of cystic fibrosis (CF patients via an as yet unknown pathway. With the generation of new porcine CF models, species-specific differences between human modifiers of CF and their porcine orthologs are considered critical for the translation of experimental data. Specifically, the porcine ortholog to the human CF modulator gene CLCA4 has recently been shown to be duplicated into two separate genes, CLCA4a and CLCA4b. Here, we characterize the duplication product, CLCA4b, in terms of its genomic structure, tissue and cellular expression patterns as well as its in vitro electrophysiological properties. The CLCA4b gene is a pig-specific duplication product of the CLCA4 ancestor and its protein is exclusively expressed in small and large intestinal crypt epithelial cells, a niche specifically occupied by no other porcine CLCA family member. Surprisingly, a unique deleterious mutation of the CLCA4b gene is spread among modern and ancient breeds in the pig population, but this mutation did not result in an apparent phenotype in homozygously affected animals. Electrophysiologically, neither the products of the wild type nor of the mutated CLCA4b genes were able to evoke a calcium-activated anion conductance, a consensus feature of other CLCA proteins. The apparently pig-specific duplication of the CLCA4 gene with unique expression of the CLCA4b protein variant in intestinal crypt epithelial cells where the porcine CFTR is also present raises the question of whether it may modulate the porcine CF phenotype. Moreover, the naturally occurring null variant of CLCA4b will be valuable for the understanding of CLCA protein function and their relevance in modulating the CF phenotype.

  16. The spectrum of HNF1A gene mutations in Greek patients with MODY3: relative frequency and identification of seven novel germline mutations.

    Science.gov (United States)

    Tatsi, Christina; Kanaka-Gantenbein, Christina; Vazeou-Gerassimidi, Adriani; Chrysis, Dionysios; Delis, Dimitrios; Tentolouris, Nikolaos; Dacou-Voutetakis, Catherine; Chrousos, George P; Sertedaki, Amalia

    2013-11-01

    Maturity-Onset Diabetes of the Young (MODY) is the most common type of monogenic diabetes accounting for 1-2% of the population with diabetes. The relative incidence of HNF1A-MODY (MODY3) is high in European countries; however, data are not available for the Greek population. The aims of this study were to determine the relative frequency of MODY3 in Greece, the type of the mutations observed, and their relation to the phenotype of the patients. Three hundred ninety-five patients were referred to our center because of suspected MODY during a period of 15 yr. The use of Denaturing Gradient Gel Electrophoresis of polymerase chain reaction amplified DNA revealed 72 patients carrying Glucokinase gene mutations (MODY2) and 8 patients carrying HNF1A gene mutations (MODY3). After using strict criteria, 54 patients were selected to be further evaluated by direct sequencing or by multiplex ligation probe amplification (MLPA) for the presence of HNF1A gene mutations. In 16 unrelated patients and 13 of their relatives, 15 mutations were identified in the HNF1A gene. Eight of these mutations were previously reported, whereas seven were novel. Clinical features, such as age of diabetes at diagnosis or severity of hyperglycemia, were not related to the mutation type or location. In our cohort of patients fulfilling strict clinical criteria for MODY, 12% carried an HNF1A gene mutation, suggesting that defects of this gene are responsible for a significant proportion of monogenic diabetes in the Greek population. No clear phenotype-genotype correlations were identified. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    Science.gov (United States)

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  18. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    Directory of Open Access Journals (Sweden)

    Xiaoyan Huang

    2017-01-01

    Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  19. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  20. Neurocognitive Profiles in Duchenne Muscular Dystrophy and Gene Mutation Site

    Science.gov (United States)

    D’Angelo, Maria Grazia; Lorusso, Maria Luisa; Civati, Federica; Comi, Giacomo Pietro; Magri, Francesca; Del Bo, Roberto; Guglieri, Michela; Molteni, Massimo; Turconi, Anna Carla; Bresolin, Nereo

    2011-01-01

    The presence of nonprogressive cognitive impairment is recognized as a common feature in a substantial proportion of patients with Duchenne muscular dystrophy. To investigate the possible role of mutations along the dystrophin gene affecting different brain dystrophin isoforms and specific cognitive profiles, 42 school-age children affected with Duchenne muscular dystrophy, subdivided according to sites of mutations along the dystrophin gene, underwent a battery of tests tapping a wide range of intellectual, linguistic, and neuropsychologic functions. Full-scale intelligence quotient was approximately 1 S.D. below the population average in the whole group of dystrophic children. Patients with Duchenne muscular dystrophy and mutations located in the distal portion of the dystrophin gene (involving the 140-kDa brain protein isoform, called Dp140) were generally more severely affected and expressed different patterns of strengths and impairments, compared with patients with Duchenne muscular dystrophy and mutations located in the proximal portion of the dystrophin gene (not involving Dp140). Patients with Duchenne muscular dystrophy and distal mutations demonstrated specific impairments in visuospatial functions and visual memory (which seemed intact in proximally mutated patients) and greater impairment in syntactic processing. PMID:22000308

  1. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

    Science.gov (United States)

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

    2005-01-01

    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  2. New Mutation Identified in the SRY Gene High Mobility Group (HMG

    Directory of Open Access Journals (Sweden)

    Feride İffet Şahin

    2013-06-01

    Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

  3. Effects of Dietary Fat Types on Growth Performance, Pork Quality, and Gene Expression in Growing-finishing Pigs

    Directory of Open Access Journals (Sweden)

    J. C. Park

    2012-12-01

    Full Text Available This study was performed to determine the effects of dietary fat sources, i.e., beef tallow, soybean oil, olive oil and coconut oil (each 3% in feed, on the growth performance, meat quality and gene expression in growing-finishing pigs. A total of 72 crossbred pigs (Landrace×Large White×Duroc were used at 71±1 kg body weight (about 130 d of age in 24 pens (320×150 cm in a confined pig house (three pigs per pen with six replicate pens per treatment. The growing diet was given for periods of 14±3 d and the finishing diet was given for periods of 28±3 d. The fat type had no significant effect either on growth performance or on chemical composition or on meat quality in growing-finishing pigs. Dietary fat type affected fatty acid composition, with higher levels of unsaturated fatty acids (UFAs and monounsaturated fatty acids (MUFAs in the olive oil group. Microarray analysis in the Longissimus dorsi identified 6 genes, related to insulin signaling pathway, that were differentially expressed among the different feed groups. Real time-PCR was conducted on the six genes in the longissimus dorsi muscle (LM. In particular, the genes encoding the protein kinase, cAMP-dependent, regulatory, type II, alpha (PRKAR2A and the catalytic subunit of protein phosphatase 1, beta isoform (PPP1CB showed the highest expression level in the olive oil group (respectively, p<0.05, p<0.001. The results of this study indicate that the type of dietary fat affects fatty acid composition and insulin signaling-related gene expression in the LM of pigs.

  4. Macrolide-Resistance Selection in Tibetan Pigs with a High Load of Mycoplasma hyopneumoniae.

    Science.gov (United States)

    Qiu, Gang; Rui, Yapei; Zhang, Jialu; Zhang, Lihong; Huang, Shucheng; Wu, Qingxia; Li, Kun; Han, Zhaoqing; Liu, Suozhu; Li, Jiakui

    2017-12-22

    Currently, tylosin tartrate is the first-line treatment for Mycoplasma hyopneumoniae infections in China. However, the efficacy of tylosin tartrate and resistance to this treatment in M. hyopneumoniae infections of Tibetan pigs are unknown. In this study, we examined the prevalence of M. hyopneumoniae infection in Tibetan pigs at three intensive farms in Tibet, China. In addition, we investigated the efficacy of tylosin tartrate treatment for porcine enzootic pneumonia by monitoring M. hyopneumoniae DNA eradication dynamics and macrolide resistance (MR). Eighty-two of 450 (18.2%) Tibetan pigs tested positive for only M. hyopneumoniae, and most of these animals (85.1%) had symptoms and signs of pneumonia. The elimination of M. hyopneumoniae DNA was substantially faster in Tibetan pigs with a lower pretreatment M. hyopneumoniae load, and the total eradication rate was 97.4% (75/77). Two Tibetan pigs tested positive for M. hyopneumoniae that contained macrolide resistance-determining mutations in the 23S rRNA gene. Our results indicate that the pretreatment M. hyopneumoniae load may be an effective predictor of macrolide treatment efficacy (and possibly that of other antimicrobial agents) and MR. Moreover, our results suggest that danofloxacin mesylate can be used as an alternative drug for the treatment of macrolide-resistant M. hyopneumoniae infection acquired during intensive farming.

  5. [Clinical features and COMP gene mutation in a family with a pseudoachondroplasia child].

    Science.gov (United States)

    Lu, Chun-Ting; Guo, Li; Zahng, Zhan-Hui; Lin, Wei-Xia; Song, Yuan-Zong; Feng, Lie

    2013-11-01

    This study aimed to report the clinical characteristics and COMP gene mutation of a family with pseudoachondroplasia (PSACH), a relatively rare spinal and epiphyseal dysplasia that is inherited as an autosomal dominant trait. Clinical information on a 5-year-2-month-old PSACH child and his parents was collected and analyzed. Diagnosis was confirmed by PCR amplification and direct sequencing of all the 19 exons and their flanking sequences of COMP gene, and the mutation was further ascertained by cloning analysis of exon 10. The child presented with short and stubby fingers, bow leg, short limb dwarfism and metaphysic broadening in long bone as well as lumbar lordosis. A mutation c.1048_1116del (p.Asn350_Asp372del) in exon 10, inherited from his father who did not demonstrate any phenotypic feature of PSACH, was detected in the child. PSACH was diagnosed definitively by means of COMP mutation analysis, on the basis of the child's clinical and imaging features. The non-penetrance phenomenon of COMP mutation was described for the first time in PSACH.

  6. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    Science.gov (United States)

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. PROP1 gene mutations in a 36-year-old female presenting with psychosis

    Directory of Open Access Journals (Sweden)

    Durgesh Prasad Chaudhary

    2017-03-01

    Full Text Available Combined pituitary hormonal deficiency (CPHD is a rare disease that results from mutations in genes coding for transcription factors that regulate the differentiation of pituitary cells. PROP1 gene mutations are one of the etiological diagnoses of congenital panhypopituitarism, however symptoms vary depending on phenotypic expression. We present a case of psychosis in a 36-year-old female with congenital panhypopituitarism who presented with paranoia, flat affect and ideas of reference without a delirious mental state, which resolved with hormone replacement and antipsychotics. Further evaluation revealed that she had a homozygous mutation of PROP1 gene. In summary, compliance with hormonal therapy for patients with hypopituitarism appears to be effective for the prevention and treatment of acute psychosis symptoms.

  8. DNA mutation motifs in the genes associated with inherited diseases.

    Directory of Open Access Journals (Sweden)

    Michal Růžička

    Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  9. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  10. Analysis of the GCK gene in 79 MODY type 2 patients: A multicenter Turkish study, mutation profile and description of twenty novel mutations.

    Science.gov (United States)

    Aykut, Ayça; Karaca, Emin; Onay, Hüseyin; Gökşen, Damla; Çetinkalp, Şevki; Eren, Erdal; Ersoy, Betül; Çakır, Esra Papatya; Büyükinan, Muammer; Kara, Cengiz; Anık, Ahmet; Kırel, Birgül; Özen, Samim; Atik, Tahir; Darcan, Şükran; Özkınay, Ferda

    2018-01-30

    Maturity onset diabetes is a genetic form of diabetes mellitus characterized by an early age at onset and several etiologic genes for this form of diabetes have been identified in many patients. Maturity onset diabetes type 2 [MODY2 (#125851)] caused by mutations in the glucokinase gene (GCK). Although its prevalence is not clear, it is estimated that 1%-2% of patients with diabetes have the monogenic form. The aim of this study was to evaluate the molecular spectrum of GCK gene mutations in 177 Turkish MODY type 2 patients. Mutations in the GCK gene were identified in 79 out of 177. All mutant alleles were identified, including 45 different GCK mutations, 20 of which were novel. Copyright © 2017. Published by Elsevier B.V.

  11. Novel growth hormone receptor gene mutation in a patient with Laron syndrome.

    Science.gov (United States)

    Arman, Ahmet; Yüksel, Bilgin; Coker, Ajda; Sarioz, Ozlem; Temiz, Fatih; Topaloglu, Ali Kemal

    2010-04-01

    Growth Hormone (GH) is a 22 kDa protein that has effects on growth and glucose and fat metabolisms. These effects are initiated by binding of growth hormone (GH) to growth hormone receptors (GHR) expressed in target cells. Mutations or deletions in the growth hormone receptor cause an autosomal disorder called Laron-type dwarfism (LS) characterized by high circulating levels of serum GH and low levels of insulin like growth factor-1 (IGF-1). We analyzed the GHR gene for genetic defect in seven patients identified as Laron type dwarfism. We identified two missense mutations (S40L and W104R), and four polymorphisms (S473S, L526I, G168G and exon 3 deletion). We are reporting a mutation (W104R) at exon 5 of GHR gene that is not previously reported, and it is a novel mutation.

  12. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Science.gov (United States)

    2010-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

  13. PROP1 gene mutations in a 36-year-old female presenting with psychosis

    Science.gov (United States)

    Rijal, Tshristi; Jha, Kunal Kishor; Saluja, Harpreet

    2017-01-01

    Summary Combined pituitary hormonal deficiency (CPHD) is a rare disease that results from mutations in genes coding for transcription factors that regulate the differentiation of pituitary cells. PROP1 gene mutations are one of the etiological diagnoses of congenital panhypopituitarism, however symptoms vary depending on phenotypic expression. We present a case of psychosis in a 36-year-old female with congenital panhypopituitarism who presented with paranoia, flat affect and ideas of reference without a delirious mental state, which resolved with hormone replacement and antipsychotics. Further evaluation revealed that she had a homozygous mutation of PROP1 gene. In summary, compliance with hormonal therapy for patients with hypopituitarism appears to be effective for the prevention and treatment of acute psychosis symptoms. Learning points: Patients with PROP1 gene mutation may present with psychosis with no impairment in orientation and memory. There is currently inadequate literature on this topic, and further study on the possible mechanisms of psychosis as a result of endocrine disturbance is required. Compliance with hormonal therapy for patients with hypopituitarism appears to be effective for prevention and treatment of acute psychosis symptoms. PMID:28458894

  14. A patient with Werner syndrome and adiponectin gene mutation.

    Science.gov (United States)

    Hashimoto, Naotake; Hatanaka, Sachiko; Yokote, Koutaro; Kurosawa, Hiroko; Yoshida, Tomohiko; Iwai, Rie; Takahashi, Hidenori; Yoshida, Katsuya; Horie, Atsuya; Sakurai, Kenichi; Yagui, Kazuo; Saito, Yasushi; Yoshida, Shouji

    2007-01-01

    Werner syndrome is a premature aging disease characterized by genomic instability and increased cancer risk. Here, we report a 45-year-old diabetic man as the first Werner syndrome patient found to have an adiponectin gene mutation. Showing graying and loss of hair, skin atrophy, and juvenile cataract, he was diagnosed with Werner syndrome type 4 by molecular analysis. His serum adiponectin concentration was low. In the globular domain of the adiponectin gene, I164T in exon 3 was detected. When we examined effects of pioglitazone (15 mg/day) on serum adiponectin multimer and monomer concentrations using selective assays, the patient's relative percentage increased in adiponectin concentration was almost same as that in the 18 diabetic patients without an adiponectin mutation, but the absolute adiponectin concentration was half of those seen in diabetic patients treated with the same pioglitazone dose who had no adiponectin mutation. The response suggested that pioglitazone treatment might help to prevent future Werner syndrome-related acceleration of atherosclerosis. Present and further clinical relevant to atherosclerosis in this patient should be imformative concerning the pathogenesis and treatment of atherosclerosis in the presence of hypoadiponectinemia and insulin resistance.

  15. Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

    Science.gov (United States)

    Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

    2000-08-01

    We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

  16. Preterm Birth Reduces Nutrient Absorption With Limited Effect on Immune Gene Expression and Gut Colonization in Pigs

    DEFF Research Database (Denmark)

    Østergaard, Mette V; Cilieborg, Malene S.; Skovgaard, Kerstin

    2015-01-01

    The primary risk factors for necrotizing enterocolitis (NEC) are preterm birth, enteral feeding, and gut colonization. It is unclear whether feeding and colonization induce excessive expression of immune genes that lead to NEC. Using a pig model, we hypothesized that reduced gestational age would...... upregulate immune-related genes and cause bacterial imbalance after birth. Preterm (85%-92% gestation, n = 53) and near-term (95%-99% gestation, n = 69) pigs were delivered by cesarean section and euthanized at birth or after 2 days of infant formula or bovine colostrum feeding. At birth, preterm delivery...... reduced 5 of 30 intestinal genes related to nutrient absorption and innate immunity, relative to near-term pigs, whereas 2 genes were upregulated. Preterm birth also reduced ex vivo intestinal glucose and leucine uptake (40%-50%), but failed to increase cytokine secretions from intestinal explants...

  17. Case report of novel CACNA1A gene mutation causing episodic ataxia type 2

    Directory of Open Access Journals (Sweden)

    David Alan Isaacs

    2017-05-01

    Full Text Available Background: Episodic ataxia type 2 (OMIM 108500 is an autosomal dominant channelopathy characterized by paroxysms of ataxia, vertigo, nausea, and other neurologic symptoms. More than 50 mutations of the CACNA1A gene have been discovered in families with episodic ataxia type 2, although 30%–50% of all patients with typical episodic ataxia type 2 phenotype have no detectable mutation of the CACNA1A gene. Case: A 46-year-old Caucasian man, with a long history of bouts of imbalance, vertigo, and nausea, presented to our hospital with 2 weeks of ataxia and headache. Subsequent evaluation revealed a novel mutation in the CACNA1A gene: c.1364 G > A Arg455Gln. Acetazolamide was initiated with symptomatic improvement. Conclusion: This case report expands the list of known CACNA1A mutations associated with episodic ataxia type 2.

  18. Distinctive genes determine different intramuscular fat and muscle fiber ratios of the longissimus dorsi muscles in Jinhua and landrace pigs.

    Directory of Open Access Journals (Sweden)

    Ting Wu

    Full Text Available Meat quality is determined by properties such as carcass color, tenderness and drip loss. These properties are closely associated with meat composition, which includes the types of muscle fiber and content of intramuscular fat (IMF. Muscle fibers are the main contributors to meat mass, while IMF not only contributes to the sensory properties but also to the plethora of physical, chemical and technological properties of meat. However, little is known about the molecular mechanisms that determine meat composition in different pig breeds. In this report we show that Jinhua pigs, a Chinese breed, contains much higher levels of IMF than do Landrace pigs, a Danish breed. We analyzed global gene expression profiles in the longissimus dorsi muscles in Jinhua and Landrace breeds at the ages of 30, 90 and 150 days. Cross-comparison analysis revealed that genes that regulate fatty acid biosynthesis (e.g., fatty acid synthase and stearoyl-CoA desaturase are expressed at higher levels in Jinhua pigs whereas those that regulate myogenesis (e.g., myogenic factor 6 and forkhead box O1 are expressed at higher levels in Landrace pigs. Among those genes which are highly expressed in Jinhua pigs at 90 days (d90, we identified a novel gene porcine FLJ36031 (pFLJ, which functions as a positive regulator of fat deposition in cultured intramuscular adipocytes. In summary, our data showed that the up-regulation of fatty acid biosynthesis regulatory genes such as pFLJ and myogenesis inhibitory genes such as myostatin in the longissimus dorsi muscles of Jinhua pigs could explain why this local breed produces meat with high levels of IMF.

  19. Distinctive genes determine different intramuscular fat and muscle fiber ratios of the longissimus dorsi muscles in Jinhua and landrace pigs.

    Science.gov (United States)

    Wu, Ting; Zhang, Zhenhai; Yuan, Zhangqin; Lo, Li Jan; Chen, Jun; Wang, Yizhen; Peng, Jinrong

    2013-01-01

    Meat quality is determined by properties such as carcass color, tenderness and drip loss. These properties are closely associated with meat composition, which includes the types of muscle fiber and content of intramuscular fat (IMF). Muscle fibers are the main contributors to meat mass, while IMF not only contributes to the sensory properties but also to the plethora of physical, chemical and technological properties of meat. However, little is known about the molecular mechanisms that determine meat composition in different pig breeds. In this report we show that Jinhua pigs, a Chinese breed, contains much higher levels of IMF than do Landrace pigs, a Danish breed. We analyzed global gene expression profiles in the longissimus dorsi muscles in Jinhua and Landrace breeds at the ages of 30, 90 and 150 days. Cross-comparison analysis revealed that genes that regulate fatty acid biosynthesis (e.g., fatty acid synthase and stearoyl-CoA desaturase) are expressed at higher levels in Jinhua pigs whereas those that regulate myogenesis (e.g., myogenic factor 6 and forkhead box O1) are expressed at higher levels in Landrace pigs. Among those genes which are highly expressed in Jinhua pigs at 90 days (d90), we identified a novel gene porcine FLJ36031 (pFLJ), which functions as a positive regulator of fat deposition in cultured intramuscular adipocytes. In summary, our data showed that the up-regulation of fatty acid biosynthesis regulatory genes such as pFLJ and myogenesis inhibitory genes such as myostatin in the longissimus dorsi muscles of Jinhua pigs could explain why this local breed produces meat with high levels of IMF.

  20. A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

    Science.gov (United States)

    Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

    2012-12-01

    Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

  1. VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

    Science.gov (United States)

    Jia, Peilin; Zhao, Zhongming

    2014-02-01

    A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

  2. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers

    Directory of Open Access Journals (Sweden)

    Hai Hu

    2017-10-01

    Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  3. Law-medicine interfacing: patenting of human genes and mutations.

    Science.gov (United States)

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2011-08-01

    Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

  4. Three novel and two known androgen receptor gene mutations ...

    Indian Academy of Sciences (India)

    gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

  5. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  6. A mutation in the MATP gene causes the cream coat colour in the horse

    Directory of Open Access Journals (Sweden)

    Guérin Gérard

    2003-01-01

    Full Text Available Abstract In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka.

  7. Transcriptome analysis of skeletal muscle tissue to identify genes involved in pre-slaughter stress response in pigs

    Directory of Open Access Journals (Sweden)

    Vincenzo Russo

    2010-01-01

    Full Text Available The knowledge of genes and molecular processes controlling stress reactions and involved in the genetic system determining resistance to stress in pigs could be important for the improvement of meat quality. This research aimed to compare the expression profiles of skeletal muscle between physically stressed and not stressed pigs of different breeds immediately before slaughter. DNA microarray analysis showed that different functional categories of genes are up-regulated in stressed compared to not stressed pigs and relevant differences among breeds were found.

  8. The Inflammation-Related Gene S100A12 Is Positively Regulated by C/EBPβ and AP-1 in Pigs

    Directory of Open Access Journals (Sweden)

    Xinyun Li

    2014-08-01

    Full Text Available S100A12 is involved in the inflammatory response and is considered an important marker for many inflammatory diseases in humans. Our previous studies indicated that the S100A12 gene was abundant in the immune tissues of pigs and was significantly upregulated during infection with Haemophilus parasuis (HPS or porcine circovirus type 2 (PCV2. In this study, the mechanism of transcriptional regulation of S100A12 was investigated in pigs. Our results showed that S100A12, CCAAT/enhancer-binding protein beta (C/EBPβ and activator protein-1 (AP-1 genes were up-regulated in PK-15 (ATCC, CCL-33 cells when treated with LPS or Poly I: C. Additionally, the promoter activity and expression level of the S100A12 gene were significantly upregulated when C/EBPβ or AP-1 were overexpressed. We utilized electromobility shift assays (EMSA to confirm that C/EBPβ and AP-1 could directly bind the S100A12 gene promoter. We also found that the transcriptional activity and expression levels of C/EBPβ and AP-1 could positively regulate each other. Furthermore, the promoter activity of the S100A12 gene was higher when C/EBPβ and AP-1 were cotransfected than when they were transfected individually. We concluded that the S100A12 gene was cooperatively and positively regulated by C/EBPβ and AP-1 in pigs. Our study offers new insight into the transcriptional regulation of the S100A12 gene.

  9. RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

    Science.gov (United States)

    Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

    2017-05-01

    To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p  0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

  10. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  11. Deep learning of mutation-gene-drug relations from the literature.

    Science.gov (United States)

    Lee, Kyubum; Kim, Byounggun; Choi, Yonghwa; Kim, Sunkyu; Shin, Wonho; Lee, Sunwon; Park, Sungjoon; Kim, Seongsoon; Tan, Aik Choon; Kang, Jaewoo

    2018-01-25

    Molecular biomarkers that can predict drug efficacy in cancer patients are crucial components for the advancement of precision medicine. However, identifying these molecular biomarkers remains a laborious and challenging task. Next-generation sequencing of patients and preclinical models have increasingly led to the identification of novel gene-mutation-drug relations, and these results have been reported and published in the scientific literature. Here, we present two new computational methods that utilize all the PubMed articles as domain specific background knowledge to assist in the extraction and curation of gene-mutation-drug relations from the literature. The first method uses the Biomedical Entity Search Tool (BEST) scoring results as some of the features to train the machine learning classifiers. The second method uses not only the BEST scoring results, but also word vectors in a deep convolutional neural network model that are constructed from and trained on numerous documents such as PubMed abstracts and Google News articles. Using the features obtained from both the BEST search engine scores and word vectors, we extract mutation-gene and mutation-drug relations from the literature using machine learning classifiers such as random forest and deep convolutional neural networks. Our methods achieved better results compared with the state-of-the-art methods. We used our proposed features in a simple machine learning model, and obtained F1-scores of 0.96 and 0.82 for mutation-gene and mutation-drug relation classification, respectively. We also developed a deep learning classification model using convolutional neural networks, BEST scores, and the word embeddings that are pre-trained on PubMed or Google News data. Using deep learning, the classification accuracy improved, and F1-scores of 0.96 and 0.86 were obtained for the mutation-gene and mutation-drug relations, respectively. We believe that our computational methods described in this research could be

  12. Identification of a novel frameshift mutation in the ILDR1 gene in a UAE family, mutations review and phenotype genotype correlation.

    Directory of Open Access Journals (Sweden)

    Abdelaziz Tlili

    Full Text Available Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG in the Immunoglobulin-Like Domain containing Receptor-1 (ILDR1 gene. Direct Sanger sequencing and segregation analysis were performed for the family pedigree. The mutation was homozygous in all affected siblings but heterozygous in the normal consanguineous parents. The present study reports a first ILDR1 gene mutation in the UAE population and confirms that the whole-exome sequencing approach is a robust tool for the diagnosis of monogenic diseases with high levels of allelic and locus heterogeneity. In addition, by reviewing all reported ILDR1 mutations, we attempt to establish a genotype phenotype correlation to explain the phenotypic variability observed at low frequencies.

  13. Localization of pig Na[sup +], K[sup +]-ATPase [alpha] and [beta] subunit genes to chromosome 4 by radioactive in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Lahbib-Mansais, Y.; Yerle, M.; Dalens, M.; Chevalet, C.; Gellin, J. (Centre de Recherches de Toulouse (France))

    1993-01-01

    Two genes coding for Na[sup +],K[sup +] -ATPase [alpha] and [beta] subunits are localized on pig chromosome 4, to the q1.6[yields]q2.3 and 1.3[yields]q2.1 regions, respectively, by radioactive in situ hybridization. According to nucleotide and amino acid sequence comparisons with different human isoforms of Na[sup +] ,K[sup +]-ATPase, these pig [alpha] and [beta] ATPase genes show strong homologies with human [alpha]1 and [beta] subunit ATPase genes, respectively. These results are discussed with respect to comparative mapping data of conserved genes in mammalian species. We showed that the pig cDNA probes encoding ATPase [alpha] and, [beta] genes reveal DNA polymorphism in Meishan an Large White pigs. 35 refs., 4 figs., 2 tabs.

  14. Mutational analysis of the HGO gene in Finnish alkaptonuria patients

    Science.gov (United States)

    de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.

    1999-01-01

    Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.


Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001

  15. Mitchell-Riley Syndrome: A Novel Mutation in RFX6 Gene

    Directory of Open Access Journals (Sweden)

    Marta Zegre Amorim

    2015-01-01

    Full Text Available A novel RFX6 homozygous missense mutation was identified in an infant with Mitchell-Riley syndrome. The most common features of Mitchell-Riley syndrome were present, including severe neonatal diabetes associated with annular pancreas, intestinal malrotation, gallbladder agenesis, cholestatic disease, chronic diarrhea, and severe intrauterine growth restriction. Perijejunal tissue similar to pancreatic tissue was found in the submucosa, a finding that has not been previously reported in this syndrome. This case associating RFX6 mutation with structural and functional pancreatic abnormalities reinforces the RFX6 gene role in pancreas development and β-cell function, adding information to the existent mutation databases.

  16. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased...

  17. Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

    Science.gov (United States)

    Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

    2017-01-01

    Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

  18. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  19. A novel missense HGD gene mutation, K57N, in a patient with alkaptonuria.

    Science.gov (United States)

    Grasko, Jonathan M; Hooper, Amanda J; Brown, Jeffrey W; McKnight, C James; Burnett, John R

    2009-05-01

    Alkaptonuria is a rare recessive disorder of phenylalanine/tyrosine metabolism due to a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) caused by mutations in the HGD gene. We report the case of a 38 year-old male with known alkaptonuria who was referred to an adult metabolic clinic after initially presenting to an emergency department with renal colic and subsequently passing black ureteric calculi. He complained of severe debilitating lower back pain, worsening over the last few years. A CT scan revealed marked degenerative changes and severe narrowing of the disc spaces along the entire lumbar spine. Sequencing of the HGD gene revealed that he was a compound heterozygote for a previously described missense mutation in exon 13 (G360R) and a novel missense mutation in exon 3 (K57N). Lys(57) is conserved among species and mutation of this residue is predicted to affect HGD protein function by interfering with substrate traffic at the active site. In summary, we describe an alkaptonuric patient and report a novel missense HGD mutation, K57N.

  20. ABCD syndrome is caused by a homozygous mutation in the EDNRB gene.

    Science.gov (United States)

    Verheij, Joke B G M; Kunze, Jürgen; Osinga, Jan; van Essen, Anthonie J; Hofstra, Robert M W

    2002-03-15

    ABCD syndrome is an autosomal recessive syndrome characterized by albinism, black lock, cell migration disorder of the neurocytes of the gut (Hirschsprung disease [HSCR]), and deafness. This phenotype clearly overlaps with the features of the Shah-Waardenburg syndrome, comprising sensorineural deafness; hypopigmentation of skin, hair, and irides; and HSCR. Therefore, we screened DNA of the index patient of the ABCD syndrome family for mutations in the endothelin B receptor (EDNRB) gene, a gene known to be involved in Shah-Waardenburg syndrome. A homozygous nonsense mutation in exon 3 (R201X) of the EDNRB gene was found. We therefore suggest that ABCD syndrome is not a separate entity, but an expression of Shah-Waardenburg syndrome.

  1. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  2. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  3. A Splice Mutation in the PHKG1 Gene Causes High Glycogen Content and Low Meat Quality in Pig Skeletal Muscle

    OpenAIRE

    Ma, Junwu; Yang, Jie; Zhou, Lisheng; Ren, Jun; Liu, Xianxian; Zhang, Hui; Yang, Bin; Zhang, Zhiyan; Ma, Huanban; Xie, Xianhua; Xing, Yuyun; Guo, Yuanmei; Huang, Lusheng

    2014-01-01

    Glycolytic potential (GP) in skeletal muscle is economically important in the pig industry because of its effect on pork processing yield. We have previously mapped a major quantitative trait loci (QTL) for GP on chromosome 3 in a White Duroc × Erhualian F2 intercross. We herein performed a systems genetic analysis to identify the causal variant underlying the phenotype QTL (pQTL). We first conducted genome-wide association analyses in the F2 intercross and an F19 Sutai pig population. The QT...

  4. GPR143 gene mutation analysis in pediatric patients with albinism.

    Science.gov (United States)

    Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej

    2012-09-01

    X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.

  5. A case of pseudohypoaldosteronism type 1 with a mutation in the mineralocorticoid receptor gene

    Directory of Open Access Journals (Sweden)

    Se Eun Lee

    2011-02-01

    Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare form of mineralocorticoid resistance characterized in newborns by salt wasting with dehydration, hyperkalemia and failure to thrive. This disease is heterogeneous in etiology and includes autosomal dominant PHA1 owing to mutations of the NR3C2 gene encoding the mineralocorticoid receptor, autosomal recessive PHA1 due to mutations of the epithelial sodium channel (ENaC gene, and secondary PHA1 associated with urinary tract diseases. Amongst these diseases, autosomal dominant PHA1 shows has manifestations restricted to renal tubules including a mild salt loss during infancy and that shows a gradual improvement with advancing age. Here, we report a neonatal case of PHA1 with a NR3C2 gene mutation (a heterozygous c.2146_2147insG in exon 5, in which the patient showed failure to thrive, hyponatremia, hyperkalemia, and elevated plasma renin and aldosterone levels. This is the first case of pseudohypoaldosteronism type 1 confirmed by genetic analysis in Korea.

  6. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients.

    Science.gov (United States)

    Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru

    2014-02-25

    Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Mutations in CDKL5 gene are responsible for 7 with

  7. A novel APOC2 gene mutation identified in a Chinese patient with severe hypertriglyceridemia and recurrent pancreatitis.

    Science.gov (United States)

    Jiang, Jingjing; Wang, Yuhui; Ling, Yan; Kayoumu, Abudurexiti; Liu, George; Gao, Xin

    2016-01-16

    The severe forms of hypertriglyceridemia are usually caused by genetic defects. In this study, we described a Chinese female with severe hypertriglyceridemia caused by a novel homozygous mutation in the APOC2 gene. Lipid profiles of the pedigree were studied in detail. LPL and HL activity were also measured. The coding regions of 5 candidate genes (namely LPL, APOC2, APOA5, LMF1, and GPIHBP1) were sequenced using genomic DNA from peripheral leucocytes. The ApoE gene was also genotyped. Serum triglyceride level was extremely high in the proband, compared with other family members. Plasma LPL activity was also significantly reduced in the proband. Serum ApoCII was very low in the proband as well as in the heterozygous mutation carriers. A novel mutation (c.86A > CC) was identified on exon 3 [corrected] of the APOC2 gene, which converted the Asp [corrected] codon at position 29 into Ala, followed by a termination codon (TGA). This study presented the first case of ApoCII deficiency in the Chinese population, with a novel mutation c.86A > CC in the APOC2 gene identified. Serum ApoCII protein might be a useful screening test for identifying mutation carriers.

  8. GJB2 and mitochondrial A1555G gene mutations in nonsyndromic ...

    Indian Academy of Sciences (India)

    GJB2 mutations in 21.4% of the families in this country. (Bayazit et al. 2003). In this study, GJB2 gene mutations were responsible for 14.7% of genetic nonsyndromic hear- ing losses and 12.5% of the familial cases. These results are lower than in the previous reports where the patient selec- tion criteria may play a role.

  9. Prediction of Genes Related to Positive Selection Using Whole-Genome Resequencing in Three Commercial Pig Breeds

    Directory of Open Access Journals (Sweden)

    HyoYoung Kim

    2015-12-01

    Full Text Available Selective sweep can cause genetic differentiation across populations, which allows for the identification of possible causative regions/genes underlying important traits. The pig has experienced a long history of allele frequency changes through artificial selection in the domestication process. We obtained an average of 329,482,871 sequence reads for 24 pigs from three pig breeds: Yorkshire (n = 5, Landrace (n = 13, and Duroc (n = 6. An average read depth of 11.7 was obtained using whole-genome resequencing on an Illumina HiSeq2000 platform. In this study, cross-population extended haplotype homozygosity and cross-population composite likelihood ratio tests were implemented to detect genes experiencing positive selection for the genome-wide resequencing data generated from three commercial pig breeds. In our results, 26, 7, and 14 genes from Yorkshire, Landrace, and Duroc, respectively were detected by two kinds of statistical tests. Significant evidence for positive selection was identified on genes ST6GALNAC2 and EPHX1 in Yorkshire, PARK2 in Landrace, and BMP6, SLA-DQA1, and PRKG1 in Duroc.These genes are reportedly relevant to lactation, reproduction, meat quality, and growth traits. To understand how these single nucleotide polymorphisms (SNPs related positive selection affect protein function, we analyzed the effect of non-synonymous SNPs. Three SNPs (rs324509622, rs80931851, and rs80937718 in the SLA-DQA1 gene were significant in the enrichment tests, indicating strong evidence for positive selection in Duroc. Our analyses identified genes under positive selection for lactation, reproduction, and meat-quality and growth traits in Yorkshire, Landrace, and Duroc, respectively.

  10. Towards linked open gene mutations data

    Science.gov (United States)

    2012-01-01

    Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives

  11. Towards linked open gene mutations data.

    Science.gov (United States)

    Zappa, Achille; Splendiani, Andrea; Romano, Paolo

    2012-03-28

    With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on

  12. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    Science.gov (United States)

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

    2014-05-01

    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  13. A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia

    Energy Technology Data Exchange (ETDEWEB)

    Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)

    1995-01-02

    Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.

  14. Mutational and Evolutionary Analyses of Bovine Reprimo Gene ...

    African Journals Online (AJOL)

    It can therefore be concluded that bovine RPRM gene contained 4 transition mutations and 5 indels that can be used in marker assisted selection. Evolutionary findings also demonstrated the existence of a divergent evolution between bovine RPRM gene and RPRM gene of fishes and frog. Keywords: Identity, phylogeny ...

  15. NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

    Directory of Open Access Journals (Sweden)

    Maija Wolf

    2005-01-01

    Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

  16. Evaluation of the mutagenicity of alkylating agents, methylnitrosourea and temozolomide, using the rat Pig-a assay with total red blood cells or reticulocytes.

    Science.gov (United States)

    Muto, Shigeharu; Yamada, Katsuya; Kato, Tatsuya; Ando, Masamitsu; Inoue, Yoshimi; Iwase, Yumiko; Uno, Yoshifumi

    2016-11-15

    A collaborative study of the endogenous phosphatidylinositol glycan class A (Pig-a) gene mutation assay was conducted by the Japanese Environmental Mutagen Society/Mammalian Mutagenicity Study Group with a single-dosing regimen of test chemicals administered to male rats. As a part of the study, two DNA alkylating agents, methylnitrosourea (MNU) and temozolomide (TMZ), were dosed by single oral gavage at 25, 50, and 100mg/kg body weight. Pig-a mutant analysis of total red blood cells (RBCs; RBC Pig-a assay) and reticulocytes (RETs; PIGRET assay) was performed on Days 8, 15 and 29 after the administration. Both chemicals increased Pig-a mutants among RBCs and RETs with dose dependency on all days examined. The mutant frequencies were higher among RETs compared with RBCs, indicating that the PIGRET assay could detect mutagenicity more sensitively than the RBC Pig-a assay after a single dose of test chemicals. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Novel compound heterozygous mutations in MYO7A gene associated with autosomal recessive sensorineural hearing loss in a Chinese family.

    Science.gov (United States)

    Ma, Yalin; Xiao, Yun; Zhang, Fengguo; Han, Yuechen; Li, Jianfeng; Xu, Lei; Bai, Xiaohui; Wang, Haibo

    2016-04-01

    Mutations in MYO7A gene have been reported to be associated with Usher Syndrome type 1B (USH1B) and nonsyndromic hearing loss (DFNB2, DFNA11). Most mutations in MYO7A gene caused USH1B, whereas only a few reported mutations led to DFNB2 and DFNA11. The current study was designed to investigate the mutations among a Chinese family with autosomal recessive hearing loss. In this study, we present the clinical, genetic and molecular characteristics of a Chinese family. Targeted capture of 127 known deafness genes and next-generation sequencing were employed to study the genetic causes of two siblings in the Chinese family. Sanger sequencing was employed to examine those variant mutations in the members of this family and other ethnicity-matched controls. We identified the novel compound heterozygous mutant alleles of MYO7A gene: a novel missense mutation c.3671C>A (p.A1224D) and a reported insert mutation c.390_391insC (p.P131PfsX9). Variants were further confirmed by Sanger sequencing. These two compound heterozygous variants were co-segregated with autosomal recessive hearing loss phenotype. The gene mutation analysis and protein sequence alignment further supported that the novel compound heterozygous mutations were pathogenic. The novel compound heterozygous mutations (c.3671C>A and c.390_391insC) in MYO7A gene identified in this study were responsible for the autosomal recessive sensorineural hearing loss of this Chinese family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    Science.gov (United States)

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  19. A novel nonsense mutation in the NDP gene in a Chinese family with Norrie disease.

    Science.gov (United States)

    Liu, Deyuan; Hu, Zhengmao; Peng, Yu; Yu, Changhong; Liu, Yalan; Mo, Xiaoyun; Li, Xiaoping; Lu, Lina; Xu, Xiaojuan; Su, Wei; Pan, Qian; Xia, Kun

    2010-12-08

    Norrie disease (ND), a rare X-linked recessive disorder, is characterized by congenital blindness and, occasionally, mental retardation and hearing loss. ND is caused by the Norrie Disease Protein gene (NDP), which codes for norrin, a cysteine-rich protein involved in ocular vascular development. Here, we report a novel mutation of NDP that was identified in a Chinese family in which three members displayed typical ND symptoms and other complex phenotypes, such as cerebellar atrophy, motor disorders, and mental disorders. We conducted an extensive clinical examination of the proband and performed a computed tomography (CT) scan of his brain. Additionally, we performed ophthalmic examinations, haplotype analyses, and NDP DNA sequencing for 26 individuals from the proband's extended family. The proband's computed tomography scan, in which the fifth ventricle could be observed, indicated cerebellar atrophy. Genome scans and haplotype analyses traced the disease to chromosome Xp21.1-p11.22. Mutation screening of the NDP gene identified a novel nonsense mutation, c.343C>T, in this region. Although recent research has shown that multiple different mutations can be responsible for the ND phenotype, additional research is needed to understand the mechanism responsible for the diverse phenotypes caused by mutations in the NDP gene.

  20. Mutation of the S and 3c genes in genomes of feline coronaviruses.

    Science.gov (United States)

    Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

    2018-05-17

    Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

  1. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  2. Mutations du gene de la filamine et syndromes malformatifs | Koffi ...

    African Journals Online (AJOL)

    Filamin is a cytoskeletal protein that occurs in the control of cytoskeleton structure and activity, the modulation of cell shape and migration as well as in the maintaining of cell shape. Mutations in the genes FLNA and FLNB provoke diverse malformative diseases in human. Mutations in the gene FLNA cause four X-Linked ...

  3. Mutational analysis of COL1A1 and COL1A2 genes among Estonian osteogenesis imperfecta patients.

    Science.gov (United States)

    Zhytnik, Lidiia; Maasalu, Katre; Reimann, Ene; Prans, Ele; Kõks, Sulev; Märtson, Aare

    2017-08-15

    Osteogenesis imperfecta (OI) is a rare bone disorder. In 90% of cases, OI is caused by mutations in the COL1A1/2 genes, which code procollagen α1 and α2 chains. The main aim of the current research was to identify the mutational spectrum of COL1A1/2 genes in Estonian patients. The small population size of Estonia provides a unique chance to explore the collagen I mutational profile of 100% of OI families in the country. We performed mutational analysis of peripheral blood gDNA of 30 unrelated Estonian OI patients using Sanger sequencing of COL1A1 and COL1A2 genes, including all intron-exon junctions and 5'UTR and 3'UTR regions, to identify causative OI mutations. We identified COL1A1/2 mutations in 86.67% of patients (26/30). 76.92% of discovered mutations were located in the COL1A1 (n = 20) and 23.08% in the COL1A2 (n = 6) gene. Half of the COL1A1/2 mutations appeared to be novel. The percentage of quantitative COL1A1/2 mutations was 69.23%. Glycine substitution with serine was the most prevalent among missense mutations. All qualitative mutations were situated in the chain domain of pro-α1/2 chains. Our study shows that among the Estonian OI population, the range of collagen I mutations is quite high, which agrees with other described OI cohorts of Northern Europe. The Estonian OI cohort differs due to the high number of quantitative variants and simple missense variants, which are mostly Gly to Ser substitutions and do not extend the chain domain of COL1A1/2 products.

  4. Associations of heart and adipocyte fatty acid-binding protein gene expression with intramuscular fat content in pigs

    NARCIS (Netherlands)

    Gerbens, F.; Verburg, F.J.; Moerkerk, van H.T.; Engel, B.; Buist, W.; Veerkamp, J.H.; Pas, te M.F.

    2001-01-01

    Intramuscular fat content is a major determinant of meat quality in pigs. Previously, polymorphisms in the adipocyte and heart fatty acid-binding protein genes, A-FABP and H-FABP, have been significantly associated with genetic variation of intramuscular fat content in a Duroc pig population.

  5. Associations of heart and adipocyte fatty acid-binding protein gene expression with intramuscular fat content in pigs.

    NARCIS (Netherlands)

    Gerbens, F.; Verburg, F.J.; Moerkerk, H.T.B. van; Engel, B.; Buist, W.; Veerkamp, J.H.; Pas, M.F. te

    2001-01-01

    Intramuscular fat content is a major determinant of meat quality in pigs. Previously, polymorphisms in the adipocyte and heart fatty acid-binding protein genes, A-FABP and H-FABP, have been significantly associated with genetic variation of intramuscular fat content in a Duroc pig population.

  6. A Pathway-Centered Analysis of Pig Domestication and Breeding in Eurasia

    Directory of Open Access Journals (Sweden)

    Jordi Leno-Colorado

    2017-07-01

    Full Text Available Ascertaining the molecular and physiological basis of domestication and breeding is an active area of research. Due to the current wide distribution of its wild ancestor, the wild boar, the pig (Sus scrofa is an excellent model to study these processes, which occurred independently in East Asia and Europe ca. 9000 yr ago. Analyzing genome variability patterns in terms of metabolic pathways is attractive since it considers the impact of interrelated functions of genes, in contrast to genome-wide scans that treat genes or genome windows in isolation. To that end, we studied 40 wild boars and 123 domestic pig genomes from Asia and Europe when metabolic pathway was the unit of analysis. We computed statistical significance for differentiation (Fst and linkage disequilibrium (nSL statistics at the pathway level. In terms of Fst, we found 21 and 12 pathways significantly differentiated at a q-value 10 significant pathways (in terms of Fst, comprising genes involved in the transduction of a large number of signals, like phospholipase PCLB1, which is expressed in the brain, or ITPR3, which has an important role in taste transduction. In terms of nSL, significant pathways were mainly related to reproductive performance (ovarian steroidogenesis, a similarly important target trait during domestication and modern animal breeding. Different levels of recombination cannot explain these results, since we found no correlation between Fst and recombination rate. However, we did find an increased ratio of deleterious mutations in domestic vs. wild populations, suggesting a relaxed functional constraint associated with the domestication and breeding processes. Purifying selection was, nevertheless, stronger in significantly differentiated pathways than in random pathways, mainly in Europe. We conclude that pathway analysis facilitates the biological interpretation of genome-wide studies. Notably, in the case of pig, behavior played an important role, among other

  7. A Pathway-Centered Analysis of Pig Domestication and Breeding in Eurasia.

    Science.gov (United States)

    Leno-Colorado, Jordi; Hudson, Nick J; Reverter, Antonio; Pérez-Enciso, Miguel

    2017-07-05

    Ascertaining the molecular and physiological basis of domestication and breeding is an active area of research. Due to the current wide distribution of its wild ancestor, the wild boar, the pig ( Sus scrofa ) is an excellent model to study these processes, which occurred independently in East Asia and Europe ca. 9000 yr ago. Analyzing genome variability patterns in terms of metabolic pathways is attractive since it considers the impact of interrelated functions of genes, in contrast to genome-wide scans that treat genes or genome windows in isolation. To that end, we studied 40 wild boars and 123 domestic pig genomes from Asia and Europe when metabolic pathway was the unit of analysis. We computed statistical significance for differentiation (Fst) and linkage disequilibrium (nSL) statistics at the pathway level. In terms of Fst, we found 21 and 12 pathways significantly differentiated at a q -value 10 significant pathways (in terms of Fst), comprising genes involved in the transduction of a large number of signals, like phospholipase PCLB1, which is expressed in the brain, or ITPR3, which has an important role in taste transduction. In terms of nSL, significant pathways were mainly related to reproductive performance (ovarian steroidogenesis), a similarly important target trait during domestication and modern animal breeding. Different levels of recombination cannot explain these results, since we found no correlation between Fst and recombination rate. However, we did find an increased ratio of deleterious mutations in domestic vs. wild populations, suggesting a relaxed functional constraint associated with the domestication and breeding processes. Purifying selection was, nevertheless, stronger in significantly differentiated pathways than in random pathways, mainly in Europe. We conclude that pathway analysis facilitates the biological interpretation of genome-wide studies. Notably, in the case of pig, behavior played an important role, among other physiological

  8. A rat model of hypohidrotic ectodermal dysplasia carries a missense mutation in the Edaradd gene

    Science.gov (United States)

    2011-01-01

    Background Hypohidrotic ectodermal dysplasia (HED) is a congenital disorder characterized by sparse hair, oligodontia, and inability to sweat. It is caused by mutations in any of three Eda pathway genes: ectodysplasin (Eda), Eda receptor (Edar), and Edar-associated death domain (Edaradd), which encode ligand, receptor, and intracellular adaptor molecule, respectively. The Eda signaling pathway activates NF-κB, which is central to ectodermal differentiation. Although the causative genes and the molecular pathway affecting HED have been identified, no curative treatment for HED has been established. Previously, we found a rat spontaneous mutation that caused defects in hair follicles and named it sparse-and-wavy (swh). Here, we have established the swh rat as the first rat model of HED and successfully identified the swh mutation. Results The swh/swh rat showed sparse hair, abnormal morphology of teeth, and absence of sweat glands. The ectoderm-derived glands, meibomian, preputial, and tongue glands, were absent. We mapped the swh mutation to the most telomeric part of rat Chr 7 and found a Pro153Ser missense mutation in the Edaradd gene. This mutation was located in the death domain of EDARADD, which is crucial for signal transduction and resulted in failure to activate NF-κB. Conclusions These findings suggest that swh is a loss-of-function mutation in the rat Edaradd and indicate that the swh/swh rat would be an excellent animal model of HED that could be used to investigate the pathological basis of the disease and the development of new therapies. PMID:22013926

  9. Geographical distribution of β-globin gene mutations in Syria.

    Science.gov (United States)

    Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

    2018-04-11

    Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

  10. Frequency of mutations in the genes associated with hereditary sensory and autonomic neuropathy in a UK cohort.

    LENUS (Irish Health Repository)

    Davidson, G L

    2012-08-01

    The hereditary sensory and autonomic neuropathies (HSAN, also known as the hereditary sensory neuropathies) are a clinically and genetically heterogeneous group of disorders, characterised by a progressive sensory neuropathy often complicated by ulcers and amputations, with variable motor and autonomic involvement. To date, mutations in twelve genes have been identified as causing HSAN. To study the frequency of mutations in these genes and the associated phenotypes, we screened 140 index patients in our inherited neuropathy cohort with a clinical diagnosis of HSAN for mutations in the coding regions of SPTLC1, RAB7, WNK1\\/HSN2, FAM134B, NTRK1 (TRKA) and NGFB. We identified 25 index patients with mutations in six genes associated with HSAN (SPTLC1, RAB7, WNK1\\/HSN2, FAM134B, NTRK1 and NGFB); 20 of which appear to be pathogenic giving an overall mutation frequency of 14.3%. Mutations in the known genes for HSAN are rare suggesting that further HSAN genes are yet to be identified. The p.Cys133Trp mutation in SPTLC1 is the most common cause of HSAN in the UK population and should be screened first in all patients with sporadic or autosomal dominant HSAN.

  11. Frequency of mutations in the genes associated with hereditary sensory and autonomic neuropathy in a UK cohort.

    Science.gov (United States)

    Davidson, G L; Murphy, S M; Polke, J M; Laura, M; Salih, M A M; Muntoni, F; Blake, J; Brandner, S; Davies, N; Horvath, R; Price, S; Donaghy, M; Roberts, M; Foulds, N; Ramdharry, G; Soler, D; Lunn, M P; Manji, H; Davis, M B; Houlden, H; Reilly, M M

    2012-08-01

    The hereditary sensory and autonomic neuropathies (HSAN, also known as the hereditary sensory neuropathies) are a clinically and genetically heterogeneous group of disorders, characterised by a progressive sensory neuropathy often complicated by ulcers and amputations, with variable motor and autonomic involvement. To date, mutations in twelve genes have been identified as causing HSAN. To study the frequency of mutations in these genes and the associated phenotypes, we screened 140 index patients in our inherited neuropathy cohort with a clinical diagnosis of HSAN for mutations in the coding regions of SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 (TRKA) and NGFB. We identified 25 index patients with mutations in six genes associated with HSAN (SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 and NGFB); 20 of which appear to be pathogenic giving an overall mutation frequency of 14.3%. Mutations in the known genes for HSAN are rare suggesting that further HSAN genes are yet to be identified. The p.Cys133Trp mutation in SPTLC1 is the most common cause of HSAN in the UK population and should be screened first in all patients with sporadic or autosomal dominant HSAN.

  12. Numerous BAF complex genes are mutated in Coffin-Siris syndrome.

    Science.gov (United States)

    Miyake, Noriko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

    2014-09-01

    Coffin-Siris syndrome (CSS; OMIM#135900) is a rare congenital anomaly syndrome characterized by intellectual disability, coarse face, hypertrichosis, and absence/hypoplasia of the fifth digits' nails. As the majority of patients are sporadic, an autosomal dominant inheritance model has been postulated. Recently, whole exome sequencing (WES) emerged as a comprehensive analytical method for rare variants. We applied WES on five CSS patients and found two de novo mutations in SMARCB1. SMARCB1 was completely sequenced in 23 CSS patients and the mutations were found in two more patients. As SMARCB1 encodes a subunit of the BAF complex functioning as a chromatin remodeling factor, mutations in 15 other subunit genes may cause CSS and thus were analyzed in 23 CSS patients. We identified heterozygous mutations in either of six genes (SMARCA4, SMARCB1, SMARCA2, SMARCE1, ARID1A, and ARID1B) in 20 out of 23 CSS patients. The patient with a SMARCA2 mutation was re-evaluated and identified as having Nicolaides-Baraitser syndrome (OMIM#601358), which is similar to but different from CSS. Additionally, 49 more CSS patients were analyzed as a second cohort. Together with the first cohort, 37 out of 71 (22 plus 49) patients were found to have a mutation in either one of five BAF complex genes. Furthermore, two CSS patients were reported to have a PHF6 abnormality, which can also cause Borjeson-Forssman-Lehmann syndrome (OMIM#301900), an X-linked intellectual disability syndrome with epilepsy and endocrine abnormalities. The current list of mutated genes in CSS is far from being complete and analysis of more patients is required. © 2014 Wiley Periodicals, Inc.

  13. A Restricted Spectrum of Mutations in the SMAD4 Tumor-Suppressor Gene Underlies Myhre Syndrome

    Science.gov (United States)

    Caputo, Viviana; Cianetti, Luciano; Niceta, Marcello; Carta, Claudio; Ciolfi, Andrea; Bocchinfuso, Gianfranco; Carrani, Eugenio; Dentici, Maria Lisa; Biamino, Elisa; Belligni, Elga; Garavelli, Livia; Boccone, Loredana; Melis, Daniela; Andria, Generoso; Gelb, Bruce D.; Stella, Lorenzo; Silengo, Margherita; Dallapiccola, Bruno; Tartaglia, Marco

    2012-01-01

    Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor β and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth. PMID:22243968

  14. Analysis of gene mutations in children with cholestasis of undefined etiology.

    Science.gov (United States)

    Matte, Ursula; Mourya, Reena; Miethke, Alexander; Liu, Cong; Kauffmann, Gregory; Moyer, Katie; Zhang, Kejian; Bezerra, Jorge A

    2010-10-01

    The discovery of genetic mutations in children with inherited syndromes of intrahepatic cholestasis allows for diagnostic specificity despite similar clinical phenotypes. Here, we aimed to determine whether mutation screening of target genes could assign a molecular diagnosis in children with idiopathic cholestasis. DNA samples were obtained from 51 subjects with cholestasis of undefined etiology and surveyed for mutations in the genes SERPINA1, JAG1, ATP8B1, ABCB11, and ABCB4 by a high-throughput gene chip. Then, the sequence readouts for all 5 genes were analyzed for mutations and correlated with clinical phenotypes. Healthy subjects served as controls. Sequence analysis of the genes identified 14 (or 27%) subjects with missense, nonsense, deletion, and splice site variants associated with disease phenotypes based on the type of mutation and/or biallelic involvement in the JAG1, ATP8B1, ABCB11, or ABCB4 genes. These patients had no syndromic features and could not be differentiated by biochemical markers or histopathology. Among the remaining subjects, 10 (or ∼20%) had sequence variants in ATP8B1 or ABCB11 that involved only 1 allele, 8 had variants not likely to be associated with disease phenotypes, and 19 had no variants that changed amino acid composition. Gene sequence analysis assigned a molecular diagnosis in 27% of subjects with idiopathic cholestasis based on the presence of variants likely to cause disease phenotypes.

  15. Analysis of single nucleotide polymorphisms in major and candidate genes for production traits in Nero Siciliano pig breed

    Directory of Open Access Journals (Sweden)

    Alessandro Zumbo

    2010-01-01

    Full Text Available Nero Siciliano (NS; Sicilian Black is a local pig breed reared on the island of Sicily mainly under extensive management.The breed is well adapted to marginal conditions and is appreciated for its reproductive performance, disease resistanceand production of tasty meat. For a genetic characterization of this breed we analyzed the allele frequencies of singlenucleotide polymorphisms (SNPs in eight major or candidate genes (ryanodine receptor 1, RYR1; Na+, K+ ATPase subunitα 2, ATP1A2; myosin heavy chain 2B, MYH4; sarcolipin, SLN; cathepsin B, CTSB; cystatin B, CSTB; estrogen receptor,ESR; melanocortin receptor 1, MC1R for performance and phenotypic traits. The animals that were sampled andanalyzed represent about 6-8% of the total NS pig population. PCR-RFLP or PCR-SSCP techniques were used to type theDNA markers in the selected loci. Exact test of Hardy-Weinberg equilibrium was computed for each locus, Fis statisticsand heterozygosity were calculated for each locus and over all loci. Allele frequencies obtained in NS breed were comparedto the frequencies already available in literature for the Large White, Landrace, Duroc, Belgian Landrace, Piétrain,Hampshire and Meishan breeds. For the ESR locus, as no information on the distribution of the two alleles were available,we typed a sample of unrelated pigs from the considered breeds.Even if only eight loci were studied in NS breed, important elements were obtained from the data. The 1843T (n alleleat the RYR1 locus is present in NS breed, thus the molecular test to identify the carriers of this allele should be adoptedto avoid its spreading in the population. Moreover, other studies are needed to clarify the allelic structure of the MC1Rgene, which affects coat color, in order to evaluate if this gene could be used in genetic tests for the traceability of themeat products of this breed. Finally, the present work represents an attempt to evaluate data on mutations within majorand candidate genes

  16. The Guinea Pig as a Model for Sporadic Alzheimer’s Disease (AD): The Impact of Cholesterol Intake on Expression of AD-Related Genes

    Science.gov (United States)

    Ong, Daniel; Wijaya, Linda; Laws, Simon M.; Taddei, Kevin; Newman, Morgan; Lardelli, Michael; Martins, Ralph N.; Verdile, Giuseppe

    2013-01-01

    We investigated the guinea pig, Cavia porcellus, as a model for Alzheimer’s disease (AD), both in terms of the conservation of genes involved in AD and the regulatory responses of these to a known AD risk factor - high cholesterol intake. Unlike rats and mice, guinea pigs possess an Aβ peptide sequence identical to human Aβ. Consistent with the commonality between cardiovascular and AD risk factors in humans, we saw that a high cholesterol diet leads to up-regulation of BACE1 (β-secretase) transcription and down-regulation of ADAM10 (α-secretase) transcription which should increase release of Aβ from APP. Significantly, guinea pigs possess isoforms of AD-related genes found in humans but not present in mice or rats. For example, we discovered that the truncated PS2V isoform of human PSEN2, that is found at raised levels in AD brains and that increases γ-secretase activity and Aβ synthesis, is not uniquely human or aberrant as previously believed. We show that PS2V formation is up-regulated by hypoxia and a high-cholesterol diet while, consistent with observations in humans, Aβ concentrations are raised in some brain regions but not others. Also like humans, but unlike mice, the guinea pig gene encoding tau, MAPT, encodes isoforms with both three and four microtubule binding domains, and cholesterol alters the ratio of these isoforms. We conclude that AD-related genes are highly conserved and more similar to human than the rat or mouse. Guinea pigs represent a superior rodent model for analysis of the impact of dietary factors such as cholesterol on the regulation of AD-related genes. PMID:23805206

  17. Joint analysis of quantitative trait loci and major-effect causative mutations affecting meat quality and carcass composition traits in pigs.

    Science.gov (United States)

    Cherel, Pierre; Pires, José; Glénisson, Jérôme; Milan, Denis; Iannuccelli, Nathalie; Hérault, Frédéric; Damon, Marie; Le Roy, Pascale

    2011-08-29

    Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08), with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the influence of major-effect mutations on the least affected

  18. Joint analysis of quantitative trait loci and major-effect causative mutations affecting meat quality and carcass composition traits in pigs

    Directory of Open Access Journals (Sweden)

    Iannuccelli Nathalie

    2011-08-01

    Full Text Available Abstract Background Detection of quantitative trait loci (QTLs affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08, with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Results Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Conclusions Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the

  19. [A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

    Science.gov (United States)

    Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

    2003-01-01

    To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

  20. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    Science.gov (United States)

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  1. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  2. A novel mutation of WFS1 gene in a Chinese patient with Wolfram syndrome: a case report.

    Science.gov (United States)

    Li, Min; Liu, Jia; Yi, Huan; Xu, Li; Zhong, Xiufeng; Peng, Fuhua

    2018-03-17

    Wolfram syndrome (WS), caused by mutations of the Wolfram syndrome 1 (WFS1) gene on chromosome 4p16.1, is an autosomal recessive disorder characterized by diabetes insipidus (DI), neuro-psychiatric disorders, hearing deficit, and urinary tract anomalies. Here we report a 11-year-old Chinese boy who presented with visual loss, was suspected with optic neuritis (ON) or neuromyelitis optica (NMO) and referred to our department for further diagnosis. Finally he was diagnosed with WS because of diabetes mellitus (DM) and optic atrophy (OA). Eight exons and flanking introns of WFS1 gene were analyzed by sequencing. A novel mutation c.1760G > A in WFS1 gene of exon 8 was identified. This report reviews a case of WS associated with a novel mutation, c.1760G > A in WFS1 gene of exon 8, and emphasizes that WS should be taken into account for juveniles with visual loss and diabetes mellitus.

  3. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  4. Molecular cloning and expression of the IL-10 gene from guinea pigs.

    Science.gov (United States)

    Dirisala, Vijaya R; Jeevan, Amminikutty; Bix, Gregory; Yoshimura, Teizo; McMurray, David N

    2012-04-25

    The Guinea pig (Cavia porcellus) is one of the most relevant small animals for modeling human tuberculosis (TB) in terms of susceptibility to low dose aerosol infection, the organization of granulomas, extrapulmonary dissemination and vaccine-induced protection. It is also considered to be a gold standard for a number of other infectious and non-infectious diseases; however, this animal model has a major disadvantage due to the lack of readily available immunological reagents. In the present study, we successfully cloned a cDNA for the critical Th2 cytokine, interleukin-10 (IL-10), from inbred Strain 2 guinea pigs using the DNA sequence information provided by the genome project. The complete open reading frame (ORF) consists of 537 base pairs which encodes a protein of 179 amino acids. This cDNA sequence exhibited 87% homology with human IL-10. Surprisingly, it showed only 84% homology with the previously published IL-10 sequence from the C4-deficient (C4D) guinea pig, leading us to clone IL-10 cDNA from the Hartley strain of guinea pig. The IL-10 gene from the Hartley strain showed 100% homology with the IL-10 sequence of Strain 2 guinea pigs. In order to validate the only published IL-10 sequence existing in Genbank reported from C4D guinea pigs, genomic DNA was isolated from tissues of C4D guinea pigs. Amplification with various sets of primers showed that the IL-10 sequence reported from C4D guinea pigs contained numerous errors. Hence the IL-10 sequence that is being reported by us replaces the earlier sequence making our IL-10 sequence to be the first one accurate from guinea pig. Recombinant guinea pig IL-10 proteins were subsequently expressed in both prokaryotic and eukaryotic cells, purified and were confirmed by N-terminal sequencing. Polyclonal anti-IL-10 antibodies were generated in rabbits using the recombinant IL-10 protein expressed in this study. Taken together, our results indicate that the DNA sequence information provided by the genome project

  5. Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect

    International Nuclear Information System (INIS)

    Wang Hu; Wang Jizheng; Zheng Weiyue; Wang Xiaojian; Wang Shuxia; Song Lei; Zou Yubao; Yao Yan; Hui Rutai

    2006-01-01

    Dilated cardiomyopathy is a form of heart muscle disease characterized by impaired systolic function and ventricular dilation. The mutations in lamin A/C gene have been linked to dilated cardiomyopathy. We screened genetic mutations in a large Chinese family of 50 members including members with dilated cardiomyopathy and found a Glu82Lys substitution mutation in the rod domain of the lamin A/C protein in eight family members, three of them have been diagnosed as dilated cardiomyopathy, one presented with heart dilation. The pathogenic mechanism of lamin A/C gene defect is poorly understood. Glu82Lys mutated lamin A/C and wild type protein was transfected into HEK293 cells. The mutated protein was not properly localized at the inner nuclear membrane and the emerin protein, which interacts with lamin A/C, was also aberrantly distributed. The nuclear membrane structure was disrupted and heterochromatin was aggregated aberrantly in the nucleus of the HEK293 cells stably transfected with mutated lamin A/C gene as determined by transmission electron microscopy

  6. Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome.

    Science.gov (United States)

    Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna

    2015-09-01

    Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many

  7. Systemic gene delivery transduces the enteric nervous system of guinea pigs and cynomolgus macaques.

    Science.gov (United States)

    Gombash, S E; Cowley, C J; Fitzgerald, J A; Lepak, C A; Neides, M G; Hook, K; Todd, L J; Wang, G-D; Mueller, C; Kaspar, B K; Bielefeld, E C; Fischer, A J; Wood, J D; Foust, K D

    2017-10-01

    Characterization of adeno-associated viral vector (AAV) mediated gene delivery to the enteric nervous system (ENS) was recently described in mice and rats. In these proof-of-concept experiments, we show that intravenous injections of clinically relevant AAVs can transduce the ENS in guinea pigs and non-human primates. Neonatal guinea pigs were given intravenous injections of either AAV8 or AAV9 vectors that contained a green fluorescent protein (GFP) expression cassette or phosphate-buffered saline. Piglets were euthanized three weeks post injection and tissues were harvested for immunofluorescent analysis. GFP expression was detected in myenteric and submucosal neurons along the length of the gastrointestinal tract in AAV8 injected guinea pigs. GFP-positive neurons were found in dorsal motor nucleus of the vagus and dorsal root ganglia. Less transduction occurred in AAV9-treated tissues. Gastrointestinal tissues were analyzed from young cynomolgus macaques that received systemic injection of AAV9 GFP. GFP expression was detected in myenteric neurons of the stomach, small and large intestine. These data demonstrate that ENS gene delivery translates to larger species. This work develops tools for the field of neurogastroenterology to explore gut physiology and anatomy using emerging technologies such as optogenetics and gene editing. It also provides a basis to develop novel therapies for chronic gut disorders.

  8. Study the Molecular Association between a Deletion Mutation in CHEK2 gene (5395 bp and Breast Cancer

    Directory of Open Access Journals (Sweden)

    Manijeh Jalilvand

    2015-07-01

    Full Text Available Background & Objectives: Breast cancer is the most common cancer among women and the second most common cause of cancer death. Genetic factors play an important role in the development of breast cancer. Among these genetic factors, CHEk2 (checkpoint kinase 2 gene, as a tumor suppressor gene, plays a critical role in DNA repair. Germline mutations in CEHK2 result in the loss of this feature. One of the mutations in CHEK2 gene is a 5395 bp deletion mutation which has been associated with the increasing risk of Breast Cancer in some populations in the world.  In the present study, we investigated the association between a 5395 bp deletion mutation in CHEK2 gene and the risk of Breast Cancer in the women of an Iranian population. Methods: Pathologic information of 38 cases under the age of 45 and 62 cases over the age of 45 referring to surgery ward of Milad Hospital in Tehran were extracted. 100 healthy controls were included in the study as well. After obtaining informed consent, 5 mL whole blood was taken DNA was successfully isolated. Multiplex PCR was used to investigate the association between a 5395bp deletion mutation in CHEK2 gene and increasing risk of Breast Cancer among patients. Results: The 5395bp deletion mutation in CHEK2 gene was not found in any of the participating groups of patients or heathy controls. Conclusion: The present study revealed that there is no significant relation between increasing the risk of Breast Cancer and bearing large deletion mutation in exon 9 and exon 10 of CHECK2 gene.

  9. The multidrug resistance 1 gene Abcb1 in brain and placenta: comparative analysis in human and guinea pig.

    Science.gov (United States)

    Pappas, Jane J; Petropoulos, Sophie; Suderman, Matthew; Iqbal, Majid; Moisiadis, Vasilis; Turecki, Gustavo; Matthews, Stephen G; Szyf, Moshe

    2014-01-01

    The Multidrug Resistance 1 (MDR1; alternatively ABCB1) gene product P-glycoprotein (P-gp), an ATP binding cassette transporter, extrudes multiple endogenous and exogenous substrates from the cell, playing an important role in normal physiology and xenobiotic distribution and bioavailability. To date, the predominant animal models used to investigate the role of P-gp have been the mouse and rat, which have two distinct genes, Abcb1a and Abcb1b. In contrast, the human has a single gene, ABCB1, for which only a single isoform has been validated. We and others have previously shown important differences between Abcb1a and Abcb1b, limiting the extrapolation from rodent findings to the human. Since the guinea pig has a relatively long gestation, hemomonochorial placentation and neuroanatomically mature offspring, it is more similar to the human, and may provide a more comparable model for investigating the regulation of P-gp in the brain and placenta, however, to date, the Abcb1 gene in the guinea pig remains to be characterized. The placenta and fetal brain are barrier sites that express P-gp and that play a critical role of protection of the fetus and the fetal brain from maternally administered drugs and other xenobiotics. Using RNA sequencing (RNA-seq), reverse transcription-polymerase chain reaction (RT-PCR) and quantitative PCR (QPCR) to sequence the expressed isoforms of guinea pig Abcb1, we demonstrate that like the human, the guinea pig genome contains one gene for Abcb1 but that it is expressed as at least three different isoforms via alternative splicing and alternate exon usage. Further, we demonstrate that these isoforms are more closely related to human than to rat or mouse isoforms. This striking, overall similarity and evolutionary relatedness between guinea pig Abcb1 and human ABCB1 indicate that the guinea pig represents a relevant animal model for investigating the function and regulation of P-gp in the placenta and brain.

  10. The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

    OpenAIRE

    Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

    2014-01-01

    As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

  11. rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

    Science.gov (United States)

    Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

    2018-03-01

    The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  12. A novel mutation of the MITF gene in a family with Waardenburg syndrome type 2: A case report.

    Science.gov (United States)

    Shi, Yunfang; Li, Xiaozhou; Ju, Duan; Li, Yan; Zhang, Xiuling; Zhang, Ying

    2016-04-01

    Waardenburg syndrome (WS) is an autosomal dominant disorder with varying degrees of sensorineural hearing loss, and accumulation of pigmentation in hair, skin and iris. There are four types of WS (WS1-4) with differing characteristics. Mutations in six genes [paired box gene 3 ( PAX3 ), microphthalmia-associated transcription factor ( MITF ), endothelin 3 ( END3 ), endothelin receptor type B ( EDNRB ), SRY (sex determining region Y)-box 10 ( SOX10 ) and snail homolog 2 ( SNAI2 )] have been identified to be associated with the various types. This case report describes the investigation of genetic mutations in three patients with WS2 from a single family. Genomic DNA was extracted, and the six WS-related genes were sequenced using next-generation sequencing technology. In addition to mutations in PAX3, EDNRB and SOX10, a novel heterozygous MITF mutation, p.Δ315Arg (c.944_946delGAA) on exon 8 was identified. This is predicted to be a candidate disease-causing mutation that may affect the structure and function of the enzyme.

  13. A novel mutation in the succinate dehydrogenase subunit D gene in siblings with the hereditary paraganglioma–pheochromocytoma syndrome

    Directory of Open Access Journals (Sweden)

    Chaithra Prasad

    2014-10-01

    Full Text Available Germline mutations in the succinate dehydrogenase complex subunit D gene are now known to be associated with hereditary paraganglioma–pheochromocytoma syndromes. Since the initial succinate dehydrogenase complex subunit D gene mutation was identified about a decade ago, more than 131 unique variants have been reported. We report the case of two siblings presenting with multiple paragangliomas and pheochromocytomas; they were both found to carry a mutation in the succinate dehydrogenase complex subunit D gene involving a substitution of thymine to guanine at nucleotide 236 in exon 3. This particular mutation of the succinate dehydrogenase complex subunit D gene has only been reported in one previous patient in Japan; this is, therefore, the first report of this pathogenic mutation in siblings and the first report of this mutation in North America. With continued screening of more individuals, we will be able to create a robust mutation database that can help us understand disease patterns associated with particular variants and may be a starting point in the development of new therapies for familial paraganglioma syndromes.

  14. D701N mutation in the PB2 protein contributes to the pathogenicity of H5N1 avian influenza viruses but not transmissibility in guinea pigs

    Directory of Open Access Journals (Sweden)

    Peirong eJiao

    2014-11-01

    Full Text Available H5N1 highly pathogenic avian influenza virus (HPAIV of clade 2.3.2 has been circulating in waterfowl in Southern China since 2003. Our previous studies showed that certain H5N1 HPAIV isolates within clade 2.3.2 from Southern China had high pathogenicity in different birds. Guinea pigs have been successfully used as models to evaluate the transmissibility of AIVs and other species of influenza viruses in mammalian hosts. However, few studies have reported pathogenicity and transmissibility of H5N1 HPAIVs of this clade in guinea pigs. In this study, we selected an H5N1 HPAIV isolate, A/duck/Guangdong/357/2008, to investigate the pathogenicity and transmissibility of the virus in guinea pigs. The virus had high pathogenicity in mice; additionally, it only replicated in some tissues of the guinea pigs without production of clinical signs, but was transmissible among guinea pigs. Interestingly, virus isolates from co-caged guinea pigs had the D701N mutation in the PB2 protein. These mutant viruses showed higher pathogenicity in mice and higher replication capability in guinea pigs but did not demonstrate enhanced the transmissibility among guinea pigs. These findings indicate the transmission of the H5N1 virus between mammals could induce virus mutations, and the mutant viruses might have higher pathogenicity in mammals without higher transmissibility. Therefore, the continued evaluation of the pathogenicity and transmissibility of avian influenza virus (AIVs in mammals is critical to the understanding of the evolutionary characteristics of AIVs and the emergence of potential pandemic strains.

  15. [Gene clone and expression of Barx1 in different tooth of the mini-pig at embryonic day 40].

    Science.gov (United States)

    Zhang, Ying; Yin, Ji-rong; Yang, Kai

    2012-10-01

    To partially clone and compare the quantitative expression of tooth development-related gene Barx1 in different teeth of the mini-pig embryo at embryonic day 40, and to investigate the relationship between Barx1 spatial quantitative expression and tooth morphogenesis. The mini-pig Barx1 genes was partially cloned and the mRNA sequences of human Barx1 genes was aligned with expressed sequence tags (EST) of pig by basic local alignment search tool (BLAST), which were assembled with DNAman v5.2.2. With designed primers, Barx1 was partially cloned in use of reverse transcription polymerase chain reaction (PCR), and tested by BLAST with all the species in NCBI database and confirmed as one part of target gene. Laser capture microdissection was used to collect tooth samples from frozen sections which were prepared before in -80°C freezer. Real-time PCR was carried out to analyze quantitative expression in different teeth. Partial mini-pig Barx1 gene of 698 bp was cloned. Real-time PCR showed that, glyceraldehyde-3-phosphate dehydrogenase used as loading control, the figures of 2(-ΔCT) of lower deciduous incisor, canine, the third premolar and molar were 0.000 249, 0.000 715, 0.026 096 and 0.112 656, respectively. There was a trend of increasing expression from anterior to posterior teeth. Barx1 gene could be related to the number or differentiation of tooth cusps.

  16. Dose-effect of ionizing radiation-induced PIG3 gene expression alteration in human lymphoblastoid AHH-1 cells and human peripheral blood lymphocytes.

    Science.gov (United States)

    Liu, Qing-Jie; Zhang, De-Qin; Zhang, Qing-Zhao; Feng, Jiang-Bin; Lu, Xue; Wang, Xin-Ru; Li, Kun-Peng; Chen, De-Qing; Mu, Xiao-Feng; Li, Shuang; Gao, Ling

    2015-01-01

    To identify new ionizing radiation (IR)-sensitive genes and observe the dose-effect of gene expression alteration (GEA) induced by IR. Microarray was used to screen the differentially expressed genes in human lymphoblastoid cells (AHH-1) using three doses of (60)Co γ-rays (0.5-8 Gy at 1 Gy/min). Given that p53-inducible gene 3 (PIG3) was consistently upregulated, the GEA of PIG3 in AHH-1 cells and human peripheral blood lymphocytes (HPBL) induced by γ-rays (1 Gy/min) was measured at messenger RNA (mRNA) and protein levels. The GEA of PIG3 in AHH-1 cells exposed to neutron radiation (californium-252, 0.073 Gy/min) was also quantified. PIG3 was one of the seven differentially expressed genes found in the microarray analysis. The PIG3 mRNA and protein levels in AHH-1 cells were significantly increased from 1-10 Gy of γ-rays 8-72 h or 8-168 h after exposure, respectively. The enhancement was also observed in AHH-1 cells from 0.4-1.6 Gy of neutrons 48 h post-irradiation. The PIG3 mRNA levels (mRNA copy numbers) in HPBL were significantly increased from 1-8 Gy of γ-rays within 4-24 h post-irradiation, but the highest increase in signal-to-noise responsiveness is approximately two-fold, which was less than that of AHH-1 (approximately 20-fold). IR can upregulate the PIG3 gene expression in AHH-1 and HPBL in the early phase after exposure; however, the IR induced expression levels of PIG3 are greater in AHH-1 than HPBL.

  17. Mice overexpressing both non-mutated human SOD1 and mutated SOD1G93A genes: a competent experimental model for studying iron metabolism in amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Anna eGajowiak

    2016-01-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a progressive neurodegenerative disease characterized by degeneration and loss of motor neurons in the spinal cord, brainstem and motor cortex. Up to 10% of ALS cases are inherited (familial, fALS and associated with mutations, frequently in the superoxide dismutase 1 (SOD1 gene. Rodent transgenic models of ALS are often used to elucidate a complex pathogenesis of this disease. Of importance, both ALS patients and animals carrying mutated human SOD1 gene show symptoms of oxidative stress and iron metabolism misregulation. The aim of our study was to characterize changes in iron metabolism in one of the most commonly used models of ALS – transgenic mice overexpressing human mutated SOD1G93A gene. We analyzed the expression of iron-related genes in asymptomatic, 2-month old and symptomatic, 4-month old SOD1G93A mice. In parallel, respective age-matched mice overexpressing human non-mutated SOD1 transgene and control mice were analyzed. We demonstrate that the overexpression of both SOD1 and SOD1G93A genes account for a substantial increase in SOD1 protein levels and activity in selected tissues and that not all the changes in iron metabolism genes expression are specific for the overexpression of the mutated form of SOD1.

  18. Usefulness of BCOR gene mutation as a prognostic factor in acute myeloid leukemia with intermediate cytogenetic prognosis.

    Science.gov (United States)

    Terada, Kazuki; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kobayashi, Yutaka; Tajika, Kenji; Gomi, Seiji; Kurosawa, Saiko; Saito, Riho; Furuta, Yutaka; Miyadera, Keiki; Tokura, Taichiro; Marumo, Atushi; Omori, Ikuko; Sakaguchi, Masahiro; Fujiwara, Yusuke; Yui, Shunsuke; Ryotokuji, Takeshi; Arai, Kunihito; Kitano, Tomoaki; Wakita, Satoshi; Fukuda, Takahiro; Inokuchi, Koiti

    2018-04-16

    BCOR gene is a transcription regulatory factor that plays an essential role in normal hematopoiesis. The wider introduction of next-generation sequencing technology has led to reports in recent years of mutations in the BCOR gene in acute myeloid leukemia (AML), but the related clinical characteristics and prognosis are not sufficiently understood. We investigated the clinical characteristics and prognosis of 377 de novo AML cases with BCOR or BCORL1 mutation. BCOR or BCORL1 gene mutations were found in 28 cases (7.4%). Among cases aged 65 years or below that were also FLT3-ITD-negative and in the intermediate cytogenetic prognosis group, BCOR or BCORL1 gene mutations were observed in 11% of cases (12 of 111 cases), and this group had significantly lower 5-year overall survival (OS) (13.6% vs. 55.0%, P=0.0021) and relapse-free survival (RFS) (14.3% vs. 44.5%, P=0.0168) compared to cases without BCOR or BCORL1 gene mutations. Multivariate analysis demonstrated that BCOR mutations were an independent unfavorable prognostic factor (P=0.0038, P=0.0463) for both OS and RFS. In cases of AML that are FLT3-ITD-negative, aged 65 years or below, and in the intermediate cytogenetic prognosis group, which are considered to have relatively favorable prognosis, BCOR gene mutations appear to be an important prognostic factor. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  19. An FBXO40 knockout generated by CRISPR/Cas9 causes muscle hypertrophy in pigs without detectable pathological effects.

    Science.gov (United States)

    Zou, Yunlong; Li, Zhiyuan; Zou, Yunjing; Hao, Haiyang; Li, Ning; Li, Qiuyan

    2018-04-15

    The regulatory function of Fbxo40 has been well characterized in mice. As a key component of the SCF-E3 ubiquitin ligase complex, Fbxo40 induces IRS1 ubiquitination, thus inactivating the IGF1/Akt pathway. The expression of Fbxo40 is restricted to muscle, and mice with an Fbxo40 null mutation exhibit muscle hypertrophy. However, the function of FBXO40 has not been elucidated in pigs, and it is not known whether FBXO40 mutations affect their health. We therefore generated FBXO40 knockout pigs using somatic cell nuclear transfer (SCNT) technology. CRISPR/Cas9 technology was combined with G418 selection, making it possible to generate donor cells at an efficiency of 75.86%. In muscle from FBXO40 knockout pigs, IRS1 levels were higher, and the IGF1/Akt pathway was stimulated. Mutant animals also had approximately 4% more muscle mass compared to WT controls. The knockout pigs developed normally and no pathological changes were found in major organs. These results demonstrate that FBXO40 is a promising candidate gene for improving production traits in agricultural livestock and for developing therapeutic interventions for muscle diseases. Copyright © 2018. Published by Elsevier Inc.

  20. Genetic factors of Ebola virus virulence in guinea pigs.

    Science.gov (United States)

    Subbotina, Ekaterina; Dadaeva, Alexandra; Kachko, Alla; Chepurnov, Alexander

    2010-10-01

    Zaire ebolavirus (ZEBOV) causes severe hemorrhagic fever in primates, whereas in guinea pigs it induces a nonlethal infection with a mild fever and subsequent recovery. We performed 7 selective passages in guinea pigs resulted in obtaining of guinea pig-adapted strain (GPA-P7) strain. By the 7th passage, the infection with EBOV induced a lethal disease in animals accompanied by the characteristic hematological changes: leukocytosis (primarily due to neutrophilia) as well as pronounced deficiencies in platelets, lymphocytes, monocytes and significant decrease of blood neutrophils phagocytic capacity. Increasing of virulence correlated with appearance of several nucleotide substitutions: in the genes NP, A2166G (N566S), VP24, U10784C (L147P), G10557A (M71I), G10805U (R154L), and L, G12286A (V236I). It has been theoretically calculated that the mutations associated with an increase in EBOV virulence can confer characteristic secondary structure on the proteins NP (C-terminal region) and full-sized VP24. (c) 2010 Elsevier B.V. All rights reserved.

  1. Prothrombin G20210A gene mutation in pregnant females with thrombotic obstetric complications

    International Nuclear Information System (INIS)

    Alam, M.A.; Ali, N.; Ayyub, M.

    2018-01-01

    To determine the frequency of prothrombin G20210A gene mutation in pregnant females with adverse thrombotic obstetric complication and to compare it with prothrombin G20210A gene's frequency in control population. Study Design: Case control study. Place and Duration of Study: Department of Haematology, Army Medical College Rawalpindi and Military Hospital Rawalpindi, from Nov 2013 to Oct 2014. Material and Methods: Sixty pregnant females were included in the study; 30 were cases with adverse thrombotic obstetric complication, while 30 were controls. Detailed history was obtained and 3 ml blood in EDTA tube was collected. DNA was extracted from whole blood and through RT-PCR, presence of prothrombin G20210A gene mutation was looked for in patients and controls. Data was analyzed using SPSS 21. Results: A total of 60 women-30 cases with thrombotic obstetric complications as 'cases' and 30 as 'controls'- were included in the study. Mean age of 'cases' was 28.70 +- 4.23 years while that of 'controls' was 27.33 +- 4.49 years. There was no statistically significant difference among the two groups (p=0.54). In case group only one of 30 (3.3%) patients had heterozygous F2 G20210A mutation while 29 (96.7%) patients had wild type allele. In control group, all the 30 (100%) subjects had wild type allele. The odds of finding the mutation in cases was 1:29 i.e. 0.03 as compared to zero in the control group. The difference was statistically insignificant (p=0.5). Conclusion: Our study shows that the frequency of F2 G20210A gene mutation in pregnant females having adverse thrombotic obstetric complications was not significantly different from its frequency in control population. (author)

  2. Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

    Energy Technology Data Exchange (ETDEWEB)

    Poussaint, T.Y. [Dept. of Radiology, Children' s Hospital, Boston, MA (United States); Fox, J.W.; Walsh, C.A. [Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, MA (United States); Dept. of Neurology, Beth Israel Deaconess Medical Center, Harvard Institutes of Medicine, Boston, MA (United States); Dobyns, W.B. [Department of Human Genetics, The University of Chicago, Chicago, IL (United States); Radtke, R. [Division of Neurology, Duke University Medical Center, Durham, NC (United States); Scheffer, I.E.; Berkovic, S.F. [Department of Neurology, University of Melbourne, Austin and Repatriation Medical Centre, Heidelberg (Australia); Barnes, P.D. [Department of Radiology, Children' s Hospital and Harvard Medical School, Boston, MA (United States); Huttenlocher, P.R. [Department of Pediatrics, University of Chicago, Chicago, Illinois (United States)

    2000-11-01

    Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

  3. Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

    International Nuclear Information System (INIS)

    Poussaint, T.Y.; Fox, J.W.; Walsh, C.A.; Dobyns, W.B.; Radtke, R.; Scheffer, I.E.; Berkovic, S.F.; Barnes, P.D.; Huttenlocher, P.R.

    2000-01-01

    Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

  4. Novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Bertelsen, Birgitte; Gredal, Ole

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder. About 10% of ALS cases are familial (FALS) and the genetic defect is known only in approximately 20%-30% of these cases. The most common genetic cause of ALS is SOD1 (superoxide dismutase 1) mutation. Very recently......, mutations of the optineurin gene (OPTN), which is involved in open-angle glaucoma, were identified in 3 Japanese patients/families with ALS, and subsequently in a few FALS patients of European descent. We found a heterozygous nonsense mutation (c.493C>T, p.Gln165X, exon 6) in the OPTN gene in a Danish...... patient with ALS, and the mutation segregated from his affected father. The p.Gln165X mutation could not be detected in 1070 healthy Danish controls, in 1000 Danish individuals with metabolic phenotypes or in 64 sporadic ALS (SALS) cases. The p.Gln165X mutation described in this study is the first...

  5. The fecal presence of enterotoxin and F4 genes as an indicator of efficacy of treatment with colistin sulfate in pigs.

    Science.gov (United States)

    Rhouma, Mohamed; Fairbrother, John Morris; Thériault, William; Beaudry, Francis; Bergeron, Nadia; Laurent-Lewandowski, Sylvette; Letellier, Ann

    2017-01-05

    Enterotoxigenic Escherichia coli (ETEC) strains producing multiple enterotoxins are important causes of post-weaning diarrhea (PWD) in pigs. The aim of the present study was to investigate the fecal presence of ETEC enterotoxin as well as F4 and F18 genes as an indicator of colistin sulfate (CS) efficacy for treatment of PWD in pigs. Forty-eight piglets were weaned at the age of 21 days, and were divided into four groups: challenged treated, challenged untreated, unchallenged treated, and unchallenged untreated. Challenge was performed using 10 9  CFU of an ETEC: F4 strain, and treatment was conducted using oral CS at the dose of 50,000 IU/kg. The fecal presence of genes encoding for STa, STb, LT, F4 and F18 was detected using PCR. The PCR amplification of ETEC virulence genes showed that nearly 100% of pigs excreted genes encoding for STa and STb toxins in the feces before the challenge. These genes, in the absence of the gene encoding F4, were considered as a marker for F4-negative ETEC. One day after ETEC: F4 oral challenge pigs in the two challenged groups excreted the genes encoding LT and F4 in the feces. These genes were considered as a marker for F4-positive ETEC. However, the gene encoding F18 was not detected in any fecal samples of the 4 groups throughout the experiment. After only 3 days of successive oral treatment with CS, a significant reduction in both the F4-positive and negative ETEC populations was observed in the challenged treated group compared to the challenged untreated group (p F4-positive and F4-negative ETEC in pigs. However, CS clinical efficiency was correlated with non-detection of F4-positive ETEC in the feces. Furthermore the fecal presence of F4-negative ETEC was not associated with clinical symptoms of post-weaning diarrhea in pigs.

  6. An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies

    International Nuclear Information System (INIS)

    Jin Tao; Zou Liuhe; Yang Ling

    2004-01-01

    Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)

  7. Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento

    Directory of Open Access Journals (Sweden)

    Li Ma

    2013-08-01

    Full Text Available AIM: To screen mutations in the retinitis pigmentosa 1 (RP1 gene and the rhodopsin (RHO gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP and describe the genotype-phenotype relationship of the mutations.METHODS:Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations.RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800 and one non-coding variant (rs56340615 were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

  8. Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento.

    Science.gov (United States)

    Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling

    2013-01-01

    To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

  9. Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome

    Directory of Open Access Journals (Sweden)

    Marianna P.R. Porto

    2010-01-01

    Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.

  10. Acral peeling skin syndrome associated with a novel CSTA gene mutation.

    Science.gov (United States)

    Muttardi, K; Nitoiu, D; Kelsell, D P; O'Toole, E A; Batta, K

    2016-06-01

    Acral peeling skin syndrome (APSS) is a rare autosomal recessive condition, characterized by asymptomatic peeling of the skin of the hands and feet, often linked to mutations in the gene TGM5. However, more recently recessive loss of function mutations in CSTA, encoding cystatin A, have been linked with APSS and exfoliative ichthyosis. We describe the clinical features in two sisters with APSS, associated with a novel large homozygous deletion encompassing exon 1 of CSTA. © 2015 British Association of Dermatologists.

  11. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  12. A Novel FOXE1 Mutation (R73S) in Bamforth–Lazarus Syndrome Causing Increased Thyroidal Gene Expression

    Science.gov (United States)

    Carré, Aurore; Hamza, Rasha T.; Kariyawasam, Dulanjalee; Guillot, Loïc; Teissier, Raphaël; Tron, Elodie; Castanet, Mireille; Dupuy, Corinne; El Kholy, Mohamed; Polak, Michel

    2014-01-01

    Background: Homozygous loss-of-function mutations in the FOXE1 gene have been reported in several patients with partial or complete Bamforth–Lazarus syndrome: congenital hypothyroidism (CH) with thyroid dysgenesis (usually athyreosis), cleft palate, spiky hair, with or without choanal atresia, and bifid epiglottis. Here, our objective was to evaluate potential functional consequences of a FOXE1 mutation in a patient with a similar clinical phenotype. Methods: FOXE1 was sequenced in eight patients with thyroid dysgenesis and cleft palate. Transient transfection was performed in HEK293 cells using the thyroglobulin (TG) and thyroid peroxidase (TPO) promoters in luciferase reporter plasmids to assess the functional impact of the FOXE1 mutations. Primary human thyrocytes transfected with wild type and mutant FOXE1 served to assess the impact of the mutation on endogenous TG and TPO expression. Results: We identified and characterized the function of a new homozygous FOXE1 missense mutation (p.R73S) in a boy with a typical phenotype (athyreosis, cleft palate, and partial choanal atresia). This new mutation located within the forkhead domain was inherited from the heterozygous healthy consanguineous parents. In vitro functional studies in HEK293 cells showed that this mutant gene enhanced the activity of the TG and TPO gene promoters (1.5-fold and 1.7-fold respectively vs. wild type FOXE1; p<0.05), unlike the five mutations previously reported in Bamforth–Lazarus syndrome. The gain-of-function effect of the FOXE1-p.R73S mutant gene was confirmed by an increase in endogenous TG production in primary human thyrocytes. Conclusion: We identified a new homozygous FOXE1 mutation responsible for enhanced expression of the TG and TPO genes in a boy whose phenotype is similar to that reported previously in patients with loss-of-function FOXE1 mutations. This finding further delineates the role for FOXE1 in both thyroid and palate development, and shows that enhanced gene

  13. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  14. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany.

    Directory of Open Access Journals (Sweden)

    Jessica Joerling

    09085, and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA, tlyC, and hlyA. Our data indicate that in Germany, swine dysentery might be caused by a limited number of B. hyodysenteriae clonal groups. Major STs (ST8, ST52, and ST112 are shared with other countries in Europe suggesting a possible role of the European intra-Community trade of pigs in the dissemination of certain clones. The identification of several novel STs, some of which are single or double locus variants of ST52, may on the other hand hint towards an ongoing diversification of the pathogen in the studied area. The linkage of pleuromutilin susceptibility and sequence type of an isolate might reflect a clonal expansion of the underlying resistance mechanism, namely mutations in the ribosomal RNA genes. A linkage between single virulence-associated genes (VAGs or even VAG patterns and the phylogenetic background of the isolates could not be established, since almost all VAGs were regularly present in the isolates.

  15. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany

    Science.gov (United States)

    Joerling, Jessica; Barth, Stefanie A.; Schlez, Karen; Willems, Hermann

    2018-01-01

    09085, and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA, tlyC, and hlyA. Our data indicate that in Germany, swine dysentery might be caused by a limited number of B. hyodysenteriae clonal groups. Major STs (ST8, ST52, and ST112) are shared with other countries in Europe suggesting a possible role of the European intra-Community trade of pigs in the dissemination of certain clones. The identification of several novel STs, some of which are single or double locus variants of ST52, may on the other hand hint towards an ongoing diversification of the pathogen in the studied area. The linkage of pleuromutilin susceptibility and sequence type of an isolate might reflect a clonal expansion of the underlying resistance mechanism, namely mutations in the ribosomal RNA genes. A linkage between single virulence-associated genes (VAGs) or even VAG patterns and the phylogenetic background of the isolates could not be established, since almost all VAGs were regularly present in the isolates. PMID:29324785

  16. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN

    2014-08-01

    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  17. Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations.

    Science.gov (United States)

    Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh

    2013-02-15

    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  19. c.376G>A mutation in WFS1 gene causes Wolfram syndrome without deafness.

    Science.gov (United States)

    Safarpour Lima, Behnam; Ghaedi, Hamid; Daftarian, Narsis; Ahmadieh, Hamid; Jamshidi, Javad; Khorrami, Mehdi; Noroozi, Rezvan; Sohrabifar, Nasim; Assarzadegan, Farhad; Hesami, Omid; Taghavi, Shaghayegh; Ahmadifard, Azadeh; Atakhorrami, Minoo; Rahimi-Aliabadi, Simin; Shahmohammadibeni, Neda; Alehabib, Elham; Andarva, Monavvar; Darvish, Hossein; Emamalizadeh, Babak

    2016-02-01

    Wolfram syndrome is one of the rare autosomal recessive, progressive, neurodegenerative disorders, characterized by diabetes mellitus and optic atrophy. Several other features are observed in patients including deafness, ataxia, and peripheral neuropathy. A gene called WFS1 is identified on chromosome 4p, responsible for Wolfram syndrome. We investigated a family consisted of parents and 8 children, which 5 of them have been diagnosed for Wolfram syndrome. WFS1 gene in all family members was sequenced for causative mutations. A mutation (c.376G>A, p.A126T) was found in all affected members in homozygous state and in both parents in heterozygous state. The bioinformatics analysis showed the deleterious effects of this nucleotide change on the structure and function of the protein product. As all of the patients in the family showed the homozygote mutation, and parents were both heterozygote, this mutation is probably the cause of the disease. We identified this mutation in homozygous state for the first time as Wolfram syndrome causation. We also showed that this mutation probably doesn't cause deafness in affected individuals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  20. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    Science.gov (United States)

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  1. Studies on meat color, myoglobin content, enzyme activities, and genes associated with oxidative potential of pigs slaughtered at different growth stages

    Science.gov (United States)

    Yu, Qin Ping; Feng, Ding Yuan; Xiao, Juan; Wu, Fan; He, Xiao Jun; Xia, Min Hao; Dong, Tao; Liu, Yi Hua; Tan, Hui Ze; Zou, Shi Geng; Zheng, Tao; Ou, Xian Hua; Zuo, Jian Jun

    2017-01-01

    Objective This experiment investigated meat color, myoglobin content, enzyme activities, and expression of genes associated with oxidative potential of pigs slaughtered at different growth stages. Methods Sixty 4-week-old Duroc×Landrace×Yorkshire pigs were assigned to 6 replicate groups, each containing 10 pigs. One pig from each group was sacrificed at day 35, 63, 98, and 161 to isolate longissimus dorsi and triceps muscles. Results Meat color scores were higher in pigs at 35 d than those at 63 d and 98 d (pMeat color scores were correlated to the proportion of oxymyoglobin (r = 0.59, pmeat color, myoglobin content, enzyme activities, and genes associated with oxidative potential varied at different stages. PMID:28728400

  2. Collodion Baby with TGM1 gene mutation

    Directory of Open Access Journals (Sweden)

    Sharma D

    2015-09-01

    Full Text Available Deepak Sharma,1 Basudev Gupta,2 Sweta Shastri,3 Aakash Pandita,1 Smita Pawar4 1Department of Neonatology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, 2Department of Pediatrics, Civil Hospital, Palwal, Haryana, 3Department of Pathology, NKP Salve Medical College, Nagpur, Maharashtra, 4Department of Obstetrics and Gynaecology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, IndiaAbstract: Collodion baby (CB is normally diagnosed at the time of birth and refers to a newborn infant that is delivered with a lambskin-like membrane encompassing the total body surface. CB is not a specific disease entity, but is a common phenotype in conditions like harlequin ichthyosis, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, and trichothiodystrophy. We report a CB that was brought to our department and later diagnosed to have TGM1 gene c.984+1G>A mutation. However, it could not be ascertained whether the infant had lamellar ichthyosis or congenital ichthyosiform erythroderma (both having the same mutation. The infant was lost to follow-up.Keywords: cellophane membrane, c.984+1G>A mutation, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, parchment membrane, TGM1 gene

  3. Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

    Science.gov (United States)

    Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

    2015-01-01

    To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

  4. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR

    DEFF Research Database (Denmark)

    Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Cirera, Susanna

    2007-01-01

    -microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane synthase (HMBS), hypoxanthine phosphoribosyltransferase I (HPRT I), ribosomal protein L4 (RPL4), succinate dehydrogenase complex subunit A (SDHA), TATA box binding protein (TPB) and tyrosine 3-monooxygenase/tryptophan 5......-monooxygenase activation protein zeta polypeptide (YWHAZ). The stability of these reference genes in different pig tissues was investigated using the geNorm application. The range of expression stability in the genes analysed was (from the most stable to the least stable): ACTB/RPL4, TBP, HPRT, HMBS, YWHAZ...

  5. Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

    Science.gov (United States)

    Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

    2015-01-01

    Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

  6. Novel mutations of the nucleophosmin (NPM-1) gene in Egyptian patients with acute myeloid leukemia: A pilot study

    International Nuclear Information System (INIS)

    Neemat Kassem, N.; Abel Hamid, A.; Tarek Attia, T.; Mahmoud, S.; Moemen, E.; Baathallah, Sh.; Safwat, E.; Khalaf, M.; Shaker, O.

    2011-01-01

    Mutations of the nucleophosmin (NPM-1) gene have been reported in 50-60% of acute myeloid leukemia (AML) patients with normal karyotype. This work was designed to study the prevalence and nature of NPM1 gene mutations in a group of Egyptian patients with AML to get an idea about the profile of NPM1 gene mutations in our society. In 45 previously untreated patients with de novo AML, peripheral blood and/or bone marrow samples from all patients were subjected to microscopic morphologic examination, cytochemical analysis, immuno phenotyping and karyotyping. Patients with normal cytogenetic results were selected for molecular analysis of NPM1 exon 12 by PCR amplification followed by DNA sequencing of the amplified product. Twenty-one patients (46.7%) had abnormal karyotype: six cases with ;(15;17), five cases with (8;21), five cases had trisomy 8, two cases carrying inv(3) and three cases had monosomy 7. The remaining 24 patients (53.3%) had normal karyotype. These patients were then subjected to molecular analysis. Out of these 24 patients with normal karyotype, mutant NPM-1 was detected in 11 patients (45.8%) by DNA sequencing; 2 cases showed type A mutation, 2 cases were harboring [ins 1015-4019 (CACG)], with point mutation [1006C→G], while the remaining 7 cases showed heterozygous deletion of nt A [del 1178 (A)]. Conclusion: Two novel NPM1 gene mutations were detected among our study population of AML patients identified as: the insertion CACG associated with point mutation, deletion of one base, or associated with point mutation. NPM1 gene mutations may become a new tool for monitoring minimal residual disease in AML with normal karyotype. Whether these previously unreported NPM-1 mutations will confer the same better outcome as previously reported mutations is currently unknown and warrants a larger study.

  7. MicroRNA genes and their target 3'-untranslated regions are infrequently somatically mutated in ovarian cancers.

    Directory of Open Access Journals (Sweden)

    Georgina L Ryland

    Full Text Available MicroRNAs are key regulators of gene expression and have been shown to have altered expression in a variety of cancer types, including epithelial ovarian cancer. MiRNA function is most often achieved through binding to the 3'-untranslated region of the target protein coding gene. Mutation screening using massively-parallel sequencing of 712 miRNA genes in 86 ovarian cancer cases identified only 5 mutated miRNA genes, each in a different case. One mutation was located in the mature miRNA, and three mutations were predicted to alter the secondary structure of the miRNA transcript. Screening of the 3'-untranslated region of 18 candidate cancer genes identified one mutation in each of AKT2, EGFR, ERRB2 and CTNNB1. The functional effect of these mutations is unclear, as expression data available for AKT2 and EGFR showed no increase in gene transcript. Mutations in miRNA genes and 3'-untranslated regions are thus uncommon in ovarian cancer.

  8. Retinal phenotype-genotype correlation of pediatric patients expressing mutations in the Norrie disease gene.

    Science.gov (United States)

    Wu, Wei-Chi; Drenser, Kimberly; Trese, Michael; Capone, Antonio; Dailey, Wendy

    2007-02-01

    To correlate the ophthalmic findings of patients with pediatric vitreoretinopathies with mutations occurring in the Norrie disease gene (NDP). One hundred nine subjects with diverse pediatric vitreoretinopathies and 54 control subjects were enrolled in the study. Diagnoses were based on retinal findings at each patient's first examination. Samples of DNA from each patient underwent polymerase chain reaction amplification and direct sequencing of the NDP gene. Eleven male patients expressing mutations in the NDP gene were identified in the test group, whereas the controls demonstrated wild-type NDP. All patients diagnosed as having Norrie disease had mutations in the NDP gene. Four of the patients with Norrie disease had mutations involving a cysteine residue in the cysteine-knot motif. Four patients diagnosed as having familial exudative vitreoretinopathy were found to have noncysteine mutations. One patient with retinopathy of prematurity had a 14-base deletion in the 5' untranslated region (exon 1), and 1 patient with bilateral persistent fetal vasculature syndrome expressed a noncysteine mutation in the second exon. Mutations disrupting the cysteine-knot motif corresponded to severe retinal dysgenesis, whereas patients with noncysteine mutations had varying degrees of avascular peripheral retina, extraretinal vasculature, and subretinal exudate. Patients exhibiting severe retinal dysgenesis should be suspected of carrying a mutation that disrupts the cysteine-knot motif in the NDP gene.

  9. Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations.

    Directory of Open Access Journals (Sweden)

    Christian Trolle

    Full Text Available QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc over time and relate the findings to the Turner syndrome phenotype.Adult women with Turner syndrome (n = 88 were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%, and adjusted for influence of heart rate by Bazett's (bQTc and Hodges's formula (hQTc. The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms. Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done.The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms compared to controls (390.4 ± 17.8 ms was prolonged (p432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2 and one in a minor Long QT syndrome gene (KCNE2.There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women.NCT00624949. https://register.clinicaltrials.gov/prs/app/action/SelectProtocol/sid/S0001FLI/selectaction/View/ts/3/uid/U000099E.

  10. Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease.

    Science.gov (United States)

    Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

    2016-01-01

    Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD.

  11. Mutation screening of the Ectodysplasin-A receptor gene EDAR in hypohidrotic ectodermal dysplasia

    NARCIS (Netherlands)

    van der Hout, Annemarie H.; Oudesluijs, Gretel G.; Venema, Andrea; Verheij, Joke B. G. M.; Mol, Bart G. J.; Rump, Patrick; Brunner, Han G.; Vos, Yvonne J.; van Essen, Anthonie J.

    Hypohidrotic ectodermal dysplasia (HED) can be caused by mutations in the X-linked ectodysplasin A (ED1) gene or the autosomal ectodysplasin A-receptor (EDAR) and EDAR-associated death domain (EDARADD) genes. X-linked and autosomal forms are sometimes clinically indistinguishable. For genetic

  12. Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

    Directory of Open Access Journals (Sweden)

    F.V. Perícole

    2005-09-01

    Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

  13. The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

    Science.gov (United States)

    Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

    2015-11-01

    Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

  14. Growth hormone receptor-deficient pigs resemble the pathophysiology of human Laron syndrome and reveal altered activation of signaling cascades in the liver

    Directory of Open Access Journals (Sweden)

    Arne Hinrichs

    2018-05-01

    Full Text Available Objective: Laron syndrome (LS is a rare, autosomal recessive disorder in humans caused by loss-of-function mutations of the growth hormone receptor (GHR gene. To establish a large animal model for LS, pigs with GHR knockout (KO mutations were generated and characterized. Methods: CRISPR/Cas9 technology was applied to mutate exon 3 of the GHR gene in porcine zygotes. Two heterozygous founder sows with a 1-bp or 7-bp insertion in GHR exon 3 were obtained, and their heterozygous F1 offspring were intercrossed to produce GHR-KO, heterozygous GHR mutant, and wild-type pigs. Since the latter two groups were not significantly different in any parameter investigated, they were pooled as the GHR expressing control group. The characterization program included body and organ growth, body composition, endocrine and clinical-chemical parameters, as well as signaling studies in liver tissue. Results: GHR-KO pigs lacked GHR and had markedly reduced serum insulin-like growth factor 1 (IGF1 levels and reduced IGF-binding protein 3 (IGFBP3 activity but increased IGFBP2 levels. Serum GH concentrations were significantly elevated compared with control pigs. GHR-KO pigs had a normal birth weight. Growth retardation became significant at the age of five weeks. At the age of six months, the body weight of GHR-KO pigs was reduced by 60% compared with controls. Most organ weights of GHR-KO pigs were reduced proportionally to body weight. However, the weights of liver, kidneys, and heart were disproportionately reduced, while the relative brain weight was almost doubled. GHR-KO pigs had a markedly increased percentage of total body fat relative to body weight and displayed transient juvenile hypoglycemia along with decreased serum triglyceride and cholesterol levels. Analysis of insulin receptor related signaling in the liver of adult fasted pigs revealed increased phosphorylation of IRS1 and PI3K. In agreement with the loss of GHR, phosphorylation of STAT5 was

  15. Glaucoma and Cytochrome P4501B1 Gene Mutations

    Directory of Open Access Journals (Sweden)

    Mukesh Tanwar

    2010-01-01

    Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.

  16. Use of a Guinea pig-specific transcriptome array for evaluation of protective immunity against genital chlamydial infection following intranasal vaccination in Guinea pigs.

    Science.gov (United States)

    Wali, Shradha; Gupta, Rishein; Veselenak, Ronald L; Li, Yansong; Yu, Jieh-Juen; Murthy, Ashlesh K; Cap, Andrew P; Guentzel, M Neal; Chambers, James P; Zhong, Guangming; Rank, Roger G; Pyles, Richard B; Arulanandam, Bernard P

    2014-01-01

    Guinea pigs have been used as a second animal model to validate putative anti-chlamydial vaccine candidates tested in mice. However, the lack of guinea pig-specific reagents has limited the utility of this animal model in Chlamydia sp. vaccine studies. Using a novel guinea pig-specific transcriptome array, we determined correlates of protection in guinea pigs vaccinated with Chlamydia caviae (C. caviae) via the intranasal route, previously reported by us and others to provide robust antigen specific immunity against subsequent intravaginal challenge. C. caviae vaccinated guinea pigs resolved genital infection by day 3 post challenge. In contrast, mock vaccinated animals continued to shed viable Chlamydia up to day 18 post challenge. Importantly, at day 80 post challenge, vaccinated guinea pigs experienced significantly reduced genital pathology - a sequelae of genital chlamydial infections, in comparison to mock vaccinated guinea pigs. Sera from vaccinated guinea pigs displayed antigen specific IgG responses and increased IgG1 and IgG2 titers capable of neutralizing GPIC in vitro. Th1-cellular/inflammatory immune genes and Th2-humoral associated genes were also found to be elevated in vaccinated guinea pigs at day 3 post-challenge and correlated with early clearance of the bacterium. Overall, this study provides the first evidence of guinea pig-specific genes involved in anti-chlamydial vaccination and illustrates the enhancement of the utility of this animal model in chlamydial pathogenesis.

  17. Novel mutation in ABCC6 gene in a Japanese pedigree with pseudoxanthoma elasticum and retinitis pigmentosa.

    Science.gov (United States)

    Yoshida, S; Honda, M; Yoshida, A; Nakao, S; Goto, Y; Nakamura, T; Fujisawa, K; Ishibashi, T

    2005-02-01

    To report a novel mutation of the ABCC6 gene in a Japanese family that had a case of pseudoxanthoma elasticum (PXE) another with PXE and retinitis pigmentosa. Ophthalmologic examinations were performed, and the ABCC6 gene was analysed by direct genomic sequencing. Fundus examinations of the 48-year-old proband disclosed angioid streaks and a peud'orange appearance of the retina of the both eyes, whereas both of his 25- and 20-year-old daughters had pigmentary degeneration and angioid streaks. In the sibilings, the mixed cone-rod ERG was almost nondetectable, whereas that of the proband was well-preserved. Molecular genetic analysis revealed that the proband has a homozygous nonsense mutation at the 595 bp in the ABCC6, and the siblings were heterozygous for the same mutation. This mutation was not detected in Japanese subjects in the JSNP database (http://snp.ims.u-tokyo.ac.jp/). Our results demonstrated an association between a novel mutation in the ABCC6 gene and PXE in a Japanese family.

  18. A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland.

    Science.gov (United States)

    Perreten, Vincent; Boerlin, Patrick

    2003-03-01

    A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Delta/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland.

  19. A New Sulfonamide Resistance Gene (sul3) in Escherichia coli Is Widespread in the Pig Population of Switzerland

    OpenAIRE

    Perreten, Vincent; Boerlin, Patrick

    2003-01-01

    A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Δ/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland.

  20. Identification of novel mutations in the α-galactosidase A gene in patients with Fabry disease: pitfalls of mutation analyses in patients with low α-galactosidase A activity.

    Science.gov (United States)

    Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro

    2011-05-01

    Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  1. A survey of new temperature-sensitive, embryonic-lethal mutations in C. elegans: 24 alleles of thirteen genes.

    Directory of Open Access Journals (Sweden)

    Sean M O'Rourke

    2011-03-01

    Full Text Available To study essential maternal gene requirements in the early C. elegans embryo, we have screened for temperature-sensitive, embryonic lethal mutations in an effort to bypass essential zygotic requirements for such genes during larval and adult germline development. With conditional alleles, multiple essential requirements can be examined by shifting at different times from the permissive temperature of 15°C to the restrictive temperature of 26°C. Here we describe 24 conditional mutations that affect 13 different loci and report the identity of the gene mutations responsible for the conditional lethality in 22 of the mutants. All but four are mis-sense mutations, with two mutations affecting splice sites, another creating an in-frame deletion, and one creating a premature stop codon. Almost all of the mis-sense mutations affect residues conserved in orthologs, and thus may be useful for engineering conditional mutations in other organisms. We find that 62% of the mutants display additional phenotypes when shifted to the restrictive temperature as L1 larvae, in addition to causing embryonic lethality after L4 upshifts. Remarkably, we also found that 13 out of the 24 mutations appear to be fast-acting, making them particularly useful for careful dissection of multiple essential requirements. Our findings highlight the value of C. elegans for identifying useful temperature-sensitive mutations in essential genes, and provide new insights into the requirements for some of the affected loci.

  2. Identification of adaptive mutations in the influenza A virus non-structural 1 gene that increase cytoplasmic localization and differentially regulate host gene expression.

    Directory of Open Access Journals (Sweden)

    Nicole Forbes

    Full Text Available The NS1 protein of influenza A virus (IAV is a multifunctional virulence factor. We have previously characterized gain-of-function mutations in the NS1 protein arising from the experimental adaptation of the human isolate A/Hong Kong/1/1968(H3N2 (HK to the mouse. The majority of these mouse adapted NS1 mutations were demonstrated to increase virulence, viral fitness, and interferon antagonism, but differ in binding to the post-transcriptional processing factor cleavage and polyadenylation specificity factor 30 (CPSF30. Because nuclear trafficking is a major genetic determinant of influenza virus host adaptation, we assessed subcellular localization and host gene expression of NS1 adaptive mutations. Recombinant HK viruses with adaptive mutations in the NS1 gene were assessed for NS1 protein subcellular localization in mouse and human cells using confocal microscopy and cellular fractionation. In human cells the HK wild-type (HK-wt virus NS1 protein partitioned equivalently between the cytoplasm and nucleus but was defective in cytoplasmic localization in mouse cells. Several adaptive mutations increased the proportion of NS1 in the cytoplasm of mouse cells with the greatest effects for mutations M106I and D125G. The host gene expression profile of the adaptive mutants was determined by microarray analysis of infected mouse cells to show either high or low extents of host-gene regulation (HGR or LGR phenotypes. While host genes were predominantly down regulated for the HGR group of mutants (D2N, V23A, F103L, M106I+L98S, L98S, M106V, and M106V+M124I, the LGR phenotype mutants (D125G, M106I, V180A, V226I, and R227K were characterized by a predominant up regulation of host genes. CPSF30 binding affinity of NS1 mutants did not predict effects on host gene expression. To our knowledge this is the first report of roles of adaptive NS1 mutations that impact intracellular localization and regulation of host gene expression.

  3. Functioning Mediastinal Paraganglioma Associated with a Germline Mutation of von Hippel-Lindau Gene

    Directory of Open Access Journals (Sweden)

    Thibault Bahougne

    2018-05-01

    Full Text Available We report the case of a 21-year old woman presenting with high blood pressure and raised normetanephrine levels. Indium-111-pentetreotide single photon-emission computed tomography with computed tomography (SPECT/CT and 2-deoxy-2-[fluorine-18]fluoro-d-glucose (FDG positron emission tomography/computed tomography (PET/CT imaging showing isolated tracer-uptake by a 2 cm tumor close to the costovertebral angle of the third thoracic vertebra. Thoracic surgery led to normalization of normetanephrine levels. Histological findings were consistent with the presence of a paraganglioma. Mutations in SDHA, SDHB, SDHC, SDHD, RET, SDHAF2, TMEM127, MAX, NF1, FH, MDH2, and EPAS1 were absent, but a heterozygous missense mutation, c.311G > T, was found in exon 1 of the von Hippel-Lindau gene, VHL, resulting in a glycine to valine substitution in the VHL protein at position 104, p.Gly104Val. This same mutation was found in both the mother and the 17-year old sister in whom a small retinal hemangioblastoma was also found. We diagnose an unusual functional mediastinal paraganglioma in this young patient with a germline VHL gene mutation, a mutation previously described as inducing polycythemia and/or pheochromocytoma but not paraganglioma or retinal hemangioblastoma.

  4. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

    Science.gov (United States)

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

    2016-01-01

    Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

  5. Eight previously unidentified mutations found in the OA1 ocular albinism gene

    Directory of Open Access Journals (Sweden)

    Dufier Jean-Louis

    2006-04-01

    Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.

  6. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene

    DEFF Research Database (Denmark)

    Xu, H; Wu, X R; Wewer, U M

    1994-01-01

    The classic murine muscular dystrophy strain, dy, was first described almost 40 years ago. We have identified the molecular basis of an allele of dy, called dy2J, by detecting a mutation in the laminin alpha 2 chain gene--the first identified mutation in laminin-2. The G to A mutation in a splice...

  7. A GYS1 gene mutation is highly associated with polysaccharide storage myopathy in Cob Normand draught horses.

    Science.gov (United States)

    Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G

    2009-02-01

    Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.

  8. [Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

    Science.gov (United States)

    Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

    2017-10-02

    Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

  9. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

    Science.gov (United States)

    Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

    2009-01-01

    Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  10. A novel mutation in the sterol 27-hydroxylase gene of a woman with autosomal recessive cerebrotendinous xanthomatosis

    Directory of Open Access Journals (Sweden)

    Garuti Rita

    2010-10-01

    Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.

  11. A three-step programmed method for the identification of causative gene mutations of maturity onset diabetes of the young (MODY).

    Science.gov (United States)

    Li, Qian; Cao, Xi; Qiu, Hai-Yan; Lu, Jing; Gao, Rui; Liu, Chao; Yuan, Ming-Xia; Yang, Guang-Ran; Yang, Jin-Kui

    2016-08-22

    To establish a three-step programmed method to find gene mutations related to maturity onset diabetes of the young (MODY). Target region capture and next-generation sequencing (NGS) were performed using customized oligonucleotide probes designed to capture suspected genes for MODY in 11 probands with clinically diagnosed MODY. The suspected associations of certain genes with MODY were then confirmed by Sanger sequencing in the probands and their family members. Finally, to validate variants of one of the genes of interest (glucokinase, GCK) as pathogenic mutations, protein function editing by the variant genes was assessed. In the target region capture and NGS phase, a total of nine variants of seven genes (GCK, WFS1, SLC19A2, SH2B1, SERPINB4, RFX6, and GATA6) were identified in eight probands. Two heterozygous GCK mutations located on the same allele (p.Leu77Arg and p.Val101Met) were identified in a MODY family. Sanger sequencing was used to confirm the variants identified by NGS to be present in probands and their diabetic family members, but not in non-diabetic family members. Finally, enzyme kinetic and thermal stability analyses revealed that the p.Leu77Arg mutation or the p.Leu77Arg mutation in combination with the p.Val101Met mutation inactivates GCK function and stability, while mutation of p.Val101Met alone does not. The p.Leu77Arg but not p.Val101Met GCK mutation is therefore considered a pathogenic mutation associated with MODY. Genetic screening coupled with gene-editing protein function testing is an effective and reliable method by which causative gene mutations of MODY can be identified. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Effects of missense mutations in sortase A gene on enzyme activity in Streptococcus mutans.

    Science.gov (United States)

    Zhuang, P L; Yu, L X; Tao, Y; Zhou, Y; Zhi, Q H; Lin, H C

    2016-04-11

    Streptococcus mutans (S. mutans) is the major aetiological agent of dental caries, and the transpeptidase Sortase A (SrtA) plays a major role in cariogenicity. The T168G and G470A missense mutations in the srtA gene may be linked to caries susceptibility, as demonstrated in our previous studies. This study aimed to investigate the effects of these missense mutations of the srtA gene on SrtA enzyme activity in S. mutans. The point mutated recombinant S.mutans T168G and G470A sortases were expressed in expression plasmid pET32a. S. mutans UA159 sortase coding gene srtA was used as the template for point mutation. Enzymatic activity was assessed by quantifying increases in the fluorescence intensity generated when a substrate Dabcyl-QALPNTGEE-Edans was cleaved by SrtA. The kinetic constants were calculated based on the curve fit for the Michaelis-Menten equation. SrtA△N40(UA159) and the mutant enzymes, SrtA△N40(D56E) and SrtA△N40(R157H), were expressed and purified. A kinetic analysis showed that the affinity of SrtA△N40(D56E) and SrtA△N40(R157H) remained approximately equal to the affinity of SrtA△N40(UA159), as determined by the Michaelis constant (K m ). However, the catalytic rate constant (k cat ) and catalytic efficiency (k cat /K m ) of SrtA△N40(D56E) were reduced compared with those of SrtA△N40(R157H) and SrtA△N40(UA159), whereas the k cat and k cat /K m values of SrtA△N40(R157H) were slightly lower than those of SrtA△N40(UA159). The findings of this study indicate that the T168G missense mutation of the srtA gene results in a significant reduction in enzymatic activity compared with S. mutans UA159, suggesting that the T168G missense mutation of the srtA gene may be related to low cariogenicity.

  13. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo Lisboa Bittencourt

    2009-01-01

    Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  14. Waardenburg syndrome type II in a Chinese patient caused by a novel nonsense mutation in the SOX10 gene.

    Science.gov (United States)

    Ma, Jing; Zhang, Tie-Song; Lin, Ken; Sun, Hao; Jiang, Hong-Chao; Yang, Yan-Li; Low, Fan; Gao, Ying-Qin; Ruan, Biao

    2016-06-01

    Waardenburg syndrome is a congenital genetic disorder. It is the most common type of syndromic hearing impairment with highly genetic heterogeneity and proved to be related by 6 genes as follows: PAX3, MITF, SNAI2, EDN3, EDNRB and SOX10. This article aims to identify the genetic causes of a Chinese WS child patient. A Chinese WS child was collected for clinical data collection by questionnaire survey. DNA samples of proband and his parents were extracted from peripheral blood samples. Six candidate genes were sequenced by the Trusight One sequencing panel on the illumina NextSeq 500 platform. A novel nonsense heterozygous mutation was found in the coding region of exon 2 in the SOX10 gene of proband. The novel nonsense heterozygous mutation could cause the replacement of the 55th lysine codon by stop codon (484T > C, C142R) and further more possibly cause terminating the protein translation in advance. However, both proband's parents had no mutation of genes above mentioned. The gene mutation of SOX10 [NM_006941.3 c.163A > T] is a novel nonsense mutation. No record of this mutation has been found in dbSNP, HGMD, 1000 Genomes Project, ClinVar and ESP6500 databases. It meets the condition of PS2 of strong evidence in 2015 ACMG Standards and Guidelines. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Genome-wide association and pathway analysis of feed efficiency in pigs reveal candidate genes and pathways for residual feed intake

    DEFF Research Database (Denmark)

    Do, Duy Ngoc; Strathe, Anders Bjerring; Ostersen, Tage

    2014-01-01

    Residual feed intake (RFI) is a complex trait that is economically important for livestock production; however, the genetic and biological mechanisms regulating RFI are largely unknown in pigs. Therefore, the study aimed to identify single nucleotide polymorphisms (SNPs), candidate genes and biol...... revealed key genes and genetic variants that control feed efficiency that could potentially be useful for genetic selection of more feed efficient pigs....

  16. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    OpenAIRE

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-01-01

    Purpose: Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing bas...

  17. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  18. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  19. [An overview of oculocutaneous albinism: TYR gene mutations in five Colombian individuals].

    Science.gov (United States)

    Sanabria, Diana; Groot, Helena; Guzmán, Julio; Lattig, María Claudia

    2012-06-01

    Oculocutaneus albinism is a pigment-related inherited disorder characterized by hypopigmentation of the skin, hair and eyes, foveal hypoplasia and low vision. To date, 230 mutations in the TYR gene have been reported as responsible for oculocutaneus albinism type 1 worldwide. TYR gene encodes the enzyme tyrosinase involved in the metabolic pathway of melanin synthesis. Mutations were identified in the TYR gene as responsible for oculocutaneous albinism type 1 in five Colombian individuals, and a new ophthalmic system was tested that corrected visual defects and symptoms in a patient with oculocutaneous albinism. Samples were taken from 5 individuals, four of whom belong to a single family, along with a fifth individual not related to the family. Five exons in the TYR gene were sequenced to search for the gene carriers in the family and in the non-related individual. In addition, clinical ophthalmological evaluation and implementation of an new oculo-visual system was undertaken. A G47D and 1379delTT mutation was identified in the family. The unrelated individual carried a compound heterozygote for the G47D and D42N mutations. The oculo-visual corrective system was able to increase visual acuity and to diminish the nystagmus and photophobia. This is the first study in Colombia where albinism mutations are reported. The methods developed will enable future molecular screening studies in Colombian populations.

  20. Molecular screening of pituitary adenomas for gene mutations and rearrangements

    Energy Technology Data Exchange (ETDEWEB)

    Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))

    1993-07-01

    Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.

  1. Evidence of a major gene from Bayesian segregation analyses of liability to osteochondral diseases in pigs.

    Science.gov (United States)

    Kadarmideen, Haja N; Janss, Luc L G

    2005-11-01

    Bayesian segregation analyses were used to investigate the mode of inheritance of osteochondral lesions (osteochondrosis, OC) in pigs. Data consisted of 1163 animals with OC and their pedigrees included 2891 animals. Mixed-inheritance threshold models (MITM) and several variants of MITM, in conjunction with Markov chain Monte Carlo methods, were developed for the analysis of these (categorical) data. Results showed major genes with significant and substantially higher variances (range 1.384-37.81), compared to the polygenic variance (sigmau2). Consequently, heritabilities for a mixed inheritance (range 0.65-0.90) were much higher than the heritabilities from the polygenes. Disease allele frequencies range was 0.38-0.88. Additional analyses estimating the transmission probabilities of the major gene showed clear evidence for Mendelian segregation of a major gene affecting osteochondrosis. The variants, MITM with informative prior on sigmau2, showed significant improvement in marginal distributions and accuracy of parameters. MITM with a "reduced polygenic model" for parameterization of polygenic effects avoided convergence problems and poor mixing encountered in an "individual polygenic model." In all cases, "shrinkage estimators" for fixed effects avoided unidentifiability for these parameters. The mixed-inheritance linear model (MILM) was also applied to all OC lesions and compared with the MITM. This is the first study to report evidence of major genes for osteochondral lesions in pigs; these results may also form a basis for underpinning the genetic inheritance of this disease in other animals as well as in humans.

  2. Dietary supplementation with arginine and glutamic acid enhances key lipogenic gene expression in growing pigs.

    Science.gov (United States)

    Hu, C J; Jiang, Q Y; Zhang, T; Yin, Y L; Li, F N; Su, J Y; Wu, G Y; Kong, X F

    2017-12-01

    Our previous study showed dietary supplementation with Arg and Glu increased intramuscular fat deposition and decreased back fat thickness in pigs, suggesting that the genes involved in lipid metabolism might be regulated differently in muscle and s.c. adipose (SA) tissues. Sixty Duroc × Large White × Landrace pigs with an average initial BW of 77.1 ± 1.3 kg were randomly assigned to 1 of 5 treatment groups (castrated male to female ratio = 1:1). Pigs in the control group were fed a basic diet, and those in experimental groups were fed the basic diet supplemented with 2.05% alanine (isonitrogenous group), 1.00% arginine (Arg group), 1.00% glutamic acid + 1.44% alanine (Glu group), or 1.00% arginine + 1.00% glutamic acid (Arg+Glu group). Fatty acid percentages and mRNA expression levels of the genes involved in lipid metabolism in muscle and SA tissues were examined. The percentages of C14:0 and C16:0 in the SA tissue of Glu group pigs and C14:0 in the longissimus dorsi (LD) muscle of Glu and Arg+Glu groups decreased ( acid synthase in the Arg+Glu group was more upregulated ( < 0.05) than that of the Arg group. An increase in the mRNA level of in the biceps femoris muscle was also observed in the Arg+Glu group ( < 0.05) compared with the basic diet and isonitrogenous groups. Collectively, these findings suggest that dietary supplementation with Arg and Glu upregulates the expression of genes involved in adipogenesis in muscle tissues and lipolysis in SA tissues.

  3. A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

    Science.gov (United States)

    Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

    2017-07-15

    Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

  4. Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease

    Science.gov (United States)

    Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L.; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

    2016-01-01

    Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD. PMID:27932943

  5. Severe Hypertriglyceridemia due to a novel p.Q240H mutation in the Lipoprotein Lipase gene.

    Science.gov (United States)

    Soto, Angela Ganan; McIntyre, Adam; Agrawal, Sungeeta; Bialo, Shara R; Hegele, Robert A; Boney, Charlotte M

    2015-09-04

    Lipoprotein Lipase (LPL) deficiency is a rare autosomal recessive disorder with a heterogeneous clinical presentation. Several mutations in the LPL gene have been identified to cause decreased activity of the enzyme. An 11-week-old, exclusively breastfed male presented with coffee-ground emesis, melena, xanthomas, lipemia retinalis and chylomicronemia. Genomic DNA analysis identified lipoprotein lipase deficiency due to compound heterozygosity including a novel p.Q240H mutation in exon 5 of the lipoprotein lipase (LPL) gene. His severe hypertriglyceridemia, including xanthomas, resolved with dietary long-chain fat restriction. We describe a novel mutation of the LPL gene causing severe hypertriglyceridemia and report the response to treatment. A review of the current literature regarding LPL deficiency syndrome reveals a few potential new therapies under investigation.

  6. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    Science.gov (United States)

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  7. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  8. Growth hormone receptor-deficient pigs resemble the pathophysiology of human Laron syndrome and reveal altered activation of signaling cascades in the liver.

    Science.gov (United States)

    Hinrichs, Arne; Kessler, Barbara; Kurome, Mayuko; Blutke, Andreas; Kemter, Elisabeth; Bernau, Maren; Scholz, Armin M; Rathkolb, Birgit; Renner, Simone; Bultmann, Sebastian; Leonhardt, Heinrich; de Angelis, Martin Hrabĕ; Nagashima, Hiroshi; Hoeflich, Andreas; Blum, Werner F; Bidlingmaier, Martin; Wanke, Rüdiger; Dahlhoff, Maik; Wolf, Eckhard

    2018-05-01

    Laron syndrome (LS) is a rare, autosomal recessive disorder in humans caused by loss-of-function mutations of the growth hormone receptor (GHR) gene. To establish a large animal model for LS, pigs with GHR knockout (KO) mutations were generated and characterized. CRISPR/Cas9 technology was applied to mutate exon 3 of the GHR gene in porcine zygotes. Two heterozygous founder sows with a 1-bp or 7-bp insertion in GHR exon 3 were obtained, and their heterozygous F1 offspring were intercrossed to produce GHR-KO, heterozygous GHR mutant, and wild-type pigs. Since the latter two groups were not significantly different in any parameter investigated, they were pooled as the GHR expressing control group. The characterization program included body and organ growth, body composition, endocrine and clinical-chemical parameters, as well as signaling studies in liver tissue. GHR-KO pigs lacked GHR and had markedly reduced serum insulin-like growth factor 1 (IGF1) levels and reduced IGF-binding protein 3 (IGFBP3) activity but increased IGFBP2 levels. Serum GH concentrations were significantly elevated compared with control pigs. GHR-KO pigs had a normal birth weight. Growth retardation became significant at the age of five weeks. At the age of six months, the body weight of GHR-KO pigs was reduced by 60% compared with controls. Most organ weights of GHR-KO pigs were reduced proportionally to body weight. However, the weights of liver, kidneys, and heart were disproportionately reduced, while the relative brain weight was almost doubled. GHR-KO pigs had a markedly increased percentage of total body fat relative to body weight and displayed transient juvenile hypoglycemia along with decreased serum triglyceride and cholesterol levels. Analysis of insulin receptor related signaling in the liver of adult fasted pigs revealed increased phosphorylation of IRS1 and PI3K. In agreement with the loss of GHR, phosphorylation of STAT5 was significantly reduced. In contrast, phosphorylation

  9. Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations.

    Science.gov (United States)

    Trolle, Christian; Mortensen, Kristian H; Pedersen, Lisbeth N; Berglund, Agnethe; Jensen, Henrik K; Andersen, Niels H; Gravholt, Claus H

    2013-01-01

    QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc) over time and relate the findings to the Turner syndrome phenotype. Adult women with Turner syndrome (n = 88) were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%), and adjusted for influence of heart rate by Bazett's (bQTc) and Hodges's formula (hQTc). The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms). Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done. The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms) compared to controls (390.4 ± 17.8 ms) was prolonged (pTurner syndrome karyotypes (418.2 ± 24.8 vs. 407.6 ± 25.5 ms; p = 0.055). In women with Turner syndrome and a bQTc >432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2) and one in a minor Long QT syndrome gene (KCNE2). There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women. NCT00624949. https://register.clinicaltrials.gov/prs/app/action/SelectProtocol/sid/S0001FLI/selectaction/View/ts/3/uid/U000099E.

  10. A Classic Case of Maple Syrup Urine Disease and a Novel Mutation in the BCKDHA Gene

    Directory of Open Access Journals (Sweden)

    Alieh Mirzaee

    2017-09-01

    Full Text Available Background: Maple syrup urine disease (MSUD is an inherited branched-chain amino acid metabolic disorder caused by the deficiency in the branched-chain alpha-keto acid dehydrogenase (BCKD complex. In MSUD, elevation of the branched-chain amino acids, such as alpha-keto acid and alpha-hydroxy acid, occurs due to the BCKDC gene deficiency, appearing in the blood, urine, and cerebrospinal fluid, which leads to neurological damage and mental retardation. MSUD phenotypically penetrates due to the mutations in the coding genes of four subunits of the BCKD complex, including the BCKDHA, BCKDHB, DBT, and DLD genes.Case report: We aimed to report the cases of three families whose children were affected by MSUD and presented with symptomatic features during the first week of birth, which were identified by mass spectrometry. DNA study was performed as a diagnosis panel containing four encoded BCKDC subunit genes.Conclusion: In the current study, DNA analysis and phenotypic manifestations indicated a novel mutation of c.143delT, p.L48Rfs*15 in the BCKDHA gene in a homozygous state, which is a causative mutation for the classic MSUD phenotype. Early diagnosis and neonatal screening are recommended for the accurate and effective treatment of this disease

  11. Social Health Insurance-Based Simultaneous Screening for 154 Mutations in 19 Deafness Genes Efficiently Identified Causative Mutations in Japanese Hearing Loss Patients.

    Directory of Open Access Journals (Sweden)

    Kentaro Mori

    Full Text Available Sensorineural hearing loss is one of the most common neurosensory disorders in humans. The incidence of SNHL is estimated to be 1 in 500-1000 newborns. In more than half of these patients, the hearing loss is associated with genetic causes. In Japan, genetic testing for the patients with SNHL using the Invader assay to screen for 46 mutations in 13 deafness genes was approved by the Ministry of Health, Labour and Welfare for inclusion in social health insurance coverage in 2012. Furthermore, from August 2015, this genetic testing has been expanded to screen for 154 mutations in 19 deafness genes using targeted genomic enrichment with massively parallel DNA sequencing combined with the Invader assay and TaqMan genotyping. For this study we analyzed 717 unrelated Japanese hearing loss patients. The total allele frequency of 154 mutations in 19 deafness genes was 32.64% (468/1434 and the total numbers of cases associated with at least one mutation was 44.07% (316/717. Among these, we were able to diagnose 212 (30% patients, indicating that the present screening could efficiently identify causative mutations in hearing loss patients. It is noteworthy that 27 patients (3.8% had coexistent multiple mutations in different genes. Five of these 27 patients (0.7%, 5/717 overall were diagnosed with genetic hearing loss affected by concomitant with responsible mutations in more than two different genes. For patients identified with multiple mutations in different genes, it is necessary to consider that several genes might have an impact on their phenotypes.

  12. A novel nonsense mutation of the GPR143 gene identified in a Chinese pedigree with ocular albinism.

    Directory of Open Access Journals (Sweden)

    Naihong Yan

    Full Text Available BACKGROUND: The purpose of this study was to elucidate the molecular basis of ocular albinism type I in a Chinese pedigree. METHODOLOGY/PRINCIPAL FINDINGS: Complete ophthalmologic examinations were performed on 4 patients, 7 carriers and 17 unaffected individuals in this five-generation family. All coding exons of four-point-one (4.1, ezrin, radixin, moesin (FERM domain-containing 7 (FRMD7 and G protein-coupled receptor 143 (GPR143 genes were amplified by polymerase chain reaction (PCR, sequenced and compared with a reference database. Ocular albinism and nystagmus were found in all patients of this family. Macular hypoplasia was present in the patients including the proband. A novel nonsense hemizygous mutation c.807T>A in the GPR143 gene was identified in four patients and the heterozygous mutation was found in seven asymptomatic individuals. This mutation is a substitution of tyrosine for adenine which leads to a premature stop codon at position 269 (p.Y269X of GPR143. CONCLUSIONS/SIGNIFICANCE: This is the first report that p.Y269X mutation of GPR143 gene is responsible for the pathogenesis of familial ocular albinism. These results expand the mutation spectrum of GPR143, and demonstrate the clinical characteristics of ocular albinism type I in Chinese population.

  13. Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis

    OpenAIRE

    Sánchez, Karen; Arcia, Orlando; Matute, Xiorama; Mindiola, Luz; Chaustre, Ismenia; Takiff, Howard

    2014-01-01

    Mutations in the CFTR gene in Cystic Fibrosis (CF) patients have geographic differences and there is scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in these patients. We amplified and sequenced exons 7, 10, 11, 19, 20 and 21, which contain the most common CFTR mutations, from 105 Venezuelan patients in the National CF Program. Eleven different mutations were identified, four with frequencies greater than 1%: p.Phe508del...

  14. HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.

    Science.gov (United States)

    Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J

    2017-07-01

    Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.

  15. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    Science.gov (United States)

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

    Science.gov (United States)

    Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

    2012-01-01

    Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

  17. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  18. Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

    Science.gov (United States)

    Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

    2017-11-01

    High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  19. Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Robb

    Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.

  20. Identification of a Novel HADHB Gene Mutation in an Iranian Patient with Mitochondrial Trifunctional Protein Deficiency.

    Science.gov (United States)

    Shahrokhi, Mahdiyeh; Shafiei, Mohammad; Galehdari, Hamid; Shariati, Gholamreza

    2017-01-01

    Mitochondrial trifunctional protein (MTP) is a hetero-octamer composed of eight parts (subunits): four α-subunits containing LCEH (long-chain 2,3-enoyl-CoA  hydratase) and LCHAD (long-chain 3-hydroxyacyl CoA dehydrogenase) activity, and four β-subunits that possess LCKT (long-chain  3-ketoacyl-CoA thiolase) activity which catalyzes three out of four steps in β-oxidation spiral of long-chain fatty acid. Its deficiency is an autosomal recessive disorder that causes a clinical spectrum of diseases. A blood spot was collected from the patient's original newborn screening card with parental informed consent. A newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS were performed. After isolation of DNA and Amplification of all exons of the HADHA and HADHB, directly Sequence analyses of all exons and the flanking introns both of genes were performed. Here, we report a novel mutation in a patient with MTP deficiency diagnosed with newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS and then confirmed by enzyme analysis in cultured fibroblasts and direct sequencing of the HADHA and HADHB genes. Molecular analysis of causative genes showed a missense mutation (p.Q385P) c.1154A > C in exon 14 of HADHB gene. Since this mutation was not found in 50 normal control cases; so it was concluded that c.1154A > C mutation was a causative mutation. Phenotype analysis of this mutation predicted pathogenesis which reduces the stability of the MTP protein complex.

  1. High dietary zinc supplementation increases the occurrence of tetracycline and sulfonamide resistance genes in the intestine of weaned pigs

    OpenAIRE

    Vahjen, Wilfried; Pietruszy?ska, Dominika; Starke, Ingo C.; Zentek, J?rgen

    2015-01-01

    Background Dietary zinc oxide is used in pig nutrition to combat post weaning diarrhoea. Recent data suggests that high doses (2.5?g/kg feed) increase the bacterial antibiotic resistance development in weaned pigs. Therefore, the aim of this study was to investigate the development of enterobacterial antibiotic resistance genes in the intestinal tract of weaned pigs. Findings Weaned pigs were fed diets for 4?weeks containing 57 (low), 164 (intermediate) or 2425 (high) mg?kg?1 analytical grade...

  2. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  3. EPILEPSY CAUSED BY PCDH19 GENE MUTATION: A REVIEW OF LITERATURE AND THE AUTHORS’ OBSERVATIONS

    Directory of Open Access Journals (Sweden)

    K. Yu. Mukhin

    2016-01-01

    Full Text Available Mutation in the PCDH19 gene was first described by L.M. Dibbens et al. in 2008. Mutations in this gene are associated with epilepsy and mental retardation limited to females. The clinical manifestations that are observed in some patients with PCDH19 mutation and Dravet syndrome that is caused by mutation in the SCN1A gene include the onset of febrile and afebrile seizures in infancy, serial seizures during fever, and regression in development after the onset of seizures. Due to the fact that the two diseases have common clinical signs, it is best to test for PCDH19 mutation in patients with the clinical picture of Dravet syndrome and a negative test for SCN1A. In general, the number of scientific papers devoted to analysis and recommendations for the choice of therapy in patients with rare genetic pathology is small now. We analyzed the specific features of clinical signs and therapy in our two observed female patients aged 4 and 11 years with verified PCDH19 mutation. Both patients were noted to have severe epilepsy with febrile convulsions with the development of status epilepticus and to be unresponsive to antiepileptic therapy. The use of different antiepileptic drugs (valproate, oxcarbazepine, phenobarbital, topiramate, levetiracetam at different combinations failed to control the course of epilepsy in the 4-year-old patient whereas the 11-year-old patient who took a combination of valproic acid and benzodiazepines achieved a positive effect.

  4. Association of mutations in the hemochromatosis gene with shorter life expectancy

    DEFF Research Database (Denmark)

    Bathum, L; Christiansen, L; Nybo, H

    2001-01-01

    BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....

  5. Effects of a Mutation in the gyrA Gene on the Virulence of Uropathogenic Escherichia coli

    DEFF Research Database (Denmark)

    Sánchez-Céspedes, Javier; Sáez-López, Emma; Frimodt-Møller, N

    2015-01-01

    the gyrA wild-type gene. However, only a slight recovery was observed in the colonization of the bladder in the GyrA complement strain compared to the mutant strain in a murine model of ascending urinary tract infection. In conclusion, a mutation in the gyrA gene of uropathogenic E. coli reduced......Fluoroquinolones are among the drugs most extensively used for the treatment of bacterial infections in human and veterinary medicine. Resistance to quinolones can be chromosome or plasmid mediated. The chromosomal mechanism of resistance is associated with mutations in the DNA gyrase...

  6. Investigation of QTL regions on Chromosome 17 for genes associated with meat color in the pig.

    Science.gov (United States)

    Fan, B; Glenn, K L; Geiger, B; Mileham, A; Rothschild, M F

    2008-08-01

    Previous studies have uncovered several significant quantitative trait loci (QTL) relevant to meat colour traits mapped at the end of SSC17 in the pig. Furthermore, results released from the porcine genome sequencing project have identified genes underlying the entire QTL regions and can further contribute to mining the region for likely causative genes. Ten protein coding genes or novel transcripts located within the QTL regions were screened for single nucleotide polymorphisms (SNPs). Linkage mapping and association studies were carried out in the ISU Berkshire x Yorkshire (B x Y) pig resource family. The total length of the new SSC17 linkage map was 126.6 cM and additional markers including endothelin 3 (EDN3) and phosphatase and actin regulator 3 (PHACTR3) genes were assigned at positions 119.4 cM and 122.9 cM, respectively. A new QTL peak was noted at approximately 120 cM, close to the EDN3 gene, and for some colour traits QTL exceeded the 5% chromosome-wise significance threshold. The association analyses in the B x Y family showed that the EDN3 BslI and PHACTR3 PstI polymorphisms were strongly associated with the subjective colour score and objective colour reflectance measures in the loin, as well as average drip loss percentage and pH value. The RNPC1 DpnII and CTCFL HpyCH4III polymorphisms were associated with some meat colour traits. No significant association between CBLN4, TFAP2C, and four novel transcripts and meat colour traits were detected. The association analyses conducted in one commercial pig line found that both EDN3 BslI and PHACTR3 PstI polymorphisms were associated with meat colour reflectance traits such as centre loin hue angle and Minolta Lightness score. The present findings suggested that the EDN3 and PHACTR3 genes might have potential effects on meat colour in pigs, and molecular mechanisms of their functions are worth exploring.

  7. Germline mutations in 40 cancer susceptibility genes among Chinese patients with high hereditary risk breast cancer.

    Science.gov (United States)

    Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun

    2018-05-12

    Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.

  8. [Identification of novel pathogenic gene mutations in pediatric acute myeloid leukemia by whole-exome resequencing].

    Science.gov (United States)

    Shiba, Norio

    2015-12-01

    A new class of gene mutations, identified in the pathogenesis of adult acute myeloid leukemia (AML), includes DNMT3A, IDH1/2, TET2 and EZH2. However, these mutations are rare in pediatric AML cases, indicating that pathogeneses differ between adult and pediatric forms of AML. Meanwhile, the recent development of massively parallel sequencing technologies has provided a new opportunity to discover genetic changes across entire genomes or proteincoding sequences. In order to reveal a complete registry of gene mutations, we performed whole exome resequencing of paired tumor-normal specimens from 19 pediatric AML cases using Illumina HiSeq 2000. In total, 80 somatic mutations or 4.2 mutations per sample were identified. Many of the recurrent mutations identified in this study involved previously reported targets in AML, such as FLT3, CEBPA, KIT, CBL, NRAS, WT1 and EZH2. On the other hand, several genes were newly identified in the current study, including BCORL1 and major cohesin components such as SMC3 and RAD21. Whole exome resequencing revealed a complex array of gene mutations in pediatric AML genomes. Our results indicate that a subset of pediatric AML represents a discrete entity that could be discriminated from its adult counterpart, in terms of the spectrum of gene mutations.

  9. A single point-mutation within the melanophilin gene causes the lavender plumage colour dilution phenotype in the chicken

    Directory of Open Access Journals (Sweden)

    Tixier-Boichard Michèle

    2008-01-01

    Full Text Available Abstract Background The lavender phenotype in the chicken causes the dilution of both black (eumelanin and red/brown (phaeomelanin pigments. Defects in three genes involved in intracellular melanosomal transport, previously described in mammals, give rise to similar diluted pigmentation phenotypes as those seen in lavender chickens. Results We have used a candidate-gene approach based on an expectation of homology with mammals to isolate a gene involved in pigmentation in chicken. Comparative sequence analysis of candidate genes in the chicken identified a strong association between a mutation in the MLPH gene and the diluted pigmentation phenotype. This mutation results in the amino acid change R35W, at a site also associated with similar phenotypes in mice, humans and cats. Conclusion This is the first time that an avian species with a mutation in the MLPH gene has been reported.

  10. Gene expression profiles in testis of pigs with extreme high and low levels of androstenone

    Directory of Open Access Journals (Sweden)

    Bendixen Christian

    2007-11-01

    Full Text Available Abstract Background: Boar taint is a major obstacle when using uncastrated male pigs for swine production. One of the main compounds causing this taint is androstenone, a pheromone produced in porcine testis. Here we use microarrays to study the expression of thousands of genes simultaneously in testis of high and low androstenone boars. The study allows identification of genes and pathways associated with elevated androstenone levels, which is essential for recognising potential molecular markers for breeding purposes. Results: Testicular tissue was collected from 60 boars, 30 with extreme high and 30 with extreme low levels of androstenone, from each of the two breeds Duroc and Norwegian Landrace. The samples were hybridised to porcine arrays containing 26,877 cDNA clones, detecting 563 and 160 genes that were differentially expressed (p Conclusion: This study contributes to the understanding of the complex genetic system controlling and responding to androstenone levels in pig testis. The identification of new pathways and genes involved in the biosynthesis and metabolism of androstenone is an important first step towards finding molecular markers to reduce boar taint.

  11. Joint analysis of quantitative trait loci and majoreffect causative mutations affecting meat quality and carcass composition traits in pigs

    OpenAIRE

    Cherel, Pierre; Pires, José; Glénisson, Jérôme; Milan, Denis; Iannuccelli, Nathalie; Herault, Frédéric; Damon, Marie; Le Roy, Pascale

    2011-01-01

    Abstract Background Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effect...

  12. [Identification of novel compound heterozygous mutations of USH2A gene in a family with Usher syndrome type II].

    Science.gov (United States)

    Jiang, Haiou; Ge, Chuanqin; Wang, Yiwang; Tang, Genyun; Quan, Qingli

    2015-06-01

    To identify potential mutations in a Chinese family with Usher syndrome type II. Genomic DNA was obtained from two affected and four unaffected members of the family and subjected to amplification of the entire coding sequence and splicing sites of USH2A gene. Mutation detection was conducted by direct sequencing of the PCR products. A total of 100 normal unrelated individuals were used as controls. The patients were identified to be a compound heterozygote for two mutations: c.8272G>T (p.E2758X) in exon 42 from his mother and c.12376-12378ACT>TAA(p.T4126X) in exon 63 of the USH2A gene from his father. Both mutations were not found in either of the two unaffected family members or 100 unrelated controls, and had completely co-segregated with the disease phenotype in the family. Neither mutation has been reported in the HGMD database. The novel compound heterozygous mutations c.8272G>T and c.12376-12378ACT>TAA within the USH2A gene may be responsible for the disease. This result may provide new clues for molecular diagnosis of this disease.

  13. Major gene mutations and domestication of plants

    International Nuclear Information System (INIS)

    Ashri, A.

    1989-01-01

    From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

  14. Molecular cytogenetics of radiation-induced gene mutations in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Aleksandrov, I.D.; Aleksandrova, M.V.; Lapidus, I.L.; Karpovskij, A.L.

    1996-01-01

    The classical paradigm of spatially unrelated lesions for gene mutations and chromosomal exchange breakpoints induced by ionizing radiations in eukaryotic cells was re-examined in the experiments on the mapping of gamma-ray- or neutron-induced breakpoints in and outside of white (w) and vestigial (vg) genes of Drosophila melanogaster using the in situ hybridization of the large fragments of the genes under study with the polythene chromosomes of the relevant mutants. The results for the random sample of 60 inversion and translocation breakpoints analysed to date have shown that (i) 50% of them are mapped as the hot spots within big introns of both the genes, and (ii) 21 of 60 breaks (35%) are located outside of genes. It is important to note that 26% (16/60) of the breakpoints analysed are flanked by the deletions, the sizes of which vary from the quarter to a whole of the gene. It was found that the deletions flank both the inversion and translocation breakpoints and arise more often after action of neutrons than photons. An unexpectedly high frequency of the multiple-damaged w and vg mutants that have the gene/point mutation and additional, but separate, chromosome exchange (the so-called double- or triple-site mutants) has shown that the genetic danger of ionizing radiation is higher than usually accepted on the base of single gene/point mutation assessments. 11 refs., 3 figs

  15. Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases

    International Nuclear Information System (INIS)

    Watanabe, Masahito; Umeyama, Kazuhiro; Matsunari, Hitomi; Takayanagi, Shuko; Haruyama, Erika; Nakano, Kazuaki; Fujiwara, Tsukasa; Ikezawa, Yuka; Nakauchi, Hiromitsu

    2010-01-01

    Research highlights: → EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. → ZFNs induced targeted mutations in porcine primary cultured cells. → Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor the exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.

  16. Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

    Directory of Open Access Journals (Sweden)

    Rodolfo Delfini Cançado

    Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

  17. Clinical impact of recurrently mutated genes on lymphoma diagnostics: state-of-the-art and beyond.

    Science.gov (United States)

    Rosenquist, Richard; Rosenwald, Andreas; Du, Ming-Qing; Gaidano, Gianluca; Groenen, Patricia; Wotherspoon, Andrew; Ghia, Paolo; Gaulard, Philippe; Campo, Elias; Stamatopoulos, Kostas

    2016-09-01

    Similar to the inherent clinical heterogeneity of most, if not all, lymphoma entities, the genetic landscape of these tumors is markedly complex in the majority of cases, with a rapidly growing list of recurrently mutated genes discovered in recent years by next-generation sequencing technology. Whilst a few genes have been implied to have diagnostic, prognostic and even predictive impact, most gene mutations still require rigorous validation in larger, preferably prospective patient series, to scrutinize their potential role in lymphoma diagnostics and patient management. In selected entities, a predominantly mutated gene is identified in almost all cases (e.g. Waldenström's macroglobulinemia/lymphoplasmacytic lymphoma and hairy-cell leukemia), while for the vast majority of lymphomas a quite diverse mutation pattern is observed, with a limited number of frequently mutated genes followed by a seemingly endless tail of genes with mutations at a low frequency. Herein, the European Expert Group on NGS-based Diagnostics in Lymphomas (EGNL) summarizes the current status of this ever-evolving field, and, based on the present evidence level, segregates mutations into the following categories: i) immediate impact on treatment decisions, ii) diagnostic impact, iii) prognostic impact, iv) potential clinical impact in the near future, or v) should only be considered for research purposes. In the coming years, coordinated efforts aiming to apply targeted next-generation sequencing in large patient series will be needed in order to elucidate if a particular gene mutation will have an immediate impact on the lymphoma classification, and ultimately aid clinical decision making. Copyright© Ferrata Storti Foundation.

  18. Same β-globin gene mutation is present on nine different β-thalassemia chromosomes in a Sardinian population

    International Nuclear Information System (INIS)

    Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

    1987-01-01

    The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region

  19. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  20. Diffusion tensor imaging of brain white matter in Huntington gene mutation individuals

    Directory of Open Access Journals (Sweden)

    Roberta Arb Saba

    Full Text Available ABSTRACT Objective To evaluate the role of the involvement of white matter tracts in huntingtin gene mutation patients as a potential biomarker of the progression of the disease. Methods We evaluated 34 participants (11 symptomatic huntingtin gene mutation, 12 presymptomatic huntingtin gene mutation, and 11 controls. We performed brain magnetic resonance imaging to assess white matter integrity using diffusion tensor imaging, with measurement of fractional anisotropy. Results We observed a significant decrease of fractional anisotropy in the cortical spinal tracts, corona radiate, corpus callosum, external capsule, thalamic radiations, superior and inferior longitudinal fasciculus, and inferior frontal-occipital fasciculus in the Huntington disease group compared to the control and presymptomatic groups. Reduction of fractional anisotropy is indicative of a degenerative process and axonal loss. There was no statistically significant difference between the presymptomatic and control groups. Conclusion White matter integrity is affected in huntingtin gene mutation symptomatic individuals, but other studies with larger samples are required to assess its usefulness in the progression of the neurodegenerative process.

  1. ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

    Science.gov (United States)

    Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

    2011-01-01

    We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

  2. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  3. Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa

    International Nuclear Information System (INIS)

    Dryja, T.P.; Han, L.B.; Cowley, G.S.; McGee, T.L.; Berson, E.L.

    1991-01-01

    The authors searched for point mutations in every exon of the rhodopsin gene in 150 patients from separate families with autosomal dominant retinitis pigmentosa. Including the 4 mutations the authors reported previously, they found a total of 17 different mutations that correlate with the disease. Each of these mutations is a single-base substitution corresponding to a single amino acid substitution. Based on current models for the structure of rhodopsin, 3 of the 17 mutant amino acids are normally located on the cytoplasmic side of the protein, 6 in transmembrane domains, and 8 on the intradiscal side. Forty-three of the 150 patients (29%) carry 1 of these mutations, and no patient has more than 1 mutation. In every family with a mutation so far analyzed, the mutation cosegregates with the disease. They found one instance of a mutation in an affected patient that was absent in both unaffected parents (i.e., a new germ-line mutation), indicating that some isolate cases of retinitis pigmentosa carry a mutation of the rhodopsin gene

  4. A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Junyu Zhang

    Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

  5. Missense mutation in the USH2A gene: association with recessive retinitis pigmentosa without hearing loss.

    Science.gov (United States)

    Rivolta, C; Sweklo, E A; Berson, E L; Dryja, T P

    2000-06-01

    Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an amino-acid residue within the fifth laminin-epidermal growth factor-like domain of the USH2A gene and that is associated with recessive RP without hearing loss. This single mutation was found in 4.5% of 224 patients with recessive RP, suggesting that USH2A could cause more cases of nonsyndromic recessive RP than does any other gene identified to date.

  6. HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides

    Energy Technology Data Exchange (ETDEWEB)

    Jingyong, Zhao; Yongzhong, Xu; Tao, Zhao; Fengmei, Cui; Liuyi, Wang; Qinhua, Lao [Suzhou Univ., Suzhou (China). Radiation Medicine Department

    2001-07-01

    HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides was performed and the relationships between mutation frequency and dose were studied. Rats were injected intravenously with radionuclides, the blood was sampled at different time after injection; HPRT gene locus mutation frequency (GMF) were examined by methods of multi-nucleus cell and Brdurd assay, working out the Dose-response function. GMF rose with the increase of dose and dose-rates and were clearly interrelated. The HPRT gene locus mutation is very sensitive to radiation and may be used as a biological dosimeter.

  7. Intrafamiliar clinical variability of circumferential skin creases Kunze type caused by a novel heterozygous mutation of N-terminal TUBB gene.

    Science.gov (United States)

    Dentici, M L; Terracciano, A; Bellacchio, E; Capolino, R; Novelli, A; Digilio, M C; Dallapiccola, B

    2018-02-10

    Circumferential skin creases Kunze type (CSC-KT; OMIM 156610, 616734) is a rare disorder characterized by folding of excess skin, which leads to ringed creases, known as Michelin Tire Baby Syndrome (MTBS). CSC-KT patients also exhibit facial dysmorphism, growth retardation, intellectual disability (ID) and multiple congenital malformations. Recently, 2 heterozygous mutations in TUBB gene and 4 mutations (both homozygous and heterozygous) in MAPRE2 gene were identified in 3 and 4 CSC-KT patients, respectively. In the 3 TUBB gene-related CSC-KT patients, all mutations fall in the N-terminal gene domain and were de novo. Mutations in the C-terminal of TUBB gene have been associated to microcephaly and structural brain malformation, in the absence of CSC-KT features. We report a 9-year-old boy with a diagnosis of CSC-KT based on MTBS, facial dysmorphism, microcephaly, severe ID, cortical atrophy and corpus callosum hypoplasia. Sanger sequencing identified a novel heterozygous c.218T>C (p.Met73Thr) mutation in the N-terminal of TUBB gene, that was inherited from the mother affected by isolated MTBS. This is the first report of inherited TUBB gene-related CSC-KT resulting from a novel heterozygous mutation in the N-terminal domain. Present data support the role of TUBB mutations in CSC-KT and definitely includes CSC-KT syndrome within the tubulinopathies. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. A novel AVPR2 gene mutation of X-linked congenital nephrogenic diabetes insipidus in an Asian pedigree.

    Science.gov (United States)

    Guo, Wei-Hong; Li, Qiang; Wei, Hong-Yan; Lu, Hong-Yan; Qu, Hui-Qi; Zhu, Mei

    2016-10-01

    Polyuria and polydipsia are the characteristics of congenital nephrogenic diabetes insipidus (CNDI). Approximately 90% of all patients with CNDI have X-linked hereditary disease, which is due to a mutation of the arginine vasopressin receptor 2 ( AVPR2) gene. This case report describes a 54-year-old male with polyuria and polydipsia and several male members of his pedigree who had the same symptoms. The proband was diagnosed with diabetes insipidus using a water-deprivation and arginine vasopressin stimulation test. Genomic DNA from the patient and his family members was extracted and the AVPR2 gene was sequenced. A novel missense mutation of a cytosine to guanine transition at position 972 (c.972C > G) was found, which resulted in the substitution of isoleucine for methionine at amino acid position 324 (p.I324M) in the seventh transmembrane domain of the protein. The proband's mother and daughter were heterozygous for this mutation. The novel mutation of the AVPR2 gene further broadens the phenotypic spectrum of the AVPR2 gene.

  9. A case report of novel mutation in PRF1 gene, which causes familial autosomal recessive hemophagocytic lymphohistiocytosis.

    Science.gov (United States)

    Bordbar, Mohammad Reza; Modarresi, Farzaneh; Farazi Fard, Mohammad Ali; Dastsooz, Hassan; Shakib Azad, Nader; Faghihi, Mohammad Ali

    2017-05-03

    Hemophagocytic Lymphohistiocytosis (HLH) is a life-threatening immunodeficiency and multi-organ disease that affects people of all ages and ethnic groups. Common symptoms and signs of this disease are high fever, hepatosplenomegaly, and cytopenias. Familial form of HLH disease, which is an autosomal recessive hematological disorder is due to disease-causing mutations in several genes essential for NK and T-cell granule-mediated cytotoxic function. For an effective cytotoxic response from cytotoxic T lymphocyte or NK cell encountering an infected cell or tumor cell, different processes are required, including trafficking, docking, priming, membrane fusion, and entry of cytotoxic granules into the target cell leading to apoptosis. Therefore, genes involved in these steps play important roles in the pathogenesis of HLH disease which include PRF1, UNC13D (MUNC13-4), STX11, and STXBP2 (MUNC18-2). Here, we report a novel missense mutation in an 8-year-old boy suffered from hepatosplenomegaly, hepatitis, epilepsy and pancytopenia. The patient was born to a first-cousin parents with no previous documented disease in his parents. To identify mutated gene in the proband, Whole Exome Sequencing (WES) utilizing next generation sequencing was used on an Illumina HiSeq 2000 platform on DNA sample from the patient. Results showed a novel deleterious homozygous missense mutation in PRF1 gene (NM_001083116: exon3: c. 1120 T > G, p.W374G) in the patient and then using Sanger sequencing it was confirmed in the proband and his parents. Since his parents were heterozygous for the identified mutation, autosomal recessive pattern of inheritance was confirmed in the family. Our study identified a rare new pathogenic missense mutation in PRF1 gene in patient with HLH disease and it is the first report of mutation in PRF1 in Iranian patients with this disease.

  10. Detecting negative selection on recurrent mutations using gene genealogy

    Science.gov (United States)

    2013-01-01

    Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their

  11. Two novel mutations in the PPIB gene cause a rare pedigree of osteogenesis imperfecta type IX.

    Science.gov (United States)

    Jiang, Yu; Pan, Jingxin; Guo, Dongwei; Zhang, Wei; Xie, Jie; Fang, Zishui; Guo, Chunmiao; Fang, Qun; Jiang, Weiying; Guo, Yibin

    2017-06-01

    Osteogenesis imperfecta (OI) is a rare genetic skeletal disorder characterized by increased bone fragility and vulnerability to fractures. PPIB is identified as a candidate gene for OI-IX, here we detect two pathogenic mutations in PPIB and analyze the genotype-phenotype correlation in a Chinese family with OI. Next-generation sequencing (NGS) was used to screen the whole exome of the parents of proband. Screening of variation frequency, evolutionary conservation comparisons, pathogenicity evaluation, and protein structure prediction were conducted to assess the pathogenicity of the novel mutations. Sanger sequencing was used to confirm the candidate variants. RTQ-PCR was used to analyze the PPIB gene expression. All mutant genes screened out by NGS were excluded except PPIB. Two novel heterozygous PPIB mutations (father, c.25A>G; mother, c.509G>A) were identified in relation to osteogenesis imperfecta type IX. Both mutations were predicted to be pathogenic by bioinformatics analysis and RTQ-PCR analysis revealed downregulated PPIB expression in the two carriers. We report a rare pedigree with an autosomal recessive osteogenesis imperfecta type IX (OI-IX) caused by two novel PPIB mutations identified for the first time in China. The current study expands our knowledge of PPIB mutations and their associated phenotypes, and provides new information on the genetic defects associated with this disease for clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. High risk of cerebral-vein thrombosis in carriers of a prothrombin-gene mutation and in users of oral contraceptives.

    Science.gov (United States)

    Martinelli, I; Sacchi, E; Landi, G; Taioli, E; Duca, F; Mannucci, P M

    1998-06-18

    Idiopathic cerebral-vein thrombosis can cause serious neurologic disability. We evaluated risk factors for this disorder, including genetic risk factors (mutations in the genes encoding factor V and prothrombin) and nongenetic risk factors (such as the use of oral contraceptive agents). We compared the prevalence of these risk factors in 40 patients with cerebral-vein thrombosis, 80 patients with deep-vein thrombosis of the lower extremities, and 120 healthy controls. The G1691A mutation in the factor V gene and the G20210A prothrombin-gene mutation, which are established genetic risk factors for venous thrombosis, were studied. We also assessed the use of oral contraceptives and other risk factors for thrombosis. The prevalence of the prothrombin-gene mutation was higher in patients with cerebral-vein thrombosis (20 percent) than in healthy controls (3 percent; odds ratio, 10.2; 95 percent confidence interval, 2.3 to 31.0) and was similar to that in patients with deep-vein thrombosis (18 percent). Similar results were obtained for the mutation in the factor V gene. The use of oral contraceptives was more frequent among women with cerebral-vein thrombosis (96 percent) than among controls (32 percent; odds ratio, 22.1; 95 percent confidence interval, 5.9 to 84.2) and among those with deep-vein thrombosis (61 percent; odds ratio, 4.4; 95 percent confidence interval, 1.1 to 17.8). For women who were taking oral contraceptives and who also had the prothrombin-gene mutation (seven patients with cerebral-vein thrombosis but only one control), the odds ratio for cerebral-vein thrombosis rose to 149.3 (95 percent confidence interval, 31.0 to 711.0). Mutations in the prothrombin gene and the factor V gene are associated with cerebral-vein thrombosis. The use of oral contraceptives is also strongly and independently associated with the disorder. The presence of both the prothrombin-gene mutation and oral-contraceptive use raises the risk of cerebral-vein thrombosis further.

  13. Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene

    Energy Technology Data Exchange (ETDEWEB)

    Goltsov, A.A.; Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States)); Konecki, D.S.; Lichter-Konecki, U.

    1992-09-01

    The HindIII RFLP in the human phenylalanine hydroxylase (PAH) gene is caused by the presence of an AT-rich (70%) minisatellite region. This region contains various multiples of 30-bp tandem repeats and is located 3 kb downstream of the final exon of the gene. PCR-mediated amplification of this region from haplotyped PAH chromosomes indicates that the previously reported 4.0-kb HindIII allele contains three of these repeats, while the 4.4-kb HindIII allele contains 12 of these repeats. The 4.2-kb HindIII fragment can contain six, seven, eight, or nine copies of this repeat. These variations permit more detailed analysis of mutant haplotypes 1, 5, 6, and, possibly, others. Kindred analysis in phenylketonuria families demonstrates Mendelian segregation of these VNTR alleles, as well as associations between theses alleles and certain PAH mutations. The R261Q mutation, associated with haplotype 1, is associated almost exclusively with an allele containing eight repeats; the R408W mutation, when occurring on a haplotype 1 background, may also be associated with the eight-repeat VNTR allele. Other PAH mutations associated with haplotype 1, R252W and P281L, do not appear to segregate with specific VNTR alleles. The IVS-10 mutation, when associated with haplotype 6, is associated exclusively with an allele containing seven repeats. The combined use of this VNTR system and the existing RFLP haplotype system will increase the performance of prenatal diagnostic tests based on haplotype analysis. In addition, this VNTR may prove useful in studies concerning the origins and distributions of PAH mutations in different human populations. 32 refs., 3 figs., 3 tabs.

  14. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Science.gov (United States)

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. A novel missense mutation in the CLCN7 gene linked to benign autosomal dominant osteopetrosis: a case series

    Directory of Open Access Journals (Sweden)

    Rashid Ban Mousa

    2013-01-01

    Full Text Available Abstract Introduction Osteopetrosis is a rare inherited genetic disease characterized by sclerosis of the skeleton. The absence or malfunction of osteoclasts is found to be strongly associated with the disease evolution. Currently, four clinically distinct forms of the disease have been recognized: the infantile autosomal recessive osteopetrosis, the malignant and the intermediate forms, and autosomal dominant osteopetrosis, type I and type II forms. The autosomal recessive types are the most severe forms with symptoms in very early childhood, whereas the autosomal dominant classes exhibit a heterogeneous trait with milder symptoms, often at later childhood or adulthood. Case presentation Case 1 is the 12-year-old daughter (index patient of an Iraqi-Kurdish family who, at the age of eight years, was diagnosed clinically to have mild autosomal dominant osteopetrosis. Presently, at 12-years old, she has severe complications due to the disease progression. In addition, the same family previously experienced the death of a female child in her late childhood. The deceased child had been misdiagnosed, at that time, with thalassemia major. In this report, we extended our investigation to identify the type of the inheritance patterns of osteopetrosis using molecular techniques, because consanguineous marriages exist within the family history. We have detected one heterozygous mutation in exon 15 of the Chloride Channel 7 gene in the index patient (Case 1, whereas other mutations were not detected in the associated genes TCIRG1, OSTM1, RANK, and RANKL. The missense mutation (CGG>TGG located in exon 15 (c.1225C>T of the Chloride Channel 7 gene changed the amino acid position 409 from arginine to tryptophan (p.R409W, c.1225C>T. Case 2 is the 16-year-old son (brother of the index patient of the same family who was diagnosed clinically with mild autosomal dominant osteopetrosis. We have identified the same heterozygous mutation in exon 15 of the Chloride

  16. A novel missense mutation in the CLCN7 gene linked to benign autosomal dominant osteopetrosis: a case series.

    Science.gov (United States)

    Rashid, Ban Mousa; Rashid, Nawshirwan Gafoor; Schulz, Ansgar; Lahr, Georgia; Nore, Beston Faiek

    2013-01-09

    Osteopetrosis is a rare inherited genetic disease characterized by sclerosis of the skeleton. The absence or malfunction of osteoclasts is found to be strongly associated with the disease evolution. Currently, four clinically distinct forms of the disease have been recognized: the infantile autosomal recessive osteopetrosis, the malignant and the intermediate forms, and autosomal dominant osteopetrosis, type I and type II forms. The autosomal recessive types are the most severe forms with symptoms in very early childhood, whereas the autosomal dominant classes exhibit a heterogeneous trait with milder symptoms, often at later childhood or adulthood. Case 1 is the 12-year-old daughter (index patient) of an Iraqi-Kurdish family who, at the age of eight years, was diagnosed clinically to have mild autosomal dominant osteopetrosis. Presently, at 12-years old, she has severe complications due to the disease progression. In addition, the same family previously experienced the death of a female child in her late childhood. The deceased child had been misdiagnosed, at that time, with thalassemia major. In this report, we extended our investigation to identify the type of the inheritance patterns of osteopetrosis using molecular techniques, because consanguineous marriages exist within the family history. We have detected one heterozygous mutation in exon 15 of the Chloride Channel 7 gene in the index patient (Case 1), whereas other mutations were not detected in the associated genes TCIRG1, OSTM1, RANK, and RANKL. The missense mutation (CGG>TGG) located in exon 15 (c.1225C>T) of the Chloride Channel 7 gene changed the amino acid position 409 from arginine to tryptophan (p.R409W, c.1225C>T).Case 2 is the 16-year-old son (brother of the index patient) of the same family who was diagnosed clinically with mild autosomal dominant osteopetrosis. We have identified the same heterozygous mutation in exon 15 of the Chloride channel 7 gene in this patient (Case 2). The missense

  17. The sequence and analysis of a Chinese pig genome

    Directory of Open Access Journals (Sweden)

    Fang Xiaodong

    2012-11-01

    Full Text Available Abstract Background The pig is an economically important food source, amounting to approximately 40% of all meat consumed worldwide. Pigs also serve as an important model organism because of their similarity to humans at the anatomical, physiological and genetic level, making them very useful for studying a variety of human diseases. A pig strain of particular interest is the miniature pig, specifically the Wuzhishan pig (WZSP, as it has been extensively inbred. Its high level of homozygosity offers increased ease for selective breeding for specific traits and a more straightforward understanding of the genetic changes that underlie its biological characteristics. WZSP also serves as a promising means for applications in surgery, tissue engineering, and xenotransplantation. Here, we report the sequencing and analysis of an inbreeding WZSP genome. Results Our results reveal some unique genomic features, including a relatively high level of homozygosity in the diploid genome, an unusual distribution of heterozygosity, an over-representation of tRNA-derived transposable elements, a small amount of porcine endogenous retrovirus, and a lack of type C retroviruses. In addition, we carried out systematic research on gene evolution, together with a detailed investigation of the counterparts of human drug target genes. Conclusion Our results provide the opportunity to more clearly define the genomic character of pig, which could enhance our ability to create more useful pig models.

  18. A novel mutation in the endothelin B receptor gene in a moroccan family with shah-waardenburg syndrome.

    Science.gov (United States)

    Doubaj, Yassamine; Pingault, Véronique; Elalaoui, Siham C; Ratbi, Ilham; Azouz, Mohamed; Zerhouni, Hicham; Ettayebi, Fouad; Sefiani, Abdelaziz

    2015-02-01

    Waardenburg syndrome (WS) is a neurocristopathy disorder combining sensorineural deafness and pigmentary abnormalities. The presence of additional signs defines the 4 subtypes. WS type IV, also called Shah-Waardenburg syndrome (SWS), is characterized by the association with congenital aganglionic megacolon (Hirschsprung disease). To date, 3 causative genes have been related to this congenital disorder. Mutations in the EDNRB and EDN3 genes are responsible for the autosomal recessive form of SWS, whereas SOX10 mutations are inherited in an autosomal dominant manner. We report here the case of a 3-month-old Morrocan girl with WS type IV, born to consanguineous parents. The patient had 3 cousins who died in infancy with the same symptoms. Molecular analysis by Sanger sequencing revealed the presence of a novel homozygous missense mutation c.1133A>G (p.Asn378Ser) in the EDNRB gene. The proband's parents as well as the parents of the deceased cousins are heterozygous carriers of this likely pathogenic mutation. This molecular diagnosis allows us to provide genetic counseling to the family and eventually propose prenatal diagnosis to prevent recurrence of the disease in subsequent pregnancies.

  19. Epigenetic regulation of the ELOVL6 gene is associated with a major QTL effect on fatty acid composition in pigs

    NARCIS (Netherlands)

    Corominas, J.; Marchesi, J.A.; Puig-Oliveras, A.; Revilla, M.; Estelle, J.; Alves, E.; Folch, J.M.; Ballester, M.

    2015-01-01

    BACKGROUND: In previous studies on an Iberian x Landrace cross, we have provided evidence that supported the porcine ELOVL6 gene as the major causative gene of the QTL on pig chromosome 8 for palmitic and palmitoleic acid contents in muscle and backfat. The single nucleotide polymorphism (SNP)

  20. Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

    International Nuclear Information System (INIS)

    Irshad, S.; Nawaz, T.

    2008-01-01

    Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

  1. A novel missense mutation in the gene EDARADD associated with an unusual phenotype of hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Wohlfart, Sigrun; Söder, Stephan; Smahi, Asma; Schneider, Holm

    2016-01-01

    Hypohidrotic ectodermal dysplasia (HED) is a rare disorder characterized by deficient development of structures derived from the ectoderm including hair, nails, eccrine glands, and teeth. HED forms that are caused by mutations in the genes EDA, EDAR, or EDARADD may show almost identical phenotypes, explained by a common signaling pathway. Proper interaction of the proteins encoded by these three genes is important for the activation of the NF-κB signaling pathway and subsequent transcription of the target genes. Mutations in the gene EDARADD are most rarely implicated in HED. Here we describe a novel missense mutation, c.367G>A (p.Asp123Asn), in this gene which did not appear to influence the interaction between EDAR and EDARADD proteins, but led to an impaired ability to activate NF-κB signaling. Female members of the affected family showed either unilateral or bilateral amazia. In addition, an affected girl developed bilateral ovarian teratomas, possibly associated with her genetic condition. © 2015 Wiley Periodicals, Inc.

  2. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  3. A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II.

    Science.gov (United States)

    Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa

    2013-03-01

    Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome.

  4. A mutation in a functional Sp1 binding site of the telomerase RNA gene (hTERC promoter in a patient with Paroxysmal Nocturnal Haemoglobinuria

    Directory of Open Access Journals (Sweden)

    Mason Philip J

    2004-06-01

    Full Text Available Abstract Background Mutations in the gene coding for the RNA component of telomerase, hTERC, have been found in autosomal dominant dyskeratosis congenita (DC and aplastic anemia. Paroxysmal nocturnal hemoglobinuria (PNH is a clonal blood disorder associated with aplastic anemia and characterized by the presence of one or more clones of blood cells lacking glycosylphosphatidylinositol (GPI anchored proteins due to a somatic mutation in the PIGA gene. Methods We searched for mutations in DNA extracted from PNH patients by amplification of the hTERC gene and denaturing high performance liquid chromatography (dHPLC. After a mutation was found in a potential transcription factor binding site in one patient electrophoretic mobility shift assays were used to detect binding of transcription factors to that site. The effect of the mutation on the function of the promoter was tested by transient transfection constructs in which the promoter is used to drive a reporter gene. Results Here we report the finding of a novel promoter mutation (-99C->G in the hTERC gene in a patient with PNH. The mutation disrupts an Sp1 binding site and destroys its ability to bind Sp1. Transient transfection assays show that mutations in this hTERC site including C-99G cause either up- or down-regulation of promoter activity and suggest that the site regulates core promoter activity in a context dependent manner in cancer cells. Conclusions These data are the first report of an hTERC promoter mutation from a patient sample which can modulate core promoter activity in vitro, raising the possibility that the mutation may affect the transcription of the gene in hematopoietic stem cells in vivo, and that dysregulation of telomerase may play a role in the development of bone marrow failure and the evolution of PNH clones.

  5. A novel missense mutation in collagenous domain of EDA gene in a ...

    Indian Academy of Sciences (India)

    Supplementary data: A novel missense mutation in collagenous domain of EDA gene in a. Chinese family with X-linked hypohidrotic ectodermal dysplasia. Daxu Li, Ran Xu, Fumeng Huang, Biyuan Wang, Yu Tao, Zijian Jiang, Hairui Li, Jianfeng Yao,. Peng Xu, Xiaokang Wu, Le Ren, Rui Zhang, John R. Kelsoe and Jie Ma.

  6. Brugada syndrome with a novel missense mutation in SCN5A gene: A case report from Bangladesh

    Directory of Open Access Journals (Sweden)

    Md. Zahidus Sayeed

    2014-01-01

    Full Text Available Brugada syndrome is an inherited cardiac arrhythmia that follows autosomal dominant transmission and can cause sudden death. We report a case of Brugada syndrome in a 55-year-old male patient presented with recurrent palpitation, atypical chest pain and presyncope. ECG changes were consistent with type 1 Brugada. Gene analysis revealed a novel missense mutation in SCN5A gene with a genetic variation of D785N and a nucleotide change at 2353G-A. One of his children also had the same mutation. To our knowledge this is the first genetically proved case of Brugada syndrome in Bangladesh.

  7. Gene mutation in ATM/PI3K region of nasopharyngeal carcinoma cell lines

    International Nuclear Information System (INIS)

    Wang Hongmei; Wu Xinyao; Xia Yunfei

    2002-01-01

    Objective: To define the correlation between nasopharyngeal carcinoma (NPC) cell radiosensitivity and gene mutation in the ATM/PI3K coding region. Methods: The gene mutation in the ATM/PI3K region of nasopharyngeal carcinoma cell lines which vary in radiosensitivity, was monitored by reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence-marked ddNTP cycle sequencing technique. Results: No gene mutation was detected in the ATM/PI3K region of either CNE1 or CNE2. Conclusion: Disparity in intrinsic radiosensitivity between different NPC cell lines depends on some other factors and mechanism without being related to ATM/PI3K mutations

  8. A novel MEFV gene mutation (A511V) in a Chilean FMF patient ...

    African Journals Online (AJOL)

    Familial Mediterranean fever (FMF) is an autosomal recessive disease which is characterized by recurrent fever and inflammation of serous membranes. A Chilean FMF patient was investigated for MEFV mutations. After DNA extraction, exons 3, 5, 10 and 30UTR region of MEFV gene were analyzed by DNA sequencing ...

  9. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Science.gov (United States)

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  10. Somatic Mutational Landscape of Splicing Factor Genes and Their Functional Consequences across 33 Cancer Types

    Directory of Open Access Journals (Sweden)

    Michael Seiler

    2018-04-01

    Full Text Available Summary: Hotspot mutations in splicing factor genes have been recently reported at high frequency in hematological malignancies, suggesting the importance of RNA splicing in cancer. We analyzed whole-exome sequencing data across 33 tumor types in The Cancer Genome Atlas (TCGA, and we identified 119 splicing factor genes with significant non-silent mutation patterns, including mutation over-representation, recurrent loss of function (tumor suppressor-like, or hotspot mutation profile (oncogene-like. Furthermore, RNA sequencing analysis revealed altered splicing events associated with selected splicing factor mutations. In addition, we were able to identify common gene pathway profiles associated with the presence of these mutations. Our analysis suggests that somatic alteration of genes involved in the RNA-splicing process is common in cancer and may represent an underappreciated hallmark of tumorigenesis. : Seiler et al. report that 119 splicing factor genes carry putative driver mutations over 33 tumor types in TCGA. The most common mutations appear to be mutually exclusive and are associated with lineage-independent altered splicing. Samples with these mutations show deregulation of cell-autonomous pathways and immune infiltration. Keywords: splicing, SF3B1, U2AF1, SRSF2, RBM10, FUBP1, cancer, mutation

  11. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  12. A molecular nature of mutation in ADE2 gene of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Korolev, V.G.

    1983-01-01

    A study was made on the lethal and mutagenous effects and the spectrum of mutations, induced by the decomposition of 32 P, introduced into DNA of yeast cells in the form of 32 P-desoxyguanosinemonophosphate ( 32 PdGMP) and 32 P-thymidinemonophosphate ( 32 P-TMP). Inactivation probability for one 32 P decomposition was independent on labelled nucleotide, included in DNA. At the same time the probability of mutation occUrrence in ADE1 and ADE2 genes per one 32 P decomposition is 3 times higher for the case of 32 PdGMP inclusion than 32 P-TMP. The data showGC that amount of base pairs in ADE1 and ADE2 genes is a of induced mutations differ with respect to the ratio of GC→AT at and at AT→GC transitions, depending on labelled nucleotide

  13. Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

    Science.gov (United States)

    Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

    2011-07-01

    Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

  14. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  15. Novel Missense Mitochondrial ND4L Gene Mutations in Friedreich's Ataxia

    Directory of Open Access Journals (Sweden)

    Mohammad Mehdi Heidari

    2011-05-01

    Full Text Available AbstractObjective(sThe mitochondrial defects in Friedreich's ataxia have been reported in many researches. Mitochondrial DNA is one of the candidates for defects in mitochondrion, and complex I is the first and one of the largest catalytic complexes of oxidative phosphorylation (OXPHOS system. Materials and MethodsWe searched the mitochondrial ND4L gene for mutations by TTGE and sequencing on 30 FRDA patients and 35 healthy controls.ResultsWe found 3 missense mutations [m.10506A>G (T13A, m.10530G>A (V21M, and m.10653G>A (A62T] in four patients whose m.10530G>A and m.10653G>A were not reported previously. In two patients, heteroplasmic m.10530G>A mutation was detected. They showed a very early ataxia syndrome. Our results showed that the number of mutations in FRDA patients was higher than that in the control cases (P= 0.0287.ConclusionAlthough this disease is due to nuclear gene mutation, the presence of these mutations might be responsible for further mitochondrial defects and the increase of the gravity of the disease. Thus, it should be considered in patients with this disorder.

  16. T Cell Lymphoma and Leukemia in Severe Combined Immunodeficiency Pigs following Bone Marrow Transplantation: A Case Report

    Directory of Open Access Journals (Sweden)

    Ellis J. Powell

    2017-07-01

    Full Text Available After the discovery of naturally occurring severe combined immunodeficiency (SCID within a selection line of pigs at Iowa State University, we found two causative mutations in the Artemis gene: haplotype 12 (ART12 and haplotype 16 (ART16. Bone marrow transplants (BMTs were performed to create genetically SCID and phenotypically immunocompetent breeding animals to establish a SCID colony for further characterization and research utilization. Of nine original BMT transfer recipients, only four achieved successful engraftment. At approximately 11 months of age, both animals homozygous for the ART16 mutation were diagnosed with T cell lymphoma. One of these ART16/ART16 recipients was a male who received a transplant from a female sibling; the tumors in this recipient consist primarily of Y chromosome-positive cells. The other ART16/ART16 animal also presented with leukemia in addition to T cell lymphoma, while one of the ART12/ART16 compound heterozygote recipients presented with a nephroblastoma at a similar age. Human Artemis SCID patients have reported cases of lymphoma associated with a “leaky” Artemis phenotype. The naturally occurring Artemis SCID pig offers a large animal model more similar to human SCID patients and may offer a naturally occurring cancer model and provides a valuable platform for therapy development.

  17. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  18. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    Directory of Open Access Journals (Sweden)

    Matei Irina

    2001-08-01

    Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.

  19. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    Science.gov (United States)

    Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

    2001-01-01

    Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

  20. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    Science.gov (United States)

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  1. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  2. Phenotypic Involvement in Females with the FMR1 Gene Mutation.

    Science.gov (United States)

    Riddle, J. E.; Cheema, A.; Sobesky, W. E.; Gardner, S. C.; Taylor, A. K.; Pennington, B. F.; Hagerman, R. J.

    1998-01-01

    A study investigated phenotypic effects seen in 114 females with premutation and 41 females (ages 18-58) with full Fragile X mental retardation gene mutation. Those with the full mutation had a greater incidence of hand-flapping, eye contact problems, special education help for reading and math, and grade retention. (Author/CR)

  3. Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation: indicators of tumor staging and metastasis in adenocarcinomatous sporadic colorectal cancer in Indian population.

    Directory of Open Access Journals (Sweden)

    Rupal Sinha

    Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.

  4. Common Mediterranean Fever (MEFV Gene Mutations Associated with Ankylosing Spondylitis in Turkish Population

    Directory of Open Access Journals (Sweden)

    Serbulent Yigit

    2012-01-01

    Full Text Available Ankylosing spondylitis (AS is a common inflammatory rheumatic disease. Mediterranean fever (MEFV gene, which has already been identified as being responsible for familial Mediterranean fever (FMF, is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76. This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2. A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060. There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS.

  5. Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene.

    Science.gov (United States)

    Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair

    2015-01-01

    Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.

  6. Atypical Clinical Presentation of Xeroderma Pigmentosum in a Patient Harboring a Novel Missense Mutation in the XPC Gene: The Importance of Clinical Suspicion.

    Science.gov (United States)

    Meneses, Marina; Chavez-Bourgeois, Marion; Badenas, Celia; Villablanca, Salvador; Aguilera, Paula; Bennàssar, Antoni; Alos, Llucia; Puig, Susana; Malvehy, Josep; Carrera, Cristina

    2015-01-01

    Xeroderma pigmentosum (XP) is a genodermatosis caused by abnormal DNA repair. XP complementation group C (XPC) is the most frequent type in Mediterranean countries. We describe a case with a novel mutation in the XPC gene. A healthy Caucasian male patient was diagnosed with multiple primary melanomas. Digital follow-up and molecular studies were carried out. During digital follow-up 8 more additional melanomas were diagnosed. Molecular studies did not identify mutations in CDKN2A, CDK4 or MITF genes. Two heterozygous mutations in the XPC gene were detected: c.2287delC (p.Leu763Cysfs*4) frameshift and c.2212A>G (p.Thr738Ala) missense mutations. The p.Thr738Ala missense mutation has not been previously described. Missense mutations in the XPC gene may allow partial functionality that could explain this unusual late onset XP. Atypical clinical presentation of XPC could be misdiagnosed when genetic aberrations allow partial DNA repair capacity. © 2015 S. Karger AG, Basel.

  7. Kinetics of IFN-gamma and TNF-alpha gene expression and their relationship with disease progression after infection with Mycobacterium tuberculosis in guinea pigs.

    Science.gov (United States)

    Roh, In Soon; Cho, Sungae; Eum, Seok-Yong; Cho, Sang-Nae

    2013-05-01

    Guinea pig is one of the most suitable animal models for Mycobacterium tuberculosis (M. tb) infection since it shows similarities to pulmonary infection in humans. Although guinea pig shows hematogenous spread of M. tb infection into the whole body, immunological studies have mainly focused on granulomatous tissues in lungs and spleens. In order to investigate the time-course of disease pathogenesis and immunological profiles in each infected organ, we performed the following approaches with guinea pigs experimentally infected with M. tb over a 22-week post-infection period. We examined body weight changes, M. tb growth curve, cytokine gene expression (IFN-γ and TNF-α), and histopathology in liver, spleen, lungs and lymph nodes of infected guinea pigs. The body weights of infected guinea pigs did not increase as much as uninfected ones and the number of M. tb bacilli in their organs increased except bronchotracheal lymph node during the experimental period. The gene expression of IFN-γ and TNF-α was induced between 3 and 6 weeks of infection; however, kinetic profiles of cytokine gene expression showed heterogeneity among organs over the study period. Histophathologically granulomatous lesions were developed in all four organs of infected guinea pigs. Although IFN-γ and TNF-α gene expression profiles showed heterogeneity, the granuloma formation was clearly observed in every organ regardless of whether the number of bacilli increased or decreased. However, this protective immunity was accompanied with severe tissue damage in all four organs, which may lead to the death of guinea pigs.

  8. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

    Science.gov (United States)

    Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

    2014-05-15

    Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

  9. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  10. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  11. Detecting selection signatures between Duroc and Duroc synthetic pig populations using high-density SNP chip.

    Science.gov (United States)

    Edea, Z; Hong, J-K; Jung, J-H; Kim, D-W; Kim, Y-M; Kim, E-S; Shin, S S; Jung, Y C; Kim, K-S

    2017-08-01

    The development of high throughput genotyping techniques has facilitated the identification of selection signatures of pigs. The detection of genomic selection signals in a population subjected to differential selection pressures may provide insights into the genes associated with economically and biologically important traits. To identify genomic regions under selection, we genotyped 488 Duroc (D) pigs and 155 D × Korean native pigs (DKNPs) using the Porcine SNP70K BeadChip. By applying the F ST and extended haplotype homozygosity (EHH-Rsb) methods, we detected genes under directional selection associated with growth/stature (DOCK7, PLCB4, HS2ST1, FBP2 and TG), carcass and meat quality (TG, COL14A1, FBXO5, NR3C1, SNX7, ARHGAP26 and DPYD), number of teats (LOC100153159 and LRRC1), pigmentation (MME) and ear morphology (SOX5), which are all mostly near or at fixation. These results could be a basis for investigating the underlying mutations associated with observed phenotypic variation. Validation using genome-wide association analysis would also facilitate the inclusion of some of these markers in genetic evaluation programs. © 2017 Stichting International Foundation for Animal Genetics.

  12. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  13. Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

    Directory of Open Access Journals (Sweden)

    Hashishe Mervat M

    2010-06-01

    Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

  14. A novel mutation of adenomatous polyposis coli (APC) gene results in the formation of supernumerary teeth.

    Science.gov (United States)

    Yu, Fang; Cai, Wenping; Jiang, Beizhan; Xu, Laijun; Liu, Shangfeng; Zhao, Shouliang

    2018-01-01

    Supernumerary teeth are teeth that are present in addition to normal teeth. Although several hypotheses and some molecular signalling pathways explain the formation of supernumerary teeth, but their exact disease pathogenesis is unknown. To study the molecular mechanisms of supernumerary tooth-related syndrome (Gardner syndrome), a deeper understanding of the aetiology of supernumerary teeth and the associated syndrome is needed, with the goal of inhibiting disease inheritance via prenatal diagnosis. We recruited a Chinese family with Gardner syndrome. Haematoxylin and eosin staining of supernumerary teeth and colonic polyp lesion biopsies revealed that these patients exhibited significant pathological characteristics. APC gene mutations were detected by PCR and direct sequencing. We revealed the pathological pathway involved in human supernumerary tooth development and the mouse tooth germ development expression profile by RNA sequencing (RNA-seq). Sequencing analysis revealed that an APC gene mutation in exon 15, namely 4292-4293-Del GA, caused Gardner syndrome in this family. This mutation not only initiated the various manifestations typical of Gardner syndrome but also resulted in odontoma and supernumerary teeth in this case. Furthermore, RNA-seq analysis of human supernumerary teeth suggests that the APC gene is the key gene involved in the development of supernumerary teeth in humans. The mouse tooth germ development expression profile shows that the APC gene plays an important role in tooth germ development. We identified a new mutation in the APC gene that results in supernumerary teeth in association with Gardner syndrome. This information may shed light on the molecular pathogenesis of supernumerary teeth. Gene-based diagnosis and gene therapy for supernumerary teeth may become available in the future, and our study provides a high-resolution reference for treating other syndromes associated with supernumerary teeth. © 2017 The Authors. Journal of

  15. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  16. A novel Norrie disease pseudoglioma gene mutation, c.-1_2delAAT, responsible for Norrie disease in a Chinese family.

    Science.gov (United States)

    Zhang, Xin-Yu; Jiang, Wei-Ying; Chen, Lu-Ming; Chen, Su-Qin

    2013-01-01

    To investigate the genetic findings and phenotypic characteristics of a Chinese family with Norrie disease (ND). Molecular genetic analysis and clinical examinations were performed on a Chinese family with ND. Mutations in the Norrie disease pseudoglioma (NDP) gene were detected by direct sequencing. Haplotypes were constructed and compared with the phenotypes in the family. Evolutionary comparisons and mutant open reading frame (ORF) prediction were also undertaken. Two family members with ocular manifestations were diagnosed with ND. No signs of sensorineural hearing loss were observed in either patient, while one of them showed signs of mild mental retardation. A novel heterozygous mutation in the NDP gene, c.-1_2delAAT, was detected in both patients. The mutation and the mutation bearing haplotype co-segregated with the ND phenotype in males and was transmitted from their mothers and/or grandmothers (II:2). The male without ND did not harbor the mutation. The mutation occurred at the highly conserved nucleotides. ORF finder predicted that the mutation would lead to the production of a truncated protein that lacks the first 11 N-terminal amino acids. A novel mutation, c.-1_2delAAT in the NDP gene, was identified in a Chinese family with ND. This mutation caused ND without obvious sensorineural hearing loss. Mental disorder was found in one but not the other patients. The clinical heterogeneity in the family indicated that other genetic variants and epigenetic factors may also play a role in the disease presentation.

  17. Clinical significance of FLG gene mutations in children with atopic dermatitis

    Directory of Open Access Journals (Sweden)

    E. E. Varlamov

    2015-01-01

    Full Text Available Skin barrier dysfunction due to deficiency of the skin protein filaggrin is one of the factors involved in the pathogenesis of atopic dermatitis. Objective: to determine the clinical significance of 2282 del CAGT, R501X, R2447X, and S3247X mutations in the FLG gene in children with atopic dermatitis. The investigation included 58 children with atopic dermatitis. A molecular genetic analysis of the four mutations in the FLG gene was done in all the children. In the patients with FLG gene mutations, there was a tendency towards a higher frequency of sensitization to house dust allergens, significantly more often sensitization to cat epidermal allergen, and significantly higher levels of specific IgE to the cat epidermis. Conclusion. Mutations in the FLG gene encoding the protein filaggrin raise the risk for sensitization to domestic and epidermal allergens and, in case of already existing sensitization to the cat epidermis, the patients are found with a high degree of probability to have the high concentration of specific IgE to this allergen. The above fact justifies the need to place special emphasis on measures to eliminate house dust allergens, and cat epidermis allergen in particular, and to personalize approaches to therapy and prevention of atopic dermatitis in children. 

  18. Malignant melanoma arising from a perianal fistula and harbouring a BRAF gene mutation: a case report

    International Nuclear Information System (INIS)

    Martinez-Cadenas, Conrado; Lozoya, Rafael; Boldó, Enrique; Bosch, Nuria; Peñas, Lucas; Flores-Couce, Esther; Ochoa, Enrique; Munárriz, Javier; Aracil, Juan P; Tajahuerce, Marcos; Royo, Ramón

    2011-01-01

    Melanoma of the anal region is a very uncommon disease, accounting for only 0.2-0.3% of all melanoma cases. Mutations of the BRAF gene are usually absent in melanomas occurring in this region as well as in other sun-protected regions. The development of a tumour in a longstanding perianal fistula is also extremely rare. More frequent is the case of a tumour presenting as a fistula, that is, the fistula being a consequence of the cancerous process, although we have found only two cases of fistula-generating melanomas reported in the literature. Here we report the case of a 38-year-old male who presented with a perianal fistula of four years of evolution. Histopathological examination of the fistulous tract confirmed the presence of malignant melanoma. Due to the small size and the central location of the melanoma inside the fistulous tract, we believe the melanoma reported here developed in the epithelium of the fistula once the latter was already formed. Resected sentinel lymph nodes were negative and the patient, after going through a wide local excision, remains disease-free nine years after diagnosis. DNA obtained from melanoma tissue was analysed by automated direct sequencing and the V600E (T1799A) mutation was detected in exon 15 of the BRAF gene. Since fistulae experience persistent inflammation, the fact that this melanoma harbours a BRAF mutation strengthens the view that oxidative stress caused by inflammatory processes plays an important role in the genesis of BRAF gene mutations

  19. Malignant melanoma arising from a perianal fistula and harbouring a BRAF gene mutation: a case report

    Directory of Open Access Journals (Sweden)

    Tajahuerce Marcos

    2011-08-01

    Full Text Available Abstract Background Melanoma of the anal region is a very uncommon disease, accounting for only 0.2-0.3% of all melanoma cases. Mutations of the BRAF gene are usually absent in melanomas occurring in this region as well as in other sun-protected regions. The development of a tumour in a longstanding perianal fistula is also extremely rare. More frequent is the case of a tumour presenting as a fistula, that is, the fistula being a consequence of the cancerous process, although we have found only two cases of fistula-generating melanomas reported in the literature. Case Presentation Here we report the case of a 38-year-old male who presented with a perianal fistula of four years of evolution. Histopathological examination of the fistulous tract confirmed the presence of malignant melanoma. Due to the small size and the central location of the melanoma inside the fistulous tract, we believe the melanoma reported here developed in the epithelium of the fistula once the latter was already formed. Resected sentinel lymph nodes were negative and the patient, after going through a wide local excision, remains disease-free nine years after diagnosis. DNA obtained from melanoma tissue was analysed by automated direct sequencing and the V600E (T1799A mutation was detected in exon 15 of the BRAF gene. Conclusion Since fistulae experience persistent inflammation, the fact that this melanoma harbours a BRAF mutation strengthens the view that oxidative stress caused by inflammatory processes plays an important role in the genesis of BRAF gene mutations.

  20. Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

    2017-01-01

    We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

  1. Mutation analysis of COL4A3 and COL4A4 genes in a Chinese

    Indian Academy of Sciences (India)

    Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutationsin COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical ...

  2. Identification of growth trait related genes in a Yorkshire purebred pig population by genome-wide association studies

    Directory of Open Access Journals (Sweden)

    Qingli Meng

    2017-04-01

    Full Text Available Objective The aim of this study is to identify genomic regions or genes controlling growth traits in pigs. Methods Using a panel of 54,148 single nucleotide polymorphisms (SNPs, we performed a genome-wide Association (GWA study in 562 pure Yorshire pigs with four growth traits: average daily gain from 30 kg to 100 kg or 115 kg, and days to 100 kg or 115 kg. Fixed and random model Circulating Probability Unification method was used to identify the associations between 54,148 SNPs and these four traits. SNP annotations were performed through the Sus scrofa data set from Ensembl. Bioinformatics analysis, including gene ontology analysis, pathway analysis and network analysis, was used to identify the candidate genes. Results We detected 6 significant and 12 suggestive SNPs, and identified 9 candidate genes in close proximity to them (suppressor of glucose by autophagy [SOGA1], R-Spondin 2 [RSPO2], mitogen activated protein kinase kinase 6 [MAP2K6], phospholipase C beta 1 [PLCB1], rho GTPASE activating protein 24 [ARHGAP24], cytoplasmic polyadenylation element binding protein 4 [CPEB4], GLI family zinc finger 2 [GLI2], neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 [NYAP2], and zinc finger protein multitype 2 [ZFPM2]. Gene ontology analysis and literature mining indicated that the candidate genes are involved in bone, muscle, fat, and lung development. Pathway analysis revealed that PLCB1 and MAP2K6 participate in the gonadotropin signaling pathway and suggests that these two genes contribute to growth at the onset of puberty. Conclusion Our results provide new clues for understanding the genetic mechanisms underlying growth traits, and may help improve these traits in future breeding programs.

  3. Study of the effect of HFE gene mutations on iron overload in ...

    African Journals Online (AJOL)

    Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

  4. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    Science.gov (United States)

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  5. Identification of a breast cancer family double heterozygote for RAD51C and BRCA2 gene mutations

    DEFF Research Database (Denmark)

    Ahlborn, Lise B; Steffensen, Ane Y; Jønson, Lars

    2015-01-01

    for mutations in the RAD51C and BRCA2 genes. The RAD51C missense mutation p.Arg258His has previously been identified in a homozygous state in a patient with Fanconi anemia. This mutation is known to affect the DNA repair function of the RAD51C protein. The BRCA2 p.Leu3216Leu synonymous mutation has not been...

  6. A novel nonsense mutation in the tyrosinase gene is related to the albinism in a capuchin monkey (Sapajus apella).

    Science.gov (United States)

    Galante Rocha de Vasconcelos, Felipe Tadeu; Hauzman, Einat; Dutra Henriques, Leonardo; Kilpp Goulart, Paulo Roney; de Faria Galvão, Olavo; Sano, Ronaldo Yuiti; da Silva Souza, Givago; Lynch Alfaro, Jessica; de Lima Silveira, Luis Carlos; Fix Ventura, Dora; Oliveira Bonci, Daniela Maria

    2017-05-05

    Oculocutaneous Albinism (OCA) is an autosomal recessive inherited condition that affects the pigmentation of eyes, hair and skin. The OCA phenotype may be caused by mutations in the tyrosinase gene (TYR), which expresses the tyrosinase enzyme and has an important role in the synthesis of melanin pigment. The aim of this study was to identify the genetic mutation responsible for the albinism in a captive capuchin monkey, and to describe the TYR gene of normal phenotype individuals. In addition, we identified the subject's species. A homozygous nonsense mutation was identified in exon 1 of the TYR gene, with the substitution of a cytosine for a thymine nucleotide (C64T) at codon 22, leading to a premature stop codon (R22X) in the albino robust capuchin monkey. The albino and five non-albino robust capuchin monkeys were identified as Sapajus apella, based on phylogenetic analyses, pelage pattern and geographic provenance. One individual was identified as S. macrocephalus. We conclude that the point mutation C64T in the TYR gene is responsible for the OCA1 albino phenotype in the capuchin monkey, classified as Sapajus apella.

  7. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    Science.gov (United States)

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  8. Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

    Directory of Open Access Journals (Sweden)

    Yuichiro Iida

    Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

  9. A genome-wide scan for signatures of directional selection in domesticated pigs.

    Science.gov (United States)

    Moon, Sunjin; Kim, Tae-Hun; Lee, Kyung-Tai; Kwak, Woori; Lee, Taeheon; Lee, Si-Woo; Kim, Myung-Jick; Cho, Kyuho; Kim, Namshin; Chung, Won-Hyong; Sung, Samsun; Park, Taesung; Cho, Seoae; Groenen, Martien Am; Nielsen, Rasmus; Kim, Yuseob; Kim, Heebal

    2015-02-25

    Animal domestication involved drastic phenotypic changes driven by strong artificial selection and also resulted in new populations of breeds, established by humans. This study aims to identify genes that show evidence of recent artificial selection during pig domestication. Whole-genome resequencing of 30 individual pigs from domesticated breeds, Landrace and Yorkshire, and 10 Asian wild boars at ~16-fold coverage was performed resulting in over 4.3 million SNPs for 19,990 genes. We constructed a comprehensive genome map of directional selection by detecting selective sweeps using an F ST-based approach that detects directional selection in lineages leading to the domesticated breeds and using a haplotype-based test that detects ongoing selective sweeps within the breeds. We show that candidate genes under selection are significantly enriched for loci implicated in quantitative traits important to pig reproduction and production. The candidate gene with the strongest signals of directional selection belongs to group III of the metabolomics glutamate receptors, known to affect brain functions associated with eating behavior, suggesting that loci under strong selection include loci involved in behaviorial traits in domesticated pigs including tameness. We show that a significant proportion of selection signatures coincide with loci that were previously inferred to affect phenotypic variation in pigs. We further identify functional enrichment related to behavior, such as signal transduction and neuronal activities, for those targets of selection during domestication in pigs.

  10. Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

    Science.gov (United States)

    Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

    2018-05-31

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

  11. Application of DNA chips in the analysis of gene mutation in HBV

    International Nuclear Information System (INIS)

    Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min

    2005-01-01

    Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)

  12.  Mutations of noncollagen genes in osteogenesis imperfecta – implications of the gene products in collagen biosynthesis and pathogenesis of disease

    Directory of Open Access Journals (Sweden)

    Anna Galicka

    2012-06-01

    Full Text Available  Recent investigations revealed that the “brittle bone” phenotype in osteogenesis imperfecta (OI is caused not only by dominant mutations in collagen type I genes, but also by recessively inherited mutations in genes responsible for the post-translational processing of type I procollagen as well as for bone formation. The phenotype of patients with mutations in noncollagen genes overlaps with very severe type III and lethal type II OI caused by mutations in collagen genes. Mutations in genes that encode proteins involved in collagen prolyl 3-hydroxylation (P3H1/CRTAP/CyPB eliminated Pro986 hydroxylation and caused an increase in modification of collagen helix by prolyl 4-hydroxylase and lysyl hydroxylase. However, the importance of these disturbances in the disease pathomechanism is not known. Loss of complex proteins’ function as collagen chaperones may dominate the disease mechanism. The latest findings added to the spectrum of OI-causing and collagen-influencing factors other chaperones (HSP47 and FKBP65 and protein BMP-1, which emphasizes the complexity of collagen folding and secretion as well as their importance in bone formation. Furthermore, mutations in genes encoding transcription factor SP7/Osterix and pigment epithelium-derived factor (PEDF constitute a novel mechanism for OI, which is independent of changes in biosynthesis and processing of collagen.

  13. Effect of DGAT1 gene mutation in sows of dam-line on the ...

    African Journals Online (AJOL)

    Diacylglycerol acyltransferase 1 gene (DGAT1) involved in the synthesis and transport of triglycerides is located on chromosome 4 in pigs, in the region with about 200 QTLs responsible among other things for: fat thickness, daily gains, fat content and composition of fatty acids. It is thus probable that the gene polymorphism ...

  14. Porcine Zygote Injection with Cas9/sgRNA Results in DMD-Modified Pig with Muscle Dystrophy

    Directory of Open Access Journals (Sweden)

    Hong-Hao Yu

    2016-10-01

    Full Text Available Dystrophinopathy, including Duchenne muscle dystrophy (DMD and Becker muscle dystrophy (BMD is an incurable X-linked hereditary muscle dystrophy caused by a mutation in the DMD gene in coding dystrophin. Advances in further understanding DMD/BMD for therapy are expected. Studies on mdx mice and dogs with muscle dystrophy provide limited insight into DMD disease mechanisms and therapeutic testing because of the different pathological manifestations. Miniature pigs share similar physiology and anatomy with humans and are thus an excellent animal model of human disease. Here, we successfully achieved precise DMD targeting in Chinese Diannan miniature pigs by co-injecting zygotes with Cas9 mRNA and sgRNA targeting DMD. Two piglets were obtained after embryo transfer, one of piglets was identified as DMD-modified individual via traditional cloning, sequencing and T7EN1 cleavage assay. An examination of targeting rates in the DMD-modified piglet revealed that sgRNA:Cas9-mediated on-target mosaic mutations were 70% and 60% of dystrophin alleles in skeletal and smooth muscle, respectively. Meanwhile, no detectable off-target mutations were found, highlighting the high specificity of genetic modification using CRISPR/Cas9. The DMD-modified piglet exhibited degenerative and disordered phenotypes in skeletal and cardiac muscle, and declining thickness of smooth muscle in the stomach and intestine. In conclusion, we successfully generated myopathy animal model by modifying the DMD via CRISPR/Cas9 system in a miniature pig.

  15. Mutation Spectrum of the ABCA4 Gene in a Greek Cohort with Stargardt Disease: Identification of Novel Mutations and Evidence of Three Prevalent Mutated Alleles

    Directory of Open Access Journals (Sweden)

    Kamakari Smaragda

    2018-01-01

    Full Text Available Aim. To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1. Materials and Methods. A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results. An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%. Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%. In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions. By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations.

  16. Identification of Constrained Cancer Driver Genes Based on Mutation Timing

    Science.gov (United States)

    Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

    2015-01-01

    Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148

  17. Nonsense mutations in the human β-globin gene affect mRNA metabolism

    International Nuclear Information System (INIS)

    Baserga, S.J.; Benz, E.J. Jr.

    1988-01-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

  18. New mutations and an updated database for the patched-1 (PTCH1) gene.

    Science.gov (United States)

    Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J

    2018-05-01

    Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  19. Isocitrate dehydrogenase 1 and 2 genes mutations and MGMT methylation in gliomas

    Directory of Open Access Journals (Sweden)

    D. V. Tabakov

    2017-01-01

    Full Text Available Gliomas are the most common brain tumors. It is difficult to detect them at early stages of disease and there is a few available therapies providing significant improvement in survival. Mutations of isocitrate dehydrogenase 1 and 2 genes (IDH1 and IDH2 play significant role in gliomogenesis, diagnostics and selection of patient therapy. We tested the distribution of IDH1 and IDH2 mutations in gliomas of different histological types and grades of malignancy by DNA melting analysis using our protocol with a sensitivity of 5 %. The results of this assay were confirmed by conventional Sanger sequencing. IDH1/2 mutations were detected in 74 % of lower grade gliomas (II and III, World Health Organization and in 14 % of glioblastomas (IV, World Health Organization. Mutation rate in gliomas with oligodendroglioma component were significantly higher then in other glioma types (р = 0.014. The IDH1 mutations was the most common (79 % of general mutation number. IDH1/2 mutations can induce aberrant gene methylation. Detection of methylation rate of the gene encoding for O6-methylguanine-DNA-methyltransferase (MGMT, predictive biomarker for treatment of gliomas with the alkylating agents, has demonstrated a partial association with IDH1/2 mutations. In 73 % of IDH1/2-mutant tumors MGMT promoter methylation were observed. At the same time IDH1/2 mutations were not revealed in 67 % tumors with MGMT promoter methylation. These results indicate existence of another mechanism of MGMT methylation in gliomas. Our data strong support for necessity of both markers testing when patient therapy is selected.

  20. HFE gene mutations in coronary atherothrombotic disease

    Directory of Open Access Journals (Sweden)

    Calado R.T.

    2000-01-01

    Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

  1. A novel nonsense mutation in cathepsin C gene in an Egyptian ...

    African Journals Online (AJOL)

    Hala Soliman

    2015-04-22

    Apr 22, 2015 ... as defects of phagocytic function and deregulation of localized ... Aim: The aim of this study is to detect the mutation in CTSC gene expected to be the ..... [20] Toomes C, James J, Wood AJ, McCormick D, Lench N, Hewitt.

  2. Mu Opioid Receptor Gene: New Point Mutations in Opioid Addicts

    Directory of Open Access Journals (Sweden)

    Amin Dinarvand

    2014-02-01

    Full Text Available Introduction: Association between single-nucleotide polymorphisms (SNPs in mu opioid receptor gene and drug addiction has been shown in various studies. Here, we have evaluated the existence of polymorphisms in exon 3 of this gene in Iranian population and investigated the possible association between these mutations and opioid addiction.  Methods: 79 opioid-dependent subjects (55 males, 24 females and 134 non-addict or control individuals (74 males, 60 females participated in the study. Genomic DNA was extracted from volunteers’ peripheral blood and exon 3 of the mu opioid receptor gene was amplified by polymerase chain reaction (PCR whose products were then sequenced.  Results: Three different heterozygote polymorphisms were observed in 3 male individuals: 759T>C and 877G>A mutations were found in 2 control volunteers and 1043G>C substitution was observed in an opioid-addicted subject. Association between genotype and opioid addiction for each mutation was not statistically significant.  Discussion: It seems that the sample size used in our study is not enough to confirm or reject any association between 759T>C, 877G>A and 1043G>C substitutions in exon 3 of the mu opioid receptor gene and opioid addiction susceptibility in Iranian population.

  3. Mutation of the PAX6 gene in a sporadic patient with atypical aniridia

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, D.; Li, Y.; Traboulsi, E.I. [Wilmer Eye Institute, Baltimore, MD (United States)] [and others

    1994-09-01

    A 28 year-old man presented with poor vision since childhood and gradual further decline of several years duration. His visual acuity measures 20/200 OD with -11.50 + 0.50 x 150 and 20/100 OS with -12.25 + 0.25 x 35. He had a fine nystagmus. His visual fields were full. There was a circumferential pannus with areas of corneal stromal opacification. The iris was hypoplastic with atypical colobomatous defects. The lenses had scattered cortical opacities. The intraocular pressures were normal. The optic nerves had cup disk ratios of 0.6 OU. The family history was negative for similar defects. A diagnosis of aniridia was made and blood was drawn for analysis of the PAX6 gene. PCR amplification of exon 5 showed heterozygous fragments with one allele being larger than normal. Direct DNA sequencing of the individual heterozygous allele showed a 41 base pair insertion at nucleotide 483 in exon 5 of the paired domain. This frameshift mutation changed codon 71 to a stop codon. The diagnosis of aniridia was confirmed in this atypical patient, who will need to be monitored for his high risk of glaucoma. The risk of developing Wilms` tumor in patients with mutations within the aniridia gene is presumably negligible since the neighboring Wilms` tumor gene is unaffected. The identification of intragenic mutations of the PAX6 gene in patients with sporadic aniridia modifies the management of such patients because of recognition of the increased risk of glaucoma and by reducing the necessity for frequent monitoring for the presence of Wilms` tumor.

  4. Severe Clinical Course in a Patient with Congenital Amegakaryocytic Thrombocytopenia Due to a Missense Mutation of the c-MPL Gene.

    Science.gov (United States)

    Ok Bozkaya, İkbal; Yaralı, Neşe; Işık, Pamir; Ünsal Saç, Rukiye; Tavil, Betül; Tunç, Bahattin

    2015-06-01

    Congenital amegakaryocytic thrombocytopenia (CAMT) generally begins at birth with severe thrombocytopenia and progresses to pancytopenia. It is caused by mutations in the thrombopoietin receptor gene, the myeloproliferative leukemia virus oncogene (c-MPL). The association between CAMT and c-MPL mutation type has been reported in the literature. Patients with CAMT have been categorized according to their clinical symptoms caused by different mutations. Missense mutations of c-MPL have been classified as type II and these patients have delayed onset of bone marrow failure compared to type I patients. Here we present a girl with severe clinical course of CAMT II having a missense mutation in exon 4 of the c-MPL gene who was admitted to our hospital with intracranial hemorrhage during the newborn period.

  5. HPRT gene mutation frequency and the factor of influence in adult peripheral blood lymphocytes

    International Nuclear Information System (INIS)

    Zhao Jingyong; Zheng Siying; Cui Fengmei; Wang Liuyi; Lao Qinhua; Wu Hongliang

    2002-01-01

    Objective: To study the HPRT gene loci mutation frequencies and the factor of influence in peripheral blood lymphocytes of adult with ages ranging from 21-50. Methods: HPRT gene mutation frequency (GMf) were examined by the technique of multinuclear cell assay. Relation between GMf and years were fitted with a computer. Results: Relation could be described by the following equation: y = 0.7555 + 0.0440x, r = 0.9829. Smoking has influence on GMf and sex hasn't. Conclusion: HPRT gene mutation frequency increases with increasing of age. Increasing rate is 0.00440% per year

  6. Expression of the Alzheimer's Disease Mutations AβPP695sw and PSEN1M146I in Double-Transgenic Göttingen Minipigs

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Johansen, Marianne G; Schmidt, Mette

    2016-01-01

    Mutations in the amyloid-β protein precursor gene (AβPP), the presenilin 1 gene (PSEN1) or the presenilin 2 gene (PSEN2) that increase production of the AβPP-derived peptide Aβ42 cause early-onset Alzheimer’s disease. Rodent models of the disease show that further increase in Aβ42 production...... a 10- and an 18-month-old pig. Such accumulation may represent an early event in the pathogenesis of Alzheimer’s disease....

  7. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    Science.gov (United States)

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  8. Colorectal Adenomatous Polyposis: Heterogeneity of Susceptibility Gene Mutations and Phenotypes in a Cohort of Italian Patients.

    Science.gov (United States)

    Marabelli, Monica; Molinaro, Valeria; Abou Khouzam, Raefa; Berrino, Enrico; Panero, Mara; Balsamo, Antonella; Venesio, Tiziana; Ranzani, Guglielmina Nadia

    2016-12-01

    Colorectal adenomatous polyposis entailing cancer predisposition is caused by constitutional mutations in different genes. APC is associated with the familial adenomatous polyposis (FAP/AFAP) and MUTYH with the MUTYH-associated polyposis (MAP), while POLE and POLD1 mutations cause the polymerase proofreading-associated polyposis (PPAP). We screened for mutations in patients with multiple adenomas/FAP: 121 patients were analyzed for APC and MUTYH mutations, and 36 patients were also evaluated for POLE and POLD1 gene mutations. We found 20 FAP/AFAP, 15 MAP, and no PPAP subjects: pathogenic mutations proved to be heterogeneous, and included 5 APC and 1 MUTYH novel mutations. The mutation detection rate was significantly different between patients with 5-100 polyps and those with >100 polyps (p = 8.154 × 10 -7 ), with APC mutations being associated with an aggressive phenotype (p = 1.279 × 10 -9 ). Mean age at diagnosis was lower in FAP/AFAP compared to MAP (p = 3.055 × 10 -4 ). Mutation-negative probands showed a mean age at diagnosis that was significantly higher than FAP/AFAP (p = 3.46986 × 10 -7 ) and included 45.3% of patients with <30 polyps and 70.9% of patients with no family history. This study enlarges the APC and MUTYH mutational spectra, and also evaluated variants of uncertain significance, including the MUTYH p.Gln338His mutation. Moreover this study underscores the phenotypic heterogeneity and genotype-phenotype correlations in a cohort of Italian patients.

  9. Novel mutation of the PRNP gene of a clinical CJD case

    Directory of Open Access Journals (Sweden)

    Collinge John

    2006-11-01

    Full Text Available Abstract Background Transmissible spongiform encephalopathies (TSEs, a group of neurodegenerative diseases, are thought to be caused by an abnormal isoform of a naturally occurring protein known as cellular prion protein, PrPC. The abnormal form of prion protein, PrPSc accumulates in the brain of affected individuals. Both isoforms are encoded by the same prion protein gene (PRNP, and the structural changes occur post-translationally. Certain mutations in the PRNP gene result in genetic TSEs or increased susceptibility to TSEs. Case presentation A 70 year old woman was admitted to the hospital with severe confusion and inability to walk. Relatives recognized memory loss, gait and behavioral disturbances over a six month period prior to hospitalization. Neurological examination revealed Creutzfeldt-Jakob disease (CJD related symptoms such as incontinence, Babinski sign and myoclonus. EEG showed periodic sharp waves typical of sporadic CJD and cerebrospinal fluid analysis (CSF was positive for the presence of the 14-3-3-protein. As the disease progressed the patient developed akinetic mutism and died in the tenth month after onset of the disease symptoms. Unfortunately, no autopsy material was available. PRNP sequencing showed the occurrence of a point mutation on one allele at codon 193, which is altered from ACC, coding for a threonine, to ATC, encoding an isoleucine (T193I. Conclusion Here we report a novel mutation of the PRNP gene found in an elderly female patient resulting in heterozygosity for isoleucine and threonine at codon 193, in which normally homozygosity for threonine is expected (T193. The patient presented typical clinical symptoms of CJD. EEG findings and the presence of the 14-3-3 protein in the CSF, contributed to CJD diagnosis, allowing the classification of this case as a probable CJD according to the World Health Organization (WHO accepted criteria.

  10. Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

    Directory of Open Access Journals (Sweden)

    Ivette M Sandoval

    Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

  11. Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Chia-Sui Hung

    2007-01-01

    Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172

  12. Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

    Science.gov (United States)

    Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

    2010-01-01

    RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

  13. Ocular findings associated with a Cys39Arg mutation in the Norrie disease gene.

    Science.gov (United States)

    Joos, K M; Kimura, A E; Vandenburgh, K; Bartley, J A; Stone, E M

    1994-12-01

    To diagnose the carriers and noncarriers in a family affected with Norrie disease based on molecular analysis. Family members from three generations, including one affected patient, two obligate carriers, one carrier identified with linkage analysis, one noncarrier identified with linkage analysis, and one female family member with indeterminate carrier status, were examined clinically and electrophysiologically. Linkage analysis had previously failed to determine the carrier status of one female family member in the third generation. Blood samples were screened for mutations in the Norrie disease gene with single-strand conformation polymorphism analysis. The mutation was characterized by dideoxy-termination sequencing. Ophthalmoscopy and electroretinographic examination failed to detect the carrier state. The affected individuals and carriers in this family were found to have a transition from thymidine to cytosine in the first nucleotide of codon 39 of the Norrie disease gene, causing a cysteine-to-arginine mutation. Single-strand conformation polymorphism analysis identified a patient of indeterminate status (by linkage) to be a noncarrier of Norrie disease. Ophthalmoscopy and electroretinography could not identify carriers of this Norrie disease mutation. Single-strand conformation polymorphism analysis was more sensitive and specific than linkage analysis in identifying carriers in this family.

  14. [Characteristics of phenylalanine hydroxylase gene mutations among patients with phenylketonuria from Linyi region of Shandong Province].

    Science.gov (United States)

    Li, Huafeng; Li, Yongli; Zhang, Li

    2017-06-10

    To explore the characteristics of (PAH) gene mutations among patients with phenylketonuria (PKU) from Linyi area of Shandong Province. For 51 children affected with PKU and their parents, the 13 exons and their flanking intronic sequences of the PAH gene were directly sequenced with Sanger method. PAH gene mutations were detected in all of the 102 alleles of the patients, which included 31 types of mutations. Common mutations included R243Q (17/102, 16.67%), IVS4-1G to A (9/102, 8.82%), R241C (8/102, 7.84%), R111X (8/102, 7.84%), and V399V (8/102, 7.84%). In addition, two novel mutations, D101N, 345-347del, have been detected. The 31 types of mutations included missense, nonsense, deletion, and splicing mutations, which were mainly located in exons 7 (29, 28.43%), 11 (18, 17.65%), 3 (16, 15.69%) and 12 (13, 12.75%). Mutations of the PAH gene in Linyi region mainly distributed in exons 7, 11, and 3, and the most common mutation were R243Q. Two novel mutations, D101N and 345-347del, have been detected.

  15. Gene array and real time PCR analysis of the adrenal sensitivity to adrenocorticotropic hormone in pig

    Directory of Open Access Journals (Sweden)

    SanCristobal Magali

    2008-02-01

    Full Text Available Abstract Background Variability in hypothalamic-pituitary-adrenal (HPA axis activity has been shown to be influenced by genetic factors and related to great metabolic differences such as obesity. The aim of this study was to investigate molecular bases of genetic variability of the adrenal sensitivity to ACTH, a major source of variability, in Meishan (MS and Large White (LW pigs, MS being reported to exhibit higher basal cortisol levels, response to ACTH and fatness than LW. A pig cDNA microarray was used to identify changes in gene expression in basal conditions and in response to ACTH stimulation. Results Genotype and/or ACTH affected the expression of 211 genes related to transcription, cell growth/maintenance, signal transduction, cell structure/adhesion/extra cellular matrix and protein kinase/phosphatase activity. No change in the expression of known key regulator proteins of the ACTH signaling pathway or of steroidogenic enzymes was found. However, Mdh2, Sdha, Suclg2, genes involved in the tricarboxylic acid (TCA pathway, were over-expressed in MS pigs. Higher TCA cycle activity in MS than in LW may thus result in higher steroidogenic activity and thus explain the typically higher cortisol levels in MS compared to LW. Moreover, up-regulation of Star and Ldlr genes in MS and/or in response to ACTH suggest that differences in the adrenal function between MS and LW may also involve mechanisms requisite for cholesterol supply to steroidogenesis. Conclusion The present study provides new potential candidate genes to explain genetic variations in the adrenal sensitivity to ACTH and better understand relationship between HPA axis activity and obesity.

  16. NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

    Science.gov (United States)

    Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

    2003-01-01

    The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

  17. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    Science.gov (United States)

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  18. Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyaya, M.; Osborn, M.; Maynard, J.; Harper, P. [Institute of Medical Genetics, Cardiff, Wales (United Kingdom)

    1996-07-26

    Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detected in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.

  19. Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta.

    Science.gov (United States)

    Ho Duy, Binh; Zhytnik, Lidiia; Maasalu, Katre; Kändla, Ivo; Prans, Ele; Reimann, Ene; Märtson, Aare; Kõks, Sulev

    2016-08-12

    The genetics of osteogenesis imperfecta (OI) have not been studied in a Vietnamese population before. We performed mutational analysis of the COL1A1 and COL1A2 genes in 91 unrelated OI patients of Vietnamese origin. We then systematically characterized the mutation profiles of these two genes which are most commonly related to OI. Genomic DNA was extracted from EDTA-preserved blood according to standard high-salt extraction methods. Sequence analysis and pathogenic variant identification was performed with Mutation Surveyor DNA variant analysis software. Prediction of the pathogenicity of mutations was conducted using Alamut Visual software. The presence of variants was checked against Dalgleish's osteogenesis imperfecta mutation database. The sample consisted of 91 unrelated osteogenesis imperfecta patients. We identified 54 patients with COL1A1/2 pathogenic variants; 33 with COL1A1 and 21 with COL1A2. Two patients had multiple pathogenic variants. Seventeen novel COL1A1 and 10 novel COL1A2 variants were identified. The majority of identified COL1A1/2 pathogenic variants occurred in a glycine substitution (36/56, 64.3 %), usually serine (23/36, 63.9 %). We found two pathogenic variants of the COL1A1 gene c.2461G > A (p.Gly821Ser) in four unrelated patients and one, c.2005G > A (p.Ala669Thr), in two unrelated patients. Our data showed a lower number of collagen OI pathogenic variants in Vietnamese patients compared to reported rates for Asian populations. The OI mutational profile of the Vietnamese population is unique and related to the presence of a high number of recessive mutations in non-collagenous OI genes. Further analysis of OI patients negative for collagen mutations, is required.

  20. Somatic mutations in mismatch repair genes in sporadic gastric carcinomas are not a cause but a consequence of the mutator phenotype

    NARCIS (Netherlands)

    Pinto, Mafalda; Wub, Ying; Mensink, Rob G. J.; Cirnes, Luis; Seruca, Raquel; Hofstra, Robert M. W.

    2008-01-01

    In hereditary nonpolyposis colorectal cancer (HNPCC), patients' mismatch repair (MMR) gene mutations cause MMR deficiency, leading to microsatellite instability (MSI-H). MSI-H is also found in a substantial fraction of sporadic gastric carcinomas (SGC), mainly due to MLH1 promoter hypermethylation,

  1. Gene expression analyses of the small intestine of pigs in the ex-evacuation zone of the Fukushima Daiichi Nuclear Power Plant.

    Science.gov (United States)

    Morimoto, Motoko; Kato, Ayaka; Kobayashi, Jin; Okuda, Kei; Kuwahara, Yoshikazu; Kino, Yasushi; Abe, Yasuyuki; Sekine, Tsutomu; Fukuda, Tomokazu; Isogai, Emiko; Fukumoto, Manabu

    2017-11-15

    After the accident at the Fukushima Daiichi Nuclear Power Plant, radioactive contaminants were released over a widespread area. Monitoring the biological effects of radiation exposure in animals in the ex-evacuation zone should be continued to understand the health effects of radiation exposure in humans. The present study aimed to clarify the effects of radiation by investigating whether there is any alteration in the morphology and gene expressions of immune molecules in the intestine of pigs and inobuta (wild boar and domestic pig hybrid) in the ex-evacuation zone in 2012. Gene expression analysis was performed in small intestine samples from pigs, which were collected from January to February 2012, in the ex-evacuation zone. Pigs lived freely in this zone, and their small intestine was considered to be affected by the dietary intake of radioactive contaminants. Several genes were selected by microarray analysis for further investigation using real-time polymerase chain reaction. IFN-γ, which is an important inflammatory cytokine, and TLR3, which is a pattern recognize receptor for innate immune system genes, were highly elevated in these pigs. The expressions of the genes of these proteins were associated with the radiation level in the muscles. We also examined the alteration of gene expressions in wild boars 5 years after the disaster. The expression of IFN-γ and TLR3 remained high, and that of Cyclin G1, which is important in the cell cycle, was elevated. We demonstrated that some changes in gene expression occurred in the small intestine of animals in the ex-evacuation zone after radiation. It is difficult to conclude that these alterations are caused by only artificial radionuclides from the Fukushima Daiichi Nuclear Power Plant. However, the animals in the ex-evacuation zone might have experienced some changes owing to radioactive materials, including contaminated soil, small animals, and insects. We need to continue monitoring the effects of long

  2. FLNC Gene Splice Mutations Cause Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Rene L. Begay, BS

    2016-08-01

    Full Text Available A genetic etiology has been identified in 30% to 40% of dilated cardiomyopathy (DCM patients, yet only 50% of these cases are associated with a known causative gene variant. Thus, in order to understand the pathophysiology of DCM, it is necessary to identify and characterize additional genes. In this study, whole exome sequencing in combination with segregation analysis was used to identify mutations in a novel gene, filamin C (FLNC, resulting in a cardiac-restricted DCM pathology. Here we provide functional data via zebrafish studies and protein analysis to support a model implicating FLNC haploinsufficiency as a mechanism of DCM.

  3. High incidence of GJB2 gene mutations among assortatively mating ...

    Indian Academy of Sciences (India)

    High incidence of GJB2 gene mutations among assortatively mating hearing impaired families in Kerala: future implications. Amritkumar Pavithra, Justin Margret Jeffrey, Jayasankaran Chandru, Arabandi Ramesh and C. R. Srikumari Srisailapathy. J. Genet. 93, 207–213. Table 1. Consolidated table of GJB2 mutation status ...

  4. A novel Norrie disease pseudoglioma gene mutation, c.-1_2delAAT, responsible for Norrie disease in a Chinese family

    Directory of Open Access Journals (Sweden)

    Xin-Yu Zhang

    2013-12-01

    Full Text Available AIM:To investigate the genetic findings and phenotypic characteristics of a Chinese family with Norrie disease (ND.METHODS:Molecular genetic analysis and clinical examinations were performed on a Chinese family with ND. Mutations in the Norrie disease pseudoglioma (NDP gene were detected by direct sequencing. Haplotypes were constructed and compared with the phenotypes in the family. Evolutionary comparisons and mutant open reading frame (ORF prediction were also undertaken.RESULTS:Two family members with ocular manifestations were diagnosed with ND. No signs of sensorineural hearing loss were observed in either patient, while one of them showed signs of mild mental retardation. A novel heterozygous mutation in the NDP gene, c.-1_2delAAT, was detected in both patients. The mutation and the mutation bearing haplotype co-segregated with the ND phenotype in males and was transmitted from their mothers and/or grandmothers (II:2. The male without ND did not harbor the mutation. The mutation occurred at the highly conserved nucleotides. ORF finder predicted that the mutation would lead to the production of a truncated protein that lacks the first 11 N-terminal amino acids.CONCLUSION:A novel mutation, c.-1_2delAAT in the NDP gene, was identified in a Chinese family with ND. This mutation caused ND without obvious sensorineural hearing loss. Mental disorder was found in one but not the other patients. The clinical heterogeneity in the family indicated that other genetic variants and epigenetic factors may also play a role in the disease presentation.

  5. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Directory of Open Access Journals (Sweden)

    Wu Bailin

    2008-11-01

    Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

  6. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Science.gov (United States)

    Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

    2008-01-01

    Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

  7. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Influenza A virus NS1 gene mutations F103L and M106I increase replication and virulence

    Directory of Open Access Journals (Sweden)

    Ping Jihui

    2011-01-01

    Full Text Available Abstract Background To understand the evolutionary steps required for a virus to become virulent in a new host, a human influenza A virus (IAV, A/Hong Kong/1/68(H3N2 (HK-wt, was adapted to increased virulence in the mouse. Among eleven mutations selected in the NS1 gene, two mutations F103L and M106I had been previously detected in the highly virulent human H5N1 isolate, A/HK/156/97, suggesting a role for these mutations in virulence in mice and humans. Results To determine the selective advantage of these mutations, reverse genetics was used to rescue viruses containing each of the NS1 mouse adapted mutations into viruses possessing the HK-wt NS1 gene on the A/PR/8/34 genetic backbone. Both F103L and M106I NS1 mutations significantly enhanced growth in vitro (mouse and canine cells and in vivo (BALB/c mouse lungs as well as enhanced virulence in the mouse. Only the M106I NS1 mutation enhanced growth in human cells. Furthermore, these NS1 mutations enhanced early viral protein synthesis in MDCK cells and showed an increased ability to replicate in mouse interferon β (IFN-β pre-treated mouse cells relative to rPR8-HK-NS-wt NS1. The double mutant, rPR8-HK-NS-F103L + M106I, demonstrated growth attenuation late in infection due to increased IFN-β induction in mouse cells. We then generated a rPR8 virus possessing the A/HK/156/97 NS gene that possesses 103L + 106I, and then rescued the L103F + I106M mutant. The 103L + 106I mutations increased virulence by >10 fold in BALB/c mice. We also inserted the avian A/Ck/Beijing/1/95 NS1 gene (the source lineage of the A/HK/156/97 NS1 gene that possesses 103L + 106I, onto the A/WSN/33 backbone and then generated the L103F + I106M mutant. None of the H5N1 and H9N2 NS containing viruses resulted in increased IFN-β induction. The rWSN-A/Ck/Beijing/1/95-NS1 gene possessing 103L and 106I demonstrated 100 fold enhanced growth and >10 fold enhanced virulence that was associated with increased tropism for lung

  9. De novo dominant mutation of SOX10 gene in a Chinese family with Waardenburg syndrome type II.

    Science.gov (United States)

    Chen, Kaitian; Zong, Ling; Liu, Min; Zhan, Yuan; Wu, Xuan; Zou, Wenting; Jiang, Hongyan

    2014-06-01

    Waardenburg syndrome is a rare genetic disorder, inherited as an autosomal dominant trait. The condition is characterized by sensorineural hearing loss and pigment disturbances of the hair, skin, and iris. The de novo mutation in the SOX10 gene, responsible for Waardenburg syndrome type II, is rarely seen. The present study aimed to identify the genetic causes of Waardenburg syndrome type II in a Chinese family. Clinical and molecular evaluations were conducted in a Chinese family with Waardenburg syndrome type II. A novel SOX10 heterozygous c.259-260delCT mutation was identified. Heterozygosity was not observed in the parents and sister of the proband, indicating that the mutation has arisen de novo. The novel frameshift mutation, located in exon 3 of the SOX10 gene, disrupted normal amino acid coding from Leu87, leading to premature termination at nucleotide 396 (TGA). The high mobility group domain of SOX10 was inferred to be partially impaired. The novel heterozygous c.259-260delCT mutation in the SOX10 gene was considered to be the cause of Waardenburg syndrome in the proband. The clinical and genetic characterization of this family would help elucidate the genetic heterogeneity of SOX10 in Waardenburg syndrome type II. Moreover, the de novo pattern expanded the mutation data of SOX10. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  11. A novel mutation in the NOD2 gene associated with Blau syndrome: a Norwegian family with four affected members

    DEFF Research Database (Denmark)

    Milman, N; Ursin, K; Rødevand, E

    2009-01-01

    BACKGROUND: Blau syndrome is a chronic granulomatous disease with an autosomal dominant trait characterized by the triad granulomatous dermatitis, arthritis, and uveitis. It is caused by mutations in the NOD2 gene, also termed the CARD15 gene. OBJECTIVE: To report a novel mutation in the NOD2 gen...... with an autosomal dominant heritage. Most likely the mutation has arisen de novo in the proband. Genetic counselling and antenatal diagnostics should be available to the involved families....... associated with Blau syndrome. METHODS AND RESULTS: The proband was a 68-year-old ethnic Norwegian male who had uveitis and arthritis since 10 years of age followed by lifelong recurrent arthritis and chronic eye involvement. Genetic analysis showed a heterozygous c.1814 C>A, T605N mutation in NOD2 that has...

  12. 657del5 mutation of the NBS1 gene in myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    Bunjevacki Vera

    2014-01-01

    Full Text Available Myelodysplastic syndromes (MDS are clonal hematologic stem cell disorders with an as yet unknown molecular pathology. Genetic instability has been proposed as a cause of MDS. Mutations in the NBS1 gene, whose product nibrin (p95 is involved in DNA damage repair and cell-cycle control, might be associated with an elevated predisposition to the development of MDS. The aim of the study was to examine truncating 5 bp deletion (657del5, the most frequent NBS1 gene mutation in Slavic populations, in MDS patients. Among 71 MDS patients, we found one case that was heterozygous for the NBS1 657del5 mutation. To the best of our knowledge, this is the first report of a NBS1 mutation in MDS. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  13. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  14. Production of cloned pigs with targeted attenuation of gene expression.

    Directory of Open Access Journals (Sweden)

    Vilceu Bordignon

    Full Text Available The objective of this study was to demonstrate that RNA interference (RNAi and somatic cell nuclear transfer (SCNT technologies can be used to attenuate the expression of specific genes in tissues of swine, a large animal species. Apolipoprotein E (apoE, a secreted glycoprotein known for its major role in lipid and lipoprotein metabolism and transport, was selected as the target gene for this study. Three synthetic small interfering RNAs (siRNA targeting the porcine apoE mRNA were tested in porcine granulosa cells in primary culture and reduced apoE mRNA abundance ranging from 45-82% compared to control cells. The most effective sequence was selected for cloning into a short hairpin RNA (shRNA expression vector under the control of RNA polymerase III (U6 promoter. Stably transfected fetal porcine fibroblast cells were generated and used to produce embryos with in vitro matured porcine oocytes, which were then transferred into the uterus of surrogate gilts. Seven live and one stillborn piglet were born from three gilts that became pregnant. Integration of the shRNA expression vector into the genome of clone piglets was confirmed by PCR and expression of the GFP transgene linked to the expression vector. Analysis showed that apoE protein levels in the liver and plasma of the clone pigs bearing the shRNA expression vector targeting the apoE mRNA was significantly reduced compared to control pigs cloned from non-transfected fibroblasts of the same cell line. These results demonstrate the feasibility of applying RNAi and SCNT technologies for introducing stable genetic modifications in somatic cells for eventual attenuation of gene expression in vivo in large animal species.

  15. Rapid detection of single nucleotide mutation in p53 gene based on ...

    Indian Academy of Sciences (India)

    mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

  16. Mutations in the LHX2 gene are not a frequent cause of micro/anophthalmia.

    Science.gov (United States)

    Desmaison, Annaïck; Vigouroux, Adeline; Rieubland, Claudine; Peres, Christine; Calvas, Patrick; Chassaing, Nicolas

    2010-12-18

    Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (orthodenticle homeobox 2 [OTX2], retina and anterior neural fold homeobox [RAX], SRY-box 2 [SOX2], CEH10 homeodomain-containing homolog [CHX10], and growth differentiation factor 6 [GDF6]) have been implicated mainly in isolated micro/anophthalmia but causative mutations of these genes explain less than a quarter of these developmental defects. The essential role of the LIM homeobox 2 (LHX2) transcription factor in early eye development has recently been documented. We postulated that mutations in this gene could lead to micro/anophthalmia, and thus performed molecular screening of its sequence in patients having micro/anophthalmia. Seventy patients having non-syndromic forms of colobomatous microphthalmia (n=25), isolated microphthalmia (n=18), or anophthalmia (n=17), and syndromic forms of micro/anophthalmia (n=10) were included in this study after negative molecular screening for OTX2, RAX, SOX2, and CHX10 mutations. Mutation screening of LHX2 was performed by direct sequencing of the coding sequences and intron/exon boundaries. Two heterozygous variants of unknown significance (c.128C>G [p.Pro43Arg]; c.776C>A [p.Pro259Gln]) were identified in LHX2 among the 70 patients. These variations were not identified in a panel of 100 control patients of mixed origins. The variation c.776C>A (p.Pro259Gln) was considered as non pathogenic by in silico analysis, while the variation c.128C>G (p.Pro43Arg) considered as deleterious by in silico analysis and was inherited from the asymptomatic father. Mutations in LHX2 do not represent a frequent cause of micro/anophthalmia.

  17. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    Science.gov (United States)

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  18. Alport Syndrome: De Novo Mutation in the COL4A5 Gene Converting Glycine 1205 to Valine

    Directory of Open Access Journals (Sweden)

    Pilar Antón-Martín

    2012-01-01

    Full Text Available Background Alport syndrome is a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family. It is a genetically heterogeneous disease with different mutations and forms of inheritance that presents with renal affection, hearing loss and eye defects. Several new mutations related to X-linked forms have been previously determined. Methods We report the case of a 12 years old male and his family diagnosed with Alport syndrome after genetic analysis was performed. Result Anew mutation determining a nucleotide change C.3614G > T (p. Gly1205Val in hemizygosis in the COL4A5 gene was found. This molecular defect has not been previously described. Conclusion Molecular biology has helped us to comprehend the mechanisms of pathophysiology in Alport syndrome. Genetic analysis provides the only conclusive diagnosis of the disorder at the moment. Our contribution with a new mutation further supports the need of more sophisticated molecular methods to increase the mutation detection rates with lower costs and less time.

  19. Delineation of the Marfan phenotype associated with mutations in exons 23-32 of the FBN1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Putnam, E.A.; Cho, M.; Milewicz, D.M. [Univ. of Texas-Houston Medical School, Houston, TX (United States)] [and others

    1996-03-29

    Marfan syndrome is a dominantly inherited connective tissue disorder with a wide range of phenotypic severity. The condition is the result of mutations in FBN1, a large gene composed of 65 exons encoding the fibrillin-1 protein. While mutations causing classic manifestations of Marfan syndrome have been identified throughout the FBN1 gene, the six previously characterized mutations resulting in the severe, perinatal lethal form of Marfan syndrome have clustered in exons 24-32 of the gene. We screened 8 patients with either neonatal Marfan syndrome or severe cardiovascular complications of Marfan syndrome for mutations in this region of the gene. Using intron-based exon-specific primers, we amplified exons 23-32 from genomic DNAs, screened these fragments by single-stranded conformational polymorphism analysis, and sequenced indicated exons. This analysis documented mutations in exons 25-27 of the FBN1 mutations in 6 of these patients. These results, taken together with previously published FBN1 mutations in this region, further define the phenotype associated with mutations in exons 24-32 of the FBN1 gene, information important for the development of possible diagnostic tests and genetic counseling. 49 refs., 4 figs., 2 tabs.

  20. Investigation of mutations in the HBB gene using the 1,000 genomes database.

    Science.gov (United States)

    Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

    2017-01-01

    Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.

  1. A novel splice site mutation in the dentin sialophosphoprotein gene in a Chinese family with dentinogenesis imperfecta type II

    International Nuclear Information System (INIS)

    Wang Haoyang; Hou Yanning; Cui Yingxia; Huang Yufeng; Shi Yichao; Xia Xinyi; Lu Hongyong; Wang Yunhua; Li Xiaojun

    2009-01-01

    Twenty-four individuals were investigated that spanned six generations in a Chinese family affected with an apparently autosomal dominant form of dentinogenesis imperfecta type II (DGI-II, OMIM 125490). All affected individuals presented with typical, clinical and radiographic features of DGI-II, but without bilateral progressive high-frequency sensorineural hearing loss. To investigate the mutated molecule, a positional candidate approach was used to determine the mutated gene in this family. Genomic DNA was obtained from 24 affected individuals, 18 unaffected relatives of the family and 50 controls. Haplotype analysis was performed using leukocyte DNA for 6 short tandem repeat (STR) markers present in chromosome 4 (D4S1534, GATA62A11, DSPP, DMP1, SPP1 and D4S1563). In the critical region between D4S1534 and DMP1, the dentin sialophosphoprotein (DSPP) gene (OMIM *125485) was considered as the strongest candidate gene. The first four exons and exon/intron boundaries of the gene were analyzed using DNA from 24 affected individuals and 18 unaffected relatives of the same family. DNA sequencing revealed a heterozygous deletion mutation in intron 2 (at positions -3 to -25), which resulted in a frameshift mutation, that changed the acceptor site sequence from CAG to AAG (IVS2-3C→A) and may also have disrupted the branch point consensus sequence in intron 2. The mutation was found in the 24 affected individuals, but not in the 18 unaffected relatives and 50 controls. The deletion was identified by allele-specific sequencing and denaturing high-performance liquid chromatography (DHPLC) analysis. We conclude that the heterozygous deletion mutation contributed to the pathogenesis of DGI-II

  2. Mutations to Less-Preferred Synonymous Codons in a Highly Expressed Gene of Escherichia coli: Fitness and Epistatic Interactions.

    Directory of Open Access Journals (Sweden)

    David J Hauber

    Full Text Available Codon-tRNA coevolution to maximize protein production has been, until recently, the dominant hypothesis to explain codon-usage bias in highly expressed bacterial genes. Two predictions of this hypothesis are 1 selection is weak; and 2 similar silent replacements at different codons should have similar fitness consequence. We used an allele-replacement strategy to change five specific 3rd-codon-position (silent sites in the highly expressed Escherichia coli ribosomal protein gene rplQ from the wild type to a less-preferred alternative. We introduced the five mutations within a 10-codon region. Four of the silent sites were chosen to test the second prediction, with a CTG to CTA mutation being introduced at two closely linked leucine codons and an AAA to AAG mutation being introduced at two closely linked lysine codons. We also introduced a fifth silent mutation, a GTG to GTA mutation at a valine codon in the same genic region. We measured the fitness effect of the individual mutations by competing each single-mutant strain against the parental wild-type strain, using a disrupted form of the araA gene as a selectively neutral phenotypic marker to distinguish between strains in direct competition experiments. Three of the silent mutations had a fitness effect of |s| > 0.02, which is contradictory to the prediction that selection will be weak. The two leucine mutations had significantly different fitness effects, as did the two lysine mutations, contradictory to the prediction that similar mutations at different codons should have similar fitness effects. We also constructed a strain carrying all five silent mutations in combination. Its fitness effect was greater than that predicted from the individual fitness values, suggesting that negative synergistic epistasis acts on the combination allele.

  3. Identification of an alternative knockdown resistance (kdr)-like mutation, M918L, and a novel mutation, V1010A, in the Thrips tabaci voltage-gated sodium channel gene.

    Science.gov (United States)

    Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley

    2014-06-01

    Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.

  4. Identification and functional analysis of a novel mutation in the SOX10 gene associated with Waardenburg syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Chen, Hong-Sheng; Li, Hai-Bo; Zhang, Hua; Mei, Ling-Yun; He, Chu-Feng; Wang, Xing-Wei; Men, Mei-Chao; Jiang, Lu; Liao, Xin-Bin; Wu, Hong; Feng, Yong

    2014-03-15

    Waardenburg syndrome type IV (WS4) is a rare genetic disorder, characterized by auditory-pigmentary abnormalities and Hirschsprung disease. Mutations of the EDNRB gene, EDN3 gene, or SOX10 gene are responsible for WS4. In the present study, we reported a case of a Chinese patient with clinical features of WS4. In addition, the three genes mentioned above were sequenced in order to identify whether mutations are responsible for the case. We revealed a novel nonsense mutation, c.1063C>T (p.Q355*), in the last coding exon of SOX10. The same mutation was not found in three unaffected family members or 100 unrelated controls. Then, the function and mechanism of the mutation were investigated in vitro. We found both wild-type (WT) and mutant SOX10 p.Q355* were detected at the expected size and their expression levels are equivalent. The mutant protein also localized in the nucleus and retained the DNA-binding activity as WT counterpart; however, it lost its transactivation capability on the MITF promoter and acted as a dominant-negative repressor impairing function of the WT SOX10. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    Science.gov (United States)

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  6. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  7. Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

    Science.gov (United States)

    Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

    2017-10-01

    Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

  8. A Novel Missense Mutation in SLC5A5 Gene in a Sudanese Family with Congenital Hypothyroidism.

    Science.gov (United States)

    Watanabe, Yui; Ebrhim, Reham Shareef; Abdullah, Mohamed A; Weiss, Roy E

    2018-05-15

    Thyroid hormone synthesis requires the presence of iodide. The sodium iodide symporter (NIS) is a glycoprotein which mediates the active uptake of iodide from the blood stream into the thyroid grand. NIS defects due to SLC5A5 gene mutations are known to cause congenital hypothyroidism (CH). The proposita is a 28-year-old female whose origin is the North Sudan where neonatal screening for CH is not available. She presented with severe constipation and a goiter at the age of 40 days. Laboratory testing confirmed CH and she was started on levothyroxine (L-T4). Presumably due to the delayed treatment the patient developed mental retardation. Her younger sister presented with a goiter, tongue protrusion and umbilical hernia and the youngest brother was also diagnosed with CH based on the TSH >100 µIU/mL at the age of 22 days and 8 days, respectively. Two siblings were treated with L-T4 and had normal development. Their consanguineous parents had no history of thyroid disorders. We performed whole exome sequencing (WES) on the proposita. WES identified a novel homozygous missense mutation in the SLC5A5 gene: c.1042T>G, p.Tyr348Asp, which was subsequently confirmed by Sanger sequencing. All affected children were homozygous for the same mutation and their unaffected mother was heterozygous. The NIS protein is composed of 13 transmembrane segments (TMS), an extracellular amino-terminus and an intracellular carboxyl terminus. The mutation is located in the TMS IX which has the most β-OH group-containing amino acids (serine and threonine) which is implicated in Na+ binding and translocation. In conclusion, a novel homozygous missense mutation in the SLC5A5 gene was identified in the Sudanese family with CH. The mutation is located in the TMS IX of the NIS protein which is essential for NIS function. Low iodine intake in Sudan is considered to affect severity of hypothyroidism in the patients.

  9. A high-throughput protocol for mutation scanning of the BRCA1 and BRCA2 genes

    International Nuclear Information System (INIS)

    Hondow, Heather L; Fox, Stephen B; Mitchell, Gillian; Scott, Rodney J; Beshay, Victoria; Wong, Stephen Q; Dobrovic, Alexander

    2011-01-01

    Detection of mutations by DNA sequencing can be facilitated by scanning methods to identify amplicons which may have mutations. Current scanning methods used for the detection of germline sequence variants are laborious as they require post-PCR manipulation. High resolution melting (HRM) is a cost-effective rapid screening strategy, which readily detects heterozygous variants by melting curve analysis of PCR products. It is well suited to screening genes such as BRCA1 and BRCA2 as germline pathogenic mutations in these genes are always heterozygous. Assays for the analysis of all coding regions and intron-exon boundaries of BRCA1 and BRCA2 were designed, and optimised. A final set of 94 assays which ran under identical amplification conditions were chosen for BRCA1 (36) and BRCA2 (58). Significant attention was placed on primer design to enable reproducible detection of mutations within the amplicon while minimising unnecessary detection of polymorphisms. Deoxyinosine residues were incorporated into primers that overlay intronic polymorphisms. Multiple 384 well plates were used to facilitate high throughput. 169 BRCA1 and 239 BRCA2 known sequence variants were used to test the amplicons. We also performed an extensive blinded validation of the protocol with 384 separate patient DNAs. All heterozygous variants were detected with the optimised assays. This is the first HRM approach to screen the entire coding region of the BRCA1 and BRCA2 genes using one set of reaction conditions in a multi plate 384 well format using specifically designed primers. The parallel screening of a relatively large number of samples enables better detection of sequence variants. HRM has the advantages of decreasing the necessary sequencing by more than 90%. This markedly reduced cost of sequencing will result in BRCA1 and BRCA2 mutation testing becoming accessible to individuals who currently do not undergo mutation testing because of the significant costs involved

  10. Gene Mutation Profiles in Primary Diffuse Large B Cell Lymphoma of Central Nervous System: Next Generation Sequencing Analyses

    Science.gov (United States)

    Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja

    2016-01-01

    The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089

  11. [Analysis of gene mutation of early onset epileptic spasm with unknown reason].

    Science.gov (United States)

    Yang, X; Pan, G; Li, W H; Zhang, L M; Wu, B B; Wang, H J; Zhang, P; Zhou, S Z

    2017-11-02

    Objective: To summarize the gene mutation of early onset epileptic spasm with unknown reason. Method: In this prospective study, data of patients with early onset epileptic spasm with unknown reason were collected from neurological department of Children's Hospital of Fudan University between March 2016 and December 2016. Patients with known disorders such as infection, metabolic, structural, immunological problems and known genetic mutations were excluded. Patients with genetic disease that can be diagnosed by clinical manifestations and phenotypic characteristics were also excluded. Genetic research methods included nervous system panel containing 1 427 epilepsy genes, whole exome sequencing (WES), analysis of copy number variation (CNV) and karyotype analysis of chromosome. The basic information, phenotypes, genetic results and the antiepileptic treatment of patients were analyzed. Result: Nine of the 17 cases with early onset epileptic spasm were boys and eight were girls. Patients' age at first seizure onset ranged from 1 day after birth to 8 months (median age of 3 months). The first hospital visit age ranged from 1 month to 2 years (median age of 4.5 months). The time of following-up ranged from 8 months to 3 years and 10 months. All the 17 patients had early onset epileptic spasm. Video electroencephalogram was used to monitor the spasm seizure. Five patients had Ohtahara syndrome, 10 had West syndrome, two had unclear classification. In 17 cases, 10 of them had detected pathogenic genes. Nine cases had point mutations, involving SCN2A, ARX, UNC80, KCNQ2, and GABRB3. Except one case of mutations in GABRB3 gene have been reported, all the other cases had new mutations. One patient had deletion mutation in CDKL5 gene. One CNV case had 6q 22.31 5.5MB repeats. Ten cases out of 17 were using 2-3 antiepileptic drugs (AEDs) and the drugs had no effect. Seven cases used adrenocorticotropic hormone (ACTH) and prednisone besides AEDs (a total course for 8 weeks

  12. Behavioural genetic differences between Chinese and European pigs

    Indian Academy of Sciences (India)

    Aggression is a heritable trait and genetically related to neurotransmitter-related genes. ... indigenous Mi pigs and 100 landrace-large white (LLW) cross pigs with 32 SNPs localized in 11 neurotransmitter-related genes. ... Current Issue : Vol.

  13. Severe manifestation of Bartter syndrome Type IV caused by a novel insertion mutation in the BSND gene.

    Science.gov (United States)

    de Pablos, Augusto Luque; García-Nieto, Victor; López-Menchero, Jesús C; Ramos-Trujillo, Elena; González-Acosta, Hilaria; Claverie-Martín, Félix

    2014-05-01

    Bartter syndrome Type IV is a rare subtype of the Bartter syndromes that leads to both severe renal salt wasting and sensorineural deafness. This autosomal recessive disease is caused by mutations in the gene encoding barttin, BSND, an essential subunit of the ClC-K chloride channels expressed in renal and inner ear epithelia. Patients differ in the severity of renal symptoms, which appears to depend on the modification of channel function by the mutant barttin. To date, only a few BSND mutations have been reported, most of which are missense or nonsense mutations. In this study, we report the identification of the first insertion mutation, p.W102Vfs*7, in the BSND gene of a newborn girl with acute clinical symptoms including early-onset chronic renal failure. The results support previous data indicating that mutations that are predicted to abolish barttin expression are associated with a severe phenotype and early onset renal failure.

  14. Netherton syndrome in one Chinese adult with a novel mutation in the SPINK5 gene and immunohistochemical studies of LEKTI

    Directory of Open Access Journals (Sweden)

    Zhang Xi-Bao

    2012-01-01

    Full Text Available Background : Netherton syndrome (NS is a severe autosomal recessive ichthyosis. It is characterized by congenital ichthyosiform erythroderma, trichorrhexis invaginata, ichthyosis linearis circumflexa, atopic diathesis, and frequent bacterial infections. The disease is caused by mutations in the SPINK5 (serine protease inhibitor Kazal-type 5 gene, a new type of serine protease inhibitor involved in the regulation of skin barrier formation and immunity. We report one Chinese adult with NS. The patient had typical manifestation of NS except for trichorrhexis invaginata with an atopic diathesis and recurrent staphylococcal infections since birth. Aims: To evaluate the gene mutation and of its product activity of SPINK5 gene in confirmation of the diagnosis of one Chinese adult with NS. Materials and Methods: To screen mutations in the SPINK5 gene, 33 exons and flanking intron boundaries of SPINK5 were amplified with polymerase chain reaction (PCR and used for direct sequencing. In addition, immunohistochemical staining of LEKTI (lymphoepithelial Kazal-type-related inhibitor with specific antibody was used to confirm the diagnosis of NS. The results were compared with that of healthy individuals (twenty-five blood samples. Results: A G318A mutation was found at exon 5 of patient′s SPINK5 gene which is a novel missense mutation. The PCR amplification products with mutation-specific primer were obtained only from the DNA of the patients and their mother, but not from their father and 25 healthy individuals. Immunohistochemical studies indicated there was no LEKTI expression in NS patient′s skin and there was a strong LEKTI expression in the normal human skin. Conclusion: In this report, we describe heterozygous mutation in the SPINK5 gene and expression of LEKTI in one Chinese with NS. The results indicate that defective expression of LEKTI in the epidermis and mutations of SPINK5 gene are reliable for diagnostic feature of NS with atypical

  15. A novel c.240_241insGG mutation in NDP gene in a family with Norrie disease.

    Science.gov (United States)

    Andarva, Monavvar; Jamshidi, Javad; Ghaedi, Hamid; Daftarian, Narsis; Emamalizadeh, Babak; Alehabib, Elham; Taghavi, Shaghyegh; Pouriran, Ramin; Darvish, Hossein

    2018-03-01

    Norrie disease (ND) is a rare, X-linked recessive disorder with the main characteristic of early childhood blindness. The aim of the present study was to identify the genetic cause of the disease and the phenotypic characteristics of the patients in an Iranian family with four affected males with ND. Norrie disease pseudoglioma (NDP) gene was sequenced and clinical examination was performed on patients. A GG dinucleotide insertion in exon 3 (c.240_241insGG) of NDP was detected in all patients. The mutation caused a frameshift and an early stop codon (p.Phe81Glyfs*23). A novel mutation was found in the NDP gene in the affected males of the family. As the mutation was absent in the normal male members of the family, it should be the genetic cause of the disease. © 2017 Optometry Australia.

  16. Cataract as a phenotypic marker for a mutation in WFS1, the Wolfram syndrome gene.

    Science.gov (United States)

    Titah, Salah Mohamed Cherif; Meunier, Isabelle; Blanchet, Catherine; Lopez, Severine; Rondouin, Gerard; Lenaers, Guy; Amati-Bonneau, Patrizia; Reynier, Pascal; Paquis-Flucklinger, Veronique; Hamel, Christian P

    2012-01-01

    Wolfram syndrome (WS) or diabetes insipidus, diabetes mellitus, optic atrophy, and deafness (DIDMOAD) (OMIM 222300) is an inherited neurodegenerative disease characterized by diabetes mellitus and optic atrophy as the 2 major criteria, followed later in life by deafness, diabetes insipidus, and various signs of neurologic impairment. The presence of a cataract has been variably mentioned in WS. Two members of a family had thorough ophthalmic examination and their DNA was screened for mutations in mitochondrial DNA, WFS1, OPA1, and OPA3 genes. We report a patient who first had surgery for bilateral cataract at age 5 and who subsequently presented typical signs of WS, i.e., diabetes mellitus, optic atrophy with reduced visual acuity at 20/400 on both eyes at age 22, and mild deafness. The patient was found to be a compound heterozygote for 2 truncating mutations in WFS1, the major WS gene. She carried the previously reported c.1231_1233 delCT and a novel c.2431_2465dup35 mutation. She also was heterozygote for a novel OPA1 sequence variant, c.929A>G in exon 9, whose pathogenicity remains uncertain. The patient's mother was a heterozygous carrier of the c.2431_2465dup35 mutation. She did not have diabetes mellitus or optic atrophy but had bilateral polar cataract. She did not carry the OPA1 sequence variant. Cataract could be a marker for the WFS1 heterozygosity in this family, namely the c.2431_2465dup35 mutation.

  17. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  18. A targeted constitutive mutation in the APC tumor suppressor gene underlies mammary but not intestinal tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Claudia Gaspar

    2009-07-01

    Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

  19. Somatic gene mutation in the human in relation to radiation risk

    International Nuclear Information System (INIS)

    Mendelsohn, M.L.

    1992-01-01

    This report discusses the measurement of somatic gene-mutation frequencies in the human. We ask the following questions. How well can they be measured? Do they respond to radiation? Can they also function as a dosimeter? What do they tell us about the somatic mutation theory of carcinogenesis?

  20. Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene

    International Nuclear Information System (INIS)

    Romeo, G.; Hassan, H.J.; Staempfli, S.

    1987-01-01

    The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees