WorldWideScience

Sample records for phylogenetic diversity localization

  1. Local-scale Partitioning of Functional and Phylogenetic Beta Diversity in a Tropical Tree Assemblage.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Zhang, Guocheng; Ci, Xiuqin; Cao, Min; Sha, Liqing; Li, Jie; Ferry Slik, J W; Lin, Luxiang

    2015-08-03

    The relative degree to which stochastic and deterministic processes underpin community assembly is a central problem in ecology. Quantifying local-scale phylogenetic and functional beta diversity may shed new light on this problem. We used species distribution, soil, trait and phylogenetic data to quantify whether environmental distance, geographic distance or their combination are the strongest predictors of phylogenetic and functional beta diversity on local scales in a 20-ha tropical seasonal rainforest dynamics plot in southwest China. The patterns of phylogenetic and functional beta diversity were generally consistent. The phylogenetic and functional dissimilarity between subplots (10 × 10 m, 20 × 20 m, 50 × 50 m and 100 × 100 m) was often higher than that expected by chance. The turnover of lineages and species function within habitats was generally slower than that across habitats. Partitioning the variation in phylogenetic and functional beta diversity showed that environmental distance was generally a better predictor of beta diversity than geographic distance thereby lending relatively more support for deterministic environmental filtering over stochastic processes. Overall, our results highlight that deterministic processes play a stronger role than stochastic processes in structuring community composition in this diverse assemblage of tropical trees.

  2. Relative roles of local disturbance, current climate and palaeoclimate in determining phylogenetic and functional diversity in Chinese forests

    DEFF Research Database (Denmark)

    Feng, Gang; Mi, Xiangcheng; Bøcher, Peder Klith

    2014-01-01

    their relative roles in determining woody plant phylogenetic and functional diversity in this important hotspot for woody plant diversity. Local disturbance was the best predictor of functional diversity as represented by maximum canopy height (Hmax), probably reflecting the dominant role of competition...... studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese forest plots to data on current and Last Glacial Maximum (LGM) climate as well as local disturbance regimes to study...

  3. Partitioning the regional and local drivers of phylogenetic and functional diversity along temperate elevational gradients on an East Asian peninsula.

    Science.gov (United States)

    Chun, Jung-Hwa; Lee, Chang-Bae

    2018-02-12

    Species-centric approaches to biodiversity in ecological research are limited in their ability to reflect the evolutionary history and functional diversity of community assembly. Recently, the introduction of alternative facets of biodiversity, such as phylogenetic and functional diversity, has shed light on this problem and improved our understanding of the processes underlying biodiversity patterns. Here, we investigated the phylogenetic and functional diversity patterns of α, β and γ components in woody plant assemblages along regional and local elevational gradients in South Korea. Although the patterns of phylogenetic and functional diversity varied along regional and local elevational transects, the main drivers were partitioned into two categories: regional area or climate for phylogenetic diversity, depending on whether the transect was at a regional or local scale; and habitat heterogeneity for functional diversity, which was derived in elevational bands. Moreover, environmental distance was more important than was geographic distance for phylogenetic and functional β diversity between paired elevational bands. These results support the hypothesis that niche-based deterministic processes such as environmental filtering and competitive exclusion are fundamental in structuring woody plant assemblages along temperate elevational gradients regardless of scale (regional vs. local) in our study areas.

  4. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  5. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  7. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  8. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  9. Maximizing the phylogenetic diversity of seed banks.

    Science.gov (United States)

    Griffiths, Kate E; Balding, Sharon T; Dickie, John B; Lewis, Gwilym P; Pearce, Tim R; Grenyer, Richard

    2015-04-01

    Ex situ conservation efforts such as those of zoos, botanical gardens, and seed banks will form a vital complement to in situ conservation actions over the coming decades. It is therefore necessary to pay the same attention to the biological diversity represented in ex situ conservation facilities as is often paid to protected-area networks. Building the phylogenetic diversity of ex situ collections will strengthen our capacity to respond to biodiversity loss. Since 2000, the Millennium Seed Bank Partnership has banked seed from 14% of the world's plant species. We assessed the taxonomic, geographic, and phylogenetic diversity of the Millennium Seed Bank collection of legumes (Leguminosae). We compared the collection with all known legume genera, their known geographic range (at country and regional levels), and a genus-level phylogeny of the legume family constructed for this study. Over half the phylogenetic diversity of legumes at the genus level was represented in the Millennium Seed Bank. However, pragmatic prioritization of species of economic importance and endangerment has led to the banking of a less-than-optimal phylogenetic diversity and prioritization of range-restricted species risks an underdispersed collection. The current state of the phylogenetic diversity of legumes in the Millennium Seed Bank could be substantially improved through the strategic banking of relatively few additional taxa. Our method draws on tools that are widely applied to in situ conservation planning, and it can be used to evaluate and improve the phylogenetic diversity of ex situ collections. © 2014 Society for Conservation Biology.

  10. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  11. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  12. A comparative test of phylogenetic diversity indices.

    Science.gov (United States)

    Schweiger, Oliver; Klotz, Stefan; Durka, Walter; Kühn, Ingolf

    2008-09-01

    Traditional measures of biodiversity, such as species richness, usually treat species as being equal. As this is obviously not the case, measuring diversity in terms of features accumulated over evolutionary history provides additional value to theoretical and applied ecology. Several phylogenetic diversity indices exist, but their behaviour has not yet been tested in a comparative framework. We provide a test of ten commonly used phylogenetic diversity indices based on 40 simulated phylogenies of varying topology. We restrict our analysis to a topological fully resolved tree without information on branch lengths and species lists with presence-absence data. A total of 38,000 artificial communities varying in species richness covering 5-95% of the phylogenies were created by random resampling. The indices were evaluated based on their ability to meet a priori defined requirements. No index meets all requirements, but three indices turned out to be more suitable than others under particular conditions. Average taxonomic distinctness (AvTD) and intensive quadratic entropy (J) are calculated by averaging and are, therefore, unbiased by species richness while reflecting phylogeny per se well. However, averaging leads to the violation of set monotonicity, which requires that species extinction cannot increase the index. Total taxonomic distinctness (TTD) sums up distinctiveness values for particular species across the community. It is therefore strongly linked to species richness and reflects phylogeny per se weakly but satisfies set monotonicity. We suggest that AvTD and J are best applied to studies that compare spatially or temporally rather independent communities that potentially vary strongly in their phylogenetic composition-i.e. where set monotonicity is a more negligible issue, but independence of species richness is desired. In contrast, we suggest that TTD be used in studies that compare rather interdependent communities where changes occur more gradually by

  13. Using tree diversity to compare phylogenetic heuristics.

    Science.gov (United States)

    Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

    2009-04-29

    Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

  14. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  15. Edge-related loss of tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

    Directory of Open Access Journals (Sweden)

    Bráulio A Santos

    Full Text Available Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (<80 ha forest fragments. This was attributed to a reduction of 11% in the average phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

  16. Edge-related loss of tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

    Science.gov (United States)

    Santos, Bráulio A; Arroyo-Rodríguez, Víctor; Moreno, Claudia E; Tabarelli, Marcelo

    2010-09-08

    Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

  17. Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity

    Science.gov (United States)

    Thompson, Patrick L.; Davies, T. Jonathan; Gonzalez, Andrew

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures. PMID:25693188

  18. Phylogenetically diverse macrophyte community promotes species diversity of mobile epi-benthic invertebrates

    Science.gov (United States)

    Nakamoto, Kenta; Hayakawa, Jun; Kawamura, Tomohiko; Kodama, Masafumi; Yamada, Hideaki; Kitagawa, Takashi; Watanabe, Yoshiro

    2018-07-01

    Various aspects of plant diversity such as species diversity and phylogenetic diversity enhance the species diversity of associated animals in terrestrial systems. In marine systems, however, the effects of macrophyte diversity on the species diversity of associated animals have received little attention. Here, we sampled in a subtropical seagrass-seaweed mixed bed to elucidate the effect of the macrophyte phylogenetic diversity based on the taxonomic relatedness as well as the macrophyte species diversity on species diversity of mobile epi-benthic invertebrates. Using regression analyses for each macrophyte parameter as well as multiple regression analyses, we found that the macrophyte phylogenetic diversity (taxonomic diversity index: Delta) positively influenced the invertebrate species richness and diversity index (H‧). Although the macrophyte species richness and H‧ also positively influenced the invertebrate species richness, the best fit model for invertebrate species richness did not include them, suggesting that the macrophyte species diversity indirectly influenced invertebrate species diversity. Possible explanations of the effects of macrophyte Delta on the invertebrate species diversity were the niche complementarity effect and the selection effect. This is the first study which demonstrates that macrophyte phylogenetic diversity has a strong effect on the species diversity of mobile epi-benthic invertebrates.

  19. The mean and variance of phylogenetic diversity under rarefaction

    OpenAIRE

    Nipperess, David A.; Matsen, Frederick A.

    2013-01-01

    Phylogenetic diversity (PD) depends on sampling intensity, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD. We have derived exact formulae for t...

  20. Host specialization and phylogenetic diversity of Corynespora cassiicola.

    Science.gov (United States)

    Dixon, L J; Schlub, R L; Pernezny, K; Datnoff, L E

    2009-09-01

    The fungus Corynespora cassiicola is primarily found in the tropics and subtropics, and is widely diverse in substrate utilization and host association. Isolate characterization within C. cassiicola was undertaken to investigate how genetic diversity correlates with host specificity, growth rate, and geographic distribution. C. cassiicola isolates were collected from 68 different plant species in American Samoa, Brazil, Malaysia, and Micronesia, and Florida, Mississippi, and Tennessee within the United States. Phylogenetic analyses using four loci were performed with 143 Corynespora spp. isolates, including outgroup taxa obtained from culture collections: C. citricola, C. melongenae, C. olivacea, C. proliferata, C. sesamum, and C. smithii. Phylogenetic trees were congruent from the ribosomal DNA internal transcribed spacer region, two random hypervariable loci (caa5 and ga4), and the actin-encoding locus act1, indicating a lack of recombination within the species and asexual propagation. Fifty isolates were tested for pathogenicity on eight known C. cassiicola crop hosts: basil, bean, cowpea, cucumber, papaya, soybean, sweet potato, and tomato. Pathogenicity profiles ranged from one to four hosts, with cucumber appearing in 14 of the 16 profiles. Bootstrap analyses and Bayesian posterior probability values identified six statistically significant phylogenetic lineages. The six phylogenetic lineages correlated with host of origin, pathogenicity, and growth rate but not with geographic location. Common fungal genotypes were widely distributed geographically, indicating long-distance and global dispersal of clonal lineages. This research reveals an abundance of previously unrecognized genetic diversity within the species and provides evidence for host specialization on papaya.

  1. White-tailed deer are a biotic filter during community assembly, reducing species and phylogenetic diversity.

    Science.gov (United States)

    Begley-Miller, Danielle R; Hipp, Andrew L; Brown, Bethany H; Hahn, Marlene; Rooney, Thomas P

    2014-06-09

    Community assembly entails a filtering process, where species found in a local community are those that can pass through environmental (abiotic) and biotic filters and successfully compete. Previous research has demonstrated the ability of white-tailed deer (Odocoileus virginianus) to reduce species diversity and favour browse-tolerant plant communities. In this study, we expand on our previous work by investigating deer as a possible biotic filter altering local plant community assembly. We used replicated 23-year-old deer exclosures to experimentally assess the effects of deer on species diversity (H'), richness (SR), phylogenetic community structure and phylogenetic diversity in paired browsed (control) and unbrowsed (exclosed) plots. Additionally, we developed a deer-browsing susceptibility index (DBSI) to assess the vulnerability of local species to deer. Deer browsing caused a 12 % reduction in H' and 17 % reduction in SR, consistent with previous studies. Furthermore, browsing reduced phylogenetic diversity by 63 %, causing significant phylogenetic clustering. Overall, graminoids were the least vulnerable to deer browsing based on DBSI calculations. These findings demonstrate that deer are a significant driver of plant community assembly due to their role as a selective browser, or more generally, as a biotic filter. This study highlights the importance of knowledge about the plant tree of life in assessing the effects of biotic filters on plant communities. Application of such knowledge has considerable potential to advance our understanding of plant community assembly. Published by Oxford University Press on behalf of the Annals of Botany Company.

  2. Fast Computations for Measures of Phylogenetic Beta Diversity.

    Directory of Open Access Journals (Sweden)

    Constantinos Tsirogiannis

    Full Text Available For many applications in ecology, it is important to examine the phylogenetic relations between two communities of species. More formally, let [Formula: see text] be a phylogenetic tree and let A and B be two samples of its tips, representing the examined communities. We want to compute a value that expresses the phylogenetic diversity between A and B in [Formula: see text]. There exist several measures that can do this; these are the so-called phylogenetic beta diversity (β-diversity measures. Two popular measures of this kind are the Community Distance (CD and the Common Branch Length (CBL. In most applications, it is not sufficient to compute the value of a beta diversity measure for two communities A and B; we also want to know if this value is relatively large or small compared to all possible pairs of communities in [Formula: see text] that have the same size. To decide this, the ideal approach is to compute a standardised index that involves the mean and the standard deviation of this measure among all pairs of species samples that have the same number of elements as A and B. However, no method exists for computing exactly and efficiently this index for CD and CBL. We present analytical expressions for computing the expectation and the standard deviation of CD and CBL. Based on these expressions, we describe efficient algorithms for computing the standardised indices of the two measures. Using standard algorithmic analysis, we provide guarantees on the theoretical efficiency of our algorithms. We implemented our algorithms and measured their efficiency in practice. Our implementations compute the standardised indices of CD and CBL in less than twenty seconds for a hundred pairs of samples on trees with 7 ⋅ 10(4 tips. Our implementations are available through the R package PhyloMeasures.

  3. A phylogenetic perspective on species diversity, β-diversity and biogeography for the microbial world.

    Science.gov (United States)

    Barberán, Albert; Casamayor, Emilio O

    2014-12-01

    There is an increasing interest to combine phylogenetic data with distributional and ecological records to assess how natural communities arrange under an evolutionary perspective. In the microbial world, there is also a need to go beyond the problematic species definition to deeply explore ecological patterns using genetic data. We explored links between evolution/phylogeny and community ecology using bacterial 16S rRNA gene information from a high-altitude lakes district data set. We described phylogenetic community composition, spatial distribution, and β-diversity and biogeographical patterns applying evolutionary relatedness without relying on any particular operational taxonomic unit definition. High-altitude lakes districts usually contain a large mosaic of highly diverse small water bodies and conform a fine biogeographical model of spatially close but environmentally heterogeneous ecosystems. We sampled 18 lakes in the Pyrenees with a selection criteria focused on capturing the maximum environmental variation within the smallest geographical area. The results showed highly diverse communities nonrandomly distributed with phylogenetic β-diversity patterns mainly shaped by the environment and not by the spatial distance. Community similarity based on both bacterial taxonomic composition and phylogenetic β-diversity shared similar patterns and was primarily structured by similar environmental drivers. We observed a positive relationship between lake area and phylogenetic diversity with a slope consistent with highly dispersive planktonic organisms. The phylogenetic approach incorporated patterns of common ancestry into bacterial community analysis and emerged as a very convenient analytical tool for direct inter- and intrabiome biodiversity comparisons and sorting out microbial habitats with potential application in conservation studies. © 2014 John Wiley & Sons Ltd.

  4. Incorporating phylogenetic information for the definition of floristic districts in hyper-diverse Amazon forests: implications for conservation

    NARCIS (Netherlands)

    Guevara, J.E.; Pitman, N.C.A.; ter Steege, H.; Mogollón, H.; Ceron, C.; Palacios, W.; Oleas, N.; Fine, P.V.A.

    2017-01-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the

  5. Turnover of plant lineages shapes herbivore phylogenetic beta diversity along ecological gradients.

    Science.gov (United States)

    Pellissier, Loïc; Ndiribe, Charlotte; Dubuis, Anne; Pradervand, Jean-Nicolas; Salamin, Nicolas; Guisan, Antoine; Rasmann, Sergio

    2013-05-01

    Understanding drivers of biodiversity patterns is of prime importance in this era of severe environmental crisis. More diverse plant communities have been postulated to represent a larger functional trait-space, more likely to sustain a diverse assembly of herbivore species. Here, we expand this hypothesis to integrate environmental, functional and phylogenetic variation of plant communities as factors explaining the diversity of lepidopteran assemblages along elevation gradients in the Swiss Western Alps. According to expectations, we found that the association between butterflies and their host plants is highly phylogenetically structured. Multiple regression analyses showed the combined effect of climate, functional traits and phylogenetic diversity in structuring butterfly communities. Furthermore, we provide the first evidence that plant phylogenetic beta diversity is the major driver explaining butterfly phylogenetic beta diversity. Along ecological gradients, the bottom up control of herbivore diversity is thus driven by phylogenetically structured turnover of plant traits as well as environmental variables. © 2013 Blackwell Publishing Ltd/CNRS.

  6. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  7. Tree phylogenetic diversity promotes host-parasitoid interactions.

    Science.gov (United States)

    Staab, Michael; Bruelheide, Helge; Durka, Walter; Michalski, Stefan; Purschke, Oliver; Zhu, Chao-Dong; Klein, Alexandra-Maria

    2016-07-13

    Evidence from grassland experiments suggests that a plant community's phylogenetic diversity (PD) is a strong predictor of ecosystem processes, even stronger than species richness per se This has, however, never been extended to species-rich forests and host-parasitoid interactions. We used cavity-nesting Hymenoptera and their parasitoids collected in a subtropical forest as a model system to test whether hosts, parasitoids, and their interactions are influenced by tree PD and a comprehensive set of environmental variables, including tree species richness. Parasitism rate and parasitoid abundance were positively correlated with tree PD. All variables describing parasitoids decreased with elevation, and were, except parasitism rate, dependent on host abundance. Quantitative descriptors of host-parasitoid networks were independent of the environment. Our study indicates that host-parasitoid interactions in species-rich forests are related to the PD of the tree community, which influences parasitism rates through parasitoid abundance. We show that effects of tree community PD are much stronger than effects of tree species richness, can cascade to high trophic levels, and promote trophic interactions. As during habitat modification phylogenetic information is usually lost non-randomly, even species-rich habitats may not be able to continuously provide the ecosystem process parasitism if the evolutionarily most distinct plant lineages vanish. © 2016 The Author(s).

  8. Characteristics of phylogenetic diversity in airborne bacterial populations in China

    Science.gov (United States)

    Chaudhry, Zahra; Santarpia, Joshua L.; Martins, J. V.

    2011-05-01

    Considering their potential implications for human health, agricultural productivity, and ecosystem stability, surprisingly little is known about the composition or dynamics of the atmosphere's biological aerosols. The few studies that have examined phylogenetic diversity in China focused on a single sampling period, whereas this study spans 3 months and includes over 300 samples. The 300+ samples were categorized by month and direction of their back-trajectory. DNA extraction was carried out on the pooled samples in a quantitative manner to allow for comparison between the amount of extracted material and the amount of initial total aerosol mass. Within an individual month, samples originating from similar land types and approximately equidistant to the sampling location exhibited similar diversity, whereas samples originating from much greater distances and from different land types included phyla unique to that location. Phyla from the same origin also varied from one month to the next. The biological diversity found from the Phylochips reinforces the hypothesis that air samples carry a biological record of their history.

  9. The mean and variance of phylogenetic diversity under rarefaction.

    Science.gov (United States)

    Nipperess, David A; Matsen, Frederick A

    2013-06-01

    Phylogenetic diversity (PD) depends on sampling depth, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD.We have derived exact formulae for the mean and variance of PD under rarefaction. We confirm that these formulae are correct by comparing exact solution mean and variance to that calculated by repeated random (Monte Carlo) subsampling of a dataset of stem counts of woody shrubs of Toohey Forest, Queensland, Australia. We also demonstrate the application of the method using two examples: identifying hotspots of mammalian diversity in Australasian ecoregions, and characterising the human vaginal microbiome.There is a very high degree of correspondence between the analytical and random subsampling methods for calculating mean and variance of PD under rarefaction, although the Monte Carlo method requires a large number of random draws to converge on the exact solution for the variance.Rarefaction of mammalian PD of ecoregions in Australasia to a common standard of 25 species reveals very different rank orderings of ecoregions, indicating quite different hotspots of diversity than those obtained for unrarefied PD. The application of these methods to the vaginal microbiome shows that a classical score used to quantify bacterial vaginosis is correlated with the shape of the rarefaction curve.The analytical formulae for the mean and variance of PD under rarefaction are both exact and more efficient than repeated subsampling. Rarefaction of PD allows for many applications where comparisons of samples of different depth is required.

  10. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    Science.gov (United States)

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

  11. Diversity structure of culturable bacteria isolated from the Fildes Peninsula (King George Island, Antarctica): A phylogenetic analysis perspective.

    Science.gov (United States)

    González-Rocha, Gerardo; Muñoz-Cartes, Gabriel; Canales-Aguirre, Cristian B; Lima, Celia A; Domínguez-Yévenes, Mariana; Bello-Toledo, Helia; Hernández, Cristián E

    2017-01-01

    It has been proposed that Antarctic environments select microorganisms with unique biochemical adaptations, based on the tenet 'Everything is everywhere, but, the environment selects' by Baas-Becking. However, this is a hypothesis that has not been extensively evaluated. This study evaluated the fundamental prediction contained in this hypothesis-in the sense that species are structured in the landscape according to their local habitats-, using as study model the phylogenetic diversity of the culturable bacteria of Fildes Peninsula (King George Island, Antarctica). Eighty bacterial strains isolated from 10 different locations in the area, were recovered. Based on phylogenetic analysis of 16S rRNA gene sequences, the isolates were grouped into twenty-six phylotypes distributed in three main clades, of which only six are exclusive to Antarctica. Results showed that phylotypes do not group significantly by habitat type; however, local habitat types had phylogenetic signal, which support the phylogenetic niche conservatism hypothesis and not a selective role of the environment like the Baas-Becking hypothesis suggests. We propose that, more than habitat selection resulting in new local adaptations and diversity, local historical colonization and species sorting (i.e. differences in speciation and extinction rates that arise by interaction of species level traits with the environment) play a fundamental role on the culturable bacterial diversity in Antarctica.

  12. Dimensions of biodiversity loss: Spatial mismatch in land-use impacts on species, functional and phylogenetic diversity of European bees.

    Science.gov (United States)

    De Palma, Adriana; Kuhlmann, Michael; Bugter, Rob; Ferrier, Simon; Hoskins, Andrew J; Potts, Simon G; Roberts, Stuart P M; Schweiger, Oliver; Purvis, Andy

    2017-12-01

    Agricultural intensification and urbanization are important drivers of biodiversity change in Europe. Different aspects of bee community diversity vary in their sensitivity to these pressures, as well as independently influencing ecosystem service provision (pollination). To obtain a more comprehensive understanding of human impacts on bee diversity across Europe, we assess multiple, complementary indices of diversity. One Thousand four hundred and forty six sites across Europe. We collated data on bee occurrence and abundance from the published literature and supplemented them with the PREDICTS database. Using Rao's Quadratic Entropy, we assessed how species, functional and phylogenetic diversity of 1,446 bee communities respond to land-use characteristics including land-use class, cropland intensity, human population density and distance to roads. We combined these models with statistically downscaled estimates of land use in 2005 to estimate and map-at a scale of approximately 1 km 2 -the losses in diversity relative to semi-natural/natural baseline (the predicted diversity of an uninhabited grid square, consisting only of semi-natural/natural vegetation). We show that-relative to the predicted local diversity in uninhabited semi-natural/natural habitat-half of all EU27 countries have lost over 10% of their average local species diversity and two-thirds of countries have lost over 5% of their average local functional and phylogenetic diversity. All diversity measures were generally lower in pasture and higher-intensity cropland than in semi-natural/natural vegetation, but facets of diversity showed less consistent responses to human population density. These differences have led to marked spatial mismatches in losses: losses in phylogenetic diversity were in some areas almost 20 percentage points (pp.) more severe than losses in species diversity, but in other areas losses were almost 40 pp. less severe. These results highlight the importance of exploring

  13. Continental scale patterns and predictors of fern richness and phylogenetic diversity

    Directory of Open Access Journals (Sweden)

    Nathalie eNagalingum

    2015-04-01

    Full Text Available Because ferns have a wide range of habitat preferences and are widely distributed, they are an ideal group for understanding how diversity is distributed. Here we examine fern diversity on a broad-scale using standard and corrected richness measures as well as phylogenetic indices; in addition we determine the environmental predictors of each diversity metric. Using the combined records of Australian herbaria, a dataset of over 60,000 records was obtained for 89 genera to infer richness. A phylogenetic tree of all the genera was constructed and combined with the herbarium records to obtain phylogenetic diversity patterns. A hotspot of both taxic and phylogenetic diversity occurs in the Wet Tropics of northeastern Australia. Although considerable diversity is distributed along the eastern coast, some important regions of diversity are identified only after sample-standardization of richness and through the phylogenetic metric. Of all of the metrics, annual precipitation was identified as the most explanatory variable, in part, in agreement with global and regional fern studies. Precipitation was combined with a different variable for each different metric. For corrected richness, precipitation is combined with temperature seasonality, while correlation of phylogenetic diversity to precipitation plus radiation indicates support for the species-energy hypothesis. Significantly high and significantly low phylogenetic diversity were found in geographically separate areas. These areas are correlated with different climatic conditions such as seasonality in precipitation. The use of phylogenetic metrics identifies additional areas of significant diversity, some of which have not been revealed using traditional taxonomic analyses, suggesting that different ecological and evolutionary processes have operated over the continent. Our study demonstrates that it is possible and vital to incorporate evolutionary metrics when inferring biodiversity hotspots

  14. Phylogenetic diversity of macromycetes and woody plants along an elevational gradient in Eastern Mexico

    Science.gov (United States)

    Marko Gomez-Hernandez; Guadalupe Williams-Linera; D. Jean Lodge; Roger Guevara; Eduardo Ruiz-Sanchez; Etelvina Gandara

    2016-01-01

    Phylogenetic information provides insight into the ecological and evolutionary processes that organize species assemblages. We compared patterns of phylogenetic diversity among macromycete and woody plant communities along a steep elevational gradient in eastern Mexico to better understand the evolutionary processes that structure their communities. Macrofungi and...

  15. Phylogenetic and chemical diversity of MAR4 streptomycete lineage

    Directory of Open Access Journals (Sweden)

    Marisa Paulino

    2014-06-01

    To date, phylogenetic characterization of 6 representative isolates, based on partial sequence of gene encoding 16S rRNA, confirm that these strains belong to the specie Streptomyces aculeolatus. Figure 2. Neighbour-joining phylogenetic tree created from 6 partial 16S rRNA gene sequence from Streptomyces aculeolatus strains cultured from Madeira Archipelago, based on 1000 bootstrap replicates. BLAST matches (deposited in GenBank are included with species and strain name followed by accession number. Verrucosispora maris and Micromonospora aurantiaca were used as outgroups.

  16. Phylogenetic diversity analysis of Trichoderma species based on ...

    African Journals Online (AJOL)

    vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...

  17. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities

    Directory of Open Access Journals (Sweden)

    Anthony Stuart Amend

    2015-02-01

    Full Text Available Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity. This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between phylogenetic diversity and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial phylogenetic diversity, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of sixty-six days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial phylogenetic diversity failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which phylogenetic diversity predicts ecosystem function will depend on environmental context.

  18. Phylogenetic and Functional Diversity of Fleshy-Fruited Plants Are Positively Associated with Seedling Diversity in a Tropical Montane Forest

    Directory of Open Access Journals (Sweden)

    Marcia C. Muñoz

    2017-08-01

    Full Text Available Mutualistic interactions between plants and animals can affect both plant and animal communities, and potentially leave imprints on plant demography. Yet, no study has simultaneously tested how trait variation in plant resources shapes the diversity of animal consumers, and how these interactions influence seedling recruitment. Here, we analyzed whether (i phylogenetic diversity and functional diversity of fruiting plants were correlated with the corresponding diversity of frugivorous birds, and (ii whether phylogenetic diversity and functional identity of plant and bird communities influenced the corresponding diversity and identity of seedling communities. We recorded mutualistic interactions between fleshy-fruited plants and frugivorous birds and seedling communities in 10 plots along an elevational gradient in the Colombian Andes. We built a phylogeny for plants/seedlings and birds and measured relevant morphological plant and bird traits that influence plant-bird interactions and seedling recruitment. We found that phylogenetic diversity and functional diversity of frugivorous birds were positively associated with the corresponding diversities of fruiting plants, consistent with a bottom-up effect of plants on birds. Moreover, the phylogenetic diversity of seedlings was related to the phylogenetic diversity of plants, but was unrelated to the phylogenetic diversity of frugivorous birds, suggesting that top-down effects of animals on seedlings were weak. Mean seed mass of seedling communities was positively associated with the mean fruit mass of plants, but was not associated with the mean avian body mass in the frugivore communities. Our study shows that variation in the traits of fleshy-fruited plants was associated with the diversity of frugivorous birds and affected the future trajectory of seedling recruitment, whereas the morphological traits of animal seed dispersers were unrelated to the phylogenetic and functional structure of

  19. High phylogenetic diversity is preserved in species-poor high-elevation temperate moth assemblages

    NARCIS (Netherlands)

    Zou, Yi; Sang, Weiguo; Hausmann, Axel; Axmacher, Jan Christoph

    2016-01-01

    Understanding the diversity and composition of species assemblages and identifying underlying biotic and abiotic determinants represent great ecological challenges. Addressing some of these issues, we investigated the α-diversity and phylogenetic composition of species-rich geometrid moth

  20. Soil phosphorus heterogeneity promotes tree species diversity and phylogenetic clustering in a tropical seasonal rainforest.

    Science.gov (United States)

    Xu, Wumei; Ci, Xiuqin; Song, Caiyun; He, Tianhua; Zhang, Wenfu; Li, Qiaoming; Li, Jie

    2016-12-01

    The niche theory predicts that environmental heterogeneity and species diversity are positively correlated in tropical forests, whereas the neutral theory suggests that stochastic processes are more important in determining species diversity. This study sought to investigate the effects of soil nutrient (nitrogen and phosphorus) heterogeneity on tree species diversity in the Xishuangbanna tropical seasonal rainforest in southwestern China. Thirty-nine plots of 400 m 2 (20 × 20 m) were randomly located in the Xishuangbanna tropical seasonal rainforest. Within each plot, soil nutrient (nitrogen and phosphorus) availability and heterogeneity, tree species diversity, and community phylogenetic structure were measured. Soil phosphorus heterogeneity and tree species diversity in each plot were positively correlated, while phosphorus availability and tree species diversity were not. The trees in plots with low soil phosphorus heterogeneity were phylogenetically overdispersed, while the phylogenetic structure of trees within the plots became clustered as heterogeneity increased. Neither nitrogen availability nor its heterogeneity was correlated to tree species diversity or the phylogenetic structure of trees within the plots. The interspecific competition in the forest plots with low soil phosphorus heterogeneity could lead to an overdispersed community. However, as heterogeneity increase, more closely related species may be able to coexist together and lead to a clustered community. Our results indicate that soil phosphorus heterogeneity significantly affects tree diversity in the Xishuangbanna tropical seasonal rainforest, suggesting that deterministic processes are dominant in this tropical forest assembly.

  1. Cyanobacterial nitrogenases: phylogenetic diversity, regulation and functional predictions

    Directory of Open Access Journals (Sweden)

    Alberto A. Esteves-Ferreira

    2017-03-01

    Full Text Available Abstract Cyanobacteria is a remarkable group of prokaryotic photosynthetic microorganisms, with several genera capable of fixing atmospheric nitrogen (N2 and presenting a wide range of morphologies. Although the nitrogenase complex is not present in all cyanobacterial taxa, it is spread across several cyanobacterial strains. The nitrogenase complex has also a high theoretical potential for biofuel production, since H2 is a by-product produced during N2 fixation. In this review we discuss the significance of a relatively wide variety of cell morphologies and metabolic strategies that allow spatial and temporal separation of N2 fixation from photosynthesis in cyanobacteria. Phylogenetic reconstructions based on 16S rRNA and nifD gene sequences shed light on the evolutionary history of the two genes. Our results demonstrated that (i sequences of genes involved in nitrogen fixation (nifD from several morphologically distinct strains of cyanobacteria are grouped in similarity with their morphology classification and phylogeny, and (ii nifD genes from heterocytous strains share a common ancestor. By using this data we also discuss the evolutionary importance of processes such as horizontal gene transfer and genetic duplication for nitrogenase evolution and diversification. Finally, we discuss the importance of H2 synthesis in cyanobacteria, as well as strategies and challenges to improve cyanobacterial H2 production.

  2. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa.

    Science.gov (United States)

    Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel

    2015-01-01

    The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.

  3. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa

    Science.gov (United States)

    Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel

    2015-01-01

    The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation. PMID:25978319

  4. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa.

    Directory of Open Access Journals (Sweden)

    Julian Martin Corbelli

    Full Text Available The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD, functional (FBD and phylogenetic (PBD facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants from two contrasting biomes (subtropical forest and grassland and land uses (tree plantations and cropfields in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland, and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.

  5. Evolution and Phylogenetic Diversity of Yam Species (Dioscorea spp.: Implication for Conservation and Agricultural Practices.

    Directory of Open Access Journals (Sweden)

    Marie Florence Sandrine Ngo Ngwe

    Full Text Available Yams (Dioscorea spp. consist of approximately 600 species. Presently, these species are threatened by genetic erosion due to many factors such as pest attacks and farming practices. In parallel, complex taxonomic boundaries in this genus makes it more challenging to properly address the genetic diversity of yam and manage its germplasm. As a first step toward evaluating and preserving the genetic diversity yam species, we use a phylogenetic diversity (PD approach that has the advantage to investigate phylogenetic relationships and test hypotheses of species monophyly while alleviating to the problem of ploidy variation within and among species. The Bayesian phylogenetic analysis of 62 accessions from 7 species from three regions of Cameroon showed that most Dioscorea sections were monophyletic, but species within sections were generally non-monophyletic. The wild species D. praehensilis and cultivated D. cayenensis were the species with the highest PD. At the opposite, D. esculenta has a low PD and future studies should focus on this species to properly address its conservation status. We also show that wild species show a stronger genetic structure than cultivated species, which potentially reflects the management of the yam germplasm by farmers. These findings show that phylogenetic diversity is a promising approach for an initial investigation of genetic diversity in a crop consisting of closely related species.

  6. Region effects influence local tree species diversity.

    Science.gov (United States)

    Ricklefs, Robert E; He, Fangliang

    2016-01-19

    Global patterns of biodiversity reflect both regional and local processes, but the relative importance of local ecological limits to species coexistence, as influenced by the physical environment, in contrast to regional processes including species production, dispersal, and extinction, is poorly understood. Failure to distinguish regional influences from local effects has been due, in part, to sampling limitations at small scales, environmental heterogeneity within local or regional samples, and incomplete geographic sampling of species. Here, we use a global dataset comprising 47 forest plots to demonstrate significant region effects on diversity, beyond the influence of local climate, which together explain more than 92% of the global variation in local forest tree species richness. Significant region effects imply that large-scale processes shaping the regional diversity of forest trees exert influence down to the local scale, where they interact with local processes to determine the number of coexisting species.

  7. Decoupling phylogenetic and functional diversity to reveal hidden signals in community assembly

    Czech Academy of Sciences Publication Activity Database

    de Bello, Francesco; Šmilauer, P.; Diniz-Filho, J. A. F.; Carmona, C. P.; Lososová, Z.; Herben, Tomáš; Götzenberger, Lars

    2017-01-01

    Roč. 8, č. 10 (2017), s. 1200-1211 ISSN 2041-210X R&D Projects: GA ČR(CZ) GA16-15012S; GA ČR GB14-36079G EU Projects: European Commission(XE) 267243 Institutional support: RVO:67985939 Keywords : community ecology * phylogenetic diversity * functional diversity Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 5.708, year: 2016

  8. Phylogenetic diversity of bacteria associated with toxic and non-toxic ...

    African Journals Online (AJOL)

    Phylogenetic diversity of bacteria associated with toxic and non-toxic strains of Alexandrium minutum. L Palacios, B Reguera, J Franco, I Marín. Abstract. Marine planktonic dinoflagellates are usually associated with bacteria, some of which seem to have a symbiotic relation with the dinoflagellate cells. The role of bacteria in ...

  9. Evolutionary history determines how plant productivity responds to phylogenetic diversity and species richness

    Directory of Open Access Journals (Sweden)

    Mark A. Genung

    2014-03-01

    Full Text Available The relationship between biodiversity and ecosystem function has received a great deal of attention in ecological research and recent results, from re-analyses, suggest that ecosystem function improves with increases in phylogenetic diversity. However, many of these results have been generalized across a range of different species and clades, and plants with different evolutionary histories could display different relationships between biodiversity and ecosystem function. To experimentally test this hypothesis, we manipulated species richness and phylogenetic diversity using 26 species from two subgenera of the genus Eucalyptus (subgenus Eucalyptus and subgenus Symphyomyrtus. We found that plant biomass (a measurement of ecosystem function sometimes, but not always, responded to increases in species richness and phylogenetic diversity. Specifically, Symphyomyrtus plants showed a positive response while no comparable effect was observed for Eucalyptus plants, showing that responses to biodiversity can vary across different phylogenetic groups. Our results show that the impacts of evolutionary history may complicate the relationship between the diversity of plant communities and plant biomass.

  10. Phylogenetic diversity of Pasteurellaceae and horizontal gene transfer of leukotoxin in wild and domestic sheep.

    Science.gov (United States)

    Kelley, Scott T; Cassirer, E Frances; Weiser, Glen C; Safaee, Shirin

    2007-01-01

    Wild and domestic animal populations are known to be sources and reservoirs of emerging diseases. There is also a growing recognition that horizontal genetic transfer (HGT) plays an important role in bacterial pathogenesis. We used molecular phylogenetic methods to assess diversity and cross-transmission rates of Pasteurellaceae bacteria in populations of bighorn sheep, Dall's sheep, domestic sheep and domestic goats. Members of the Pasteurellaceae cause an array of deadly illnesses including bacterial pneumonia known as "pasteurellosis", a particularly devastating disease for bighorn sheep. A phylogenetic analysis of a combined dataset of two RNA genes (16S ribosomal RNA and RNAse P RNA) revealed remarkable evolutionary diversity among Pasteurella trehalosi and Mannheimia (Pasteurella) haemolytica bacteria isolated from sheep and goats. Several phylotypes appeared to associate with particular host species, though we found numerous instances of apparent cross-transmission among species and populations. Statistical analyses revealed that host species, geographic locale and biovariant classification, but not virulence, correlated strongly with Pasteurellaceae phylogeny. Sheep host species correlated with P. trehalosi isolates phylogeny (PTP test; P=0.002), but not with the phylogeny of M. haemolytica isolates, suggesting that P. trehalosi bacteria may be more host specific. With regards to populations within species, we also discovered a strong correlation between geographic locale and isolate phylogeny in the Rocky Mountain bighorn sheep (PTP test; P=0.001). We also investigated the potential for HGT of the leukotoxin A (lktA) gene, which produces a toxin that plays an integral role in causing disease. Comparative analysis of the combined RNA gene phylogeny and the lktA phylogenies revealed considerable incongruence between the phylogenies, suggestive of HGT. Furthermore, we found identical lktA alleles in unrelated bacterial species, some of which had been isolated

  11. Seed plant phylogenetic diversity and species richness in conservation planning within a global biodiversity hotspot in eastern Asia.

    Science.gov (United States)

    Li, Rong; Kraft, Nathan J B; Yu, Haiying; Li, Heng

    2015-12-01

    One of the main goals of conservation biology is to understand the factors shaping variation in biodiversity across the planet. This understanding is critical for conservation planners to be able to develop effective conservation strategies. Although many studies have focused on species richness and the protection of rare and endemic species, less attention has been paid to the protection of the phylogenetic dimension of biodiversity. We explored how phylogenetic diversity, species richness, and phylogenetic community structure vary in seed plant communities along an elevational gradient in a relatively understudied high mountain region, the Dulong Valley, in southeastern Tibet, China. As expected, phylogenetic diversity was well correlated with species richness among the elevational bands and among communities. At the community level, evergreen broad-leaved forests had the highest levels of species richness and phylogenetic diversity. Using null model analyses, we found evidence of nonrandom phylogenetic structure across the region. Evergreen broad-leaved forests were phylogenetically overdispersed, whereas other vegetation types tended to be phylogenetically clustered. We suggest that communities with high species richness or overdispersed phylogenetic structure should be a focus for biodiversity conservation within the Dulong Valley because these areas may help maximize the potential of this flora to respond to future global change. In biodiversity hotspots worldwide, we suggest that the phylogenetic structure of a community may serve as a useful measure of phylogenetic diversity in the context of conservation planning. © 2015 Society for Conservation Biology.

  12. Phylogenetic diversity of stress signalling pathways in fungi

    Directory of Open Access Journals (Sweden)

    Stansfield Ian

    2009-02-01

    Full Text Available Abstract Background Microbes must sense environmental stresses, transduce these signals and mount protective responses to survive in hostile environments. In this study we have tested the hypothesis that fungal stress signalling pathways have evolved rapidly in a niche-specific fashion that is independent of phylogeny. To test this hypothesis we have compared the conservation of stress signalling molecules in diverse fungal species with their stress resistance. These fungi, which include ascomycetes, basidiomycetes and microsporidia, occupy highly divergent niches from saline environments to plant or mammalian hosts. Results The fungi displayed significant variation in their resistance to osmotic (NaCl and sorbitol, oxidative (H2O2 and menadione and cell wall stresses (Calcofluor White and Congo Red. There was no strict correlation between fungal phylogeny and stress resistance. Rather, the human pathogens tended to be more resistant to all three types of stress, an exception being the sensitivity of Candida albicans to the cell wall stress, Calcofluor White. In contrast, the plant pathogens were relatively sensitive to oxidative stress. The degree of conservation of osmotic, oxidative and cell wall stress signalling pathways amongst the eighteen fungal species was examined. Putative orthologues of functionally defined signalling components in Saccharomyces cerevisiae were identified by performing reciprocal BLASTP searches, and the percent amino acid identities of these orthologues recorded. This revealed that in general, central components of the osmotic, oxidative and cell wall stress signalling pathways are relatively well conserved, whereas the sensors lying upstream and transcriptional regulators lying downstream of these modules have diverged significantly. There was no obvious correlation between the degree of conservation of stress signalling pathways and the resistance of a particular fungus to the corresponding stress. Conclusion Our

  13. Phylogenetic diversity and biogeography of the Mamiellophyceae lineage of eukaryotic phytoplankton across the oceans.

    Science.gov (United States)

    Monier, Adam; Worden, Alexandra Z; Richards, Thomas A

    2016-08-01

    High-throughput diversity amplicon sequencing of marine microbial samples has revealed that members of the Mamiellophyceae lineage are successful phytoplankton in many oceanic habitats. Indeed, these eukaryotic green algae can dominate the picoplanktonic biomass, however, given the broad expanses of the oceans, their geographical distributions and the phylogenetic diversity of some groups remain poorly characterized. As these algae play a foundational role in marine food webs, it is crucial to assess their global distribution in order to better predict potential changes in abundance and community structure. To this end, we analyzed the V9-18S small subunit rDNA sequences deposited from the Tara Oceans expedition to evaluate the diversity and biogeography of these phytoplankton. Our results show that the phylogenetic composition of Mamiellophyceae communities is in part determined by geographical provenance, and do not appear to be influenced - in the samples recovered - by water depth, at least at the resolution possible with the V9-18S. Phylogenetic classification of Mamiellophyceae sequences revealed that the Dolichomastigales order encompasses more sequence diversity than other orders in this lineage. These results indicate that a large fraction of the Mamiellophyceae diversity has been hitherto overlooked, likely because of a combination of size fraction, sequencing and geographical limitations. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  14. Community phylogenetic diversity of cyanobacterial mats associated with geothermal springs along a tropical intertidal gradient.

    Science.gov (United States)

    Jing, Hongmei; Lacap, Donnabella C; Lau, Chui Yim; Pointing, Stephen B

    2006-04-01

    The 16S rRNA gene-defined bacterial diversity of tropical intertidal geothermal vents subject to varying degrees of seawater inundation was investigated. Shannon-Weaver diversity estimates of clone library-derived sequences revealed that the hottest pools located above the mean high-water mark that did not experience seawater inundation were most diverse, followed by those that were permanently submerged below the mean low-water mark. Pools located in the intertidal were the least biodiverse, and this is attributed to the fluctuating conditions caused by periodic seawater inundation rather than physicochemical conditions per se. Phylogenetic analysis revealed that a ubiquitous Oscillatoria-like phylotype accounted for 83% of clones. Synechococcus-like phylotypes were also encountered at each location, whilst others belonging to the Chroococcales, Oscillatoriales, and other non-phototrophic bacteria occurred only at specific locations along the gradient. All cyanobacterial phylotypes displayed highest phylogenetic affinity to terrestrial thermophilic counterparts rather than marine taxa.

  15. Microbial network, phylogenetic diversity and community membership in the active layer across a permafrost thaw gradient.

    Science.gov (United States)

    Mondav, Rhiannon; McCalley, Carmody K; Hodgkins, Suzanne B; Frolking, Steve; Saleska, Scott R; Rich, Virginia I; Chanton, Jeff P; Crill, Patrick M

    2017-08-01

    Biogenic production and release of methane (CH 4 ) from thawing permafrost has the potential to be a strong source of radiative forcing. We investigated changes in the active layer microbial community of three sites representative of distinct permafrost thaw stages at a palsa mire in northern Sweden. The palsa site (intact permafrost and low radiative forcing signature) had a phylogenetically clustered community dominated by Acidobacteria and Proteobacteria. The bog (thawing permafrost and low radiative forcing signature) had lower alpha diversity and midrange phylogenetic clustering, characteristic of ecosystem disturbance affecting habitat filtering. Hydrogenotrophic methanogens and Acidobacteria dominated the bog shifting from palsa-like to fen-like at the waterline. The fen (no underlying permafrost, high radiative forcing signature) had the highest alpha, beta and phylogenetic diversity, was dominated by Proteobacteria and Euryarchaeota and was significantly enriched in methanogens. The Mire microbial network was modular with module cores consisting of clusters of Acidobacteria, Euryarchaeota or Xanthomonodales. Loss of underlying permafrost with associated hydrological shifts correlated to changes in microbial composition, alpha, beta and phylogenetic diversity associated with a higher radiative forcing signature. These results support the complex role of microbial interactions in mediating carbon budget changes and climate feedback in response to climate forcing. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. A new support measure to quantify the impact of local optima in phylogenetic analyses.

    KAUST Repository

    Brammer, Grant; Sul, Seung-Jin; Williams, Tiffani L

    2011-01-01

    Phylogentic analyses are often incorrectly assumed to have stabilized to a single optimum. However, a set of trees from a phylogenetic analysis may contain multiple distinct local optima with each optimum providing different levels of support

  17. Trends over time in tree and seedling phylogenetic diversity indicate regional differences in forest biodiversity change.

    Science.gov (United States)

    Potter, Kevin M; Woodall, Christopher W

    2012-03-01

    Changing climate conditions may impact the short-term ability of forest tree species to regenerate in many locations. In the longer term, tree species may be unable to persist in some locations while they become established in new places. Over both time frames, forest tree biodiversity may change in unexpected ways. Using repeated inventory measurements five years apart from more than 7000 forested plots in the eastern United States, we tested three hypotheses: phylogenetic diversity is substantially different from species richness as a measure of biodiversity; forest communities have undergone recent changes in phylogenetic diversity that differ by size class, region, and seed dispersal strategy; and these patterns are consistent with expected early effects of climate change. Specifically, the magnitude of diversity change across broad regions should be greater among seedlings than in trees, should be associated with latitude and elevation, and should be greater among species with high dispersal capacity. Our analyses demonstrated that phylogenetic diversity and species richness are decoupled at small and medium scales and are imperfectly associated at large scales. This suggests that it is appropriate to apply indicators of biodiversity change based on phylogenetic diversity, which account for evolutionary relationships among species and may better represent community functional diversity. Our results also detected broadscale patterns of forest biodiversity change that are consistent with expected early effects of climate change. First, the statistically significant increase over time in seedling diversity in the South suggests that conditions there have become more favorable for the reproduction and dispersal of a wider variety of species, whereas the significant decrease in northern seedling diversity indicates that northern conditions have become less favorable. Second, we found weak correlations between seedling diversity change and latitude in both zones

  18. Phylogenetic and Diversity Analysis of Dactylis glomerata Subspecies Using SSR and IT-ISJ Markers.

    Science.gov (United States)

    Yan, Defei; Zhao, Xinxin; Cheng, Yajuan; Ma, Xiao; Huang, Linkai; Zhang, Xinquan

    2016-10-31

    The genus Dactylis , an important forage crop, has a wide geographical distribution in temperate regions. While this genus is thought to include a single species, Dactylis glomerata , this species encompasses many subspecies whose relationships have not been fully characterized. In this study, the genetic diversity and phylogenetic relationships of nine representative Dactylis subspecies were examined using SSR and IT-ISJ markers. In total, 21 pairs of SSR primers and 15 pairs of IT-ISJ primers were used to amplify 295 polymorphic bands with polymorphic rates of 100%. The average polymorphic information contents (PICs) of SSR and IT-ISJ markers were 0.909 and 0.780, respectively. The combined data of the two markers indicated a high level of genetic diversity among the nine D. glomerata subspecies, with a Nei's gene diversity index value of 0.283 and Shannon's diversity of 0.448. Preliminarily phylogenetic analysis results revealed that the 20 accessions could be divided into three groups (A, B, C). Furthermore, they could be divided into five clusters, which is similar to the structure analysis with K = 5. Phylogenetic placement in these three groups may be related to the distribution ranges and the climate types of the subspecies in each group. Group A contained eight accessions of four subspecies, originating from the west Mediterranean, while Group B contained seven accessions of three subspecies, originating from the east Mediterranean.

  19. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Directory of Open Access Journals (Sweden)

    David Lee Erickson

    2014-11-01

    Full Text Available Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1,347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK and psbA-trnH and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance metrics that are commonly used to infer assembly processes were estimated for each plot (Phylogenetic Distance [PD], Mean Phylogenetic Distance [MPD], and Mean Nearest Taxon Distance [MNTD]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for

  20. Phylogenetic analysis of local-scale tree soil associations in a lowland moist tropical forest.

    Directory of Open Access Journals (Sweden)

    Laura A Schreeg

    Full Text Available BACKGROUND: Local plant-soil associations are commonly studied at the species-level, while associations at the level of nodes within a phylogeny have been less well explored. Understanding associations within a phylogenetic context, however, can improve our ability to make predictions across systems and can advance our understanding of the role of evolutionary history in structuring communities. METHODOLOGY/PRINCIPAL FINDINGS: Here we quantified evolutionary signal in plant-soil associations using a DNA sequence-based community phylogeny and several soil variables (e.g., extractable phosphorus, aluminum and manganese, pH, and slope as a proxy for soil water. We used published plant distributional data from the 50-ha plot on Barro Colorado Island (BCI, Republic of Panamá. Our results suggest some groups of closely related species do share similar soil associations. Most notably, the node shared by Myrtaceae and Vochysiaceae was associated with high levels of aluminum, a potentially toxic element. The node shared by Apocynaceae was associated with high extractable phosphorus, a nutrient that could be limiting on a taxon specific level. The node shared by the large group of Laurales and Magnoliales was associated with both low extractable phosphorus and with steeper slope. Despite significant node-specific associations, this study detected little to no phylogeny-wide signal. We consider the majority of the 'traits' (i.e., soil variables evaluated to fall within the category of ecological traits. We suggest that, given this category of traits, phylogeny-wide signal might not be expected while node-specific signals can still indicate phylogenetic structure with respect to the variable of interest. CONCLUSIONS: Within the BCI forest dynamics plot, distributions of some plant taxa are associated with local-scale differences in soil variables when evaluated at individual nodes within the phylogenetic tree, but they are not detectable by phylogeny

  1. Phylogenetic congruence of lichenised fungi and algae is affected by spatial scale and taxonomic diversity

    Directory of Open Access Journals (Sweden)

    Hannah L. Buckley

    2014-09-01

    Full Text Available The role of species’ interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran’s eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners’ genetic variation. Different lichen taxa showed some variation in

  2. Phylogenetic congruence of lichenised fungi and algae is affected by spatial scale and taxonomic diversity.

    Science.gov (United States)

    Buckley, Hannah L; Rafat, Arash; Ridden, Johnathon D; Cruickshank, Robert H; Ridgway, Hayley J; Paterson, Adrian M

    2014-01-01

    The role of species' interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran's eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners' genetic variation. Different lichen taxa showed some variation in their phylogenetic congruence

  3. Evolution of species diversity in the genus Chamaecostus (Costaceae): molecular phylogenetics and morphometric approaches

    OpenAIRE

    Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania

    2015-01-01

    While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...

  4. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Science.gov (United States)

    Erickson, David L.; Jones, Frank A.; Swenson, Nathan G.; Pei, Nancai; Bourg, Norman A.; Chen, Wenna; Davies, Stuart J.; Ge, Xue-jun; Hao, Zhanqing; Howe, Robert W.; Huang, Chun-Lin; Larson, Andrew J.; Lum, Shawn K. Y.; Lutz, James A.; Ma, Keping; Meegaskumbura, Madhava; Mi, Xiangcheng; Parker, John D.; Fang-Sun, I.; Wright, S. Joseph; Wolf, Amy T.; Ye, W.; Xing, Dingliang; Zimmerman, Jess K.; Kress, W. John

    2014-01-01

    Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK, and psbA-trnH) and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance (PD) metrics that are commonly used to infer assembly processes were estimated for each plot [PD, Mean Phylogenetic Distance (MPD), and Mean Nearest Taxon Distance (MNTD)]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for individual plots, estimates of

  5. Ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses.

    Science.gov (United States)

    Fouquier, Jennifer; Rideout, Jai Ram; Bolyen, Evan; Chase, John; Shiffer, Arron; McDonald, Daniel; Knight, Rob; Caporaso, J Gregory; Kelley, Scott T

    2016-02-24

    Fungi play critical roles in many ecosystems, cause serious diseases in plants and animals, and pose significant threats to human health and structural integrity problems in built environments. While most fungal diversity remains unknown, the development of PCR primers for the internal transcribed spacer (ITS) combined with next-generation sequencing has substantially improved our ability to profile fungal microbial diversity. Although the high sequence variability in the ITS region facilitates more accurate species identification, it also makes multiple sequence alignment and phylogenetic analysis unreliable across evolutionarily distant fungi because the sequences are hard to align accurately. To address this issue, we created ghost-tree, a bioinformatics tool that integrates sequence data from two genetic markers into a single phylogenetic tree that can be used for diversity analyses. Our approach starts with a "foundation" phylogeny based on one genetic marker whose sequences can be aligned across organisms spanning divergent taxonomic groups (e.g., fungal families). Then, "extension" phylogenies are built for more closely related organisms (e.g., fungal species or strains) using a second more rapidly evolving genetic marker. These smaller phylogenies are then grafted onto the foundation tree by mapping taxonomic names such that each corresponding foundation-tree tip would branch into its new "extension tree" child. We applied ghost-tree to graft fungal extension phylogenies derived from ITS sequences onto a foundation phylogeny derived from fungal 18S sequences. Our analysis of simulated and real fungal ITS data sets found that phylogenetic distances between fungal communities computed using ghost-tree phylogenies explained significantly more variance than non-phylogenetic distances. The phylogenetic metrics also improved our ability to distinguish small differences (effect sizes) between microbial communities, though results were similar to non-phylogenetic

  6. Elevational gradients in phylogenetic structure of ant communities reveal the interplay of biotic and abiotic constraints on diversity

    DEFF Research Database (Denmark)

    Machac, Antonin; Janda, Milan; Dunn, Robert R.

    2011-01-01

    A central focus of ecology and biogeography is to determine the factors that govern spatial variation in biodiversity. Here, we examined patterns of ant diversity along climatic gradients in three temperate montane systems: Great Smoky Mountains National Park (USA), Chiricahua Mountains (USA......), and Vorarlberg (Austria). To identify the factors which potentially shape these elevational diversity gradients, we analyzed patterns of community phylogenetic structure (i.e. the evolutionary relationships among species coexisting in local communities). We found that species at low-elevation sites tended...... to be evenly dispersed across phylogeny, suggesting that these communities are structured by interspecific competition. In contrast, species occurring at high-elevation sites tended to be more closely related than expected by chance, implying that these communities are structured primarily by environmental...

  7. Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology

    DEFF Research Database (Denmark)

    Hansen, K.; Læssøe, Thomas; Pfister, D.H.

    2002-01-01

    Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....

  8. AST: an automated sequence-sampling method for improving the taxonomic diversity of gene phylogenetic trees.

    Science.gov (United States)

    Zhou, Chan; Mao, Fenglou; Yin, Yanbin; Huang, Jinling; Gogarten, Johann Peter; Xu, Ying

    2014-01-01

    A challenge in phylogenetic inference of gene trees is how to properly sample a large pool of homologous sequences to derive a good representative subset of sequences. Such a need arises in various applications, e.g. when (1) accuracy-oriented phylogenetic reconstruction methods may not be able to deal with a large pool of sequences due to their high demand in computing resources; (2) applications analyzing a collection of gene trees may prefer to use trees with fewer operational taxonomic units (OTUs), for instance for the detection of horizontal gene transfer events by identifying phylogenetic conflicts; and (3) the pool of available sequences is biased towards extensively studied species. In the past, the creation of subsamples often relied on manual selection. Here we present an Automated sequence-Sampling method for improving the Taxonomic diversity of gene phylogenetic trees, AST, to obtain representative sequences that maximize the taxonomic diversity of the sampled sequences. To demonstrate the effectiveness of AST, we have tested it to solve four problems, namely, inference of the evolutionary histories of the small ribosomal subunit protein S5 of E. coli, 16 S ribosomal RNAs and glycosyl-transferase gene family 8, and a study of ancient horizontal gene transfers from bacteria to plants. Our results show that the resolution of our computational results is almost as good as that of manual inference by domain experts, hence making the tool generally useful to phylogenetic studies by non-phylogeny specialists. The program is available at http://csbl.bmb.uga.edu/~zhouchan/AST.php.

  9. Phylogenetic diversity does not capture body size variation at risk in the world's mammals

    DEFF Research Database (Denmark)

    Fritz, Susanne A; Purvis, Andy

    2010-01-01

    Mammals contribute to important ecosystem processes and services, but many mammalian species are threatened with extinction. We compare how global patterns in three measures of mammalian diversity--species richness, phylogenetic diversity (PD) and body mass variance (BMV)--would change if all...... currently threatened species were lost. Given that many facets of species' ecology and life history scale predictably with body mass, the BMV in a region roughly reflects the diversity of species' roles within ecosystems and so is a simple proxy for functional diversity (FD). PD is also often considered...... more BMV than under random extinction, while only 11 per cent would lose significantly more PD. Ecosystem consequences of these selective losses may be profound, especially throughout the tropics, but are not captured by PD. This low surrogacy stresses a need for conservation prioritization based...

  10. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  11. The Cladistic Basis for the Phylogenetic Diversity (PD Measure Links Evolutionary Features to Environmental Gradients and Supports Broad Applications of Microbial Ecology’s “Phylogenetic Beta Diversity” Framework

    Directory of Open Access Journals (Sweden)

    Rob Knight

    2009-11-01

    Full Text Available The PD measure of phylogenetic diversity interprets branch lengths cladistically to make inferences about feature diversity. PD calculations extend conventional specieslevel ecological indices to the features level. The “phylogenetic beta diversity” framework developed by microbial ecologists calculates PD-dissimilarities between community localities. Interpretation of these PD-dissimilarities at the feature level explains the framework’s success in producing ordinations revealing environmental gradients. An example gradients space using PD-dissimilarities illustrates how evolutionary features form unimodal response patterns to gradients. This features model supports new application of existing species-level methods that are robust to unimodal responses, plus novel applications relating to climate change, commercial products discovery, and community assembly.

  12. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  13. Biodiversity assessment among two Nebraska prairies: a comparison between traditional and phylogenetic diversity indices.

    Science.gov (United States)

    Aust, Shelly K; Ahrendsen, Dakota L; Kellar, P Roxanne

    2015-01-01

    Conservation of the evolutionary diversity among organisms should be included in the selection of priority regions for preservation of Earth's biodiversity. Traditionally, biodiversity has been determined from an assessment of species richness (S), abundance, evenness, rarity, etc. of organisms but not from variation in species' evolutionary histories. Phylogenetic diversity (PD) measures evolutionary differences between taxa in a community and is gaining acceptance as a biodiversity assessment tool. However, with the increase in the number of ways to calculate PD, end-users and decision-makers are left wondering how metrics compare and what data are needed to calculate various metrics. In this study, we used massively parallel sequencing to generate over 65,000 DNA characters from three cellular compartments for over 60 species in the asterid clade of flowering plants. We estimated asterid phylogenies from character datasets of varying nucleotide quantities, and then assessed the effect of varying character datasets on resulting PD metric values. We also compared multiple PD metrics with traditional diversity indices (including S) among two endangered grassland prairies in Nebraska (U.S.A.). Our results revealed that PD metrics varied based on the quantity of genes used to infer the phylogenies; therefore, when comparing PD metrics between sites, it is vital to use comparable datasets. Additionally, various PD metrics and traditional diversity indices characterize biodiversity differently and should be chosen depending on the research question. Our study provides empirical results that reveal the value of measuring PD when considering sites for conservation, and it highlights the usefulness of using PD metrics in combination with other diversity indices when studying community assembly and ecosystem functioning. Ours is just one example of the types of investigations that need to be conducted across the tree of life and across varying ecosystems in order to build

  14. Factors shaping bacterial phylogenetic and functional diversity in coastal waters of the NW Mediterranean Sea

    Science.gov (United States)

    Boras, Julia A.; Vaqué, Dolors; Maynou, Francesc; Sà, Elisabet L.; Weinbauer, Markus G.; Sala, Maria Montserrat

    2015-03-01

    To evaluate the main factors shaping bacterioplankton phylogenetic and functional diversity in marine coastal waters, we carried out a two-year study based on a monthly sampling in Blanes Bay (NW Mediterranean). We expected the key factors driving bacterial diversity to be (1) temperature and nutrient concentration, together with chlorophyll a concentration as an indicator of phytoplankton biomass and, hence, a carbon source for bacteria (here called bottom-up factors), and (2) top-down pressure (virus- and protist-mediated mortality of bacteria). Phylogenetic diversity was analyzed by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA. Functional diversity was assessed by using monomeric carbon sources in Biolog EcoPlates and by determining the activity of six extracellular enzymes. Our results indicate that the bacterial phylogenetic and functional diversity in this coastal system is shaped mainly by bottom-up factors. A dendrogram analysis of the DGGE banding patterns revealed three main sample clusters. Two clusters differed significantly in temperature, nitrate and chlorophyll a concentration, and the third was characterized by the highest losses of bacterial production due to viral lysis detected over the whole study period. Protistan grazing had no effect on bacterial functional diversity, since there were no correlations between protist-mediated mortality (PMM) and extracellular enzyme activities, and utilization of only two out of the 31 carbon sources (N-acetyl-D-glucosamine and α-cyclodextrin) was correlated with PMM. In contrast, virus-mediated mortality correlated with changes in the percentage of use of four carbon sources, and also with specific leu-aminopeptidase and β-glucosidase activity. This suggests that viral lysate provides a pool of labile carbon sources, presumably including amino acids and glucose, which may inhibit proteolytic and glucosidic activity. Our results indicate that bottom-up factors play a more important role than

  15. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  16. Environmental quality of a stream can be better predicted by phylogenetic than by taxonomic diversity

    Directory of Open Access Journals (Sweden)

    Koperski Paweł

    2017-01-01

    Full Text Available Different indices of taxonomic diversity (TD and phylogenetic diversity (PD of the macrobenthos were compared to determine the efficient predictors of environmental quality (EQ in different types of watercourses in Poland. Archived data of 864 samples of benthic invertebrates identified to the family level were analysed on the basis of linear and non-linear multiply regression. The strengths of the correlations between two measures of EQ:BMWPpl (British Monitoring Working Party score system, Polish modification and MMI (Multimetric Macroinvertebrate Index and the values of taxonomic richness and three well-known TD indices: Shannon, Margalef and J' Evenness were compared to those for values of three PD indices, based on taxonomic distinctness. Taxonomic richness and all PD indices correlated more strongly with both measures of EQ than all TD indices. Correlations with both types of diversity indices were visibly stronger for BMWPpl when compared with MMI. We suggest that analysed indices of PD, especially MDis (mean phylogenetic distance between families in a sample, are related with EQ strongly enough to be taken into account as potential metrics in selection procedures of biological assessment.

  17. Structure and phylogenetic diversity of post-fire ectomycorrhizal communities of maritime pine.

    Science.gov (United States)

    Rincón, A; Santamaría, B P; Ocaña, L; Verdú, M

    2014-02-01

    Environmental disturbances define the diversity and assemblage of species, affecting the functioning of ecosystems. Fire is a major disturbance of Mediterranean pine forests. Pines are highly dependent on the ectomycorrhizal (EM) fungal symbiosis, which is critical for tree recruitment under primary succession. To determine the effects of time since fire on the structure and recovery of EM fungal communities, we surveyed the young Pinus pinaster regenerate in three sites differing in the elapsed time after the last fire event. Pine roots were collected, and EM fungi characterized by sequencing the internal transcribed spacer (ITS) and the large subunit (LSU) regions of the nuclear ribosomal (nr)-DNA. The effects of the elapsed time after fire on the EM community structure (richness, presence/absence of fungi, phylogenetic diversity) and on soil properties were analysed.Fungal richness decreased with the elapsed time since the fire; although, the phylogenetic diversity of the EM community increased. Soil properties were different depending on the elapsed time after fire and particularly, the organic matter, carbon-to-nitrogen (C/N) ratio, nitrogen and iron significantly correlated with the assemblage of fungal species. Ascomycetes, particularly Tuberaceae and Pezizales, were significantly over-represented on saplings in the burned site. On seedlings, a significant over-representation of Rhizopogonaceae and Atheliaceae was observed in the most recently burned site, while other fungi (i.e. Cortinariaceae) were significantly under-represented. Our results are consistent with the hypothesis that fire can act as a selective agent by printing a phylogenetic signal on the EM fungal communities associated with naturally regenerated pines, pointing out to some groups as potential fire-adapted fungi.

  18. The Role of the Phylogenetic Diversity Measure, PD, in Bio-informatics: Getting the Definition Right

    Directory of Open Access Journals (Sweden)

    Daniel P. Faith

    2006-01-01

    Full Text Available A recent paper in this journal (Faith and Baker, 2006 described bio-informatics challenges in the application of the PD (phylogenetic diversity measure of Faith (1992a, and highlighted the use of the root of the phylogenetic tree, as implied by the original definition of PD. A response paper (Crozier et al. 2006 stated that 1 the (Faith, 1992a PD definition did not include the use of the root of the tree, and 2 Moritz and Faith (1998 changed the PD definition to include the root. Both characterizations are here refuted. Examples from Faith (1992a,b document the link from the definition to the use of the root of the overall tree, and a survey of papers over the past 15 years by Faith and colleagues demonstrate that the stated PD definition has remained the same as that in the original 1992 study. PD’s estimation of biodiversity at the level of “feature diversity” is seen to have provided the original rationale for the measure’s consideration of the root of the phylogenetic tree.

  19. Diversity Dynamics in Nymphalidae Butterflies: Effect of Phylogenetic Uncertainty on Diversification Rate Shift Estimates

    Science.gov (United States)

    Peña, Carlos; Espeland, Marianne

    2015-01-01

    The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC) is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE) and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution. PMID:25830910

  20. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  1. Phylogenetic analysis of New Zealand earthworms (Oligochaeta: Megascolecidae) reveals ancient clades and cryptic taxonomic diversity.

    Science.gov (United States)

    Buckley, Thomas R; James, Sam; Allwood, Julia; Bartlam, Scott; Howitt, Robyn; Prada, Diana

    2011-01-01

    We have constructed the first ever phylogeny for the New Zealand earthworm fauna (Megascolecinae and Acanthodrilinae) including representatives from other major continental regions. Bayesian and maximum likelihood phylogenetic trees were constructed from 427 base pairs from the mitochondrial large subunit (16S) rRNA gene and 661 base pairs from the nuclear large subunit (28S) rRNA gene. Within the Acanthodrilinae we were able to identify a number of well-supported clades that were restricted to continental landmasses. Estimates of nodal support for these major clades were generally high, but relationships among clades were poorly resolved. The phylogenetic analyses revealed several independent lineages in New Zealand, some of which had a comparable phylogenetic depth to monophyletic groups sampled from Madagascar, Africa, North America and Australia. These results are consistent with at least some of these clades having inhabited New Zealand since rifting from Gondwana in the Late Cretaceous. Within the New Zealand Acanthodrilinae, major clades tended to be restricted to specific regions of New Zealand, with the central North Island and Cook Strait representing major biogeographic boundaries. Our field surveys of New Zealand and subsequent identification has also revealed extensive cryptic taxonomic diversity with approximately 48 new species sampled in addition to the 199 species recognized by previous authors. Our results indicate that further survey and taxonomic work is required to establish a foundation for future biogeographic and ecological research on this vitally important component of the New Zealand biota. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. Diversity dynamics in Nymphalidae butterflies: effect of phylogenetic uncertainty on diversification rate shift estimates.

    Directory of Open Access Journals (Sweden)

    Carlos Peña

    Full Text Available The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution.

  3. [Phylogenetic diversity of microorganisms associated with the deep-water sponge Baikalospongia intermedia].

    Science.gov (United States)

    Kalyzhnaya, O V; Itskovich, V B

    2014-07-01

    The diversity of bacteria associated with deep-water sponge Baikalospongia intermedia was evaluated by sequence analysis of 16S rRNA genes from two sponge samples collected in Lake Baikal from depths of 550 and 1204 m. A total of 64 operational taxonomic units, belonging to nine bacterial phyla, Proteobacteria (classes Alphaproteobacteria,. Betaproteobacteria, Gammaproteobacteria, and Deltaproteobacteria), Actinobacteria, Planctomycetes, Cloroflexi, Verrucomicrobia, Acidobacteria, Chlorobi, and Nitrospirae, including candidate phylum WS5, were identified. Phylogenetic analysis showed that the examined communities contained phylotypes exhibiting homology to uncultured bacteria from different lake ecosystems, freshwater sediments, soil and geological formations. Moreover, a number of phylotypes were relative to psychrophilic, methane-oxidizing, sulfate-reducing bacteria, and to microorganisms resistant to the influence of heavy metals. It seems likely that the unusual habitation conditions of deep-water sponges contribute to the taxonomic diversity of associated bacteria and have an influence on the presence of functionally important microorganisms in bacterial communities.

  4. Phylogenetic niche conservatism explains an inverse latitudinal diversity gradient in freshwater arthropods

    Science.gov (United States)

    Morinière, Jérôme; van Dam, Matthew H.; Hawlitschek, Oliver; Bergsten, Johannes; Michat, Mariano C.; Hendrich, Lars; Ribera, Ignacio; Toussaint, Emmanuel F. A.; Balke, Michael

    2016-05-01

    The underlying mechanisms responsible for the general increase in species richness from temperate regions to the tropics remain equivocal. Many hypotheses have been proposed to explain this astonishing pattern but additional empirical studies are needed to shed light on the drivers at work. Here we reconstruct the evolutionary history of the cosmopolitan diving beetle subfamily Colymbetinae, the majority of which are found in the Northern hemisphere, hence exhibiting an inversed latitudinal diversity gradient. We reconstructed a dated phylogeny using 12 genes, to investigate the biogeographical history and diversification dynamics in the Colymbetinae. We aimed to identify the role that phylogenetic niche conservatism plays in the inversed diversification pattern seen in this group. Our results suggest that Colymbetinae originated in temperate climates, which supports the hypothesis that their distribution is the result of an ancestral adaptation to temperate environmental conditions rather than tropical origins, and that temperate niche conservatism can generate and/or maintain inverse latitudinal diversity gradients.

  5. Phylogenetic diversity and biological activity of culturable Actinobacteria isolated from freshwater fish gut microbiota.

    Science.gov (United States)

    Jami, Mansooreh; Ghanbari, Mahdi; Kneifel, Wolfgang; Domig, Konrad J

    2015-06-01

    The diversity of Actinobacteria isolated from the gut microbiota of two freshwater fish species namely Schizothorax zarudnyi and Schizocypris altidorsalis was investigated employing classical cultivation techniques, repetitive sequence-based PCR (rep-PCR), partial and full 16S rDNA sequencing followed by phylogenetic analysis. A total of 277 isolates were cultured by applying three different agar media. Based on rep-PCR profile analysis a subset of 33 strains was selected for further phylogenetic investigations, antimicrobial activity testing and diversity analysis of secondary-metabolite biosynthetic genes. The identification based on 16S rRNA gene sequencing revealed that the isolates belong to eight genera distributed among six families. At the family level, 72% of the 277 isolates belong to the family Streptomycetaceae. Among the non-streptomycetes group, the most dominant group could be allocated to the family of Pseudonocardiaceae followed by the members of Micromonosporaceae. Phylogenetic analysis clearly showed that many of the isolates in the genera Streptomyces, Saccharomonospora, Micromonospora, Nocardiopsis, Arthrobacter, Kocuria, Microbacterium and Agromyces formed a single and distinct cluster with the type strains. Notably, there is no report so far about the occurrence of these Actinobacteria in the microbiota of freshwater fish. Of the 33 isolates, all the strains exhibited antibacterial activity against a set of tested human and fish pathogenic bacteria. Then, to study their associated potential capacity to synthesize diverse bioactive natural products, diversity of genes associated with secondary-metabolite biosynthesis including PKS I, PKS II, NRPS, the enzyme PhzE of the phenazine pathways, the enzyme dTGD of 6-deoxyhexoses glycosylation pathway, the enzyme Halo of halogenation pathway and the enzyme CYP in polyene polyketide biosynthesis were investigated among the isolates. All the strains possess at least two types of the investigated

  6. Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

    Science.gov (United States)

    Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

    2004-01-01

    We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

  7. Exploring the determinants of phylogenetic diversity and assemblage structure in conifers across temporal, spatial, and taxonomic scales

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Borchsenius, Finn; Sandel, Brody Steven

    -environmental models are important elements in this framework. Here, we integrate both types of data in order to explore the determinants of forest tree diversity using the conifers as a model group. Conifers are an old, diverse (ca. 650 spp. in 6 families) and widespread group of woody plants of high ecological...... and economic importance. They are better studied than most other globally distributed groups of forest trees, allowing integrative studies with high phylogenetic and spatial resolution. We analyse phylogenetic diversity, assemblage structure, and diversification rates for regional conifer assemblages...

  8. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008.

    Science.gov (United States)

    Choi, Seon Young; Rashed, Shah M; Hasan, Nur A; Alam, Munirul; Islam, Tarequl; Sadique, Abdus; Johura, Fatema-Tuz; Eppinger, Mark; Ravel, Jacques; Huq, Anwar; Cravioto, Alejandro; Colwell, Rita R

    2016-03-15

    An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997). Nontoxigenic (CTX(-)) V. cholerae El Tor dominated toxigenic (CTX(+)) strains (2001 to 2003), but V. cholerae CTX(+) variant El Tor was isolated during 2004 to 2008, outcompeting CTX(-) V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX(+) El Tor, two were CTX(-) El Tor, and the remaining strain was a CTX(+) classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX(-) isolate is ancestral to the 6th and 7th pandemic CTX(+) V. cholerae isolates. The other CTX(-) isolate joined with CTX(-) non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX(+) isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX(+) El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II) are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX(+) El Tor isolate contained West African-South American (WASA) recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs) and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity. Sequencing of genomes of V. cholerae is critical if genetic changes occurring over time in the circulating population of an area of endemicity are to be understood. Although cholera outbreaks occurred rarely

  9. Phylogenetic and structural diversity in the feline leukemia virus env gene.

    Directory of Open Access Journals (Sweden)

    Shinya Watanabe

    Full Text Available Feline leukemia virus (FeLV belongs to the genus Gammaretrovirus, and causes a variety of neoplastic and non-neoplastic diseases in cats. Alteration of viral env sequences is thought to be associated with disease specificity, but the way in which genetic diversity of FeLV contributes to the generation of such variants in nature is poorly understood. We isolated FeLV env genes from naturally infected cats in Japan and analyzed the evolutionary dynamics of these genes. Phylogenetic reconstructions separated our FeLV samples into three distinct genetic clusters, termed Genotypes I, II, and III. Genotype I is a major genetic cluster and can be further classified into Clades 1-7 in Japan. Genotypes were correlated with geographical distribution; Genotypes I and II were distributed within Japan, whilst FeLV samples from outside Japan belonged to Genotype III. These results may be due to geographical isolation of FeLVs in Japan. The observed structural diversity of the FeLV env gene appears to be caused primarily by mutation, deletion, insertion and recombination, and these variants may be generated de novo in individual cats. FeLV interference assay revealed that FeLV genotypes did not correlate with known FeLV receptor subgroups. We have identified the genotypes which we consider to be reliable for evaluating phylogenetic relationships of FeLV, which embrace the high structural diversity observed in our sample. Overall, these findings extend our understanding of Gammaretrovirus evolutionary patterns in the field, and may provide a useful basis for assessing the emergence of novel strains and understanding the molecular mechanisms of FeLV transmission in cats.

  10. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Science.gov (United States)

    Howard, Marion G; McDonald, William J F; Forster, Paul I; Kress, W John; Erickson, David; Faith, Daniel P; Shapcott, Alison

    2016-01-01

    Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ), Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD) measures as well as species richness (SR) for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD). Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness and higher than

  11. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Directory of Open Access Journals (Sweden)

    Marion G Howard

    Full Text Available Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ, Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD measures as well as species richness (SR for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD. Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness

  12. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008

    Directory of Open Access Journals (Sweden)

    Seon Young Choi

    2016-03-01

    Full Text Available An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997. Nontoxigenic (CTX− V. cholerae El Tor dominated toxigenic (CTX+ strains (2001 to 2003, but V. cholerae CTX+ variant El Tor was isolated during 2004 to 2008, outcompeting CTX−V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX+ El Tor, two were CTX− El Tor, and the remaining strain was a CTX+ classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX− isolate is ancestral to the 6th and 7th pandemic CTX+V. cholerae isolates. The other CTX− isolate joined with CTX− non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX+ isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX+ El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX+ El Tor isolate contained West African-South American (WASA recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity.

  13. Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia.

    Science.gov (United States)

    Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D

    2011-12-01

    Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.

  14. Diversity of heavy metal resistant bacteria from Kalimas Surabaya: A phylogenetic taxonomy approach

    Science.gov (United States)

    Zulaika, Enny; Utomo, Andry Prio; Prima, Adisya; Alami, Nur Hidayatul; Kuswytasari, Nengah Dwianita; Shovitri, Maya; Sembiring, Langkah

    2017-06-01

    Bacterial resistance to heavy metal is a genetic and physiological adaptation to the environment which contaminated by heavy metal. Kalimas is an important river in Surabaya that is contaminated by some heavy metals and probably as a habitat for heavy metal resistance bacteria. Bacterial resistance to heavy metals are different for each species, and their diversity can be studied by phylogenetic taxonomy approach. Isolates screening was done using nutrient agar which contained 1 mg/L HgCl2, CdCl2 and K2Cr2O7. Bacterial viability were observed by nutrient broth which contained 10 mg/L HgCl2, 30 mg/L CdCl2 and 50 mg/L K2Cr2O7. Isolates that resistant to heavy metal and viable after exposure to heavy metal were identified using 16S rRNA gene marker by Polymerase Chain Reaction (PCR). Phylogenetic tree reconstruction was done by the neighbor-joining algorithm. Genetic assignment showed isolates that resist and viable after exposure of Hg, Cd and Cr are Bacillus S1, SS19 and DA11. Based on BLAST analysis from NCBI gene bank, 16S rRNA sequences, those isolates were similar with the member of Bacillus cereus. Depend on 16S rRNA nucleotide alignment by the neighbor-joining algorithm, Bacillus S1, SS19 and DA11 were belong to Bacillus cereus sensu-lato group.

  15. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Science.gov (United States)

    Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633

  16. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities.

    Science.gov (United States)

    Amend, Anthony S; Matulich, Kristin L; Martiny, Jennifer B H

    2015-01-01

    Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity (PD). This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between PD and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial PD, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of 66 days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial PD failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which PD predicts ecosystem function will depend on environmental context.

  17. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Directory of Open Access Journals (Sweden)

    Marisa Skaljac

    2017-10-01

    Full Text Available Bemisia tabaci (Gennadius, Trialeurodes vaporariorum (Westwood, and Siphoninus phillyreae (Haliday are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia, which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.

  18. Phylogenetic insights into the diversity of homocytous cyanobacteria from Amazonian rivers.

    Science.gov (United States)

    Genuário, Diego Bonaldo; Vaz, Marcelo Gomes Marçal Vieira; Melo, Itamar Soares de

    2017-11-01

    The Amazon Rainforest holds great tropical biodiversity, mainly because of its favourable climatic conditions. The high temperatures, luminosity and humidity coupled with the nutritional simplicity of cyanobacteria allow undiscovered diversity to flourish within this group of microorganisms. Some efforts to reveal this diversity have been attempted; however, most were focused on the microscopic observation of environmental samples without any genetic information. Very few studies focusing on morphological, ecological and molecular criteria have been conducted, and none have been devoted to homocytous cyanobacteria forms in Amazonia region. Therefore, the genetic relationships amongst strains retrieved from this ecosystem with regard to other environments from Brazil and the world have not been tested and, consequently, the Amazonian strains would naturally be assumed as novel to science. To examine these relationships, cultured homocytous cyanobacteria isolated from two Amazonian rivers (Amazonas and Solimões) were evaluated using a phylogenetic perspective, considering the 16S rRNA gene sequence. A total of eleven homocytous cyanobacterial strains were isolated. Morphologically, they were identified as Pseudanabaena, Leptolyngbya, Planktothrix and Phormidium, but genetically they were included in the typical clusters of Planktothrix, Pseudanabaena, Cephalothrix, Pantanalinema and Alkalinema. These three latter genera have been detected in other Brazilian ecosystems only (Pantanal, Atlantic Rainforest and Pampa), while those remaining have been extensively found in many parts of the world. The data provided here indicate that Amazonian rivers support a homocytous cyanobacterial diversity previously reported from other geographical and ecological environments. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. High frequency of phylogenetically diverse reductive dehalogenase-homologous genes in deep subseafloor sedimentary metagenomes

    Directory of Open Access Journals (Sweden)

    Mikihiko eKawai

    2014-03-01

    Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.

  20. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  1. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  2. Phylogenetic analysis in Myrcia section Aulomyrcia and inferences on plant diversity in the Atlantic rainforest.

    Science.gov (United States)

    Staggemeier, Vanessa Graziele; Diniz-Filho, José Alexandre Felizola; Forest, Félix; Lucas, Eve

    2015-04-01

    Myrcia section Aulomyrcia includes ∼120 species that are endemic to the Neotropics and disjunctly distributed in the moist Amazon and Atlantic coastal forests of Brazil. This paper presents the first comprehensive phylogenetic study of this group and this phylogeny is used as a basis to evaluate recent classification systems and to test alternative hypotheses associated with the history of this clade. Fifty-three taxa were sampled out of the 120 species currently recognized, plus 40 outgroup taxa, for one nuclear marker (ribosomal internal transcribed spacer) and four plastid markers (psbA-trnH, trnL-trnF, trnQ-rpS16 and ndhF). The relationships were reconstructed based on Bayesian and maximum likelihood analyses. Additionally, a likelihood approach, 'geographic state speciation and extinction', was used to estimate region- dependent rates of speciation, extinction and dispersal, comparing historically climatic stable areas (refugia) and unstable areas. Maximum likelihood and Bayesian inferences indicate that Myrcia and Marlierea are polyphyletic, and the internal groupings recovered are characterized by combinations of morphological characters. Phylogenetic relationships support a link between Amazonian and north-eastern species and between north-eastern and south-eastern species. Lower extinction rates within glacial refugia suggest that these areas were important in maintaining diversity in the Atlantic forest biodiversity hotspot. This study provides a robust phylogenetic framework to address important ecological questions for Myrcia s.l. within an evolutionary context, and supports the need to unite taxonomically the two traditional genera Myrcia and Marlierea in an expanded Myrcia s.l. Furthermore, this study offers valuable insights into the diversification of plant species in the highly impacted Atlantic forest of South America; evidence is presented that the lowest extinction rates are found inside refugia and that range expansion from unstable areas

  3. Phylogenetic diversity and ecological pattern of ammonia-oxidizing archaea in the surface sediments of the western Pacific.

    Science.gov (United States)

    Cao, Huiluo; Hong, Yiguo; Li, Meng; Gu, Ji-Dong

    2011-11-01

    The phylogenetic diversity of ammonia-oxidizing archaea (AOA) was surveyed in the surface sediments from the northern part of the South China Sea (SCS). The distribution pattern of AOA in the western Pacific was discussed through comparing the SCS with other areas in the western Pacific including Changjiang Estuary and the adjacent East China Sea where high input of anthropogenic nitrogen was evident, the tropical West Pacific Continental Margins close to the Philippines, the deep-sea methane seep sediments in the Okhotsk Sea, the cold deep sea of Northeastern Japan Sea, and the hydrothermal field in the Southern Okinawa Trough. These various environments provide a wide spectrum of physical and chemical conditions for a better understanding of the distribution pattern and diversities of AOA in the western Pacific. Under these different conditions, the distinct community composition between shallow and deep-sea sediments was clearly delineated based on the UniFrac PCoA and Jackknife Environmental Cluster analyses. Phylogenetic analyses showed that a few ammonia-oxidizing archaeal subclades in the marine water column/sediment clade and endemic lineages were indicative phylotypes for some environments. Higher phylogenetic diversity was observed in the Philippines while lower diversity in the hydrothermal vent habitat. Water depth and possibly with other environmental factors could be the main driving forces to shape the phylogenetic diversity of AOA observed, not only in the SCS but also in the whole western Pacific. The multivariate regression tree analysis also supported this observation consistently. Moreover, the functions of current and other climate factors were also discussed in comparison of phylogenetic diversity. The information collectively provides important insights into the ecophysiological requirements of uncultured ammonia-oxidizing archaeal lineages in the western Pacific Ocean.

  4. Phylogenetic diversity of dissimilatory ferric iron reducers in paddy soil of Hunan, South China

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xin-Jun [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Graduate Univ., Chinese Academy of Sciences, BJ (China); Yang Jing; Chen Xue-Ping; Sun Guo-Xin [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Zhu Yong-Guan [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Key Lab. of Urban Environment and Health, Inst. of Urban Environment, Chinese Academy of Sciences, Xiamen (China)

    2009-12-15

    Purpose: Dissimilatory iron-reducing bacteria have been described by both culture-dependent and -independent methods in various environments, including freshwater, marine sediments, natural wetlands, and contaminated aquifers. However, little is known about iron-reducing microbial communities in paddy soils. The goal of this study was to characterize iron-reducing microbial communities in paddy soil. Moreover, the effect of dissolved and solid-phase iron (III) species on the iron-reducing microbial communities was also investigated by enrichment cultures. Methods: Ferric citrate and ferrihydrite were used respectively to set up enrichment cultures of dissimilatory ironreducing microorganisms using 1% inoculum of soil samples, and the iron reduction was measured. Moreover, bacterial DNA was extracted and 16S rRNA genes were PCR-amplified, and subsequently analyzed by the clone library and terminal restriction fragment length polymorphism (T-RFLP). Results: Phylogenetic analysis of 16S rRNA gene sequences extracted from the enrichment cultures revealed that Bradyrhizobium, Bacteroides, Clostridium and Ralstonia species were the dominant bacteria in the ferric citrate enrichment. However, members of the genera Clostridium, Bacteroides, and Geobacter were the dominant micro-organisms in the ferrihydrite enrichment. Analysis of enrichment cultures by T-RFLP strongly supported the cloning and sequencing results. Conclusions: The present study demonstrated that dissimilatory iron-reducing consortia in As-contaminated paddy soil are phylogenetically diverse. Moreover, iron (III) sources as a key factor have a strong effect on the iron (III)-reducing microbial community structure and relative abundance in the enrichments. In addition, Geobacter species are selectively enriched by ferrihydrite enrichment cultures. (orig.)

  5. High local genetic diversity of canine parvovirus from Ecuador.

    Science.gov (United States)

    Aldaz, Jaime; García-Díaz, Juan; Calleros, Lucía; Sosa, Katia; Iraola, Gregorio; Marandino, Ana; Hernández, Martín; Panzera, Yanina; Pérez, Ruben

    2013-09-27

    Canine parvovirus (CPV) comprises three antigenic variants (2a, 2b, and 2c) that are distributed globally with different frequencies and levels of genetic variability. CPVs from central Ecuador were herein analyzed to characterize the strains and to provide new insights into local viral diversity, evolution, and pathogenicity. Variant prevalence was analyzed by PCR and partial sequencing for 53 CPV-positive samples collected during 2011 and 2012. The full-length VP2 gene was sequenced in 24 selected strains and a maximum-likelihood phylogenetic tree was constructed using both Ecuadorian and worldwide strains. Ecuadorian CPVs have a remarkable genetic diversity that includes the circulation of all three variants and the existence of different evolutionary groups or lineages. CPV-2c was the most prevalent variant (54.7%), confirming the spread of this variant in America. Ecuadorian CPV-2c strains clustered in two lineages, which represent the first evidence of polyphyletic CPV-2c circulating in South America. CPV-2a strains constituted 41.5% of the samples and clustered in a single lineage. The two detected CPV-2b strains (3.8%) were clearly polyphyletic and appeared related to Ecuadorian CPV-2a or foreign CPV-2b strains. Besides the substitution at residue 426 that is used to identify the variants, two amino acid changes occurred in Ecuadorian strains: Val139Iso and Thr440Ser. Ser(440) occurred in a biologically relevant domain of VP2 and is here described for the first time in CPV. The associations of Ecuadorian CPV-2c and CPV-2a with clinical symptoms indicate that dull mentation, hemorrhagic gastroenteritis and hypothermia occurred more frequently in infection with CPV-2c than with CPV-2a. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Local phylogenetic divergence and global evolutionary convergence of skull function in reef fishes of the family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E; Wainwright, Peter C; Bellwood, David R; Grubich, Justin R; Fessler, Jennifer L; Clements, Kendall D; Smith, Lydia L

    2005-05-22

    The Labridae is one of the most structurally and functionally diversified fish families on coral and rocky reefs around the world, providing a compelling system for examination of evolutionary patterns of functional change. Labrid fishes have evolved a diverse array of skull forms for feeding on prey ranging from molluscs, crustaceans, plankton, detritus, algae, coral and other fishes. The species richness and diversity of feeding ecology in the Labridae make this group a marine analogue to the cichlid fishes. Despite the importance of labrids to coastal reef ecology, we lack evolutionary analysis of feeding biomechanics among labrids. Here, we combine a molecular phylogeny of the Labridae with the biomechanics of skull function to reveal a broad pattern of repeated convergence in labrid feeding systems. Mechanically fast jaw systems have evolved independently at least 14 times from ancestors with forceful jaws. A repeated phylogenetic pattern of functional divergence in local regions of the labrid tree produces an emergent family-wide pattern of global convergence in jaw function. Divergence of close relatives, convergence among higher clades and several unusual 'breakthroughs' in skull function characterize the evolution of functional complexity in one of the most diverse groups of reef fishes.

  7. A new support measure to quantify the impact of local optima in phylogenetic analyses.

    KAUST Repository

    Brammer, Grant

    2011-09-29

    Phylogentic analyses are often incorrectly assumed to have stabilized to a single optimum. However, a set of trees from a phylogenetic analysis may contain multiple distinct local optima with each optimum providing different levels of support for each clade. For situations with multiple local optima, we propose p-support which is a clade support measure that shows the impact optima have on a final consensus tree. Our p-support measure is implemented in our PeakMapper software package. We study our approach on two published, large-scale biological tree collections. PeakMapper shows that each data set contains multiple local optima. p-support shows that both datasets contain clades in the majority consensus tree that are only supported by a subset of the local optima. Clades with low p-support are most likely to benefit from further investigation. These tools provide researchers with new information regarding phylogenetic analyses beyond what is provided by other support measures alone.

  8. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  9. Spatial Patterns of Species Diversity and Phylogenetic Structure of Plant Communities in the Tianshan Mountains, Arid Central Asia

    Directory of Open Access Journals (Sweden)

    Hong-Xiang Zhang

    2017-12-01

    Full Text Available The Tianshan Mountains, located in arid Central Asia, have a humid climate and are biodiversity hotspots. Here, we aimed to clarify whether the pattern of species diversity and the phylogenetic structure of plant communities is affected by environmental variables and glacial refugia. In this study, plant community assemblies of 17 research sites with a total of 35 sample plots were investigated at the grassland/woodland boundaries on the Tianshan Mountains. Community phylogeny of these plant communities was constructed based on two plant DNA barcode regions. The indices of phylogenetic diversity and phylogenetic community structure were calculated for these sample plots. We first estimated the correlation coefficients between species richness (SR and environmental variables as well as the presence of glacial refugia. We then mapped the significant values of indices of community phylogeny (PD, RPD, NRI, and NTI to investigate the correlation between community phylogeny and environmental structure or macrozones in the study area. The results showed that a significantly higher value of SR was obtained for the refugial groups than for the colonizing groups (P < 0.05; presence of refugia and environmental variables were highly correlated to the pattern of variation in SR. Indices of community phylogeny were not significantly different between refugial and colonizing regions. Comparison with the humid western part showed that plant communities in the arid eastern part of the Tianshan Mountains tended to display more significant phylogenetic overdispersion. The variation tendency of the PhyloSor index showed that the increase in macro-geographical and environmental distance did not influence obvious phylogenetic dissimilarities between different sample plots. In conclusion, glacial refugia and environmental factors profoundly influenced the pattern of SR, but community phylogenetic structure was not affected by glacial refugia among different plant

  10. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  11. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    Science.gov (United States)

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Tasting soil fungal diversity with earth tongues: phylogenetic test of SATe alignments for environmental ITS data.

    Directory of Open Access Journals (Sweden)

    Zheng Wang

    Full Text Available An abundance of novel fungal lineages have been indicated by DNA sequencing of the nuclear ribosomal ITS region from environmental samples such as soil and wood. Although phylogenetic analysis of these novel lineages is a key component of unveiling the structure and diversity of complex communities, such analyses are rare for environmental ITS data due to the difficulties of aligning this locus across significantly divergent taxa. One potential approach to this issue is simultaneous alignment and tree estimation. We targeted divergent ITS sequences of the earth tongue fungi (Geoglossomycetes, a basal class in the Ascomycota, to assess the performance of SATé, recent software that combines progressive alignment and tree building. We found that SATé performed well in generating high-quality alignments and in accurately estimating the phylogeny of earth tongue fungi. Drawing from a data set of 300 sequences of earth tongues and progressively more distant fungal lineages, 30 insufficiently identified ITS sequences from the public sequence databases were assigned to the Geoglossomycetes. The association between earth tongues and plants has been hypothesized for a long time, but hard evidence is yet to be collected. The ITS phylogeny showed that four ectomycorrhizal isolates shared a clade with Geoglossum but not with Trichoglossum earth tongues, pointing to the significant potential inherent to ecological data mining of environmental samples. Environmental sampling holds the key to many focal questions in mycology, and simultaneous alignment and tree estimation, as performed by SATé, can be a highly efficient companion in that pursuit.

  13. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan

    2014-05-12

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  14. Phylogenetically Diverse Burkholderia Associated with Midgut Crypts of Spurge Bugs, Dicranocephalus spp. (Heteroptera: Stenocephalidae).

    Science.gov (United States)

    Kuechler, Stefan Martin; Matsuura, Yu; Dettner, Konrad; Kikuchi, Yoshitomo

    2016-06-25

    Diverse phytophagous heteropteran insects, commonly known as stinkbugs, are associated with specific gut symbiotic bacteria, which have been found in midgut cryptic spaces. Recent studies have revealed that members of the stinkbug families Coreidae and Alydidae of the superfamily Coreoidea are consistently associated with a specific group of the betaproteobacterial genus Burkholderia, called the "stinkbug-associated beneficial and environmental (SBE)" group, and horizontally acquire specific symbionts from the environment every generation. However, the symbiotic system of another coreoid family, Stenocephalidae remains undetermined. We herein investigated four species of the stenocephalid genus Dicranocephalus. Examinations via fluorescence in situ hybridization (FISH) and transmission electron microscopy (TEM) revealed the typical arrangement and ultrastructures of midgut crypts and gut symbionts. Cloning and molecular phylogenetic analyses of bacterial genes showed that the midgut crypts of all species are colonized by Burkholderia strains, which were further assigned to different subgroups of the genus Burkholderia. In addition to the SBE-group Burkholderia, a number of stenocephalid symbionts belonged to a novel clade containing B. sordidicola and B. udeis, suggesting a specific symbiont clade for the Stenocephalidae. The symbiotic systems of stenocephalid bugs may provide a unique opportunity to study the ongoing evolution of symbiont associations in the stinkbug-Burkholderia interaction.

  15. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan; Yang, Chen; Horn, Hannes; Hajjar, Dina A.; Ravasi, Timothy; Hentschel, Ute

    2014-01-01

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  16. [New isolation methods and phylogenetic diversity of actinobacteria from hypersaline beach in Aksu].

    Science.gov (United States)

    Zhang, Yao; Xia, Zhanfeng; Cao, Xinbo; Li, Jun; Zhang, Lili

    2013-08-04

    We explored 4 new methods to improve the isolation of actinobacterial resources from high salt areas. Optimized media based on 4 new strategies were used for isolating actinobacteria from hypersaline beaches. Glycerin-arginine, trehalose-creatine, glycerol-asparticacid, mannitol-casein, casein-mannitol, mannitol-alanine, chitosan-asparagineand GAUZE' No. 1 were used as basic media. New isolation strategy includes 4 methods: ten-fold dilution culture, simulation of the original environment, actinobacterial culture guided by uncultured molecular technology detected, and reference of actinobacterial media for brackish marine environment. The 16S rRNA genes of the isolates were amplified with bacterial universal primers. The results of 16S rRNA gene sequences were compared with sequences obtained from GenBank databases. We constructed phylogenetic tree with the neighbor-joining method. No actinobacterial strains were isolated by 8 media of control group, while 403 strains were isolated by new strategies. The isolates by new methods were members of 14 genera (Streptomyces, Streptomonospora, Saccharomonospora, Plantactinospora, Nocardia, Amycolatopsis, Glycomyces, Micromonospora, Nocardiopsis, Isoptericola, Nonomuraea, Thermobifida, Actinopolyspora, Actinomadura) of 10 families in 8 suborders. The most abundant and diverse isolates were the two suborders of Streptomycineae (69.96%) and Streptosporangineaesuborder (9.68%) within the phylum Actinobacteria, including 9 potential novel species. New isolation methods significantly improved the actinobacterial culturability of hypersaline areas, and obtained many potential novel species, which provided a new and more effective way to isolate actinobacteria resources in hypersaline environments.

  17. Integrated Automatic Workflow for Phylogenetic Tree Analysis Using Public Access and Local Web Services.

    Science.gov (United States)

    Damkliang, Kasikrit; Tandayya, Pichaya; Sangket, Unitsa; Pasomsub, Ekawat

    2016-11-28

    At the present, coding sequence (CDS) has been discovered and larger CDS is being revealed frequently. Approaches and related tools have also been developed and upgraded concurrently, especially for phylogenetic tree analysis. This paper proposes an integrated automatic Taverna workflow for the phylogenetic tree inferring analysis using public access web services at European Bioinformatics Institute (EMBL-EBI) and Swiss Institute of Bioinformatics (SIB), and our own deployed local web services. The workflow input is a set of CDS in the Fasta format. The workflow supports 1,000 to 20,000 numbers in bootstrapping replication. The workflow performs the tree inferring such as Parsimony (PARS), Distance Matrix - Neighbor Joining (DIST-NJ), and Maximum Likelihood (ML) algorithms of EMBOSS PHYLIPNEW package based on our proposed Multiple Sequence Alignment (MSA) similarity score. The local web services are implemented and deployed into two types using the Soaplab2 and Apache Axis2 deployment. There are SOAP and Java Web Service (JWS) providing WSDL endpoints to Taverna Workbench, a workflow manager. The workflow has been validated, the performance has been measured, and its results have been verified. Our workflow's execution time is less than ten minutes for inferring a tree with 10,000 replicates of the bootstrapping numbers. This paper proposes a new integrated automatic workflow which will be beneficial to the bioinformaticians with an intermediate level of knowledge and experiences. All local services have been deployed at our portal http://bioservices.sci.psu.ac.th.

  18. Diversity of chloroplast genome among local clones of cocoa (Theobroma cacao, L.) from Central Sulawesi

    Science.gov (United States)

    Suwastika, I. Nengah; Pakawaru, Nurul Aisyah; Rifka, Rahmansyah, Muslimin, Ishizaki, Yoko; Cruz, André Freire; Basri, Zainuddin; Shiina, Takashi

    2017-02-01

    Chloroplast genomes typically range in size from 120 to 170 kilo base pairs (kb), which relatively conserved among plant species. Recent evaluation on several species, certain unique regions showed high variability which can be utilized in the phylogenetic analysis. Many fragments of coding regions, introns, and intergenic spacers, such as atpB-rbcL, ndhF, rbcL, rpl16, trnH-psbA, trnL-F, trnS-G, etc., have been used for phylogenetic reconstructions at various taxonomic levels. Based on that status, we would like to analysis the diversity of chloroplast genome within species of local cacao (Theobroma cacao L.) from Central Sulawesi. Our recent data showed, there were more than 20 clones from local farming in Central Sulawesi, and it can be detected based on phenotypic and nuclear-genome-based characterization (RAPD- Random Amplified Polymorphic DNA and SSR- Simple Sequences Repeat) markers. In developing DNA marker for this local cacao, here we also included analysis based on the variation of chloroplast genome. At least several regions such as rpl32-TurnL, it can be considered as chloroplast markers on our local clone of cocoa. Furthermore, we could develop phylogenetic analysis in between clones of cocoa.

  19. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

    Directory of Open Access Journals (Sweden)

    Johannes Asplund-Samuelsson

    Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  20. Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

    Science.gov (United States)

    Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

    2003-01-01

    The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

  1. Phylogenetic Diversity of Archaea and Bacteria in the Anoxic Zone of a Meromictic Lake (Lake Pavin, France)▿ †

    Science.gov (United States)

    Lehours, Anne-Catherine; Evans, Paul; Bardot, Corinne; Joblin, Keith; Gérard, Fonty

    2007-01-01

    The compositions of archaeal and bacterial populations at different depths (60 m [mixolimnion-chemocline interface], 70 m [chemocline-subchemocline interface], 90 m, and 92 m [the water-sediment interface]) in the anoxic zone of the water column in Lake Pavin, a freshwater permanently stratified mountain lake in France, were determined. Phylogenetic trees were constructed from sequences to assess archaeal and bacterial diversity at the four sites. PMID:17261512

  2. Phylogenetic Diversity of aprA Genes in Subseafloor Sediments on the Northwestern Pacific Margin off Japan.

    Science.gov (United States)

    Aoki, Masataka; Kakiuchi, Ryota; Yamaguchi, Takashi; Takai, Ken; Inagaki, Fumio; Imachi, Hiroyuki

    2015-01-01

    Markedly diverse sequences of the adenosine-5'-phosphosulfate reductase alpha subunit gene (aprA), which encodes a key enzyme in microbial sulfate reduction and sulfur oxidation, were detected in subseafloor sediments on the northwestern Pacific off Japan. The aprA gene sequences were grouped into 135 operational taxonomic units (90% sequence identity), including genes related to putative sulfur-oxidizing bacteria predominantly detected in sulfate-depleted deep sediments. Our results suggest that microbial ecosystems in the subseafloor biosphere have phylogenetically diverse genetic potentials to mediate cryptic sulfur cycles in sediments, even where sulfate is rarely present.

  3. Phylogenetics and genetic diversity of the Cotesia flavipes complex of parasitoid wasps (Hymenoptera: Braconidae), biological control agents of lepidopteran stemborers.

    Science.gov (United States)

    Muirhead, Kate A; Murphy, Nicholas P; Sallam, Nader; Donnellan, Stephen C; Austin, Andrew D

    2012-06-01

    The Cotesia flavipes complex of parasitoid wasps (Hymenoptera: Braconidae) are economically important for the biological control of lepidopteran stemboring pests associated with gramineous crops. Some members of the complex successfully parasitize numerous stemborer pest species, however certain geographic populations have demonstrated variation in the range of hosts that they parasitize. In addition, the morphology of the complex is highly conserved and considerable confusion surrounds the identity of species and host-associated biotypes. We generated nucleotide sequence data for two mtDNA genes (COI, 16S) and three anonymous nuclear loci (CfBN, CfCN, CfEN) for the C. flavipes complex. To analyze genetic variation and relationships among populations we used (1) concatenated mtDNA and nDNA data, (2) a nDNA multilocus network approach, and (3) two species tree inference methods, i.e. Bayesian estimation of species trees (BEST) and Bayesian inference of species trees from multilocus data with (*)BEAST. All phylogenetic analyses provide strong support for monophyly of the complex and the presence of at least four species, C. chilonis (from China and Japan), C. sesamiae (from Africa), C. flavipes (originating from the Indo-Asia region but introduced into Africa and the New World), and C. nonagriae (from Australia and Papua New Guinea). Haplotype diversity of geographic populations relates to historical biogeographic barriers and biological control introductions, and reflects previous reports of ecological variation in these species. Strong discordance was found between the mitochondrial and nuclear markers in the Papua New Guinea haplotypes, which may be an outcome of hybridization and introgression of C. flavipes and C. nonagriae. The position of Cotesia flavipes from Japan was not well supported in any analysis and was the sister taxon to C. nonagriae (mtDNA, (*)BEAST), C. flavipes (nDNA) or C. flavipes+C. nonagriae (BEST) and, may represent a cryptic species. The

  4. Why and how might genetic and phylogenetic diversity be reflected in the identification of key biodiversity areas?

    Science.gov (United States)

    Brooks, T M; Cuttelod, A; Faith, D P; Garcia-Moreno, J; Langhammer, P; Pérez-Espona, S

    2015-02-19

    'Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326-337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for 'threatened species' to consider 'threatened taxa' and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites.

  5. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    Science.gov (United States)

    Miyake, Sou; Ngugi, David K.; Stingl, Ulrich

    2016-01-01

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  6. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    KAUST Repository

    Miyake, Sou

    2016-03-14

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  7. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    KAUST Repository

    Miyake, Sou; Ngugi, David; Stingl, Ulrich

    2016-01-01

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  8. Genetic diversity and phylogenetic analysis of Aleutian mink disease virus isolates in north-east China.

    Science.gov (United States)

    Leng, Xue; Liu, Dongxu; Li, Jianming; Shi, Kun; Zeng, Fanli; Zong, Ying; Liu, Yi; Sun, Zhibo; Zhang, Shanshan; Liu, Yadong; Du, Rui

    2018-05-01

    Aleutian mink disease is the most important disease in the mink-farming industry worldwide. So far, few large-scale molecular epidemiological studies of AMDV, based on the NS1 and VP2 genes, have been conducted in China. Here, eight new Chinese isolates of AMDV from three provinces in north-east China were analyzed to clarify the molecular epidemiology of AMDV. The seroprevalence of AMDV in north-east China was 41.8% according to counterimmuno-electrophoresis. Genetic variation analysis of the eight isolates showed significant non-synonymous substitutions in the NS1 and VP2 genes, especially in the NS1 gene. All eight isolates included the caspase-recognition sequence NS1:285 (DQTD↓S), but not the caspase recognition sequence NS1:227 (INTD↓S). The LN1 and LN2 strains had a new 10-amino-acid deletion in-between amino acids 28-37, while the JL3 strain had a one-amino-acid deletion at position 28 in the VP2 protein, compared with the AMDV-G strain. Phylogenetic analysis based on most of NS1 (1755 bp) and complete VP2 showed that the AMDV genotypes did not cluster according to their pathogenicity or geographic origin. Local and imported ADMV species are all prevalent in mink-farming populations in the north-east of China. This is the first study to report the molecular epidemiology of AMDV in north-east China based on most of NS1 and the complete VP2, and further provides information about polyG deletions and new variations in the amino acid sequences of NS1 and VP2 proteins. This report is a good foundation for further study of AMDV in China.

  9. Some Like it High! Phylogenetic Diversity of High-Elevation Cyanobacterial Community from Biological Soil Crusts of Western Himalaya.

    Science.gov (United States)

    Čapková, Kateřina; Hauer, Tomáš; Řeháková, Klára; Doležal, Jiří

    2016-01-01

    The environment of high-altitudinal cold deserts of Western Himalaya is characterized by extensive development of biological soil crusts, with cyanobacteria as dominant component. The knowledge of their taxonomic composition and dependency on soil chemistry and elevation is still fragmentary. We studied the abundance and the phylogenetic diversity of the culturable cyanobacteria and eukaryotic microalgae in soil crusts along altitudinal gradients (4600-5900 m) at two sites in the dry mountains of Ladakh (SW Tibetan Plateau and Eastern Karakoram), using both microscopic and molecular approaches. The effects of environmental factors (altitude, mountain range, and soil physico-chemical parameters) on the composition and biovolume of phototrophs were tested by multivariate redundancy analysis and variance partitioning. Both phylogenetic diversity and composition of morphotypes were similar between Karakorum and Tibetan Plateau. Phylogenetic analysis of 16S rRNA gene revealed strains belonging to at least five genera. Besides clusters of common soil genera, e.g., Microcoleus, Nodosilinea, or Nostoc, two distinct clades of simple trichal taxa were newly discovered. The most abundant cyanobacterial orders were Oscillatoriales and Nostacales, whose biovolume increased with increasing elevation, while that of Chroococales decreased. Cyanobacterial species richness was low in that only 15 morphotypes were detected. The environmental factors accounted for 52 % of the total variability in microbial data, 38.7 % of which was explained solely by soil chemical properties, 14.5 % by altitude, and 8.4 % by mountain range. The elevation, soil phosphate, and magnesium were the most important predictors of soil phototrophic communities in both mountain ranges despite their different bedrocks and origin. The present investigation represents a first record on phylogenetic diversity of the cyanobacterial community of biological soil crusts from Western Himalayas and first record

  10. Diversity and phylogenetic analyses of bacteria from a shallow-waterhydrothermal vent in Milos island (Greece

    Directory of Open Access Journals (Sweden)

    Donato eGiovannelli

    2013-07-01

    Full Text Available Studies of shallow-water hydrothermal vents have been lagging behind their deep-sea counterparts. Hence, the importance of these systems and their contribution to the local and regional diversity and biogeochemistry is unclear. This study analyzes the bacterial community along a transect at the shallow-water hydrothermal vent system of Milos island, Greece. The abundance and biomass of the prokaryotic community is comparable to areas not affected by hydrothermal activity and was, on average, 1.34×108 cells g-1. The abundance, biomass and diversity of the prokaryotic community increased with the distance from the center of the vent and appeared to be controlled by the temperature gradient rather than the trophic conditions. The retrieved 16S rRNA gene fragments matched sequences from a variety of geothermal environments, although the average similarity was low (94 %, revealing previously undiscovered taxa. Epsilonproteobacteria constituted the majority of the population along the transect, with an average contribution to the total diversity of 60%. The larger cluster of 16S rRNA gene sequences was related to chemolithoautotrophic Sulfurovum spp., an Epsilonproteobacterium so far detected only at deep-sea hydrothermal vents. The presence of previously unknown lineages of Epsilonproteobacteria could be related to the abundance of organic matter in these systems, which may support alternative metabolic strategies to chemolithoautotrophy. The relative contribution of Gammaproteobacteria to the Milos microbial community increased along the transect as the distance from the center of the vent increased. Further attempts to isolate key species from these ecosystems will be critical to shed light on their evolution and ecology.

  11. Environmental constraints on the compositional and phylogenetic beta-diversity of tropical forest snake assemblages.

    Science.gov (United States)

    Moura, Mario R; Costa, Henrique C; Argôlo, Antônio J S; Jetz, Walter

    2017-09-01

    The ongoing biodiversity crisis increases the importance and urgency of studies addressing the role of environmental variation on the composition and evolutionary history of species assemblages, but especially the tropics and ectotherms remain understudied. In regions with rainy summers, coexistence of tropical ectothermic species may be determined by the partitioning of the climatic niche, as ectotherms can rely on water availability and thermoregulatory behaviour to buffer constraints along their climatic niche. Conversely, tropical ectotherms facing dry summers would have fewer opportunities to climatic niche partitioning and other processes rather than environmental filtering would mediate species coexistence. We used 218 snake assemblages to quantify the compositional (CBD) and phylogenetic (PBD) beta-diversity of snakes in the Atlantic Forest (AF) hotspot, South America. We identify two AF regions with distinct climatological regimes: dry summers in the northern-AF and rainy summers in the southern-AF. While accounting for the influence of multiscale spatial processes, we disentangle the relative contribution of thermal, water-related and topographic conditions in structuring the CBD and PBD of snake assemblages, and determine the extent in which snake assemblages under distinct climatological regimes are affected by environmental filtering. Thermal conditions best explain CBD and PBD of snakes for the whole AF, whereas water-related factors best explain the structure of snake assemblages within a same climatological regime. CBD and PBD patterns are similarly explained by spatial factors but snake assemblages facing dry summers are more affected by spatial processes operating at fine to intermediate spatial scale, whereas those assemblages in regions with rainy summers have a stronger signature of coarse-scale processes. As expected, environmental filtering plays a stronger role in southern-AF than northern-AF, and the synergism between thermal and water

  12. Phylogenetic diversity of dominant bacterial communities during bioremediation of crude oil-polluted soil

    Directory of Open Access Journals (Sweden)

    Eugene Thomas Cloete

    2011-08-01

    Full Text Available Bioremediation of hydrocarbon pollutants is advantageous owing to the cost-effectiveness of the technology and the ubiquity of hydrocarbon degrading microorganisms in the soil. Soil microbial diversity is affected by hydrocarbon perturbation thus selective enrichment of hydrocarbon utilizers occurs. Hydrocarbons interact with the soil matrix and soil microorganisms determining the fate of the contaminants relative to their chemical nature and microbial degradative capabilities respectively. Bacterial dynamics in crude oil-polluted soil microcosms undergoing bioremediation were investigated over a 42-day period. Four out of the five microcosms containing 4kg of pristine soil each were contaminated with 4% Arabian light crude oil. Three microcosms were amended with either 25g of NPK fertilizer, calcium ammonium nitrate or poultry droppings respectively while the fourth designated oil-contaminated control was unamended. The fifth microcosm had only pristine soil and was set up to ascertain indigenous bacterial community structure pre-contamination. Biostimulated soils were periodically tilled and watered. Hydrocarbon degradation was measured throughout the experimental period by gas chromatography. Gas chromatographic tracing of residual hydrocarbons in biostimulated soils showed marked attenuation of contaminants starting from the second (day 14 till the sixth (day 42 week after contamination whereas no significant reduction in hydrocarbon peaks was seen in the oil contaminated control soil throughout the 6-week experimental period. Molecular fingerprints of bacterial communities involved in aerobic biodegradation of crude oil hydrocarbons in biostimulated soils and controls were generated with DGGE using PCR-amplification of 16S rRNA gene obtained from extracted total soil community DNA. DGGE fingerprints demonstrated that NPK, calcium ammonium nitrate and poultry droppings selected different bacterial populations during the active phase of oil

  13. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  14. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.

    Directory of Open Access Journals (Sweden)

    Jianbin Liu

    Full Text Available The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau.

  15. Phylogenetic analysis of a spontaneous cocoa bean fermentation metagenome reveals new insights into its bacterial and fungal community diversity.

    Directory of Open Access Journals (Sweden)

    Koen Illeghems

    Full Text Available This is the first report on the phylogenetic analysis of the community diversity of a single spontaneous cocoa bean box fermentation sample through a metagenomic approach involving 454 pyrosequencing. Several sequence-based and composition-based taxonomic profiling tools were used and evaluated to avoid software-dependent results and their outcome was validated by comparison with previously obtained culture-dependent and culture-independent data. Overall, this approach revealed a wider bacterial (mainly γ-Proteobacteria and fungal diversity than previously found. Further, the use of a combination of different classification methods, in a software-independent way, helped to understand the actual composition of the microbial ecosystem under study. In addition, bacteriophage-related sequences were found. The bacterial diversity depended partially on the methods used, as composition-based methods predicted a wider diversity than sequence-based methods, and as classification methods based solely on phylogenetic marker genes predicted a more restricted diversity compared with methods that took all reads into account. The metagenomic sequencing analysis identified Hanseniaspora uvarum, Hanseniaspora opuntiae, Saccharomyces cerevisiae, Lactobacillus fermentum, and Acetobacter pasteurianus as the prevailing species. Also, the presence of occasional members of the cocoa bean fermentation process was revealed (such as Erwinia tasmaniensis, Lactobacillus brevis, Lactobacillus casei, Lactobacillus rhamnosus, Lactococcus lactis, Leuconostoc mesenteroides, and Oenococcus oeni. Furthermore, the sequence reads associated with viral communities were of a restricted diversity, dominated by Myoviridae and Siphoviridae, and reflecting Lactobacillus as the dominant host. To conclude, an accurate overview of all members of a cocoa bean fermentation process sample was revealed, indicating the superiority of metagenomic sequencing over previously used techniques.

  16. Phylogenetic and functional diversity of metagenomic libraries of phenol degrading sludge from petroleum refinery wastewater treatment system.

    Science.gov (United States)

    Silva, Cynthia C; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; Kruger, Ricardo H; Rodrigues, Marili Vn; Costa, Gustavo Gl; Vidal, Ramon O; Sousa, Maíra P; Torres, Ana Paula R; Santiago, Vânia Mj; Oliveira, Valéria M

    2012-03-27

    In petrochemical refinery wastewater treatment plants (WWTP), different concentrations of pollutant compounds are received daily in the influent stream, including significant amounts of phenolic compounds, creating propitious conditions for the development of particular microorganisms that can rapidly adapt to such environment. In the present work, the microbial sludge from a refinery WWTP was enriched for phenol, cloned into fosmid vectors and pyrosequenced. The fosmid libraries yielded 13,200 clones and a comprehensive bioinformatic analysis of the sequence data set revealed a complex and diverse bacterial community in the phenol degrading sludge. The phylogenetic analyses using MEGAN in combination with RDP classifier showed a massive predominance of Proteobacteria, represented mostly by the genera Diaphorobacter, Pseudomonas, Thauera and Comamonas. The functional classification of phenol degrading sludge sequence data set generated by MG-RAST showed the wide metabolic diversity of the microbial sludge, with a high percentage of genes involved in the aerobic and anaerobic degradation of phenol and derivatives. In addition, genes related to the metabolism of many other organic and xenobiotic compounds, such as toluene, biphenyl, naphthalene and benzoate, were found. Results gathered herein demonstrated that the phenol degrading sludge has complex phylogenetic and functional diversities, showing the potential of such community to degrade several pollutant compounds. This microbiota is likely to represent a rich resource of versatile and unknown enzymes which may be exploited for biotechnological processes such as bioremediation.

  17. Valuing local diversity in palliative care: translating the concept.

    Science.gov (United States)

    Quinn, Sharon; Hickey, Deb

    The contemporary challenges associated with addressing diversity, ethnicity, equality and accessibility in today's healthcare economy, sometimes lead to a reactive response where service providers strive to apply these concepts in practice. This article describes establishing a group that could engage with the broadest spectrum of the local community in ways that would make a lasting and meaningful difference to the local population, including how individuals and groups engage with and access palliative care services. The Valuing Local Diversity in Palliative Care Group was formed in May 2006. The group, whose membership is composed of statutory and voluntary services and members of various community groups, has promoted some innovative and creative partnerships.

  18. Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

    Science.gov (United States)

    Erwin, Patrick M; Olson, Julie B; Thacker, Robert W

    2011-01-01

    Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP), might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods. We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6%) of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil). The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the ambient

  19. Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

    Directory of Open Access Journals (Sweden)

    Patrick M Erwin

    Full Text Available Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP, might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods.We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6% of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil.The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the

  20. Partitioning the impact of environment and spatial structure on alpha and beta components of taxonomic, functional, and phylogenetic diversity in European ants.

    Science.gov (United States)

    Arnan, Xavier; Cerdá, Xim; Retana, Javier

    2015-01-01

    We analyze the relative contribution of environmental and spatial variables to the alpha and beta components of taxonomic (TD), phylogenetic (PD), and functional (FD) diversity in ant communities found along different climate and anthropogenic disturbance gradients across western and central Europe, in order to assess the mechanisms structuring ant biodiversity. To this aim we calculated alpha and beta TD, PD, and FD for 349 ant communities, which included a total of 155 ant species; we examined 10 functional traits and phylogenetic relatedness. Variation partitioning was used to examine how much variation in ant diversity was explained by environmental and spatial variables. Autocorrelation in diversity measures and each trait's phylogenetic signal were also analyzed. We found strong autocorrelation in diversity measures. Both environmental and spatial variables significantly contributed to variation in TD, PD, and FD at both alpha and beta scales; spatial structure had the larger influence. The different facets of diversity showed similar patterns along environmental gradients. Environment explained a much larger percentage of variation in FD than in TD or PD. All traits demonstrated strong phylogenetic signals. Our results indicate that environmental filtering and dispersal limitations structure all types of diversity in ant communities. Strong dispersal limitations appear to have led to clustering of TD, PD, and FD in western and central Europe, probably because different historical and evolutionary processes generated different pools of species. Remarkably, these three facets of diversity showed parallel patterns along environmental gradients. Trait-mediated species sorting and niche conservatism appear to structure ant diversity, as evidenced by the fact that more variation was explained for FD and that all traits had strong phylogenetic signals. Since environmental variables explained much more variation in FD than in PD, functional diversity should be a

  1. Genetic diversity and phylogenetic analysis of Tams1 of Theileria annulata isolates from three continents between 2000 and 2012.

    Science.gov (United States)

    Wang, Jiay; Yang, Xianyong; Wang, Yuge; Jing, Zhihong; Meng, Kai; Liu, Jianzhu; Guo, Huijun; Xu, Ruixue; Cheng, Ziqiang

    2014-01-01

    Theileria annulata, which is part of the Theileria sergenti/Theileria buffeli/Theileria orientalis group, preferentially infects cattle and results in high mortality and morbidity in the Mediterranean, Middle East, and Central Asia. The polypeptide Tams1 is an immunodominant major merozoite piroplasm surface antigen of T. annulata that could be used as a marker for epidemiological studies and phylogenetic analysis. In the present study, a total of 155 Tams1 sequences were investigated for genetic diversity and phylogenetic relationships through phylogenetic analysis. Results showed that the Tams1 sequences were divided into two major groups and that distribution for some isolates also exhibited geographic specificity. As targeting polymorphic genes for parasite detection may result in underestimation of infection, polymerase chain reaction (PCR) assay using two different probes targeting tams-1 genes of these two groups can be more credible. In addition, the direction of the spread of the disease was discovered to be from the Mediterranean or the tropical zone to the Eurasian peninsula, Middle East, Southern Asia, and Africa, particularly for Group 2. A similar occurrence was also found between the Ms1 gene of Theileria lestoquardi and the Tams1 gene of T. annulata, which explains cross-immunogenicity to a certain extent. However, no potential glycosylation site in the Tams1 of T. annulata was found in this study, which illustrated that instead of N-glycosylation, other modifications have more significant effects on the immunogenicity of the Tams1 protein.

  2. Patterns of species diversity and phylogenetic structure of vascular plants on the Qinghai-Tibetan Plateau.

    Science.gov (United States)

    Yan, Yujing; Yang, Xian; Tang, Zhiyao

    2013-11-01

    Large-scale patterns of species richness and the underlying mechanisms regulating these patterns have long been the central issues in biogeography and macroecology. Phylogenetic community structure is a result of combined effects of contemporary ecological interactions, environmental filtering, and evolutionary history, and it links community ecology with biogeography and trait evolution. The Qinghai-Tibetan Plateau provides a good opportunity to test the influence of contemporary climate on shaping species richness because of its unique geological history, cold climate, and high biodiversity. In this study, based on high-resolution distributions of ˜9000 vascular plant species, we explored how species richness and phylogenetic structure of vascular plants correlate with climates on the highest (and species rich) plateau on the Earth. The results showed that most of the vascular plants were distributed on the eastern part of the plateau; there was a strong association between species richness and climate, even after the effects of habitat heterogeneity were controlled. However, the responses of richness to climate remarkably depended on life-forms. Richness of woody plants showed stronger climatic associations than that of herbaceous plants; energy and water availability together regulated richness pattern of woody plants; whereas water availability predominantly regulated richness pattern of herbaceous plants. The phylogenetic structure of vascular species clustered in most areas of the plateau, suggesting that rapid speciation and environment filtering dominated the assembly of communities on the plateau. We further propose that biodiversity conservation in this area should better take into account ecological features for different life-forms and phylogenetic lineages.

  3. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    OpenAIRE

    Skaljac, Marisa; Kanakala, Surapathrudu; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts dete...

  4. Phylogenetic diversity and community structure of sponge-associated bacteria from mangroves of the Caribbean Sea

    KAUST Repository

    Yang, Jiangke

    2011-02-08

    To gain insight into the species richness and phylogeny of the microbial communities associated with sponges in mangroves, we performed an extensive phylogenetic analysis, based on terminal restriction fragment length polymorphism profiling and 16S ribosomal RNA gene sequences, of the 4 sponge species Aplysina fulva, Haliclona hogarthi, Tedania ignis and Ircinia strobilina as well as of ambient seawater. The sponge-associated bacterial communities contained 13 phyla, including Poribacteria and an unclassified group not found in the ambient seawater community, 98% of which comprised Proteobacteria, Cyanobacteria and Bacteroidetes. Although the sponges themselves were phylogenetically distant and bacterial community variation within the host species was observed, microbial phyla such as Proteobacteria, Acidobacteria, Chloroflexi and the unclassified group were consistently observed as the dominant populations within the communities. The sponge-associated bacterial communities resident in the Caribbean Sea mangroves are phylogenetically similar but significantly distinct from communities found in other biogeographical sites such as the deep-water environments of the Caribbean Sea, the South China Sea and Australia. The interspecific variation within the host species and the distinct biogeographical characteristics that the sponge-associated bacteria exhibited indicate that the acquisition, establishment and formation of functional sponge-associated bacterial communities may initially be the product of both vertical and horizontal transmission, and is then shaped by the internal environment created by the sponge species and certain external environmental factors. © Inter-Research 2011.

  5. Phylogenetic and population genetic analyses of diploid Leucaena (Leguminosae; Mimosoideae) reveal cryptic species diversity and patterns of divergent allopatric speciation.

    Science.gov (United States)

    Govindarajulu, Rajanikanth; Hughes, Colin E; Bailey, C Donovan

    2011-12-01

    Leucaena comprises 17 diploid species, five tetraploid species, and a complex series of hybrids whose evolutionary histories have been influenced by human seed translocation, cultivation, and subsequent spontaneous hybridization. Here we investigated patterns of evolutionary divergence among diploid Leucaena through comprehensively sampled multilocus phylogenetic and population genetic approaches to address species delimitation, interspecific relationships, hybridization, and the predominant mode of speciation among diploids. Parsimony- and maximum-likelihood-based phylogenetic approaches were applied to 59 accessions sequenced for six SCAR-based nuclear loci, nrDNA ITS, and four cpDNA regions. Population genetic comparisons included 1215 AFLP loci representing 42 populations and 424 individuals. Phylogenetic results provided a well-resolved hypothesis of divergent species relationships, recovering previously recognized clades of diploids as well as newly resolved relationships. Phylogenetic and population genetic assessments identified two cryptic species that are consistent with geography and morphology. Findings from this study highlight the importance and utility of multilocus data in the recovery of complex evolutionary histories. The results are consistent with allopatric divergence representing the predominant mode of speciation among diploid Leucaena. These findings contrast with the potential hybrid origin of several tetraploid species and highlight the importance of human translocation of seed to the origin of these tetraploids. The recognition of one previously unrecognized species (L. cruziana) and the elevation of another taxon (L. collinsii subsp. zacapana) to specific status (L. zacapana) is consistent with a growing number of newly diagnosed species from neotropical seasonally dry forests, suggesting these communities harbor greater species diversity than previously recognized.

  6. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota)

    Science.gov (United States)

    József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor

    2010-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...

  7. Species richness, but not phylogenetic diversity, influences community biomass production and temporal stability in a re-examination of 16 grassland biodiversity studies

    NARCIS (Netherlands)

    Venail, P.; Gross, K.; Oakley, T.H.; Narwani, A.; Allan, E.; Flombaum, P.; Isbell, F.; Joshi, J.; Reich, P.B.; Tilman, D.; Ruijven, van J.; Cardinale, B.J.

    2015-01-01

    1.Hundreds of experiments have now manipulated species richness of various groups of organisms and examined how this aspect of biological diversity influences ecosystem functioning. Ecologists have recently expanded this field to look at whether phylogenetic diversity among species, often quantified

  8. Identification and phylogenetic analysis of local yellow and orange sweet potatoes genotypes in Sumatera Utara

    Science.gov (United States)

    Rosmayati; Bakti, D.

    2018-02-01

    The objectives of this research was to identify and create database about the diversity of local yellow and orange sweet potatoes accessions in Sumatera Utara, have diversity accession local sweet potatoes genotype in Sumatera Utara selection for classifying populations get high production and good fruit quality. The experiment was conducted in areas of production centers of sweet potatoes in the exploration survey methods in 2 districts in Sumatera Utara, which is in the Kabupaten Simalungun and Dairi. The study was conducted on June to July 2017. Observations were made based on the identification and characterization Description List of International Board for Plant Genetic Resources standard and purposive random sampling technique. The result of this research indicate there 15 genotype of sweet potato yellow and orange in KabupatenSimalungun consistedof KecamatanPurba (G3, G4 and G7), Silimakuta (G5, G6 and G14), and Pamatang Silimahuta (G15) in Kabupaten Dairi consists of Kecamatan Parbuluan (G1, G2, G8 and G9), Sidikalang (G10 and G13), Sumbul (G11), and Sitinjo (G12) with nearest relationship is G13 and G15 with a coefficient similarity 23.908 and farthest relationship is G2 and G7 with a coefficient similarity 140.029.

  9. Energy gradients and the geographic distribution of local ant diversity.

    Science.gov (United States)

    Kaspari, Michael; Ward, Philip S; Yuan, May

    2004-08-01

    Geographical diversity gradients, even among local communities, can ultimately arise from geographical differences in speciation and extinction rates. We evaluated three models--energy-speciation, energy-abundance, and area--that predict how geographic trends in net diversification rates generate trends in diversity. We sampled 96 litter ant communities from four provinces: Australia, Madagascar, North America, and South America. The energy-speciation hypothesis best predicted ant species richness by accurately predicting the slope of the temperature diversity curve, and accounting for most of the variation in diversity. The communities showed a strong latitudinal gradient in species richness as well as inter-province differences in diversity. The former vanished in the temperature-diversity residuals, suggesting that the latitudinal gradient arises primarily from higher diversification rates in the tropics. However, inter-province differences in diversity persisted in those residuals--South American communities remained more diverse than those in North America and Australia even after the effects of temperature were removed.

  10. Ecological Diversity in South American Mammals: Their Geographical Distribution Shows Variable Associations with Phylogenetic Diversity and Does Not Follow the Latitudinal Richness Gradient.

    Directory of Open Access Journals (Sweden)

    Paula Nilda Fergnani

    Full Text Available The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR is informative in terms of ecological diversity (ED, an approximation to functional diversity and phylogenetic diversity (AvPD using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans, mid-Cenozoic immigrants (hystricognaths, primates and newcomers (carnivorans, artiodactyls. If closely related species are ecologically more similar than distantly related species, AvPD will be a strong predictor of ED; however, lower ED than predicted from AvPD may be due to species retaining most of their ancestral characters, suggesting niche conservatism. This pattern could occur in tropical rainforests for taxa of tropical affinity (old autochthonous and mid-Cenozoic immigrants and in open and arid habitats for newcomers. In contrast, higher ED than expected from AvPD could occur, possibly in association with niche evolution, in arid and open habitats for taxa of tropical affinity and in forested habitats for newcomers. We found that TR was a poor predictor of ED and AvPD. After controlling for TR, there was considerable variability in the extent to which AvPD accounted for ED. Taxa of tropical affinity did not support the prediction of ED deficit within tropical rainforests, rather, they showed a mosaic of regions with an excess of ED interspersed with zones of ED deficit within the tropics; newcomers showed ED deficit in arid and open regions. Some taxa of tropical affinity showed excess of ED in tropical desert areas (hystricognaths or temperate semideserts (xenarthrans; newcomers showed excess of ED at cold-temperate latitudes in the Northern Hemisphere. This result suggests that extreme climatic conditions at both temperate and tropical latitudes may have promoted niche evolution in

  11. The evolution of reproductive diversity in Afrobatrachia: A phylogenetic comparative analysis of an extensive radiation of African frogs

    Science.gov (United States)

    Portik, Daniel M.; Blackburn, David C.

    2016-01-01

    The reproductive modes of anurans (frogs and toads) are the most diverse of terrestrial vertebrates, and a major challenge is identifying selective factors that promote the evolution or retention of reproductive modes across clades. Terrestrialized anuran breeding strategies have evolved repeatedly from the plesiomorphic fully aquatic reproductive mode, a process thought to occur through intermediate reproductive stages. Several selective forces have been proposed for the evolution of terrestrialized reproductive traits, but factors such as water systems and co‐evolution with ecomorphologies have not been investigated. We examined these topics in a comparative phylogenetic framework using Afrobatrachian frogs, an ecologically and reproductively diverse clade representing more than half of the total frog diversity found in Africa (∼400 species). We infer direct development has evolved twice independently from terrestrialized reproductive modes involving subterranean or terrestrial oviposition, supporting evolution through intermediate stages. We also detect associations between specific ecomorphologies and oviposition sites, and demonstrate arboreal species exhibit an overall shift toward using lentic water systems for breeding. These results indicate that changes in microhabitat use associated with ecomorphology, which allow access to novel sites for reproductive behavior, oviposition, or larval development, may also promote reproductive mode diversity in anurans. PMID:27402182

  12. The eastern Asian and eastern and western North American floristic disjunction: congruent phylogenetic patterns in seven diverse genera.

    Science.gov (United States)

    Xiang, Q Y; Soltis, D E; Soltis, P S

    1998-10-01

    One of the most remarkable examples of intercontinental disjunction of the North Temperate Flora involves eastern Asia and eastern and western North America. Although there has been considerable interest in this phytogeographic pattern for over 150 years (e.g., Gray, 1859; Li, 1952; Graham, 1972; Boufford and Spongberg, 1983; Wu, 1983; Tiffney, 1985a, 1985b), relationships among taxa displaying the disjunction remain obscure. Understanding phylogenetic relationships is, however, a prerequisite for historical biogeographic analyses of this distributional pattern. To understand better the relationships of taxa displaying this intercontinental disjunction, phylogenetic analyses were conducted using a variety of DNA data sets for species of four genera (Cornus, Boykinia, Tiarella, and Trautvetteria) that occur in eastern Asia, eastern North America, and western North America. An area cladogram was constructed for each of the four genera, all of which show a similar pattern of relationship: the eastern Asian species are sister to all North American species. An identical phylogenetic pattern is also found in three other taxa exhibiting this disjunction (Aralia sect. Aralia, Calycanthus, and Adiantum pedatum). The congruent phylogenetic pattern found in these seven diverse genera raises the possibility of a common origin of the eastern Asia, eastern and western North America disjunction. The data are in agreement with the long-standing hypothesis that this well-known floristic disjunction represents the fragmentation of a once continuous Mixed Mesophytic forest community and suggest that the disjunction may have involved only two major vicariance events: an initial split between Eurasia and North America, followed by the isolation of floras between eastern and western North America. However, congruence between phylogenies and geographic distributions does not necessarily indicate an identical phytogeographic history. Taxa exhibiting the same phylogenetic pattern may have

  13. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  14. Phylogenetic diversity and genotypical complexity of H9N2 influenza A viruses revealed by genomic sequence analysis.

    Directory of Open Access Journals (Sweden)

    Guoying Dong

    Full Text Available H9N2 influenza A viruses have become established worldwide in terrestrial poultry and wild birds, and are occasionally transmitted to mammals including humans and pigs. To comprehensively elucidate the genetic and evolutionary characteristics of H9N2 influenza viruses, we performed a large-scale sequence analysis of 571 viral genomes from the NCBI Influenza Virus Resource Database, representing the spectrum of H9N2 influenza viruses isolated from 1966 to 2009. Our study provides a panoramic framework for better understanding the genesis and evolution of H9N2 influenza viruses, and for describing the history of H9N2 viruses circulating in diverse hosts. Panorama phylogenetic analysis of the eight viral gene segments revealed the complexity and diversity of H9N2 influenza viruses. The 571 H9N2 viral genomes were classified into 74 separate lineages, which had marked host and geographical differences in phylogeny. Panorama genotypical analysis also revealed that H9N2 viruses include at least 98 genotypes, which were further divided according to their HA lineages into seven series (A-G. Phylogenetic analysis of the internal genes showed that H9N2 viruses are closely related to H3, H4, H5, H7, H10, and H14 subtype influenza viruses. Our results indicate that H9N2 viruses have undergone extensive reassortments to generate multiple reassortants and genotypes, suggesting that the continued circulation of multiple genotypical H9N2 viruses throughout the world in diverse hosts has the potential to cause future influenza outbreaks in poultry and epidemics in humans. We propose a nomenclature system for identifying and unifying all lineages and genotypes of H9N2 influenza viruses in order to facilitate international communication on the evolution, ecology and epidemiology of H9N2 influenza viruses.

  15. Genetic Diversity of Local and Introduced Sweet Potato [Ipomoea ...

    African Journals Online (AJOL)

    This study was therefore conducted to estimate the genetic diversity of 114 Sweet potato [Ipomoea batatas (L.) Lam] accessions obtained from Nigeria, Asia, Latin America and Local collections along with two improved varieties. Accessions were planted in 2012/13 cropping season at Haramaya University, eastern Ethiopia ...

  16. Local Convergence and Global Diversity : From Interpersonal to Social Influence

    NARCIS (Netherlands)

    Flache, Andreas; Macy, Michael W.

    2011-01-01

    How can minority cultures resist assimilation into a global monolith in an increasingly "small world"? Paradoxically, Axelrod found that local convergence can actually preserve global diversity if cultural influence is combined with homophily, the principle that "likes attract." However, follow-up

  17. Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

    Science.gov (United States)

    Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

    2016-07-01

    Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Characterization of bud emergence 46 (BEM46) protein: Sequence, structural, phylogenetic and subcellular localization analyses

    International Nuclear Information System (INIS)

    Kumar, Abhishek; Kollath-Leiß, Krisztina; Kempken, Frank

    2013-01-01

    Highlights: •All eukaryotes have at least a single copy of a bem46 ortholog. •The catalytic triad of BEM46 is illustrated using sequence and structural analysis. •We identified indels in the conserved domain of BEM46 protein. •Localization studies of BEM46 protein were carried out using GFP-fusion tagging. -- Abstract: The bud emergence 46 (BEM46) protein from Neurospora crassa belongs to the α/β-hydrolase superfamily. Recently, we have reported that the BEM46 protein is localized in the perinuclear ER and also forms spots close by the plasma membrane. The protein appears to be required for cell type-specific polarity formation in N. crassa. Furthermore, initial studies suggested that the BEM46 amino acid sequence is conserved in eukaryotes and is considered to be one of the widespread conserved “known unknown” eukaryotic genes. This warrants for a comprehensive phylogenetic analysis of this superfamily to unravel origin and molecular evolution of these genes in different eukaryotes. Herein, we observe that all eukaryotes have at least a single copy of a bem46 ortholog. Upon scanning of these proteins in various genomes, we find that there are expansions leading into several paralogs in vertebrates. Usingcomparative genomic analyses, we identified insertion/deletions (indels) in the conserved domain of BEM46 protein, which allow to differentiate fungal classes such as ascomycetes from basidiomycetes. We also find that exonic indels are able to differentiate BEM46 homologs of different eukaryotic lineage. Furthermore, we unravel that BEM46 protein from N. crassa possess a novel endoplasmic-retention signal (PEKK) using GFP-fusion tagging experiments. We propose that three residues namely a serine 188S, a histidine 292H and an aspartic acid 262D are most critical residues, forming a catalytic triad in BEM46 protein from N. crassa. We carried out a comprehensive study on bem46 genes from a molecular evolution perspective with combination of functional

  19. Characterization of bud emergence 46 (BEM46) protein: Sequence, structural, phylogenetic and subcellular localization analyses

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Abhishek; Kollath-Leiß, Krisztina; Kempken, Frank, E-mail: fkempken@bot.uni-kiel.de

    2013-08-30

    Highlights: •All eukaryotes have at least a single copy of a bem46 ortholog. •The catalytic triad of BEM46 is illustrated using sequence and structural analysis. •We identified indels in the conserved domain of BEM46 protein. •Localization studies of BEM46 protein were carried out using GFP-fusion tagging. -- Abstract: The bud emergence 46 (BEM46) protein from Neurospora crassa belongs to the α/β-hydrolase superfamily. Recently, we have reported that the BEM46 protein is localized in the perinuclear ER and also forms spots close by the plasma membrane. The protein appears to be required for cell type-specific polarity formation in N. crassa. Furthermore, initial studies suggested that the BEM46 amino acid sequence is conserved in eukaryotes and is considered to be one of the widespread conserved “known unknown” eukaryotic genes. This warrants for a comprehensive phylogenetic analysis of this superfamily to unravel origin and molecular evolution of these genes in different eukaryotes. Herein, we observe that all eukaryotes have at least a single copy of a bem46 ortholog. Upon scanning of these proteins in various genomes, we find that there are expansions leading into several paralogs in vertebrates. Usingcomparative genomic analyses, we identified insertion/deletions (indels) in the conserved domain of BEM46 protein, which allow to differentiate fungal classes such as ascomycetes from basidiomycetes. We also find that exonic indels are able to differentiate BEM46 homologs of different eukaryotic lineage. Furthermore, we unravel that BEM46 protein from N. crassa possess a novel endoplasmic-retention signal (PEKK) using GFP-fusion tagging experiments. We propose that three residues namely a serine 188S, a histidine 292H and an aspartic acid 262D are most critical residues, forming a catalytic triad in BEM46 protein from N. crassa. We carried out a comprehensive study on bem46 genes from a molecular evolution perspective with combination of functional

  20. Phylogenetic diversity of hpnP, the hopanoid methylase, and its implications for 2-methylhopanoids as biomarkers

    Science.gov (United States)

    Ricci, J. N.; Coleman, M. L.; Osburn, M. R.; Sessions, A. L.; Spear, J. R.; Newman, D. K.

    2011-12-01

    Hopanoids are a class of sterols produced by bacteria. Their hydrocarbon skeletons are resistant to degradation making their diagenetic products, hopanes, attractive biomarkers. Particular attention has been paid to 2-methylhopanes, which have been found at discrete times and locations in Earth history as far back as 2,500 Myr. Previously, they were inferred to be markers of oxygenic photosynthesis in cyanobacteria, but the discovery of an anoxygenic phototroph, Rhodopseudomonas palustris TIE-1, capable of producing significant quantities of 2-methylbacteriohopanetetrol, the parent molecule of the fossil 2-methylhopane, challenged this interpretation. In this study, we sought to determine the diversity and origin of the enzyme responsible for methylating hopanoids, HpnP. To accomplish this task, we surveyed a diversity of Yellowstone hot springs using degenerate PCR primers and searched publically available metagenomic databases for hpnP-like sequences. The Yellowstone hot spring samples were dominated by cyanobacterial-like hpnP sequences, while the metagenomic data contained many hpnP-like sequences from a diversity of environments that grouped with all known hpnP-containing phyla. With these additional hpnP sequences, we will report updated phylogenetic trees that attempt to determine the origin of hpnP. Understanding the distribution of 2-methylhopanoid production throughout the tree of life and its origin is important to be able to use 2-methylhopanes as biomarkers for any particular taxonomic group.

  1. Phylogenetic diversity of lactic acid bacteria associated with paddy rice silage as determined by 16S ribosomal DNA analysis.

    Science.gov (United States)

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.

  2. Population structure and phylogenetic relationships in a diverse panel of Brassica rapa L

    Science.gov (United States)

    The crop species Brassica rapa L. has significant economic importance around the globe. Crop domestication and improvement has resulted in extreme phenotypic diversity and subspecies that are used for oilseed, food for human consumption and fodder for livestock. However, the global distribution and ...

  3. PHYLOGENETIC AND FUNCTIONAL DIVERSITY OF SEAGULL AND CANADIAN GEESE FECAL MICROBIAL COMMUNITIES

    Science.gov (United States)

    In spite of increasing public health concerns on the risks associated with swimming in waters contaminated with waterfowl feces, there is little information on the gut microbial communities of aquatic birds. To address the molecular microbial diversity of waterfowl, 16S rDNA and ...

  4. Phylogenetic and Functional Diversity of Total (DNA) and Expressed (RNA) Bacterial Communities in Urban Green Infrastructure Bioswale Soils.

    Science.gov (United States)

    Gill, Aman S; Lee, Angela; McGuire, Krista L

    2017-08-15

    New York City (NYC) is pioneering green infrastructure with the use of bioswales and other engineered soil-based habitats to provide stormwater infiltration and other ecosystem functions. In addition to avoiding the environmental and financial costs of expanding traditional built infrastructure, green infrastructure is thought to generate cobenefits in the form of diverse ecological processes performed by its plant and microbial communities. Yet, although plant communities in these habitats are closely managed, we lack basic knowledge about how engineered ecosystems impact the distribution and functioning of soil bacteria. We sequenced amplicons of the 16S ribosomal subunit, as well as seven genes associated with functional pathways, generated from both total (DNA-based) and expressed (RNA) soil communities in the Bronx, NYC, NY, in order to test whether bioswale soils host characteristic bacterial communities with evidence for enriched microbial functioning, compared to nonengineered soils in park lawns and tree pits. Bioswales had distinct, phylogenetically diverse bacterial communities, including taxa associated with nutrient cycling and metabolism of hydrocarbons and other pollutants. Bioswale soils also had a significantly greater diversity of genes involved in several functional pathways, including carbon fixation ( cbbL-R [ cbbL gene, red-like subunit] and apsA ), nitrogen cycling ( noxZ and amoA ), and contaminant degradation ( bphA ); conversely, no functional genes were significantly more abundant in nonengineered soils. These results provide preliminary evidence that urban land management can shape the diversity and activity of soil communities, with positive consequences for genetic resources underlying valuable ecological functions, including biogeochemical cycling and degradation of common urban pollutants. IMPORTANCE Management of urban soil biodiversity by favoring taxa associated with decontamination or other microbial metabolic processes is a

  5. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  6. Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs.

    Science.gov (United States)

    Amarouche-Yala, Samia; Benouadah, Ali; El Ouahab Bentabet, Abd; López-García, Purificación

    2014-11-01

    Geothermal springs in Algeria have been known since the Roman Empire. They mainly locate in Eastern Algeria and are inhabited by thermophilic organisms, which include cyanobacteria forming mats and concretions. In this work, we have investigated the cyanobacterial diversity of these springs. Cyanobacteria were collected from water, concretions and mats in nine hot springs with water temperatures ranging from 39 to 93 °C. Samples were collected for isolation in culture, microscopic morphological examination, and molecular diversity analysis based on 16S rRNA gene sequences. Nineteen different cyanobacterial morphotypes were identified, the most abundant of which were three species of Leptolyngbya, accompanied by members of the genera Gloeocapsa, Gloeocapsopsis, Stigonema, Fischerella, Synechocystis, Microcoleus, Cyanobacterium, Chroococcus and Geitlerinema. Molecular diversity analyses were in good general agreement with classical identification and allowed the detection of additional species in three springs with temperatures higher than 50 °C. They corresponded to a Synechococcus clade and to relatives of the intracellularly calcifying Candidatus Gloeomargarita lithophora. The hottest springs were dominated by members of Leptolyngbya, Synechococcus-like cyanobacteria and Gloeomargarita, whereas Oscillatoriales other than Leptolyngbya, Chroococcales and Stigonematales dominated lower temperature springs. The isolation of some of these strains sets the ground for future studies on the biology of thermophilic cyanobacteria.

  7. Phylogenetic diversity and functional characterization of the Manila clam microbiota: a culture-based approach.

    Science.gov (United States)

    Leite, Laura; Jude-Lemeilleur, Florence; Raymond, Natalie; Henriques, Isabel; Garabetian, Frédéric; Alves, Artur

    2017-09-01

    According to the hologenome theory, the microbiota contributes to the fitness of the holobiont having an important role in its adaptation, survival, development, health, and evolution. Environmental stress also affects the microbiota and its capability to assist the holobiont in coping with stress factors. Here, we analyzed the diversity of cultivable bacteria associated with Manila clam tissues (mantle, gills, hemolymph) in two non-contaminated sites (Portugal and France) and one metal-contaminated site (Portugal). A total of 240 isolates were obtained. Representative isolates (n = 198) of the overall diversity were identified by 16S rDNA sequencing and subjected to functional characterization. Isolates affiliated with Proteobacteria, Actinobacteria, Firmicutes, and Bacteroidetes. Proteobacteria (mostly Pseudoalteromonadaceae and Vibrionaceae) were dominant in non-contaminated sites while Actinobacteria (mostly Microbacteriaceae) dominated in the metal-contaminated site. The main factor affecting the microbiota composition was contamination. No significant differences were observed between clam tissues and geographic regions. Several isolates tested positive for antibacterial activity, biofilm formation, protease, and siderophore production. The results show that the Manila clam harbors a diverse microbiota that may contribute to clam protection and overall fitness, as well as to its adaptation to stressful environments. In addition, the Manila clam microbiota is revealed as a promising source of novel probiotics with potential application in aquaculture.

  8. Phylogenetic diversity of ceftriaxone resistance and the presence of extended-spectrum β-lactamase genes in the culturable soil resistome.

    Science.gov (United States)

    Pagaling, Eulyn; Gatica, Joao; Yang, Kun; Cytryn, Eddie; Yan, Tao

    2016-09-01

    The aim of this study was to determine the phylogenetic diversity of ceftriaxone resistance and the presence of known extended-spectrum β-lactamase (ESBL) genes in culturable soil resistomes. Libraries of soil bacterial isolates resistant to ceftriaxone were established from six physicochemically diverse soils collected in Hawaii (USA) and Israel. The phylogenetic affiliation, ceftriaxone and multidrug resistance levels, and presence of known ESBL genes of the isolates were determined. The soil bacterial isolates were phylogenetically grouped with the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes and Bacteroidetes. Ceftriaxone minimum inhibitory concentrations (MICs) largely followed the phylogeny structure and higher levels of ceftriaxone resistance corresponded to higher multidrug resistance. Three distinct blaTEM variants were detected in soil bacterial isolates belonging to nine different genera. In conclusion, the culturable soil resistomes for ceftriaxone exhibited high phylogenetic diversity and multidrug resistance. blaTEM was the only known ESBL detected in the soil resistomes, and its distribution in different phylogenetic groups suggests its ubiquitous presence and/or possible horizontal gene transfer within the soil microbiomes. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  9. Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore

    Science.gov (United States)

    Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

    2016-01-01

    INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667

  10. Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore.

    Science.gov (United States)

    Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

    2016-12-01

    Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association

  11. Phylogenetic diversity and environment-specific distributions of glycosyl hydrolase family 10 xylanases in geographically distant soils.

    Directory of Open Access Journals (Sweden)

    Guozeng Wang

    Full Text Available BACKGROUND: Xylan is one of the most abundant biopolymers on Earth. Its degradation is mediated primarily by microbial xylanase in nature. To explore the diversity and distribution patterns of xylanase genes in soils, samples of five soil types with different physicochemical characters were analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Partial xylanase genes of glycoside hydrolase (GH family 10 were recovered following direct DNA extraction from soil, PCR amplification and cloning. Combined with our previous study, a total of 1084 gene fragments were obtained, representing 366 OTUs. More than half of the OTUs were novel (identities of <65% with known xylanases and had no close relatives based on phylogenetic analyses. Xylanase genes from all the soil environments were mainly distributed in Bacteroidetes, Proteobacteria, Acidobacteria, Firmicutes, Actinobacteria, Dictyoglomi and some fungi. Although identical sequences were found in several sites, habitat-specific patterns appeared to be important, and geochemical factors such as pH and oxygen content significantly influenced the compositions of xylan-degrading microbial communities. CONCLUSION/SIGNIFICANCE: These results provide insight into the GH 10 xylanases in various soil environments and reveal that xylan-degrading microbial communities are environment specific with diverse and abundant populations.

  12. Peptide-Like Nylon-3 Polymers with Activity against Phylogenetically Diverse, Intrinsically Drug-Resistant Pathogenic Fungi.

    Science.gov (United States)

    Rank, Leslie A; Walsh, Naomi M; Lim, Fang Yun; Gellman, Samuel H; Keller, Nancy P; Hull, Christina M

    2018-01-01

    Understanding the dimensions of fungal diversity has major implications for the control of diseases in humans, plants, and animals and in the overall health of ecosystems on the planet. One ancient evolutionary strategy organisms use to manage interactions with microbes, including fungi, is to produce host defense peptides (HDPs). HDPs and their synthetic analogs have been subjects of interest as potential therapeutic agents. Due to increases in fungal disease worldwide, there is great interest in developing novel antifungal agents. Here we describe activity of polymeric HDP analogs against fungi from 18 pathogenic genera composed of 41 species and 72 isolates. The synthetic polymers are members of the nylon-3 family (poly-β-amino acid materials). Three different nylon-3 polymers show high efficacy against surprisingly diverse fungi. Across the phylogenetic spectrum (with the exception of Aspergillus species), yeasts, dermatophytes, dimorphic fungi, and molds were all sensitive to the effects of these polymers. Even fungi intrinsically resistant to current antifungal drugs, such as the causative agents of mucormycosis ( Rhizopus spp.) and those with acquired resistance to azole drugs, showed nylon-3 polymer sensitivity. In addition, the emerging pathogens Pseudogymnoascus destructans (cause of white nose syndrome in bats) and Candida auris (cause of nosocomial infections of humans) were also sensitive. The three nylon-3 polymers exhibited relatively low toxicity toward mammalian cells. These findings raise the possibility that nylon-3 polymers could be useful against fungi for which there are only limited and/or no antifungal agents available at present. IMPORTANCE Fungi reside in all ecosystems on earth and impart both positive and negative effects on human, plant, and animal health. Fungal disease is on the rise worldwide, and there is a critical need for more effective and less toxic antifungal agents. Nylon-3 polymers are short, sequence random, poly

  13. Phylogenetic diversity of fungal communities in areas accessible and not accessible to tourists in Naracoorte Caves.

    Science.gov (United States)

    Adetutu, Eric M; Thorpe, Krystal; Bourne, Steven; Cao, Xiangsheng; Shahsavari, Esmaeil; Kirby, Greg; Ball, Andrew S

    2011-01-01

    The fungal diversity in areas accessible and not accessible to tourists at UNESCO World Heritage-listed Naracoorte Caves was investigated with culture-dependent and culture-independent techniques for assistance in cave management protocol development. The caves were selected based on tourist numbers and configurations: Stick Tomato (open, high numbers), Alexandra (lockable openings, high numbers) and Strawhaven (control; no access). Culture-based survey revealed Ascomycota dominance irrespective of sampling area with Microascales (Trichurus sp.) being most frequently isolated. Some Hypocreales-like sequences belonging to Fusarium sp., Trichoderma sp. and Neonectria sp. (Stick Tomato) were cultured only from areas not accessible to tourists. These orders also were detected by DGGE assay irrespective of sampling area. The predominance of Ascomycota (especially Microascales) suggested their important ecological roles in these caves. Culture-independent analysis showed higher Shannon fungal diversity values (from ITS-based DGGE profiles) in tourist-accessible areas of these caves than in inaccessible areas with the fungal community banding patterns being substantially different in Stick Tomato Cave. Further investigations are needed to determine the cause of the differences in the fungal communities of Stick Tomato Cave, although cave-related factors such as use, configuration and sediment heterogeneity might have contributed to these differences.

  14. Comparative Analysis of Glycoside Hydrolases Activities from Phylogenetically Diverse Marine Bacteria of the Genus Arenibacter

    Directory of Open Access Journals (Sweden)

    Valery Mikhailov

    2013-06-01

    Full Text Available A total of 16 marine strains belonging to the genus Arenibacter, recovered from diverse microbial communities associated with various marine habitats and collected from different locations, were evaluated in degradation of natural polysaccharides and chromogenic glycosides. Most strains were affiliated with five recognized species, and some presented three new species within the genus Arenibacter. No strains contained enzymes depolymerizing polysaccharides, but synthesized a wide spectrum of glycosidases. Highly active β-N-acetylglucosaminidases and α-N-acetylgalactosaminidases were the main glycosidases for all Arenibacter. The genes, encoding two new members of glycoside hydrolyses (GH families, 20 and 109, were isolated and characterized from the genomes of Arenibacter latericius. Molecular genetic analysis using glycosidase-specific primers shows the absence of GH27 and GH36 genes. A sequence comparison with functionally-characterized GH20 and GH109 enzymes shows that both sequences are closest to the enzymes of chitinolytic bacteria Vibrio furnissii and Cellulomonas fimi of marine and terrestrial origin, as well as human pathogen Elisabethkingia meningoseptica and simbionts Akkermansia muciniphila, gut and non-gut Bacteroides, respectively. These results revealed that the genus Arenibacter is a highly taxonomic diverse group of microorganisms, which can participate in degradation of natural polymers in marine environments depending on their niche and habitat adaptations. They are new prospective candidates for biotechnological applications due to their production of unique glycosidases.

  15. Linking phylogenetic and functional diversity to nutrient spiraling in microbial mats from Lower Kane Cave (USA).

    Science.gov (United States)

    Engel, Annette Summers; Meisinger, Daniela B; Porter, Megan L; Payn, Robert A; Schmid, Michael; Stern, Libby A; Schleifer, K H; Lee, Natuschka M

    2010-01-01

    Microbial mats in sulfidic cave streams offer unique opportunities to study redox-based biogeochemical nutrient cycles. Previous work from Lower Kane Cave, Wyoming, USA, focused on the aerobic portion of microbial mats, dominated by putative chemolithoautotrophic, sulfur-oxidizing groups within the Epsilonproteobacteria and Gammaproteobacteria. To evaluate nutrient cycling and turnover within the whole mat system, a multidisciplinary strategy was used to characterize the anaerobic portion of the mats, including application of the full-cycle rRNA approach, the most probable number method, and geochemical and isotopic analyses. Seventeen major taxonomic bacterial groups and one archaeal group were retrieved from the anaerobic portions of the mats, dominated by Deltaproteobacteria and uncultured members of the Chloroflexi phylum. A nutrient spiraling model was applied to evaluate upstream to downstream changes in microbial diversity based on carbon and sulfur nutrient concentrations. Variability in dissolved sulfide concentrations was attributed to changes in the abundance of sulfide-oxidizing microbial groups and shifts in the occurrence and abundance of sulfate-reducing microbes. Gradients in carbon and sulfur isotopic composition indicated that released and recycled byproduct compounds from upstream microbial activities were incorporated by downstream communities. On the basis of the type of available chemical energy, the variability of nutrient species in a spiraling model may explain observed differences in microbial taxonomic affiliations and metabolic functions, thereby spatially linking microbial diversity to nutrient spiraling in the cave stream ecosystem.

  16. Phylogenetic, Metabolic, and Taxonomic Diversities Shape Mediterranean Fruit Fly Microbiotas during Ontogeny

    Science.gov (United States)

    Aharon, Yael; Pasternak, Zohar; Ben Yosef, Michael; Behar, Adi; Lauzon, Carol; Yuval, Boaz

    2013-01-01

    The Mediterranean fruit fly (medfly) (Ceratitis capitata) lays eggs in fruits, where larvae subsequently develop, causing large-scale agricultural damage. Within its digestive tract, the fly supports an extended bacterial community that is composed of multiple strains of a variety of enterobacterial species. Most of these bacteria appear to be functionally redundant, with most strains sustaining diazotrophy and/or pectinolysis. At least some of these bacteria were shown to be vertically inherited, but colonization, structural, and metabolic aspects of the community's dynamics have not been investigated. We used fluorescent in situ hybridization, metabolic profiling, plate cultures, and pyrosequencing to show that an initial, egg-borne, diverse community expands throughout the fly's life cycle. While keeping “core” diazotrophic and pectinolytic functions, it also harbors diverse and fluctuating populations that express varied metabolic capabilities. We suggest that the metabolic and compositional plasticity of the fly's microbiota provides potential adaptive advantages to the medfly host and that its acquisition and dynamics are affected by mixed processes that include stochastic effects, host behavior, and molecular barriers. PMID:23104413

  17. Activity and Phylogenetic Diversity of Bacterial Cells with High and Low Nucleic Acid Content and Electron Transport System Activity in an Upwelling Ecosystem

    OpenAIRE

    Longnecker, K.; Sherr, B. F.; Sherr, E. B.

    2005-01-01

    We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters...

  18. Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

    DEFF Research Database (Denmark)

    Nielsen, L; Arctander, P; Jensen, T H

    2009-01-01

    To investigate the possible origin and spread of the dramatic re-emergent 2002 distemper epizootic observed among seals in Danish Waters, we have sequenced wild-type genes of the attachment (H) glycoproteins of viruses from both the 2002 and 1988 epizootics. Phylogenetic analysis of the H genes...... of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...... epizootic in Danish Waters was investigated and determined to be caused by canine distemper virus, the closest relative of PDV, revealing no direct epidemiological link to the seal epizootics. (C) 2009 Elsevier B.V. All rights reserved....

  19. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  20. Phylogenetic and functional diversity of the cultivable bacterial community associated with the paralytic shellfish poisoning dinoflagellate Gymnodinium catenatum.

    Science.gov (United States)

    Green, David H; Llewellyn, Lyndon E; Negri, Andrew P; Blackburn, Susan I; Bolch, Christopher J S

    2004-03-01

    Gymnodinium catenatum is one of several dinoflagellates that produce a suite of neurotoxins called the paralytic shellfish toxins (PST), responsible for outbreaks of paralytic shellfish poisoning in temperate and tropical waters. Previous research suggested that the bacteria associated with the surface of the sexual resting stages (cyst) were important to the production of PST by G. catenatum. This study sought to characterise the cultivable bacterial diversity of seven different strains of G. catenatum that produce both high and abnormally low amounts of PST, with the long-term aim of understanding the role the bacterial flora has in bloom development and toxicity of this alga. Sixty-one bacterial isolates were cultured and phylogenetically identified as belonging to the Proteobacteria (70%), Bacteroidetes (26%) or Actinobacteria (3%). The Alphaproteobacteria were the most numerous both in terms of the number of isolates cultured (49%) and were also the most abundant type of bacteria in each G. catenatum culture. Two phenotypic (functional) traits inferred from the phylogenetic data were shown to be a common feature of the bacteria present in each G. catenatum culture: firstly, Alphaproteobacteria capable of aerobic anoxygenic photosynthesis, and secondly, Gammaproteobacteria capable of hydrocarbon utilisation and oligotrophic growth. In relation to reports of autonomous production of PST by dinoflagellate-associated bacteria, PST production by bacterial isolates was investigated, but none were shown to produce any PST-like toxins. Overall, this study has identified a number of emergent trends in the bacterial community of G. catenatum which are mirrored in the bacterial flora of other dinoflagellates, and that are likely to be of especial relevance to the population dynamics of natural and harmful algal blooms.

  1. Diversity of bacteria carried by pinewood nematode in USA and phylogenetic comparison with isolates from other countries.

    Directory of Open Access Journals (Sweden)

    Diogo Neves Proença

    Full Text Available Pine wilt disease (PWD is native to North America and has spread to Asia and Europe. Lately, mutualistic relationship has been suggested between the pinewood nematode (PWN, Bursaphelenchus xylophilus the causal nematode agent of PWD, and bacteria. In countries where PWN occurs, nematodes from diseased trees were reported to carry bacteria from several genera. However no data exists for the United States. The objective of this study was to evaluate the diversity of the bacterial community carried by B. xylophilus, isolated from different Pinus spp. with PWD in Nebraska, United States. The bacteria carried by PWN belonged to Gammaproteobacteria (79.9%, Betaproteobacteria (11.7%, Bacilli (5.0%, Alphaproteobacteria (1.7% and Flavobacteriia (1.7%. Strains from the genera Chryseobacterium and Pigmentiphaga were found associated with the nematode for the first time. These results were compared to results from similar studies conducted from other countries of three continents in order to assess the diversity of bacteria with associated with PWN. The isolates from the United States, Portugal and China belonged to 25 different genera and only strains from the genus Pseudomonas were found in nematodes from all countries. The strains from China were closely related to P. fluorescens and the strains isolated from Portugal and USA were phylogenetically related to P. mohnii and P. lutea. Nematodes from the different countries are associated with bacteria of different species, not supporting a relationship between PWN with a particular bacterial species. Moreover, the diversity of the bacteria carried by the pinewood nematode seems to be related to the geographic area and the Pinus species. The roles these bacteria play within the pine trees or when associated with the nematodes, might be independent of the presence of the nematode in the tree and only related on the bacteria's relationship with the tree.

  2. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany.

    Directory of Open Access Journals (Sweden)

    Jessica Joerling

    09085, and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA, tlyC, and hlyA. Our data indicate that in Germany, swine dysentery might be caused by a limited number of B. hyodysenteriae clonal groups. Major STs (ST8, ST52, and ST112 are shared with other countries in Europe suggesting a possible role of the European intra-Community trade of pigs in the dissemination of certain clones. The identification of several novel STs, some of which are single or double locus variants of ST52, may on the other hand hint towards an ongoing diversification of the pathogen in the studied area. The linkage of pleuromutilin susceptibility and sequence type of an isolate might reflect a clonal expansion of the underlying resistance mechanism, namely mutations in the ribosomal RNA genes. A linkage between single virulence-associated genes (VAGs or even VAG patterns and the phylogenetic background of the isolates could not be established, since almost all VAGs were regularly present in the isolates.

  4. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany

    Science.gov (United States)

    Joerling, Jessica; Barth, Stefanie A.; Schlez, Karen; Willems, Hermann

    2018-01-01

    09085, and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA, tlyC, and hlyA. Our data indicate that in Germany, swine dysentery might be caused by a limited number of B. hyodysenteriae clonal groups. Major STs (ST8, ST52, and ST112) are shared with other countries in Europe suggesting a possible role of the European intra-Community trade of pigs in the dissemination of certain clones. The identification of several novel STs, some of which are single or double locus variants of ST52, may on the other hand hint towards an ongoing diversification of the pathogen in the studied area. The linkage of pleuromutilin susceptibility and sequence type of an isolate might reflect a clonal expansion of the underlying resistance mechanism, namely mutations in the ribosomal RNA genes. A linkage between single virulence-associated genes (VAGs) or even VAG patterns and the phylogenetic background of the isolates could not be established, since almost all VAGs were regularly present in the isolates. PMID:29324785

  5. Microenvironment and phylogenetic diversity of Prochloron inhabiting the surface of crustose didemnid ascidians.

    Science.gov (United States)

    Nielsen, Daniel A; Pernice, Mathieu; Schliep, Martin; Sablok, Gaurav; Jeffries, Thomas C; Kühl, Michael; Wangpraseurt, Daniel; Ralph, Peter J; Larkum, Anthony W D

    2015-10-01

    The cyanobacterium Prochloron didemni is primarily found in symbiotic relationships with various marine hosts such as ascidians and sponges. Prochloron remains to be successfully cultivated outside of its host, which reflects a lack of knowledge of its unique ecophysiological requirements. We investigated the microenvironment and diversity of Prochloron inhabiting the upper, exposed surface of didemnid ascidians, providing the first insights into this microhabitat. The pH and O2 concentration in this Prochloron biofilm changes dynamically with irradiance, where photosynthetic activity measurements showed low light adaptation (Ek ∼ 80 ± 7 μmol photons m(-2) s(-1)) but high light tolerance. Surface Prochloron cells exhibited a different fine structure to Prochloron cells from cloacal cavities in other ascidians, the principle difference being a central area of many vacuoles dissected by single thylakoids in the surface Prochloron. Cyanobacterial 16S rDNA pyro-sequencing of the biofilm community on four ascidians resulted in 433 operational taxonomic units (OTUs) where on average -85% (65-99%) of all sequence reads, represented by 136 OTUs, were identified as Prochloron via blast search. All of the major Prochloron-OTUs clustered into independent, highly supported phylotypes separate from sequences reported for internal Prochloron, suggesting a hitherto unexplored genetic variability among Prochloron colonizing the outer surface of didemnids. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Tiny worms from a mighty continent: high diversity and new phylogenetic lineages of African monogeneans.

    Science.gov (United States)

    Přikrylová, Iva; Vanhove, Maarten P M; Janssens, Steven B; Billeter, Paul A; Huyse, Tine

    2013-04-01

    The family Gyrodactylidae contains one of the most significant radiations of platyhelminth fish parasites. The so-called hyperviviparity is very rare in the animal kingdom, and the rapid generation time can lead to an explosive population growth, which can cause massive losses in farmed fish. Here we present the first molecular phylogeny including all-but-one African genera, inferred from ITS and 18S rDNA sequences. The validity of nominal genera is discussed in relation to the systematic value of morphological characters traditionally used for generic identification. New complete 18S rDNA sequences of 18 gyrodactylid species of eight genera together with ITS rDNA gene sequences of eight species representing seven genera were generated and complemented with GenBank sequences. The maximum likelihood and Bayesian analyses pointed to a paraphyletic nature of African Gyrodactylus species. They formed well-supported clades possibly indicating speciation within host taxa: (1) parasites of cichlids (Cichlidae); (2) parasites of catfishes (Siluriformes), consisting of a lineage infecting mochokids and one infecting clariids. Macrogyrodactylus spp. firmly clustered into a monophyletic group. We found that Swingleus and Fundulotrema are very closely related and clearly cluster within Gyrodactylus. This supports earlier claims as to the paraphyly of the nominal genus Gyrodactylus as it is currently defined, and necessitates a revision of Swingleus and Fundulotrema. Molecular dating estimates confirmed a relatively young, certainly post-Gondwanan, origin of gyrodactylid lineages. Building on the previously suggested South-American origin of viviparous gyrodactylids, the dataset suggests subsequent intercontinental dispersal to Africa and from there repeated colonisation of the Holarctic. Even though the African continent has been heavily under sampled, the present diversity is far greater than in the intensively studied European fauna, probably because of the high endemicity

  7. Evidence of Increased Antibiotic Resistance in Phylogenetically-Diverse Aeromonas Isolates from Semi-Intensive Fish Ponds Treated with Antibiotics.

    Science.gov (United States)

    Patil, Hemant J; Benet-Perelberg, Ayana; Naor, Alon; Smirnov, Margarita; Ofek, Tamir; Nasser, Ahmed; Minz, Dror; Cytryn, Eddie

    2016-01-01

    The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain the effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically to fingerling stocks and water column-associated Aeromonas were monitored periodically over an 11-month fish fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a 3-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas isolates were initially screened for sulfadiazine resistance and further screened against five additional antimicrobials. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamicin, and chloramphenicol resistances were low. Multidrug resistant strains as well as sul1, tetA , and intI1 gene-harboring strains were significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically distinct Aeromonas clusters were identified using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were identified, including an A. salmonicida

  8. Evidence of increased antibiotic resistance in phylogenetically-diverse Aeromonas isolates from semi-intensive fish ponds treated with antibiotics

    Directory of Open Access Journals (Sweden)

    Hemant J Patil

    2016-11-01

    Full Text Available The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically upon fingerling stocking and water column-associated Aeromonas were monitored periodically over an eleven-month fish-fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a three-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas spp. were isolated, initially screened for sulfadiazine resistance and further screened against five additional antibiotics. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamycin and chloramphenicol resistances were low. Abundance of multi-drug resistant strains as well as sul1, tetA and intI1 gene-harboring strains was significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically-distinct Aeromonas clusters were revealed using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were

  9. Metagenomic-based study of the phylogenetic and functional gene diversity in Galápagos land and marine iguanas.

    Science.gov (United States)

    Hong, Pei-Ying; Mao, Yuejian; Ortiz-Kofoed, Shannon; Shah, Rushabh; Cann, Isaac; Mackie, Roderick I

    2015-02-01

    In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.

  10. Shifts in phylogenetic diversity of archaeal communities in mangrove sediments at different sites and depths in southeastern Brazil.

    Science.gov (United States)

    Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui

    2012-06-01

    This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Metagenomic-Based Study of the Phylogenetic and Functional Gene Diversity in Galápagos Land and Marine Iguanas

    KAUST Repository

    Hong, Pei-Ying

    2014-12-19

    In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.

  12. Combining phylogenetic and demographic inferences to assess the origin of the genetic diversity in an isolated wolf population.

    Directory of Open Access Journals (Sweden)

    Luca Montana

    Full Text Available The survival of isolated small populations is threatened by both demographic and genetic factors. Large carnivores declined for centuries in most of Europe due to habitat changes, overhunting of their natural prey and direct persecution. However, the current rewilding trends are driving many carnivore populations to expand again, possibly reverting the erosion of their genetic diversity. In this study we reassessed the extent and origin of the genetic variation of the Italian wolf population, which is expanding after centuries of decline and isolation. We genotyped wolves from Italy and other nine populations at four mtDNA regions (control-region, ATP6, COIII and ND4 and 39 autosomal microsatellites. Results of phylogenetic analyses and assignment procedures confirmed in the Italian wolves a second private mtDNA haplotype, which belongs to a haplogroup distributed mostly in southern Europe. Coalescent analyses showed that the unique mtDNA haplotypes in the Italian wolves likely originated during the late Pleistocene. ABC simulations concordantly showed that the extant wolf populations in Italy and in south-western Europe started to be isolated and declined right after the last glacial maximum. Thus, the standing genetic variation in the Italian wolves principally results from the historical isolation south of the Alps.

  13. Application of the major capsid protein as a marker of the phylogenetic diversity of Emiliania huxleyi viruses.

    Science.gov (United States)

    Rowe, Janet M; Fabre, Marie-Françoise; Gobena, Daniel; Wilson, William H; Wilhelm, Steven W

    2011-05-01

    Studies of the Phycodnaviridae have traditionally relied on the DNA polymerase (pol) gene as a biomarker. However, recent investigations have suggested that the major capsid protein (MCP) gene may be a reliable phylogenetic biomarker. We used MCP gene amplicons gathered across the North Atlantic to assess the diversity of Emiliania huxleyi-infecting Phycodnaviridae. Nucleotide sequences were examined across >6000 km of open ocean, with comparisons between concentrates of the virus-size fraction of seawater and of lysates generated by exposing host strains to these same virus concentrates. Analyses revealed that many sequences were only sampled once, while several were over-represented. Analyses also revealed nucleotide sequences distinct from previous coastal isolates. Examination of lysed cultures revealed a new richness in phylogeny, as MCP sequences previously unrepresented within the existing collection of E. huxleyi viruses (EhV) were associated with viruses lysing cultures. Sequences were compared with previously described EhV MCP sequences from the North Sea and a Norwegian Fjord, as well as from the Gulf of Maine. Principal component analysis indicates that location-specific distinctions exist despite the presence of sequences common across these environments. Overall, this investigation provides new sequence data and an assessment on the use of the MCP gene. © 2011 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved.

  14. A revised root for the human Y chromosomal phylogenetic tree: the origin of patrilineal diversity in Africa.

    Science.gov (United States)

    Cruciani, Fulvio; Trombetta, Beniamino; Massaia, Andrea; Destro-Bisol, Giovanni; Sellitto, Daniele; Scozzari, Rosaria

    2011-06-10

    To shed light on the structure of the basal backbone of the human Y chromosome phylogeny, we sequenced about 200 kb of the male-specific region of the human Y chromosome (MSY) from each of seven Y chromosomes belonging to clades A1, A2, A3, and BT. We detected 146 biallelic variant sites through this analysis. We used these variants to construct a patrilineal tree, without taking into account any previously reported information regarding the phylogenetic relationships among the seven Y chromosomes here analyzed. There are several key changes at the basal nodes as compared with the most recent reference Y chromosome tree. A different position of the root was determined, with important implications for the origin of human Y chromosome diversity. An estimate of 142 KY was obtained for the coalescence time of the revised MSY tree, which is earlier than that obtained in previous studies and easier to reconcile with plausible scenarios of modern human origin. The number of deep branchings leading to African-specific clades has doubled, further strengthening the MSY-based evidence for a modern human origin in the African continent. An analysis of 2204 African DNA samples showed that the deepest clades of the revised MSY phylogeny are currently found in central and northwest Africa, opening new perspectives on early human presence in the continent. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  15. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource.

    Science.gov (United States)

    Sharpton, Thomas J; Jospin, Guillaume; Wu, Dongying; Langille, Morgan G I; Pollard, Katherine S; Eisen, Jonathan A

    2012-10-13

    New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as "Sifting Families," or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology-based analyses. We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/).

  16. Phylogenetic and functional diversity within toluene-degrading, sulphate-reducing consortia enriched from a contaminated aquifer.

    Science.gov (United States)

    Kuppardt, Anke; Kleinsteuber, Sabine; Vogt, Carsten; Lüders, Tillmann; Harms, Hauke; Chatzinotas, Antonis

    2014-08-01

    Three toluene-degrading microbial consortia were enriched under sulphate-reducing conditions from different zones of a benzene, toluene, ethylbenzene and xylenes (BTEX) plume of two connected contaminated aquifers. Two cultures were obtained from a weakly contaminated zone of the lower aquifer, while one culture originated from the highly contaminated upper aquifer. We hypothesised that the different habitat characteristics are reflected by distinct degrader populations. Degradation of toluene with concomitant production of sulphide was demonstrated in laboratory microcosms and the enrichment cultures were phylogenetically characterised. The benzylsuccinate synthase alpha-subunit (bssA) marker gene, encoding the enzyme initiating anaerobic toluene degradation, was targeted to characterise the catabolic diversity within the enrichment cultures. It was shown that the hydrogeochemical parameters in the different zones of the plume determined the microbial composition of the enrichment cultures. Both enrichment cultures from the weakly contaminated zone were of a very similar composition, dominated by Deltaproteobacteria with the Desulfobulbaceae (a Desulfopila-related phylotype) as key players. Two different bssA sequence types were found, which were both affiliated to genes from sulphate-reducing Deltaproteobacteria. In contrast, the enrichment culture from the highly contaminated zone was dominated by Clostridia with a Desulfosporosinus-related phylotype as presumed key player. A distinct bssA sequence type with high similarity to other recently detected sequences from clostridial toluene degraders was dominant in this culture. This work contributes to our understanding of the niche partitioning between degrader populations in distinct compartments of BTEX-contaminated aquifers.

  17. Local Plant Diversity Across Multiple Habitats Supports a Diverse Wild Bee Community in Pennsylvania Apple Orchards.

    Science.gov (United States)

    Kammerer, Melanie A; Biddinger, David J; Rajotte, Edwin G; Mortensen, David A

    2016-02-01

    Wild pollinators supply essential, historically undervalued pollination services to crops and other flowering plant communities with great potential to ensure agricultural production against the loss of heavily relied upon managed pollinators. Local plant communities provision wild bees with crucial floral and nesting resources, but the distribution of floristic diversity among habitat types in North American agricultural landscapes and its effect on pollinators are diverse and poorly understood, especially in orchard systems. We documented floristic diversity in typical mid-Atlantic commercial apple (Malus domestica Borkh.) orchards including the forest and orchard-forest edge ("edge") habitats surrounding orchards in a heterogeneous landscape in south-central Pennsylvania, USA. We also assessed the correlation between plant richness and orchard pollinator communities. In this apple production region, edge habitats are the most species rich, supporting 146 out of 202 plant species recorded in our survey. Plant species richness in the orchard and edge habitats were significant predictors of bee species richness and abundance in the orchard, as well as landscape area of the forest and edge habitats. Both the quantity and quality of forest and edges close to orchards play a significant role in provisioning a diverse wild bee community in this agroecosystem. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. The effects of habitat management on the species, phylogenetic and functional diversity of bees are modified by the environmental context.

    Science.gov (United States)

    Sydenham, Markus A K; Moe, Stein R; Stanescu-Yadav, Diana N; Totland, Ørjan; Eldegard, Katrine

    2016-02-01

    Anthropogenic landscape elements, such as roadsides, hedgerows, field edges, and power line clearings, can be managed to provide important habitats for wild bees. However, the effects of habitat improvement schemes in power line clearings on components of diversity are poorly studied. We conducted a large-scale experiment to test the effects of different management practices on the species, phylogenetic, and functional diversity of wild bees in power line clearings (n = 19 sites across southeastern Norway) and explored whether any treatment effects were modified by the environmental context. At each site, we conducted the following treatments: (1) Cut: all trees cut and left to decay in the clearing; (2) Cut + Remove: all trees cut and removed from the plot; and (3) Uncut: uncleared. The site-specific environmental context (i.e., elevation and floral diversity) influenced the species, phylogenetic, and functional diversity within bee species assemblages. The largest number of species was found in the Cut + Remove treatment in plots with a high forb species richness, indicating that the outcome of management practices depends on the environmental context. Clearing of treatment plots with many forb species also appeared to alter the phylogenetic composition of bee species assemblages, that is, more closely related species were found in the Cut and the Cut + Remove plots than in the Uncut plots. Synthesis and applications: Our experimental simulation of management practices in power line clearings influenced the species, phylogenetic, and functional diversity of bee species assemblages. Frequent clearing and removal of the woody debris at low elevations with a high forb species richness can increase the value of power line clearings for solitary bees. It is therefore important for managers to consider the environmental context when designing habitat improvement schemes for solitary bees.

  19. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  20. What Shapes the Phylogenetic Structure of Anuran Communities in a Seasonal Environment? The Influence of Determinism at Regional Scale to Stochasticity or Antagonistic Forces at Local Scale.

    Science.gov (United States)

    Martins, Clarissa de Araújo; Roque, Fabio de Oliveira; Santos, Bráulio A; Ferreira, Vanda Lúcia; Strüssmann, Christine; Tomas, Walfrido Moraes

    2015-01-01

    Ecological communities are structured by both deterministic and stochastic processes. We investigated phylogenetic patterns at regional and local scales to understand the influences of seasonal processes in shaping the structure of anuran communities in the southern Pantanal wetland, Brazil. We assessed the phylogenetic structure at different scales, using the Net Relatedness Index (NRI), the Nearest Taxon Index (NTI), and phylobetadiversity indexes, as well as a permutation test, to evaluate the effect of seasonality. The anuran community was represented by a non-random set of species with a high degree of phylogenetic relatedness at the regional scale. However, at the local scale the phylogenetic structure of the community was weakly related with the seasonality of the system, indicating that oriented stochastic processes (e.g. colonization, extinction and ecological drift) and/or antagonist forces drive the structure of such communities in the southern Pantanal.

  1. Virulence profile of different phylogenetic groups of locally isolated community acquired uropathogenic E. coli from Faisalabad region of Pakistan

    Directory of Open Access Journals (Sweden)

    Bashir Saira

    2012-08-01

    Full Text Available Abstract Background Uropathogenic E.coli (UPEC are among major pathogens causing urinary tract infections. Virulence factors are mainly responsible for the severity of these emerging infections. This study was planned to investigate the distribution of virulence genes and cytotoxic effects of UPEC isolates with reference to phylogenetic groups (B2, B1, D and A to understand the presence and impact of virulence factors in the severity of infection in Faisalabad region of Pakistan. Methods In this study phylogenetic analysis, virulence gene identification and cytotoxicity of 59 uropathogenic E.coli isolates obtained from non-hospitalized patients was studied. Results Among 59 isolates, phylogenetic group B2 (50% was most dominant followed by groups A, B1 (19% each and D (12%. Isolates present in group D showed highest presence of virulence genes. The prevalence hlyA (37% was highest followed by sfaDE (27%, papC (24%, cnf1 (20%, eaeA (19% and afaBC3 (14%. Highly hemolytic and highly verotoxic isolates mainly belonged to group D and B2. We also found two isolates with simultaneous presence of three fimbrial adhesin genes present on pap, afa, and sfa operons. This has not been reported before and underlines the dynamic nature of these UPEC isolates. Conclusions It was concluded that in local UPEC isolates from non-hospitalized patients, group B2 was more prevalent. However, group D isolates were most versatile as all were equipped with virulence genes and showed highest level of cytotoxicity.

  2. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource

    Directory of Open Access Journals (Sweden)

    Sharpton Thomas J

    2012-10-01

    Full Text Available Abstract Background New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. Results We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as “Sifting Families,” or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology–based analyses. Conclusions We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/.

  3. Activity and phylogenetic diversity of bacterial cells with high and low nucleic acid content and electron transport system activity in an upwelling ecosystem.

    Science.gov (United States)

    Longnecker, K; Sherr, B F; Sherr, E B

    2005-12-01

    We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea.

  4. Teaching Geoscience in Place for Local Diversity and Sustainability

    Science.gov (United States)

    Semken, S.

    2008-12-01

    Globalization, careerism, media, thoughtless consumption, standardized education and assessment, and even well-meaning advocacy for far-flung environments and people all divert our attention from meaningful interaction with our own surroundings. Meanwhile, many young Americans prefer virtual realities over personal intimacy with nature. Many have lost sight of the pedagogical power of places: localities imbued with meaning by human experience. To lack a sense of local places is to be oblivious to their environmental, cultural, and aesthetic importance, and to risk acceding to their degradation. The geosciences, born and rooted in exploration of environments, have much to lose from this trend but can be pivotal in helping to reverse it. Place-based teaching is situated in local physical and cultural environments and blends experiential learning, transdisciplinary and multicultural content, and service to the community. It is advocated for its relevance and potential to engage diverse students. Authentically place-based education is informed not only by scientific knowledge of places but also by the humanistic meanings and attachments affixed to them. Leveraging and enriching the senses of place of students, teachers, and the community is a defining and desirable learning outcome. We have researched and piloted several place-based approaches to geoscience teaching at various places in the Southwest USA: at a rural Tribal College, a large urban university, and a teacher in-service program at an underserved, minority-majority rural school district. Curricula are situated in complexly evolved, ruggedly beautiful desert-mountain physical landscapes coincident with multicultural, deeply historic, but rapidly changing cultural landscapes. The organizing theme is a cyclical path of inquiry through Earth and Sky, derived from Indigenous ethnogeology; syllabi integrate geology, hydrology, climate, environmental quality, and cultural geography and are situated in real places

  5. Phylogenetic diversity of culturable fungi from the deep-sea sediments of the central Indian Basin and their growth characteristics

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    of sporulating cultures mostly matched either with 18S or ITS sequences but seldom with both the sequences. Phylogenetic analysis of ascomycetes using 18S sequence data grouped them into 7 clusters belonging to Aspergillus sp., Sagenomella sp., Exophiala sp...

  6. Phylogenetic isolation of host trees affects assembly of local Heteroptera communities

    NARCIS (Netherlands)

    Vialatte, A.; Bailey, R.; Vasseur, C.; Matocq, A.; Gossner, M.; Everhart, D.; Vitrac, X.; Belhadj, A.; Ernoult, A.; Prinzing, A.

    2010-01-01

    A host may be physically isolated in space and then may correspond to a geographical island, but it may also be separated from its local neighbours by hundreds of millions of years of evolutionary history, and may form in this case an evolutionarily distinct island. We test how this affects the

  7. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  8. Diversity and phylogenetic analyses of bacteria from a shallow-water hydrothermal vent in Milos island (Greece).

    Science.gov (United States)

    Giovannelli, Donato; d'Errico, Giuseppe; Manini, Elena; Yakimov, Michail; Vetriani, Costantino

    2013-01-01

    Studies of shallow-water hydrothermal vents have been lagging behind their deep-sea counterparts. Hence, the importance of these systems and their contribution to the local and regional diversity and biogeochemistry is unclear. This study analyzes the bacterial community along a transect at the shallow-water hydrothermal vent system of Milos island, Greece. The abundance and biomass of the prokaryotic community is comparable to areas not affected by hydrothermal activity and was, on average, 1.34 × 10(8) cells g(-1). The abundance, biomass and diversity of the prokaryotic community increased with the distance from the center of the vent and appeared to be controlled by the temperature gradient rather than the trophic conditions. The retrieved 16S rRNA gene fragments matched sequences from a variety of geothermal environments, although the average similarity was low (94%), revealing previously undiscovered taxa. Epsilonproteobacteria constituted the majority of the population along the transect, with an average contribution to the total diversity of 60%. The larger cluster of 16S rRNA gene sequences was related to chemolithoautotrophic Sulfurovum spp., an Epsilonproteobacterium so far detected only at deep-sea hydrothermal vents. The presence of previously unknown lineages of Epsilonproteobacteria could be related to the abundance of organic matter in these systems, which may support alternative metabolic strategies to chemolithoautotrophy. The relative contribution of Gammaproteobacteria to the Milos microbial community increased along the transect as the distance from the center of the vent increased. Further attempts to isolate key species from these ecosystems will be critical to shed light on their evolution and ecology.

  9. The influence of biogeographic history on the functional and phylogenetic diversity of passerine birds in savannas and forests of the Brazilian Amazon.

    Science.gov (United States)

    Almeida, Sara Miranda; Juen, Leandro; Sobral, Fernando Landa; Santos, Marcos Pérsio Dantas

    2018-04-01

    Passeriformes is the largest and most diverse avian order in the world and comprises the Passeri and Tyranni suborders. These suborders constitute a monophyletic group, but differ in their ecology and history of occupation of South America. We investigated the influence of biogeographic history on functional and phylogenetic diversities of Passeri and Tyranni in forest and savanna habitats in the Brazilian Amazon. We compiled species composition data for 34 Passeriformes assemblages, 12 in savannas and 22 in forests. We calculated the functional (Rao's quadratic entropy, FD Q ) and phylogenetic diversities (mean pairwise distance, MPD, and mean nearest taxon distance, MNTD), and the functional beta diversity to investigate the potential role of biogeographic history in shaping ecological traits and species lineages of both suborders. The functional diversity of Passeri was higher than for Tyranni in both habitats. The MPD for Tyranni was higher than for Passeri in forests; however, there was no difference between the suborders in savannas. In savannas, Passeri presented higher MNTD than Tyranni, while in forest areas, Tyranni assemblages showed higher MNTD than Passeri. We found a high functional turnover (~75%) between Passeri and Tyranni in both habitats. The high functional diversity of Passeri in both habitats is due to the high diversity of ecological traits exhibited by species of this group, which enables the exploitation of a wide variety of resources and foraging strategies. The higher Tyranni MPD and MNTD in forests is likely due to Tyranni being older settlers in this habitat, resulting in the emergence and persistence of more lineages. The higher Passeri MNTD in savannas can be explained by the existence of a larger number of different Passeri lineages adapted to this severe habitat. The high functional turnover between the suborders in both habitats suggests an ecological strategy to avoid niche overlap.

  10. Quantification of non-coding RNA target localization diversity and its application in cancers.

    Science.gov (United States)

    Cheng, Lixin; Leung, Kwong-Sak

    2018-04-01

    Subcellular localization is pivotal for RNAs and proteins to implement biological functions. The localization diversity of protein interactions has been studied as a crucial feature of proteins, considering that the protein-protein interactions take place in various subcellular locations. Nevertheless, the localization diversity of non-coding RNA (ncRNA) target proteins has not been systematically studied, especially its characteristics in cancers. In this study, we provide a new algorithm, non-coding RNA target localization coefficient (ncTALENT), to quantify the target localization diversity of ncRNAs based on the ncRNA-protein interaction and protein subcellular localization data. ncTALENT can be used to calculate the target localization coefficient of ncRNAs and measure how diversely their targets are distributed among the subcellular locations in various scenarios. We focus our study on long non-coding RNAs (lncRNAs), and our observations reveal that the target localization diversity is a primary characteristic of lncRNAs in different biotypes. Moreover, we found that lncRNAs in multiple cancers, differentially expressed cancer lncRNAs, and lncRNAs with multiple cancer target proteins are prone to have high target localization diversity. Furthermore, the analysis of gastric cancer helps us to obtain a better understanding that the target localization diversity of lncRNAs is an important feature closely related to clinical prognosis. Overall, we systematically studied the target localization diversity of the lncRNAs and uncovered its association with cancer.

  11. High genetic diversity of equine infectious anaemia virus strains from Slovenia revealed upon phylogenetic analysis of the p15 gag gene region.

    Science.gov (United States)

    Kuhar, U; Malovrh, T

    2016-03-01

    The equine infectious anaemia virus (EIAV), which belongs to the Retroviridae family, infects equids almost worldwide. Every year, sporadic EIAV cases are detected in Slovenia. To characterise the Slovenian EIAV strains in the p15 gag gene region phylogenetically in order to compare the Slovenian EIAV strains with EIAV strains from abroad, especially with the recently published European strains. Cross-sectional study using material derived from post mortem examination. In total, 29 EIAV serologically positive horses from 18 different farms were examined in this study. Primers were designed to amplify the p15 gag gene region. Amplicons of 28 PCRs were subjected to direct DNA sequencing and phylogenetic analysis. Altogether, 28 EIAV sequences were obtained from 17 different farms and were distributed between 4 separate monophyletic groups and 9 branches upon phylogenetic analysis. Among EIAV strains from abroad, the closest relatives to Slovenian EIAV strains were European EIAV strains from Italy. Phylogenetic analysis also showed that some animals from distantly located farms were most probably infected with the same EIAV strains, as well as animals from the same farm and animals from farms located in the same geographical region. This is the first report of such high genetic diversity of EIAV strains from one country. This led to speculation that there is a potential virus reservoir among the populations of riding horses, horses kept for pleasure and horses for meat production, with some farmers or horse-owners not following legislation, thus enabling the spread of infection with EIAV. The low sensitivity of the agar gel immunodiffusion test may also contribute to the spread of infection with EIAV, because some infected horses might have escaped detection. The results of the phylogenetic analysis also provide additional knowledge about the highly heterogeneous nature of the EIAV genome. © 2015 EVJ Ltd.

  12. Genetic diversity of Echinococcus multilocularis on a local scale.

    Science.gov (United States)

    Knapp, J; Guislain, M-H; Bart, J M; Raoul, F; Gottstein, B; Giraudoux, P; Piarroux, R

    2008-05-01

    Echinococcusmultilocularis is the causative agent of human Alveolar Echinococcosis (AE), and it is one of the most lethal zoonotic infections in the Northern Hemisphere. In France, the eastern and central regions are endemic areas; Franche-Comté, Lorraine and Auvergne are particularly contaminated. Recently, several human cases were recorded in the French Ardennes area, a region adjacent to the western border of the E. multilocularis range in France. A previous study in this focus described a prevalence of over 50% of the parasite in red foxes. The present study investigated the genetic diversity of adult worms collected from foxes in a 900km(2) area in the Ardennes. Instead of a conventional mitochondrial target (ATP6), two microsatellite targets (EmsB and NAK1) were used. A total of 140 adult worms isolated from 25 red foxes were genotyped. After hierarchical clustering analyses, the EmsB target enabled us to distinguish two main assemblages, each divided into sub-groups, yielding the differentiation of six clusters or assemblage profiles. Thirteen foxes (52% of the foxes) each harbored worms from at least two different assemblage profiles, suggesting they had become infected by several sources. Using the NAK1 target, we identified 3 alleles, two found in association with the two EmsB assemblages. With the NAK1 target, we investigated the parasite breeding system and the possible causes of genetic diversification. Only one fox harbored hybrid worms, indicative of a possible (and rare) occurrence of recombination, although multiple infections have been observed in foxes. These results confirm the usefulness of microsatellite targets for assessing genetic polymorphism in a geographically restricted local range.

  13. Diversity of Phylogenetic Information According to the Locus and the Taxonomic Level: An Example from a Parasitic Mesostigmatid Mite Genus

    Directory of Open Access Journals (Sweden)

    Lise Roy

    2010-04-01

    Full Text Available Molecular markers for cladistic analyses may perform differently according to the taxonomic group considered and the historical level under investigation. Here we evaluate the phylogenetic potential of five different markers for resolving evolutionary relationships within the ectoparasitic genus Dermanyssus at the species level, and their ability to address questions about the evolution of specialization. COI provided 9–18% divergence between species (up to 9% within species, 16S rRNA 10–16% (up to 4% within species, ITS1 and 2 2–9% (up to 1% within species and Tropomyosin intron n 8–20% (up to 6% within species. EF-1a revealed different non-orthologous copies withinindividuals of Dermanyssus and Ornithonyssus. Tropomyosin intron n was shown containing consistent phylogenetic signal at the specific level within Dermanyssus and represents a promising marker for future prospects in phylogenetics of Acari. Phylogenetic analyses revealed that the generalist condition is apomorphic and D. gallinae mightrepresent a complex of hybridized lineages. The split into hirsutus-group and gallinae-group in Dermanyssus does not seem to be appropriate based upon these results and D. longipes appears to be composed of two different entities.

  14. Evaluating the microbial diversity of an in vitro model of the human large intestine by phylogenetic microarray analysis

    NARCIS (Netherlands)

    Rajilic-Stojanovic, M.; Maathuis, A.; Heilig, G.H.J.; Venema, K.; Vos, de W.M.; Smidt, H.

    2010-01-01

    A high-density phylogenetic microarray targeting small subunit rRNA (SSU rRNA) sequences of over 1000 microbial phylotypes of the human gastrointestinal tract, the HITChip, was used to assess the impact of faecal inoculum preparation and operation conditions on an in vitro model of the human large

  15. Genetic diversity of five local Swedish chicken breeds detected by microsatellite markers.

    Directory of Open Access Journals (Sweden)

    Abiye Shenkut Abebe

    Full Text Available This study aimed at investigating the genetic diversity, relationship and population structure of 110 local Swedish chickens derived from five breeds (Gotlandshöna, Hedemorahöna, Öländsk dvärghöna, Skånsk blommehöna, and Bohuslän- Dals svarthöna, in the rest of the paper the shorter name Svarthöna is used using 24 microsatellite markers. In total, one hundred thirteen alleles were detected in all populations, with a mean of 4.7 alleles per locus. For the five chicken breeds, the observed and expected heterozygosity ranged from 0.225 to 0.408 and from 0.231 to 0.515, with the lowest scores for the Svarthöna and the highest scores for the Skånsk blommehöna breeds, respectively. Similarly, the average within breed molecular kinship varied from 0.496 to 0.745, showing high coancestry, with Skånsk blommehöna having the lowest and Svarthöna the highest coancestry. Furthermore, all breeds showed significant deviations from Hardy-Weinberg expectations. Across the five breeds, the global heterozygosity deficit (FIT was 0.545, population differentiation index (FST was 0.440, and the global inbreeding of individuals within breed (FIS was 0.187. The phylogenetic relationships of chickens were examined using neighbor-joining trees constructed at the level of breeds and individual samples. The neighbor-joining tree constructed at breed level revealed two main clusters, with Hedemorahöna and Öländsk dvärghöna breeds in one cluster, and Gotlandshöna and Svarthöna breeds in the second cluster leaving the Skånsk blommehöna in the middle. Based on the results of the STRUCTURE analysis, the most likely number of clustering of the five breeds was at K = 4, with Hedemorahöna, Gotlandshöna and Svarthöna breeds forming their own distinct clusters, while Öländsk dvärghöna and Skånsk blommehöna breeds clustered together. Losses in the overall genetic diversity of local Swedish chickens due to breeds extinction varied from -1.46% to -6

  16. Genetic Diversity and Phylogenetic Analysis of the Iranian Leishmania Parasites Based on HSP70 Gene PCR-RFLP and Sequence Analysis.

    Science.gov (United States)

    Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah

    2017-08-01

    Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.

  17. Phylogenetic relationships and cryptic species diversity in the Brazilian egg-brooding tree frog, genus Fritziana Mello-Leitão 1937 (Anura: Hemiphractidae).

    Science.gov (United States)

    Walker, Marina; Lyra, Mariana L; Haddad, Célio F B

    2018-06-01

    The genus Fritziana (Anura: Hemiphractidae) comprises six described species (F. goeldii, F. ohausi, F. fissilis, F. ulei, F. tonimi, and F. izecksohni) that are endemic to the Brazilian Atlantic Forest. Although the genus has been the subject of studies dealing with its taxonomy, phylogeny, and systematics, there is considerable evidence for cryptic diversity hidden among the species. The present study aims to understand the genetic diversity and phylogenetic relationships among the species of Fritziana, as well as the relationships among populations within species. We analyzed 107 individuals throughout the distribution of the genus using three mitochondrial gene fragments (12S, 16S, and COI) and two nuclear genes (RAG1 and SLC8A3). Our data indicated that the species diversity in the genus Fritziana is underestimated by the existence of at least three candidate species hidden amongst the group of species with a closed dorsal pouch (i.e. F. fissilis and F. ulei). We also found four species presenting geographical population structures and high genetic diversity, and thus require further investigations. In addition, we found that two candidate species show a new arrangement for the tRNA-Phe gene, unique in Anura so far. Based on our results, we suggest that the conservation status of the species, as well as the species diversity in the genus Fritziana, needs to be reviewed. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Taxonomic and phylogenetic diversity of vascular plants at Ma'anling volcano urban park in tropical Haikou, China: Reponses to soil properties.

    Science.gov (United States)

    Cheng, Xia-Lan; Yuan, Lang-Xing; Nizamani, Mir Mohammad; Zhu, Zhi-Xin; Friedman, Cynthia Ross; Wang, Hua-Feng

    2018-01-01

    Anthropogenic processes and socio-economic factors play important roles in shaping plant diversity in urban parks. To investigate how plant diversity of Ma' anling urban volcano park in Hainan Province, China respond to these factors, we carried out a field investigation on the taxonomic and phylogenetic diversity of vascular plants and soil properties in this area. We found 284 species of vascular plants belonging to 88 families and 241 genera, which included 194 native species, 23 invasive species, 31 naturalized species, 40 cultivars, and 4 rare / endangered plant species. Tree composition and richness significantly varied between different vegetation formations (plantation, secondary forest, and abandoned land). Plant species richness and community composition were significantly affected by elevation (El), soil water content (WC), total soil nitrogen (TN) and soil organic matter (SOM). There were significant diversity differences between plantations and abandoned lands, but not between the plantations and secondary forests. The flora in the study site was tropical in nature, characterized by pantropic distributions. Compared to adjacent areas, floristic composition in the study site was most similar to that of Guangdong, followed by that of Vietnam. Our study revealed the diversity patterns of volcanic plants and provided the basis for future planning of plant conservation, such as preserving plant species, maintaining plant habitats, and coordinating plant management in this region.

  19. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  20. Diversity of Local Fruit Trees and Their Contribution in Sustaining ...

    African Journals Online (AJOL)

    The northern Cameroon ecosystems harbor a diversity of useful tree species producing non wood forest products (NWFPs). Indigenous fruit trees are very important for the nutritional quality of rural population and contribute to their income. A better knowledge of the potential utilization of these species and the constraints ...

  1. Local Convergence and Global Diversity : The Robustness of Cultural Homophily

    NARCIS (Netherlands)

    Flache, Andreas; Macy, Michael W.

    2007-01-01

    Introduction Cultural diversity is both persistent and precarious. People in different regions of the world are increasingly exposed to global influences from mass media, internet communication, interregional migration and mass tourism. English is rapidly becoming Earth’s Lingua Franca, and Western

  2. Global forces, local identity: the economics of cultural diversity

    NARCIS (Netherlands)

    Prinz, Aloys; Steenge, A.E.; Hospers, Gerrit J.; Langen, Martin

    2011-01-01

    While the economies of the world become more and more integrated, differences in the cultures remain. The economics of cultural diversity and of cultural interactions are the main theme of this volume. The essays originate from presentations at the binational Rothenberge seminar, organized by

  3. Analysis of Genetic diversity and reltionships in local Tunisian barley ...

    African Journals Online (AJOL)

    Yomi

    tools in the characterization and evaluation of genetic diversity within and between species and populations. It has been shown that different markers might reveal different classes of variation (Powell et al., 1996; Russell et al., 1997). It is correlated with the genome fraction surveyed by each kind of marker, their distribution ...

  4. DNA markers reveal genetic structure and localized diversity of ...

    African Journals Online (AJOL)

    uqhdesma

    2016-10-12

    Oct 12, 2016 ... cluster, and landraces from this area also exhibited the greatest allelic diversity and the highest number of private alleles. ..... number of clusters (K) was varied from one to ten with a burn-in of ..... Review Front. Plant Sci. 5:484 ...

  5. Recovery and phylogenetic diversity of culturable fungi associated with marine sponges Clathrina luteoculcitella and Holoxea sp. in the South China Sea.

    Science.gov (United States)

    Ding, Bo; Yin, Ying; Zhang, Fengli; Li, Zhiyong

    2011-08-01

    Sponge-associated fungi represent an important source of marine natural products, but little is known about the fungal diversity and the relationship of sponge-fungal association, especially no research on the fungal diversity in the South China Sea sponge has been reported. In this study, a total of 111 cultivable fungi strains were isolated from two South China Sea sponges Clathrina luteoculcitella and Holoxea sp. using eight different media. Thirty-two independent representatives were selected for analysis of phylogenetic diversity according to ARDRA and morphological characteristics. The culturable fungal communities consisted of at least 17 genera within ten taxonomic orders of two phyla (nine orders of the phylum Ascomycota and one order of the phylum Basidiomycota) including some potential novel marine fungi. Particularly, eight genera of Apiospora, Botryosphaeria, Davidiella, Didymocrea, Lentomitella, Marasmius, Pestalotiopsis, and Rhizomucor were isolated from sponge for the first time. Sponge C. luteoculcitella has greater culturable fungal diversity than sponge Holoxea sp. Five genera of Aspergillus, Davidiella, Fusarium, Paecilomyces, and Penicillium were isolated from both sponges, while 12 genera of Apiospora, Botryosphaeria, Candida, Marasmius, Cladosporium, Didymocrea, Hypocrea, Lentomitella, Nigrospora, Pestalotiopsis, Rhizomucor, and Scopulariopsis were isolated from sponge C. luteoculcitella only. Order Eurotiales especially genera Penicillium, Aspergillus, and order Hypocreales represented the dominant culturable fungi in these two South China Sea sponges. Nigrospora oryzae strain PF18 isolated from sponge C. luteoculcitella showed a strong and broad spectrum antimicrobial activities suggesting the potential for antimicrobial compounds production.

  6. The effects of micro-aeration on the phylogenetic diversity of microorganisms in a thermophilic anaerobic municipal solid-waste digester.

    Science.gov (United States)

    Tang, Yueqin; Shigematsu, Toru; Ikbal; Morimura, Shigeru; Kida, Kenji

    2004-05-01

    We demonstrated previously that micro-aeration allows construction of an effective thermophilic methane-fermentation system for treatment of municipal solid waste (MSW) without production of H(2)S. In the present study, we compared the microbial communities in a thermophilic MSW digester without aeration and with micro-aeration by fluorescence in situ hybridization (FISH), denaturing gradient gel electrophoresis (DGGE), phylogenetic analysis of libraries of 16S rRNA gene clones and quantitative real-time PCR. Moreover, we studied the activity of sulfate-reducing bacteria (SRB) by analysis of the transcription of the gene for dissimilatory sulfite reductase (dsr). Experiments using FISH revealed that microorganisms belonging to the domain Bacteria dominated in the digester both without aeration and with micro-aeration. Phylogenetic analysis based on 16S rRNA gene and analysis of bacteria by DGGE did not reveal any obvious difference within the microbial communities under the two aeration conditions, and bacteria affiliated with the phylum Firmicutes were dominant. In Archaea, the population of Methanosarcina decreased while the population of Methanoculleus increased as a result of micro-aerations as revealed by the analysis of 16S rRNA gene clones and quantitative real-time PCR. Reverse transcription and PCR (RT-PCR) demonstrated the transcription of dsrA not only in the absence of aeration but also in the presence of micro-aeration, even under conditions where no H(2)S was detected in the biogas. In conclusion, micro-aeration has no obvious effects on the phylogenetic diversity of microorganisms. Furthermore, the activity of SRBs in the digester was not repressed even though the concentration of H(2)S in the biogas was very low under the micro-aeration conditions.

  7. Phylogenetic diversity of actinobacteria associated with soft coral Alcyonium gracllimum and stony coral Tubastraea coccinea in the East China Sea.

    Science.gov (United States)

    Yang, Shan; Sun, Wei; Tang, Cen; Jin, Liling; Zhang, Fengli; Li, Zhiyong

    2013-07-01

    Actinobacteria are widely distributed in the marine environment. To date, few studies have been performed to explore the coral-associated Actinobacteria, and little is known about the diversity of coral-associated Actinobacteria. In this study, the actinobacterial diversity associated with one soft coral Alcyonium gracllimum and one stony coral Tubastraea coccinea collected from the East China Sea was investigated using both culture-independent and culture-dependent approaches. A total of 19 actinobacterial genera were detected in these two corals, among which nine genera (Corynebacterium, Dietzia, Gordonia, Kocuria, Microbacterium, Micrococcus, Mycobacterium, Streptomyces, and Candidatus Microthrix) were common, three genera (Cellulomonas, Dermatophilus, and Janibacter) were unique to the soft coral, and seven genera (Brevibacterium, Dermacoccus, Leucobacter, Micromonospora, Nocardioides, Rhodococcus, and Serinicoccus) were unique to the stony coral. This finding suggested that highly diverse Actinobacteria were associated with different types of corals. In particular, five actinobacterial genera (Cellulomonas, Dermacoccus, Gordonia, Serinicoccus, and Candidatus Microthrix) were recovered from corals for the first time, extending the known diversity of coral-associated Actinobacteria. This study shows that soft and stony corals host diverse Actinobacteria and can serve as a new source of marine actinomycetes.

  8. Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals.

    Science.gov (United States)

    Asakura, H; Makino, S; Kobori, H; Watarai, M; Shirahata, T; Ikeda, T; Takeshi, K

    2001-08-01

    Nucleotide sequences of Shiga toxin (Stx) genes in STEC from various origins were determined and characterized by phylogenetic analysis based on Shiga toxin (Stx) with those deposited in GenBank. The phylogenetic trees placed Stx1 and Stx2 into two and five groups respectively, and indicated that Stx1 in sheep-origin STEC were placed into a different group from those in other STEC, and that Stx2 of deer-origin STEC also belonged to the unique group and appeared to be distantly related to human-origin STEC. On the other hand, Stx of STEC isolated from cattle, seagulls and flies were closely related to those of human-origin STEC. Such a diversity of Stx suggested that STEC might be widely disseminated in many animal species, and be dependent on their host species or their habitat. In addition, the active sites in both toxins were compared; the active sites in both subunits of Stx in all the animal-origin STEC were identical to those in human-origin STEC, suggesting that all the toxin of STEC from animals might be also cytotoxic, and therefore, such animal-origin STEC might have potential pathogenicity for humans.

  9. Genetic diversity of Ghanaian local chicken populations based on ...

    African Journals Online (AJOL)

    In Ghana, local chickens are raised across distinct agro-ecological zones and constitute unique populations with variable phenotypes that need to be characterized to provide needed information for the conservation of useful genotypes against future needs. In particular, the Interior Savannah (GHIS) in the north, the Forest ...

  10. Diversity in local food production to combat obesity

    International Development Research Centre (IDRC) Digital Library (Canada)

    requirements for vegetable crops using 40-50% less water. ... for greater productivity, encourage procurement and consumption of local produce by public institutions and the population, and enhance .... Foreign Affairs, Trade and Development Canada (DFATD). ... Government of the Republic of Trinidad and Tobago.

  11. Dynamics of Phylogenetic Diversity and Its Influence on the Production of Extracellular Protease by Moderately Halotolerant Alkaliphilic Bacteria Acinetobacter Baumannii GTCR407 Nov

    Directory of Open Access Journals (Sweden)

    Thiyagarajan Gurunathan

    2010-07-01

    Full Text Available New characters emerge in the population of microorganisms living in the extreme environments due to its adaptation to ecological association. The microorganisms living in saline habitat utilize complex nutrients by adopting different strategies in Deoxyribonucleic Acid (DNA and Ribonucleic Acid (RNA, which are related to their metabolic and ecological diversities. Isolation and characterization of the organisms producing extracellular protease from such environment were the prime focus of this investigation, which can indicate the importance of metabolic diversity in phylogeny. Norberg medium was used to isolate halotolerant microorganisms from salt-cured skin. The isolates were screened for high activity of protease and the strain showing maximum activity of protease was taken for further studies. The biochemical characterization and 16s ribosomal RNA sequencing studies confirm that the isolate is Acinetobacter baumannii. Moreover, hydrolysis positive for starch and casein, negative for gelatin shows that the organism is a variant form of A. baumannii. Cell growth parameters such as pH and temperature were optimized and their values are 8 and 37oC respectively. The extracellular production of protease was optimized in the suitable medium and its enzyme activity was 165μg/ml/min. The results imply that the isolate had acquired operational genes through lateral gene transfer (LGT probably from unrelated species in the environment. This indicates that the isolate identified possesses metabolic and ecological diversities with values of phylogenetic delineation

  12. Large-scale phylogenetic analyses provide insights into unrecognized diversity and historical biogeography of Asian leaf-litter frogs, genus Leptolalax (Anura: Megophryidae).

    Science.gov (United States)

    Chen, Jin-Min; Poyarkov, Nikolay A; Suwannapoom, Chatmongkon; Lathrop, Amy; Wu, Yun-He; Zhou, Wei-Wei; Yuan, Zhi-Yong; Jin, Jie-Qiong; Chen, Hong-Man; Liu, He-Qun; Nguyen, Truong Quang; Nguyen, Sang Ngoc; Duong, Tang Van; Eto, Koshiro; Nishikawa, Kanto; Matsui, Masafumi; Orlov, Nikolai L; Stuart, Bryan L; Brown, Rafe M; Rowley, Jodi J L; Murphy, Robert W; Wang, Ying-Yong; Che, Jing

    2018-07-01

    Southeast Asia and southern China (SEA-SC) harbor a highly diverse and endemic flora and fauna that is under increasing threat. An understanding of the biogeographical history and drivers of this diversity is lacking, especially in some of the most diverse and threatened groups. The Asian leaf-litter frog genus Leptolalax Dubois 1980 is a forest-dependent genus distributed throughout SEA-SC, making it an ideal study group to examine specific biogeographic hypotheses. In addition, the diversity of this genus remains poorly understood, and the phylogenetic relationships among species of Leptolalax and closely related Leptobrachella Smith 1928 remain unclear. Herein, we evaluate species-level diversity based on 48 of the 53 described species from throughout the distribution of Leptolalax. Molecular analyses reveal many undescribed species, mostly in southern China and Indochina. Our well-resolved phylogeny based on multiple nuclear DNA markers shows that Leptolalax is not monophyletic with respect to Leptobrachella and, thus, we assign the former to being a junior synonym of the latter. Similarly, analyses reject monophyly of the two subgenera of Leptolalax. The diversification pattern of the group is complex, involving a high degree of sympatry and prevalence of microendemic species. Northern Sundaland (Borneo) and eastern Indochina (Vietnam) appear to have played pivotal roles as geographical centers of diversification, and paleoclimatic changes and tectonic movements seem to have driven the major divergence of clades. Analyses fail to reject an "upstream" colonization hypothesis, and, thus, the genus appears to have originated in Sundaland and then colonized mainland Asia. Our results reveal that both vicariance and dispersal are responsible for current distribution patterns in the genus. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Knowledge Production beyond Local and National Blindspots: Remedying Professional Ocularcentrism of Diversity in Music Teacher Education

    Science.gov (United States)

    Westerlund, Heidi; Karlsen, Sidsel

    2017-01-01

    In this article, we argue that mainstream discourses of diversity in music education are ocularcentric; that is, they provide a one-sided way of understanding diversity that has prevented music educators from seeing our biases. In remedying these local and national professional blindspots, we propose transnational knowledge production, which we…

  14. Institutions and Cultural Diversity: Effects of Democratic and Propaganda Processes on Local Convergence and Global Diversity.

    Science.gov (United States)

    Ulloa, Roberto; Kacperski, Celina; Sancho, Fernando

    2016-01-01

    In a connected world where people influence each other, what can cause a globalized monoculture, and which measures help to preserve the coexistence of cultures? Previous research has shown that factors such as homophily, population size, geography, mass media, and type of social influence play important roles. In the present paper, we investigate for the first time the impact that institutions have on cultural diversity. In our first three studies, we extend existing agent-based models and explore the effects of institutional influence and agent loyalty. We find that higher institutional influence increases cultural diversity, while individuals' loyalty to their institutions has a small, preserving effect. In three further studies, we test how bottom-up and top-down processes of institutional influence impact our model. We find that bottom-up democratic practices, such as referenda, tend to produce convergence towards homogeneity, while top-down information dissemination practices, such as propaganda, further increase diversity. In our last model--an integration of bottom-up and top-down processes into a feedback loop of information--we find that when democratic processes are rare, the effects of propaganda are amplified, i.e., more diversity emerges; however, when democratic processes are common, they are able to neutralize or reverse this propaganda effect. Importantly, our models allow for control over the full spectrum of diversity, so that a manipulation of our parameters can result in preferred levels of diversity, which will be useful for the study of other factors in the future. We discuss possible mechanisms behind our results, applications, and implications for political and social sciences.

  15. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  16. Some like it high! Phylogenetic diversity of high-elevation cyanobacterial community from biological soil crusts of Western Himalaya.

    Czech Academy of Sciences Publication Activity Database

    Čapková, K.; Hauer, T.; Řeháková, Klára; Doležal, J.

    2016-01-01

    Roč. 71, č. 1 (2016), s. 113-123 ISSN 0095-3628 Institutional support: RVO:60077344 Keywords : soil crusts * cyanobacterial diversity * Western Himalayas * high-elevation * desert * phosphorus Subject RIV: EH - Ecology, Behaviour Impact factor: 3.630, year: 2016

  17. Some Like it High! Phylogenetic Diversity of High-Elevation Cyanobacterial Community from Biological Soil Crusts of Western Himalaya

    Czech Academy of Sciences Publication Activity Database

    Čapková, Kateřina; Hauer, Tomáš; Řeháková, Klára; Doležal, Jiří

    2016-01-01

    Roč. 71, č. 1 (2016), s. 113-123 ISSN 0095-3628 R&D Projects: GA ČR GA13-13368S Institutional support: RVO:67985939 Keywords : Soil crusts * Cyanobacterial diversity * Western Himalayas Subject RIV: EH - Ecology , Behaviour Impact factor: 3.630, year: 2016

  18. Metagenomic-Based Study of the Phylogenetic and Functional Gene Diversity in Galápagos Land and Marine Iguanas

    KAUST Repository

    Hong, Pei-Ying; Mao, Yuejian; Ortiz-Kofoed, Shannon; Shah, Rushabh S.; Cann, Isaac Ko O; Mackie, Roderick Ian

    2014-01-01

    affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a

  19. Microscopic Examination of Distribution and Phenotypic Properties of Phylogenetically Diverse Chloroflexaceae-Related Bacteria in Hot Spring Microbial Mats

    DEFF Research Database (Denmark)

    Nübel, U.; Bateson, Mary M.; Vandieken, V.

    2002-01-01

    We investigated the diversity, distribution, and phenotypes of uncultivated Chloroflexaceae-related bacteria in photosynthetic microbial mats of an alkaline hot spring (Mushroom Spring, Yellowstone National Park). By applying a directed PCR approach, molecular cloning, and sequence analysis of 16S...

  20. Elevational gradients in phylogenetic structure of ant communities reveal the interplay of biotic and abiotic constraints on diversity

    Czech Academy of Sciences Publication Activity Database

    Machač, A.; Janda, Milan; Dunn, R. R.; Sanders, N. J.

    2011-01-01

    Roč. 34, č. 3 (2011), s. 364-371 ISSN 0906-7590 R&D Projects: GA AV ČR KJB612230701; GA MŠk LC06073; GA ČR GD206/08/H044; GA ČR GA206/09/0115; GA ČR GAP505/10/0673 Institutional research plan: CEZ:AV0Z50070508 Keywords : diversity Subject RIV: EH - Ecology, Behaviour Impact factor: 4.188, year: 2011

  1. The Genetic Diversity and Phylogenetic Characteritics of Rotavirus VP4(P Genotypes in Children With Acute Diarrhea

    Directory of Open Access Journals (Sweden)

    Haghshenas Z

    2011-11-01

    Full Text Available Background: Acute gastroenteritis is a major cause of morbidity and mortality among children in developing countries. Rotaviruses are recognized as the most common etiologic factors of gastroenteritis. In this study, we determined the epidemiologic features, clinical symptoms and molecular structure of rotavirus VP4(P genotypes in children with acute diarrhea in Bahrami Hospital in Tehran Iran, during 2009 for justifying the routine use of rotavirus vaccines in children. Methods: One hundred fifty fecal samples from 150 children with acute diarrhea in Bahrami Pediatric Hospital in Tehran, Iran were collected from January to December 2009. The patients’ mean age was 20.90+18.19 years (ranging from 1 month to 14 years. Fecal samples were transported on ice to the laboratory of virology department of Pasture Institute of Iran. The demographic and clinical data for each case were entered in an author-devised questionnaire. Group A rotavirus was detected by dsRNA-PAGE. Subsequently, rotavirus genotyping (VP4 was performed by semi-nested multiple RT-PCR and the phylogenetic tree of the Rotavirus nucleotides was constructed. The data were analyzed by statistical tests including Wilcoxon signed and Mann-Whitney U. Results: Rotavirus was isolated in 19.3% of the samples, more than 90% of which had long RNA patterns. The predominant genotype (VP4 was P[8] (86% and other genotypes respectively were P[6] (6.9% and P[4] (6.9%. Conclusion: A high prevalence of the P[8] genotype was found to be the cause of acute diarrhea. The analysis of P[8] genotype sequence showed a high level of similarity of the virus in this study with those of other Asian countries.

  2. Phenotypic and genetic diversity of Saccharomyces contaminants isolated from lager breweries and their phylogenetic relationship with brewing yeasts

    DEFF Research Database (Denmark)

    Jespersen, Lene; Kühle, Alis Van der Aa; Petersen, Kamilla M.

    2000-01-01

    -amplified intergenic transcribed spacer (ITS) regions. Chromosome length polymorphism (CLP) was evident among the Saccharomyces brewing contaminants with chromosome profiles typical of Saccharomyces sensu stricto. Based upon cluster analysis of their chromosome profiles the majority of the brewing contaminants could...... be grouped as either S. cerevisiae or S. pastorianus/S. bayanus. Further, the technique was able to differentiate between almost all brewing contaminants and to separate them from any specific lager brewing yeast. The diversity of the Saccharomyces brewing contaminants clearly demonstrated by their CLP...... in the SaccharomYces brewing contaminants indicate their adaptation to a maltose-enriched environment....

  3. Phylogenetic Diversity in Core Region of Hepatitis C Virus Genotype 1a as a Factor Associated with Fibrosis Severity in HIV-1-Coinfected Patients

    Directory of Open Access Journals (Sweden)

    Micaela Parra

    2017-01-01

    Full Text Available High hepatitis C virus (HCV genetic diversity impacts infectivity/pathogenicity, influencing chronic liver disease progression associated with fibrosis degrees and hepatocellular carcinoma. HCV core protein is crucial in cell-growth regulation and host-gene expression. Liver fibrosis is accelerated by unknown mechanisms in human immunodeficiency virus-1- (HIV-1- coinfected individuals. We aimed to study whether well-defined HCV-1a core polymorphisms and genetic heterogeneity are related to fibrosis in a highly homogeneous group of interferon-treated HIV-HCV-coinfected patients. Genetic heterogeneity was weighed by Faith’s phylogenetic diversity (PD, which has been little studied in HCV. Eighteen HCV/HIV-coinfected patients presenting different liver fibrosis stages before anti-HCV treatment-initiation were recruited. Sampling at baseline and during and after treatment was performed up to 72 weeks. At inter/intrahost level, HCV-1a populations were studied using molecular cloning and Sanger sequencing. Over 400 complete HCV-1a core sequences encompassing 573 positions of C were obtained. Amino acid substitutions found previously at positions 70 and 91 of HCV-1b core region were not observed. However, HCV genetic heterogeneity was higher in mild than in severe fibrosis cases. These results suggest a potential utility of PD as a virus-related factor associated with chronic hepatitis C progression. These observations should be reassessed in larger cohorts to corroborate our findings and assess other potential covariates.

  4. Phylogenetic analysis, subcellular localization, and expression patterns of RPD3/HDA1 family histone deacetylases in plants

    OpenAIRE

    Alinsug, Malona V; Yu, Chun-Wei; Wu, Keqiang

    2009-01-01

    Abstract Background Although histone deacetylases from model organisms have been previously identified, there is no clear basis for the classification of histone deacetylases under the RPD3/HDA1 superfamily, particularly on plants. Thus, this study aims to reconstruct a phylogenetic tree to determine evolutionary relationships between RPD3/HDA1 histone deacetylases from six different plants representing dicots with Arabidopsis thaliana, Populus trichocarpa, and Pinus taeda, monocots with Oryz...

  5. Phylogenetic diversity and spatial distribution of the microbial community associated with the Caribbean deep-water sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA gene analysis.

    Science.gov (United States)

    Meyer, Birte; Kuever, Jan

    2008-08-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species), whereas 26% appeared to be P. cf. corticata specifically associated microorganisms ("specialists"); 21% of the phylotypes were confirmed to represent seawater- and sediment-derived proteobacterial species ("contaminants") acquired by filtration processes from the host environment. Consistently, the aprA and amoA gene-based analyses indicated the presence of environmentally derived sulfur- and ammonia-oxidizers besides putative sponge-specific sulfur-oxidizing Gammaproteobacteria and Alphaproteobacteria and a sulfate-reducing archaeon. A sponge-specific, endosymbiotic sulfur cycle as described for marine oligochaetes is proposed to be also present in P. cf. corticata. Overall, the results of this work support the recent studies that demonstrated the sponge species specificity of the associated microbial community while the biogeography of the host collection site has only a minor influence on the composition. In P. cf. corticata, the specificity of the sponge-microbe associations is even extended to the spatial distribution of the microorganisms within the sponge body; distinct bacterial populations were associated with the different tissue sections, papillae, outer and inner cortex, and choanosome. The local distribution of a phylotype within P. cf. corticata correlated with its (1) phylogenetic affiliation, (2) classification as sponge-specific or nonspecifically associated microorganism, and (3) potential ecological role in the host sponge.

  6. Palaeoamyda messeliana nov. comb. (Testudines, Pan-Trionychidae from the Eocene Messel Pit and Geiseltal localities, Germany, taxonomic and phylogenetic insights

    Directory of Open Access Journals (Sweden)

    Edwin Cadena

    2016-10-01

    Full Text Available Background Abundant pan-trionychid (soft-shell turtles specimens have been found in Eocene sequences of central Europe, particularly from two localities in Germany, the Messel Pit (a UNESCO World Natural Heritage Site and Geiseltal, traditionally attributed to Trionyx messelianus or Rafetoides austriacus. Over the last two decades new specimens of this taxon from these two localities have been discovered and fully prepared. However, they have remained unstudied, as well as their phylogenetic position inside Pan-Trionychidae is unknown. Results Five new specimens of Palaeoamyda messeliana nov. comb. from Messel Pit and Geiseltal localities are fully described here. A revised diagnosis for the species is also presented here, together with its inclusion in a phylogenetic analysis of Pan-Trionychidae that shows that this species is sister to the extant Amyda cartilaginea, one of the most abundant pan-trionychid (soft-shell turtles from Asia, both members of the clade Chitrini. The specimens described in here are among the best and most complete fossil pan-trionychid skeletons so far known.

  7. Palaeoamyda messeliana nov. comb. (Testudines, Pan-Trionychidae) from the Eocene Messel Pit and Geiseltal localities, Germany, taxonomic and phylogenetic insights.

    Science.gov (United States)

    Cadena, Edwin

    2016-01-01

    Abundant pan-trionychid (soft-shell) turtles specimens have been found in Eocene sequences of central Europe, particularly from two localities in Germany, the Messel Pit (a UNESCO World Natural Heritage Site) and Geiseltal, traditionally attributed to Trionyx messelianus or Rafetoides austriacus . Over the last two decades new specimens of this taxon from these two localities have been discovered and fully prepared. However, they have remained unstudied, as well as their phylogenetic position inside Pan-Trionychidae is unknown. Five new specimens of Palaeoamyda messeliana nov. comb. from Messel Pit and Geiseltal localities are fully described here. A revised diagnosis for the species is also presented here, together with its inclusion in a phylogenetic analysis of Pan-Trionychidae that shows that this species is sister to the extant Amyda cartilaginea , one of the most abundant pan-trionychid (soft-shell) turtles from Asia, both members of the clade Chitrini. The specimens described in here are among the best and most complete fossil pan-trionychid skeletons so far known.

  8. Phylogenetic and functional diversity of Bacteria and Archaea in a unique stratified lagoon, the Clipperton atoll (N Pacific).

    Science.gov (United States)

    Galand, Pierre E; Bourrain, Muriel; De Maistre, Emmanuel; Catala, Philippe; Desdevises, Yves; Elifantz, Hila; Kirchman, David L; Lebaron, Philippe

    2012-01-01

    The Clipperton lagoon in the North Pacific Ocean has been isolated from the surrounding sea for c. 160 years. It has a stratified water column that comprises an oxic and brackish upper water layer (mixolimnion) and a deep sulfuric anoxic saline layer (monimolimnion), separated by a steep pycnocline. Here, we test whether the Clipperton lagoon with its distinctive physico-chemical features, geographic isolation, recent water column stratification, and large nutrient input harbors original microbial communities. The combination of capillary electrophoresis single-strand polymorphism (CE-SSCP) fingerprinting and sequencing of cloned bacterial and archaeal 16S rRNA genes, and functional genes for methanogenesis (mcrA), methanotrophy (pmoA), and sulfate reduction (dsrAB), revealed that microbial communities and pathways were highly stratified down the water column. The mixolimnion contained ubiquitous freshwater clades of Alpha- and Betaproteobacteria, while the pycnocline contained mostly green sulfur bacteria (phylum Chlorobi). Sequences of the upper layers were closely related to sequences found in other aquatic ecosystems, suggesting that they have a strong potential for dispersal and colonization. In contrast, the monimolimnion contained new deeply branching bacterial divisions within the OP11 cluster and the Bacteroidetes, and was the most diverse of the layers. The unique environmental conditions characterizing the deep layers of the lagoon may explain the novelty of the microbial communities found at the Clipperton atoll.

  9. Epidemiological study of phylogenetic transmission clusters in a local HIV-1 epidemic reveals distinct differences between subtype B and non-B infections.

    Science.gov (United States)

    Chalmet, Kristen; Staelens, Delfien; Blot, Stijn; Dinakis, Sylvie; Pelgrom, Jolanda; Plum, Jean; Vogelaers, Dirk; Vandekerckhove, Linos; Verhofstede, Chris

    2010-09-07

    The number of HIV-1 infected individuals in the Western world continues to rise. More in-depth understanding of regional HIV-1 epidemics is necessary for the optimal design and adequate use of future prevention strategies. The use of a combination of phylogenetic analysis of HIV sequences, with data on patients' demographics, infection route, clinical information and laboratory results, will allow a better characterization of individuals responsible for local transmission. Baseline HIV-1 pol sequences, obtained through routine drug-resistance testing, from 506 patients, newly diagnosed between 2001 and 2009, were used to construct phylogenetic trees and identify transmission-clusters. Patients' demographics, laboratory and clinical data, were retrieved anonymously. Statistical analysis was performed to identify subtype-specific and transmission-cluster-specific characteristics. Multivariate analysis showed significant differences between the 59.7% of individuals with subtype B infection and the 40.3% non-B infected individuals, with regard to route of transmission, origin, infection with Chlamydia (p = 0.01) and infection with Hepatitis C virus (p = 0.017). More and larger transmission-clusters were identified among the subtype B infections (p HIV (p = 0.017). Combination of phylogenetics with demographic information, laboratory and clinical data, revealed that HIV-1 subtype B infected Caucasian men-who-have-sex-with-men with high prevalence of sexually transmitted diseases, account for the majority of local HIV-transmissions. This finding elucidates observed epidemiological trends through molecular analysis, and justifies sustained focus in prevention on this high risk group.

  10. Genetic Diversity and Phylogenetic Relationships of Coevolving Symbiont-Harboring Insect Trypanosomatids, and Their Neotropical Dispersal by Invader African Blowflies (Calliphoridae

    Directory of Open Access Journals (Sweden)

    Tarcilla C. Borghesan

    2018-02-01

    Full Text Available This study is about the inter- and intra-specific genetic diversity of trypanosomatids of the genus Angomonas, and their association with Calliphoridae (blowflies in Neotropical and Afrotropical regions. Microscopic examination of 3,900 flies of various families, mostly Calliphoridae, revealed that 31% of them harbored trypanosomatids. Small subunit rRNA (SSU rRNA barcoding showed that Angomonas predominated (46% over the other common trypanosomatids of blowflies of genera Herpetomonas and Wallacemonas. Among Angomonas spp., A. deanei was much more common than the two-other species, A. desouzai and A. ambiguus. Phylogenetic analyses based on SSU rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH and internal transcribed spacer rDNA (ITS rDNA sequences revealed a marked genetic diversity within A. deanei, which comprised four infraspecific genotypes (Dea1–Dea4, and four corresponding symbiont genotypes (Kcr1–Kcr4. Host and symbiont phylogenies were highly congruent corroborating their co-divergence, consistent with host-symbiont interdependent metabolism and symbiont reduced genomes shaped by a long coevolutionary history. We compared the diversity of Angomonas/symbionts from three genera of blowflies, Lucilia, Chrysomya and Cochliomyia. A. deanei, A. desouzai, and A. ambiguus were found in the three genera of blowflies in South America. In Africa, A. deanei and A. ambiguus were identified in Chrysomya. The absence of A. desouzai in Africa and its presence in Neotropical Cochliomyia and Lucilia suggests parasite spillback of A. desouzai into Chrysomya, which was most likely introduced four decades ago from Africa into the Neotropic. The absence of correlation between parasite diversity and geographic and genetic distances, with identical genotypes of A. deanei found in the Neotropic and Afrotropic, is consistent with disjunct distribution due to the recent human-mediated transoceanic dispersal of Angomonas by Chrysomya. This

  11. Local phylogenetic divergence and global evolutionary convergence of skull function in reef fishes of the family Labridae

    OpenAIRE

    Westneat, Mark W; Alfaro, Michael E; Wainwright, Peter C; Bellwood, David R; Grubich, Justin R; Fessler, Jennifer L; Clements, Kendall D; Smith, Lydia L

    2005-01-01

    The Labridae is one of the most structurally and functionally diversified fish families on coral and rocky reefs around the world, providing a compelling system for examination of evolutionary patterns of functional change. Labrid fishes have evolved a diverse array of skull forms for feeding on prey ranging from molluscs, crustaceans, plankton, detritus, algae, coral and other fishes. The species richness and diversity of feeding ecology in the Labridae make this group a marine analogue to t...

  12. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  13. Pharmacological Potential of Phylogenetically Diverse Actinobacteria Isolated from Deep-Sea Coral Ecosystems of the Submarine Avilés Canyon in the Cantabrian Sea.

    Science.gov (United States)

    Sarmiento-Vizcaíno, Aida; González, Verónica; Braña, Alfredo F; Palacios, Juan J; Otero, Luis; Fernández, Jonathan; Molina, Axayacatl; Kulik, Andreas; Vázquez, Fernando; Acuña, José L; García, Luis A; Blanco, Gloria

    2017-02-01

    Marine Actinobacteria are emerging as an unexplored source for natural product discovery. Eighty-seven deep-sea coral reef invertebrates were collected during an oceanographic expedition at the submarine Avilés Canyon (Asturias, Spain) in a range of 1500 to 4700 m depth. From these, 18 cultivable bioactive Actinobacteria were isolated, mainly from corals, phylum Cnidaria, and some specimens of phyla Echinodermata, Porifera, Annelida, Arthropoda, Mollusca and Sipuncula. As determined by 16S rRNA sequencing and phylogenetic analyses, all isolates belong to the phylum Actinobacteria, mainly to the Streptomyces genus and also to Micromonospora, Pseudonocardia and Myceligenerans. Production of bioactive compounds of pharmacological interest was investigated by high-performance liquid chromatography (HPLC) and gas chromatography-mass spectrometry (GC-MS) techniques and subsequent database comparison. Results reveal that deep-sea isolated Actinobacteria display a wide repertoire of secondary metabolite production with a high chemical diversity. Most identified products (both diffusible and volatiles) are known by their contrasted antibiotic or antitumor activities. Bioassays with ethyl acetate extracts from isolates displayed strong antibiotic activities against a panel of important resistant clinical pathogens, including Gram-positive and Gram-negative bacteria, as well as fungi, all of them isolated at two main hospitals (HUCA and Cabueñes) from the same geographical region. The identity of the active extracts components of these producing Actinobacteria is currently being investigated, given its potential for the discovery of pharmaceuticals and other products of biotechnological interest.

  14. Molecular phylogenetic reconstruction and localization of the (TTAGGn telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863 suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera

    Directory of Open Access Journals (Sweden)

    Tássia Tatiane Pontes Pereira

    2018-01-01

    Full Text Available Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known. The main exception is Acromyrmex striatus (Roger, 1863, which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH with telomeric probes with (TTAGG6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  15. Origins of altruism diversity I: The diverse ecological roles of altruistic strategies and their evolutionary responses to local competition.

    Science.gov (United States)

    Van Dyken, J David; Wade, Michael J

    2012-08-01

    Nature abounds with a rich variety of altruistic strategies, including public resource enhancement, resource provisioning, communal foraging, alarm calling, and nest defense. Yet, despite their vastly different ecological roles, current theory typically treats diverse altruistic traits as being favored under the same general conditions. Here, we introduce greater ecological realism into social evolution theory and find evidence of at least four distinct modes of altruism. Contrary to existing theory, we find that altruistic traits contributing to "resource-enhancement" (e.g., siderophore production, provisioning, agriculture) and "resource-efficiency" (e.g., pack hunting, communication) are most strongly favored when there is strong local competition. These resource-based modes of helping are "K-strategies" that increase a social group's growth yield, and should characterize species with scarce resources and/or high local crowding caused by low mortality, high fecundity, and/or mortality occurring late in the process of resource-acquisition. The opposite conditions, namely weak local competition (abundant resource, low crowding), favor survival (e.g., nest defense) and fecundity (e.g., nurse workers) altruism, which are "r-strategies" that increase a social group's growth rate. We find that survival altruism is uniquely favored by a novel evolutionary force that we call "sunk cost selection." Sunk cost selection favors helping that prevents resources from being wasted on individuals destined to die before reproduction. Our results contribute to explaining the observed natural diversity of altruistic strategies, reveal the necessary connection between the evolution and the ecology of sociality, and correct the widespread but inaccurate view that local competition uniformly impedes the evolution of altruism. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  16. Constancy despite variability: Local and regional macrofaunal diversity in intertidal seagrass beds

    Science.gov (United States)

    Boyé, Aurélien; Legendre, Pierre; Grall, Jacques; Gauthier, Olivier

    2017-12-01

    The importance of seagrass habitat for the diversity of benthic fauna has been extensively studied worldwide. Most of the information available is, however, about α diversity while little consideration has been given to β diversity. To fill the knowledge gaps regarding the variability of epifaunal and infaunal seagrass assemblages at large spatial and temporal scales, we scrutinized an extensive dataset covering five years of monitoring of eight intertidal Zostera marina meadows around Brittany (France). High species richness arose at the regional scale from the combination of high local diversity of the meadows and substantial among-meadows β diversity. Epifauna and infauna appeared as distinct self-communities as they displayed different spatial and temporal patterns and varied in their responses to local hydrological conditions. Infauna had higher total β diversity than epifauna due to a tighter link to the great variability of local environmental conditions in the region. Both exhibited substantial variations in species composition and community structure with variations of dominant species that were accompanied by extensive change in numerous rare species. The dominant epifaunal species were all grazers. Changes in species composition were induced mostly by species replacement and rarely by richness differences between meadows. Indeed, species richness remained within a narrow range for all seagrass beds, suggesting a potential carrying capacity for species richness of the meadows. Overall, all meadows contributed equally to the regional turnover of seagrass macrofauna, emphasizing high variability and complementarity among beds at the regional scale. The implications of this substantial within-seagrass variability for the functioning of benthic ecosystems at broad scale and for conservation purposes in habitat mosaics warrant further investigations but our results clearly advocate taking into account within-habitat variation when evaluating the diversity

  17. Provider diversity in the English NHS: a study of recent developments in four local health economies.

    Science.gov (United States)

    Allen, Pauline; Turner, Simon; Bartlett, Will; Perotin, Virginie; Matchaya, Greenwell; Zamora, Bernarda

    2012-01-01

    To assess the impact of provider diversity on quality and innovation in the English NHS by mapping the extent of diverse provider activity and identifying the differences in performance between Third Sector Organisations (TSOs), for-profit private enterprises, and incumbent organizations within the NHS, and the factors that affect the entry and growth of new providers. Case studies of four local health economies. Data included: semi-structured interviews with 48 managerial and clinical staff from NHS organizations and providers from the private and third sector; some documentary evidence; a focus group with service users; and routine data from the Care Quality Commission and Companies House. Data collection was mainly between November 2008 and November 2009. Involvement of diverse providers in the NHS is limited. Commissioners' local strategies influence degrees of diversity. Barriers to entry for TSOs include lack of economies of scale in the bidding process. Private providers have greater concern to improve patient pathways and patient experience, whereas TSOs deliver quality improvements by using a more holistic approach and a greater degree of community involvement. Entry of new providers drives NHS trusts to respond by making improvements. Information sharing diminishes as competition intensifies. There is scope to increase the participation of diverse providers in the NHS but care must be taken not to damage public accountability, overall productivity, equity and NHS providers (especially acute hospitals, which are likely to remain in the NHS) in the process.

  18. [Phylogenetic diversity and cold-adaptive hydrolytic enzymes of culturable psychrophilic bacteria associated with sea ice from high latitude ocean, Artic].

    Science.gov (United States)

    Yu, Yong; Li, Hui-Rong; Chen, Bo; Zeng, Yin-Xin; He, Jian-Feng

    2006-04-01

    The phylogenetic diversity of culturable psychrophilic bacteria associated with sea ice from high latitude sea (77 degrees 30'N - 81 degrees 12'N), Canadian Basin and Greenland sea Arctic, was investigated. A total of 37 psychrophilic strains were isolated using three different methods of ( i ) spread plate method: 100 microL of each dilution ice-melt sample was spreaded onto the surface of Marine 2216 agar (DIFCO laboratories, Detroit, MI) and incubated for 2 to 6 weeks at 4 degrees C; ( ii ) bath culture and spread plate method: 1 mL of sample was added to 9mL of NSW (unamended natural seawater, 0.2 microm prefiltered and autoclaved) and incubated for 1 months at - 1 degrees C, then spread plate method was used to isolate bacterial strains from the pre-cultured samples; ( iii ) cold shock, bath culture and spread plate method: samples were exposed to - 20 degrees C for 24h, then bacterial strains isolated by bath culture and spread plate method under aerobic conditions. Nearly half of psychrophilic strains are isolated by using method iii . 16S rDNA nearly full-length sequence analysis reveal that psychrophilic strains fall in two phylogenetic divisions, gamma-proteobacteria (in the genera Colwellia, Marinobacter, Shewanella, Thalassomonas, Glaciecola, Marinomonas and Pseudoalteromonas) and Cytophaga-Flexibacter-Bacteroides (in the genera Flavobacterium and Psychroflexus). Nine of bacterial isolates (BSi20007, BSi20497, BSi20517, BSi20537, BSi20170, BSi20001, BSi20002, BSi20675 and BSi20101) quite likely represent novel species (16S rDNA sequence similarity below 97%). One of strains (BSi20002) from Canadian Basin shows 100% sequence similarity to the Antarctic Weddell sea ice isolate Marinobacter sp. ANT8277, suggesting bacteria may have a bipolar distribution at the species level. AF283859 sequences were submitted to the BLAST search program of the National Center for Biotechnology Information website (NCBI, http://www. ncbi. nlm.nih. gov). Twenty sequences

  19. Genetic diversity measures of local European beef cattle breeds for conservation purposes

    Directory of Open Access Journals (Sweden)

    Pereira Albano

    2001-05-01

    Full Text Available Abstract This study was undertaken to determine the genetic structure, evolutionary relationships, and the genetic diversity among 18 local cattle breeds from Spain, Portugal, and France using 16 microsatellites. Heterozygosities, estimates of Fst, genetic distances, multivariate and diversity analyses, and assignment tests were performed. Heterozygosities ranged from 0.54 in the Pirenaica breed to 0.72 in the Barrosã breed. Seven percent of the total genetic variability can be attributed to differences among breeds (mean Fst = 0.07; P

  20. Characterization of the genome of a phylogenetically distinct tospovirus and its interactions with the local lesion-induced host Chenopodium quinoa by whole-transcriptome analyses.

    Science.gov (United States)

    Chou, Wan-Chen; Lin, Shih-Shun; Yeh, Shyi-Dong; Li, Siang-Ling; Peng, Ying-Che; Fan, Ya-Hsu; Chen, Tsung-Chi

    2017-01-01

    Chenopodium quinoa is a natural local lesion host of numerous plant viruses, including tospoviruses (family Bunyaviridae). Groundnut chlorotic fan-spot tospovirus (GCFSV) has been shown to consistently induce local lesions on the leaves of C. quinoa 4 days post-inoculation (dpi). To reveal the whole genome of GCFSV and its interactions with C. quinoa, RNA-seq was performed to determine the transcriptome profiles of C. quinoa leaves. The high-throughput reads from infected C. quinoa leaves were used to identify the whole genome sequence of GCFSV and its single nucleotide polymorphisms. Our results indicated that GCFSV is a phylogenetically distinct tospovirus. Moreover, 27,170 coding and 29,563 non-coding sequences of C. quinoa were identified through de novo assembly, mixing reads from mock and infected samples. Several key genes involved in the modulation of hypersensitive response (HR) were identified. The expression levels of 4,893 deduced complete genes annotated using the Arabidopsis genome indicated that several HR-related orthologues of pathogenesis-related proteins, transcription factors, mitogen-activated protein kinases, and defense proteins were significantly expressed in leaves that formed local lesions. Here, we also provide new insights into the replication progression of a tospovirus and the molecular regulation of the C. quinoa response to virus infection.

  1. Diversity

    Science.gov (United States)

    Portraits In Courage Vol. VIII Portraits In Courage Vol. IX Portraits In Courage Vol. X AF Sites Social -Wide Initiative to Promote Diversity and Inclusion in the Federal Workforce Executive Order 13548 : Virtual Diversity Conference Air Force Diversity & Inclusion Air Force Diversity Graphic There is no

  2. High and distinct range-edge genetic diversity despite local bottlenecks.

    Directory of Open Access Journals (Sweden)

    Jorge Assis

    Full Text Available The genetic consequences of living on the edge of distributional ranges have been the subject of a largely unresolved debate. Populations occurring along persistent low latitude ranges (rear-edge are expected to retain high and unique genetic diversity. In contrast, currently less favourable environmental conditions limiting population size at such range-edges may have caused genetic erosion that prevails over past historical effects, with potential consequences on reducing future adaptive capacity. The present study provides an empirical test of whether population declines towards a peripheral range might be reflected on decreasing diversity and increasing population isolation and differentiation. We compare population genetic differentiation and diversity with trends in abundance along a latitudinal gradient towards the peripheral distribution range of Saccorhiza polyschides, a large brown seaweed that is the main structural species of kelp forests in SW Europe. Signatures of recent bottleneck events were also evaluated to determine whether the recently recorded distributional shifts had a negative influence on effective population size. Our findings show decreasing population density and increasing spatial fragmentation and local extinctions towards the southern edge. Genetic data revealed two well supported groups with a central contact zone. As predicted, higher differentiation and signs of bottlenecks were found at the southern edge region. However, a decrease in genetic diversity associated with this pattern was not verified. Surprisingly, genetic diversity increased towards the edge despite bottlenecks and much lower densities, suggesting that extinctions and recolonizations have not strongly reduced diversity or that diversity might have been even higher there in the past, a process of shifting genetic baselines.

  3. Disentangling environmental and spatial effects on phylogenetic structure of angiosperm tree communities in China.

    Science.gov (United States)

    Qian, Hong; Chen, Shengbin; Zhang, Jin-Long

    2017-07-17

    Niche-based and neutrality-based theories are two major classes of theories explaining the assembly mechanisms of local communities. Both theories have been frequently used to explain species diversity and composition in local communities but their relative importance remains unclear. Here, we analyzed 57 assemblages of angiosperm trees in 0.1-ha forest plots across China to examine the effects of environmental heterogeneity (relevant to niche-based processes) and spatial contingency (relevant to neutrality-based processes) on phylogenetic structure of angiosperm tree assemblages distributed across a wide range of environment and space. Phylogenetic structure was quantified with six phylogenetic metrics (i.e., phylogenetic diversity, mean pairwise distance, mean nearest taxon distance, and the standardized effect sizes of these three metrics), which emphasize on different depths of evolutionary histories and account for different degrees of species richness effects. Our results showed that the variation in phylogenetic metrics explained independently by environmental variables was on average much greater than that explained independently by spatial structure, and the vast majority of the variation in phylogenetic metrics was explained by spatially structured environmental variables. We conclude that niche-based processes have played a more important role than neutrality-based processes in driving phylogenetic structure of angiosperm tree species in forest communities in China.

  4. Human and ecological determinants of the spatial structure of local breed diversity.

    Science.gov (United States)

    Colino-Rabanal, Victor J; Rodríguez-Díaz, Roberto; Blanco-Villegas, María José; Peris, Salvador J; Lizana, Miguel

    2018-04-24

    Since domestication, a large number of livestock breeds adapted to local conditions have been created by natural and artificial selection, representing one of the most powerful ways in which human groups have constructed niches to meet their need. Although many authors have described local breeds as the result of culturally and environmentally mediated processes, this study, located in mainland Spain, is the first aimed at identifying and quantifying the environmental and human contributions to the spatial structure of local breed diversity, which we refer to as livestock niche. We found that the more similar two provinces were in terms of human population, ecological characteristics, historical ties, and geographic distance, the more similar the composition of local breeds in their territories. Isolation by human population distance showed the strongest effect, followed by isolation by the environment, thus supporting the view of livestock niche as a socio-cultural product adapted to the local environment, in whose construction humans make good use of their ecological and cultural inheritances. These findings provide a useful framework to understand and to envisage the effects of climate change and globalization on local breeds and their livestock niches.

  5. Local genetic diversity of sorghum in a village in northern Cameroon: structure and dynamics of landraces.

    Science.gov (United States)

    Barnaud, Adeline; Deu, Monique; Garine, Eric; McKey, Doyle; Joly, Hélène I

    2007-01-01

    We present the first study of patterns of genetic diversity of sorghum landraces at the local scale. Understanding landrace diversity aids in deciphering evolutionary forces under domestication, and has applications in the conservation of genetic resources and their use in breeding programs. Duupa farmers in a village in Northern Cameroon distinguished 59 named sorghum taxa, representing 46 landraces. In each field, seeds are sown as a mixture of landraces (mean of 12 landraces per field), giving the potential for extensive gene flow. What level of genetic diversity underlies the great morphological diversity observed among landraces? Given the potential for gene flow, how well defined genetically is each landrace? To answer these questions, we recorded spatial patterns of planting and farmers' perceptions of landraces, and characterized 21 landraces using SSR markers. Analysis using distance and clustering methods grouped the 21 landraces studied into four clusters. These clusters correspond to functionally and ecologically distinct groups of landraces. Within-landrace genetic variation accounted for 30% of total variation. The average F(is) over landraces was 0.68, suggesting high inbreeding within landraces. Differentiation among landraces was substantial and significant (F(st) = 0.36). Historical factors, variation in breeding systems, and farmers' practices all affected patterns of genetic variation. Farmers' practices are key to the maintenance, despite gene flow, of landraces with different combinations of agronomically and ecologically pertinent traits. They must be taken into account in strategies of conservation and use of genetic resources.

  6. Range-edge genetic diversity: locally poor extant southern patches maintain a regionally diverse hotspot in the seagrass Zostera marina.

    Science.gov (United States)

    Diekmann, Onno E; Serrão, Ester A

    2012-04-01

    Refugial populations at the rear edge are predicted to contain higher genetic diversity than those resulting from expansion, such as in post-glacial recolonizations. However, peripheral populations are also predicted to have decreased diversity compared to the centre of a species' distribution. We aim to test these predictions by comparing genetic diversity in populations at the limits of distribution of the seagrass Zostera marina, with populations in the species' previously described central diversity 'hotspot'. Zostera marina populations show decreased allelic richness, heterozygosity and genotypic richness in both the 'rear' edge and the 'leading' edge compared to the diversity 'hotspot' in the North Sea/Baltic region. However, when populations are pooled, genetic diversity at the southern range is as high as in the North Sea/Baltic region while the 'leading edge' remains low in genetic diversity. The decreased genetic diversity in these southern Iberian populations compared to more central populations is possibly the effect of drift because of small effective population size, as a result of reduced habitat, low sexual reproduction and low gene flow. However, when considering the whole southern edge of distribution rather than per population, diversity is as high as in the central 'hotspot' in the North Sea/Baltic region. We conclude that diversity patterns assessed per population can mask the real regional richness that is typical of rear edge populations, which have played a key role in the species biogeographical history and as marginal diversity hotspots have very high conservation value. © 2012 Blackwell Publishing Ltd.

  7. Microtheories for Spatial Data Infrastructures - Accounting for Diversity of Local Conceptualizations at a Global Level

    Science.gov (United States)

    Duce, Stephanie; Janowicz, Krzysztof

    The categorization of our environment into feature types is an essential prerequisite for cartography, geographic information retrieval, routing applications, spatial decision support systems, and data sharing in general. However, there is no a priori conceptualization of the world and the creation of features and types is an act of cognition. Humans conceptualize their environment based on multiple criteria such as their cultural background, knowledge, motivation, and particularly by space and time. Sharing and making these conceptualizations explicit in a formal, unambiguous way is at the core of semantic interoperability. One way to cope with semantic heterogeneities is by standardization, i.e., by agreeing on a shared conceptualization. This bears the danger of losing local diversity. In contrast, this work proposes the use of microtheories for Spatial Data Infrastructures, such as INSPIRE, to account for the diversity of local conceptualizations while maintaining their semantic interoperability at a global level. We introduce a novel methodology to structure ontologies by spatial and temporal aspects, in our case administrative boundaries, which reflect variations in feature conceptualization. A local, bottom-up approach, based on non-standard inference, is used to compute global feature definitions which are neither too broad nor too specific. Using different conceptualizations of rivers and other geographic feature types, we demonstrate how the present approach can improve the INSPIRE data model and ease its adoption by European member states.

  8. Diversity and wiring variability of visual local neurons in the Drosophila medulla M6 stratum.

    Science.gov (United States)

    Chin, An-Lun; Lin, Chih-Yung; Fu, Tsai-Feng; Dickson, Barry J; Chiang, Ann-Shyn

    2014-12-01

    Local neurons in the vertebrate retina are instrumental in transforming visual inputs to extract contrast, motion, and color information and in shaping bipolar-to-ganglion cell transmission to the brain. In Drosophila, UV vision is represented by R7 inner photoreceptor neurons that project to the medulla M6 stratum, with relatively little known of this downstream substrate. Here, using R7 terminals as references, we generated a 3D volume model of the M6 stratum, which revealed a retinotopic map for UV representations. Using this volume model as a common 3D framework, we compiled and analyzed the spatial distributions of more than 200 single M6-specific local neurons (M6-LNs). Based on the segregation of putative dendrites and axons, these local neurons were classified into two families, directional and nondirectional. Neurotransmitter immunostaining suggested a signal routing model in which some visual information is relayed by directional M6-LNs from the anterior to the posterior M6 and all visual information is inhibited by a diverse population of nondirectional M6-LNs covering the entire M6 stratum. Our findings suggest that the Drosophila medulla M6 stratum contains diverse LNs that form repeating functional modules similar to those found in the vertebrate inner plexiform layer. © 2014 Wiley Periodicals, Inc.

  9. Environmental Noise Could Promote Stochastic Local Stability of Behavioral Diversity Evolution

    Science.gov (United States)

    Zheng, Xiu-Deng; Li, Cong; Lessard, Sabin; Tao, Yi

    2018-05-01

    In this Letter, we investigate stochastic stability in a two-phenotype evolutionary game model for an infinite, well-mixed population undergoing discrete, nonoverlapping generations. We assume that the fitness of a phenotype is an exponential function of its expected payoff following random pairwise interactions whose outcomes randomly fluctuate with time. We show that the stochastic local stability of a constant interior equilibrium can be promoted by the random environmental noise even if the system may display a complicated nonlinear dynamics. This result provides a new perspective for a better understanding of how environmental fluctuations may contribute to the evolution of behavioral diversity.

  10. Phylogenetic diversity of archaeal 16S rRNA and ammonia monooxygenase genes from tropical estuarine sediments on the central west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, S.K.; Verma, P.; Ramaiah, N.; Anil, A.C.; Shouche, Y.S.

    of Euryarchaeota. Our results indicate that archaeal diversity in tropical estuarine sediments is influenced by the mangrove vegetation bordering the lower stretches of both estuaries. Higher diversity may be related to elevated land drainage during the monsoon...

  11. Patterns of genetic diversity of local pig populations in the State of Pernambuco, Brazil

    Directory of Open Access Journals (Sweden)

    Elizabete Cristina da Silva

    2011-08-01

    Full Text Available This study estimated the genetic diversity and structure of 12 genetic groups (GG of locally adapted and specialized pigs in the state of Pernambuco using 22 microsatellite markers. Nine locally adapted breeds (Baé, Caruncho, Canastra, Canastrão, Mamelado, Moura, Nilo, Piau and UDB (Undefined Breed and 3 specialized breeds (Duroc, Landrace and Large White, totaling 190 animals, were analyzed. The Analysis of Molecular Variance (AMOVA showed that 3.2% of the total variation was due to differences between genetic groups, and 3.6% to differences between local and commercial pigs. One hundred and ninety eight alleles were identified and apart from the Large White breed, all GG presented Hardy-Weinberg Equilibrium deviations for some loci. The total and effective allele means were lower for Duroc (3.65 and 3.01 and higher for UDB (8.89 and 4.53 and Canastra (8.61 and 4.58. Using Nei's standard genetic distance and the UPGMA method, it was possible to observe that the Landrace breed was grouped with the local genetic groups Canastra, Moura, Canastrão, Baé and Caruncho. Due to the complex admixture pattern, the genetic variability of the 12 genetic groups can be analyzed by distributing the individuals into two populations as demonstrated by a Bayesian analysis, corroborating the results from AMOVA, which revealed a low level of genetic differentiation between the inferred populations.

  12. The relative role of dispersal and local interactions for alpine plant community diversity under simulated climate warming

    Energy Technology Data Exchange (ETDEWEB)

    Klanderud, K.; Totland, Oe. [Norwegian Univ. of Life Science, Dept. of Ecology and Natural Resource Management, Aas (Norway)

    2007-08-15

    Most studies on factors determining diversity are conducted in temperate or warm regions, whereas studies in climatically harsh and low productivity areas, such as alpine regions, are rare. We examined the relative roles of seed availability and different biotic and abiotic factors for the diversity of an alpine plant community in southern Norway. Furthermore, because climate warming is predicted to be an important driver of alpine species diversity, we assessed how the relative impacts of dispersal and local interactions on diversity might change under experimental warming (open top chambers, OTCs). Addition of seeds from 27 regional species increased community diversity. The establishment of the species was negatively related both to the diversity of the existing system and the cover of the abundant dwarf shrub Dryas octopetala. These results show that both species dispersal limitation and local biotic interactions are important factors for alpine plant community diversity. Despite relatively harsh environmental conditions and low productivity, competition from the resident vegetation appeared to have a greater role for species establishment and diversity than facilitation and experimental warming. Higher temperature appeared to increase the negative relationship between resident species diversity and species establishment. This may suggest that climate warming can increase the role of interspecific competition for alpine plant community structure, and thus alter the long-term effects of biotic interactions on diversity. (au)

  13. Response of pest control by generalist predators to local-scale plant diversity: a meta-analysis.

    Science.gov (United States)

    Dassou, Anicet Gbèblonoudo; Tixier, Philippe

    2016-02-01

    Disentangling the effects of plant diversity on the control of herbivores is important for understanding agricultural sustainability. Recent studies have investigated the relationships between plant diversity and arthropod communities at the landscape scale, but few have done so at the local scale. We conducted a meta-analysis of 32 papers containing 175 independent measures of the relationship between plant diversity and arthropod communities. We found that generalist predators had a strong positive response to plant diversity, that is, their abundance increased as plant diversity increased. Herbivores, in contrast, had an overall weak and negative response to plant diversity. However, specialist and generalist herbivores differed in their response to plant diversity, that is, the response was negative for specialists and not significant for generalists. While the effects of scale remain unclear, the response to plant diversity tended to increase for specialist herbivores, but decrease for generalist herbivores as the scale increased. There was no clear effect of scale on the response of generalist predators to plant diversity. Our results suggest that the response of herbivores to plant diversity at the local scale is a balance between habitat and trophic effects that vary according to arthropod specialization and habitat type. Synthesis and applications. Positive effects of plant diversity on generalist predators confirm that, at the local scale, plant diversification of agroecosystems is a credible and promising option for increasing pest regulation. Results from our meta-analysis suggest that natural control in plant-diversified systems is more likely to occur for specialist than for generalist herbivores. In terms of pest management, our results indicate that small-scale plant diversification (via the planting of cover crops or intercrops and reduced weed management) is likely to increase the control of specialist herbivores by generalist predators.

  14. Nested PCR detection and phylogenetic analysis of Babesia bovis and Babesia bigemina in cattle from Peri-urban localities in Gauteng Province, South Africa.

    Science.gov (United States)

    Mtshali, Phillip Senzo; Tsotetsi, Ana Mbokeleng; Thekisoe, Matlhahane Molifi Oriel; Mtshali, Moses Sibusiso

    2014-01-01

    Babesia bovis and Babesia bigemina are tick-borne hemoparasites causing babesiosis in cattle worldwide. This study was aimed at providing information about the occurrence and geographical distribution of B. bovis and B. bigemina species in cattle from Gauteng province, South Africa. A total of 268 blood samples collected from apparently healthy animals in 14 different peri-urban localities were tested using previously established nested PCR assays for the detection of B. bovis and B. bigemina species-specific genes encoding rhoptry-associated protein 1 (RAP-1) and SpeI-AvaI restriction fragment, respectively. Nested PCR assays revealed that the overall prevalence was 35.5% (95% confidence interval [CI]=± 5.73) and 76.1% (95% CI=± 5.11) for B. bovis and B. bigemina, respectively. PCR results were corroborated by sequencing amplicons of randomly selected samples. The neighbor-joining trees were constructed to study the phylogenetic relationship between B. bovis and B. bigemina sequences of randomly selected isolates. Analysis of phylogram inferred with B. bovis RAP-1 sequences indicated a close relationship between our isolates and GenBank strains. On the other hand, a tree constructed with B. bigemina gp45 sequences revealed a high degree of polymorphism among the B. bigemina isolates investigated in this study. Taken together, the results presented in this work indicate the high incidence of Babesia parasites in cattle from previously uncharacterised peri-urban areas of the Gauteng province. These findings suggest that effective preventative and control measures are essential to curtail the spread of Babesia infections among cattle populations in Gauteng.

  15. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  16. Local and regional species diversity of benthic Isopoda (Crustacea) in the deep Gulf of Mexico

    Science.gov (United States)

    Wilson, George D. F.

    2008-12-01

    Recent studies of deep-sea faunas considered the influence of mid-domain models in the distribution of species diversity and richness with depth. In this paper, I show that separating local diversity from regional species richness in benthic isopods clarifies mid-domain effects in the distribution of isopods in the Gulf of Mexico. Deviations from the randomised implied species ranges can be informative to understanding general patterns within the Gulf of Mexico. The isopods from the GoMB study contained 135 species, with a total of 156 species including those from an earlier study. More than 60 species may be new to science. Most families of deep-sea isopods (suborder Asellota) were present, although some were extremely rare. The isopod family Desmosomatidae dominated the samples, and one species of Macrostylis (Macrostylidae) was found in many samples. Species richness for samples pooled within sites ranged from 1 to 52 species. Because species in pooled samples were highly correlated with individuals, species diversity was compared across sites using the expected species estimator ( n=15 individuals, ES 15). Six depth transects had idiosyncratic patterns of ES 15, and transects with the greatest short-range variation in topography, such as basins and canyons, had the greatest short-range disparity. Basins on the deep slope did not have a consistent influence (i.e., relatively higher or lower than surrounding areas) on the comparative species diversity. ES 15 of all transects together showed a weak mid-domain effect, peaking around 1200-1500 m, with low values at the shallowest and deepest samples (Sigsbee Abyssal Plain); no longitudinal (east-west) pattern was found. The regional species pool was analyzed by summing the implied ranges of all species. The species ranges in aggregate did not have significant patterns across longitudes, and many species had broad depth ranges, suggesting that the isopod fauna of the Gulf of Mexico is well dispersed. The summed

  17. Spatial phylogenetics of the vascular flora of Chile.

    Science.gov (United States)

    Scherson, Rosa A; Thornhill, Andrew H; Urbina-Casanova, Rafael; Freyman, William A; Pliscoff, Patricio A; Mishler, Brent D

    2017-07-01

    Current geographic patterns of biodiversity are a consequence of the evolutionary history of the lineages that comprise them. This study was aimed at exploring how evolutionary features of the vascular flora of Chile are distributed across the landscape. Using a phylogeny at the genus level for 87% of the Chilean vascular flora, and a geographic database of sample localities, we calculated phylogenetic diversity (PD), phylogenetic endemism (PE), relative PD (RPD), and relative PE (RPE). Categorical Analyses of Neo- and Paleo-Endemism (CANAPE) were also performed, using a spatial randomization to assess statistical significance. A cluster analysis using range-weighted phylogenetic turnover was used to compare among grid cells, and with known Chilean bioclimates. PD patterns were concordant with known centers of high taxon richness and the Chilean biodiversity hotspot. In addition, several other interesting areas of concentration of evolutionary history were revealed as potential conservation targets. The south of the country shows areas of significantly high RPD and a concentration of paleo-endemism, and the north shows areas of significantly low PD and RPD, and a concentration of neo-endemism. Range-weighted phylogenetic turnover shows high congruence with the main macrobioclimates of Chile. Even though the study was done at the genus level, the outcome provides an accurate outline of phylogenetic patterns that can be filled in as more fine-scaled information becomes available. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. [Genetic diversity and mating system Pinus brutia var. Stankewiczii sukacz. in small localities of Sudak (Crimea)].

    Science.gov (United States)

    Korshikov, I I; Kalafat, L A; Milchevskaya, Ya G

    2015-01-01

    A comparative analysis of genetic variation at 12 polymorphic isozyme loci, and the mating system has been carried out in mature trees and their seed progeny in three small localities of Pinus brutia var. stankewiczii Sukacz. near the town of Sudak--settlement of Novyi Svet in the Crimea. We found that embryos maintain the same allelic diversity as mother plants but their observed heterozygosity is lower on the average by 37.4%. The significant deviation of genotype distribution from the theoretically expected ratios caused by the deficiency of heterozygotes was observed at 8 out of 12 loci. Multilocus estimate of outcrossing rate (t(m)) in populations varied from 68.9 to 94.9% making on the average 80.7%.

  19. Selection from parasites favours immunogenetic diversity but not divergence among locally adapted host populations.

    Science.gov (United States)

    Tobler, M; Plath, M; Riesch, R; Schlupp, I; Grasse, A; Munimanda, G K; Setzer, C; Penn, D J; Moodley, Y

    2014-05-01

    The unprecedented polymorphism in the major histocompatibility complex (MHC) genes is thought to be maintained by balancing selection from parasites. However, do parasites also drive divergence at MHC loci between host populations, or do the effects of balancing selection maintain similarities among populations? We examined MHC variation in populations of the livebearing fish Poecilia mexicana and characterized their parasite communities. Poecilia mexicana populations in the Cueva del Azufre system are locally adapted to darkness and the presence of toxic hydrogen sulphide, representing highly divergent ecotypes or incipient species. Parasite communities differed significantly across populations, and populations with higher parasite loads had higher levels of diversity at class II MHC genes. However, despite different parasite communities, marked divergence in adaptive traits and in neutral genetic markers, we found MHC alleles to be remarkably similar among host populations. Our findings indicate that balancing selection from parasites maintains immunogenetic diversity of hosts, but this process does not promote MHC divergence in this system. On the contrary, we suggest that balancing selection on immunogenetic loci may outweigh divergent selection causing divergence, thereby hindering host divergence and speciation. Our findings support the hypothesis that balancing selection maintains MHC similarities among lineages during and after speciation (trans-species evolution). © 2014 The Authors. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

  20. Changes in species diversity of arboreal spiders in Mexican coffee agroecosystems: untangling the web of local and landscape influences driving diversity

    Directory of Open Access Journals (Sweden)

    Zachary Hajian-Forooshani

    2014-11-01

    Full Text Available Agricultural intensification is implicated as a major driver of global biodiversity loss. Local management and landscape scale factors both influence biodiversity in agricultural systems, but there are relatively few studies to date looking at how local and landscape scales influence biodiversity in tropical agroecosystems. Understanding what drives the diversity of groups of organisms such as spiders is important from a pragmatic point of view because of the important biocontrol services they offer to agriculture. Spiders in coffee are somewhat enigmatic because of their positive or lack of response to agricultural intensification. In this study, we provide the first analysis, to our knowledge, of the arboreal spiders in the shade trees of coffee plantations. In the Soconusco region of Chiapas, Mexico we sampled across 38 sites on 9 coffee plantations. Tree and canopy connectedness were found to positively influence overall arboreal spider richness and abundance. We found that different functional groups of spiders are responding to different local and landscape factors, but overall elevation was most important variable influencing arboreal spider diversity. Our study has practical management applications that suggest having shade grown coffee offers more suitable habitat for arboreal spiders due to a variety of the characteristics of the shade trees. Our results which show consistently more diverse arboreal spider communities in lower elevations are important in light of looming global climate change. As the range of suitable elevations for coffee cultivation shrinks promoting arboreal spider diversity will be important in sustaining the viability of coffee.

  1. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  2. Aggregation of Cricket Activity in Response to Resource Addition Increases Local Diversity.

    Directory of Open Access Journals (Sweden)

    Neucir Szinwelski

    Full Text Available Crickets are often found feeding on fallen fruits among forest litter. Fruits and other sugar-rich resources are not homogeneously distributed, nor are they always available. We therefore expect that crickets dwelling in forest litter have a limited supply of sugar-rich resource, and will perceive this and displace towards resource-supplemented sites. Here we evaluate how sugar availability affects cricket species richness and abundance in old-growth Atlantic forest by spraying sugarcane syrup on leaf litter, simulating increasing availability, and collecting crickets via pitfall trapping. We found an asymptotic positive association between resource addition and species richness, and an interaction between resource addition and species identity on cricket abundance, which indicates differential effects of resource addition among cricket species. Our results indicate that 12 of the 13 cricket species present in forest litter are maintained at low densities by resource scarcity; this highlights sugar-rich resource as a short-term driver of litter cricket community structure in tropical forests. When resource was experimentally increased, species richness increased due to behavioral displacement. We present evidence that the density of many species is limited by resource scarcity and, when resources are added, behavioral displacement promotes increased species packing and alters species composition. Further, our findings have technical applicability for increasing sampling efficiency of local cricket diversity in studies aiming to estimate species richness, but with no regard to local environmental drivers or species-abundance characteristics.

  3. Diversity of use and local knowledge of wild edible plant resources in Nepal

    Directory of Open Access Journals (Sweden)

    Uprety Yadav

    2012-04-01

    Full Text Available Abstract Background Wild edible plants (WEP provide staple and supplement foods, as well as cash income to local communities, thus favouring food security. However, WEP are largely ignored in land use planning and implementation, economic development, and biodiversity conservation. Moreover, WEP-related traditional knowledge is rapidly eroding. Therefore, we designed this study to fulfill a part of the knowledge gap by providing data on diversity, traditional knowledge, economic potential, and conservation value of WEP from Nepal. Methods The information was collected through focus group discussions and key informant interviews. Percentage of general utility of the plants among the study communities was evaluated using the Chi-square (χ2 test of homogeneity. High priority species were identified after consultation with the local stakeholders followed by scoring based on defined criteria. Pairwise ranking was used to assess ethnoecological knowledge to identify the threats to WEP. Results We documented 81 species belonging to Angiosperms (74, Pteridophytes (5, and Fungi (2. Most of the species were used as fruits (44 species followed by vegetables (36. Almost half of the species (47% were also used for purposes other than food. From the species with market value (37% of the total, 10 were identified as high priority species. Pairwise ranking revealed that WEP are threatened mostly by habitat destruction, land-use change and over-harvesting. Some of these plants are crop wild relatives and could thus be used for crop improvement. Interestingly, our study also revealed that young people who spend most of the time in the forest as herdsmen are particularly knowledgeable of wild fruit plants. Conclusion We provide empirical evidence from a relatively large area of Nepal about diversity and status of WEP, as well as methodological insights about the proper knowledge holders to consult. Regarding the unique and important knowledge they have on WEP

  4. Dietary Diversity on the Swahili Coast: The Fauna from Two Zanzibar Trading Locales.

    Science.gov (United States)

    Prendergast, M E; Quintana Morales, E M; Crowther, A; Horton, M C; Boivin, N L

    2017-01-01

    Occupants of coastal and island eastern Africa-now known as the 'Swahili coast'-were involved in long-distance trade with the Indian Ocean world during the later first millennium CE. Such exchanges may be traced via the appearance of non-native animals in the archaeofaunal record; additionally, this record reveals daily culinary practises of the members of trading communities and can thus shed light on subsistence technologies and social organisation. Yet despite the potential contributions of faunal data to Swahili coast archaeology, few detailed zooarchaeological studies have been conducted. Here, we present an analysis of faunal remains from new excavations at two coastal Zanzibar trading locales: the small settlement of Fukuchani in the north-west and the larger town of Unguja Ukuu in the south-west. The occurrences of non-native fauna at these sites-Asian black rat (Rattus rattus) and domestic chicken (Gallus gallus), as well as domestic cat (Felis catus)-are among the earliest in eastern Africa. The sites contrast with one another in their emphases on wild and domestic fauna: Fukuchani's inhabitants were economically and socially engaged with the wild terrestrial realm, evidenced not only through diet but also through the burial of a cache of wild bovid metatarsals. In contrast, the town of Unguja Ukuu had a domestic economy reliant on caprine herding, alongside more limited chicken keeping, although hunting or trapping of wild fauna also played an important role. Occupants of both sites were focused on a diversity of near-shore marine resources, with little or no evidence for the kind of venturing into deeper waters that would have required investment in new technologies. Comparisons with contemporaneous sites suggest that some of the patterns at Fukuchani and Unguja Ukuu are not replicated elsewhere. This diversity in early Swahili coast foodways is essential to discussions of the agents engaged in long-distance maritime trade. © 2017 The Authors

  5. Local endemicity and high diversity characterise high-latitude coral- Symbiodinium partnerships

    Science.gov (United States)

    Wicks, L. C.; Sampayo, E.; Gardner, J. P. A.; Davy, S. K.

    2010-12-01

    Obligate symbiotic dinoflagellates ( Symbiodinium) residing within the tissues of most reef invertebrates are important in determining the tolerance range of their host. Coral communities living at high latitudes experience wide fluctuations in environmental conditions and thus provide an ideal system to gain insights into the range within which the symbiotic relationship can be sustained. Further, understanding whether and how symbiont communities associated with high-latitude coral reefs are different from their tropical counterparts will provide clues to the potential of corals to cope with marginal or changing conditions. However, little is known of the host and symbiont partnerships at high latitudes. Symbiodinium diversity and specificity of high-latitude coral communities were explored using denaturing gradient gel electrophoresis (PCR-DGGE) analysis of the internal transcribed spacer regions (ITS1 and ITS2) of the ribosomal DNA at Lord Howe Island (31°S; Australia), and the Kermadec Islands (29°S; New Zealand). All but one host associated with clade C Symbiodinium, the exception being a soft coral ( Capnella sp.) that contained Symbiodinium B1. Besides ‘host-generalist’ Symbiodinium types C1 and C3, approximately 72% of the Symbiodinium identified were novel C types, and zonation of symbionts in relation to environmental parameters such as depth and turbidity was evident in certain host species. The high-latitude Symbiodinium communities showed little overlap and relatively high diversity compared with communities sampled on the tropical Great Barrier Reef. Although host specificity was maintained in certain species, others shared symbionts and this potential reduction of fidelity at high-latitude locations may be the result of locally challenging and highly variable environmental conditions.

  6. Gender isn't an issue! Case studies of exemplary practice in promoting gender equality and diversity in local authorities

    OpenAIRE

    Broussine, M.; Fox, P.

    2005-01-01

    Report of an inquiry, the aims of which were:\\ud \\ud 1)Develop case studies which demonstrate exemplary practice in progress towards gender equality in five selected local authorities. \\ud \\ud 2)Identify the systemic and cultural factors, working styles and practices and processes that contribute to good practice in gender equality and diversity. \\ud \\ud 3)Point local authorities to best practice so that they might learn from a process which has identified and celebrated achievement.

  7. Antarctic glossopterid diversity on a local scale: the presence of multiple megasporophyll genera, Upper Permian, Mt. Achernar, Transantarctic Mountains, Antarctica.

    Science.gov (United States)

    Ryberg, Patricia E; Taylor, Edith L; Taylor, Thomas N

    2012-09-01

    The glossopterids are a group of plants that thrived during a time of global warming similar to what is happening on the Earth today as well as the transition from archaic plant groups to the ancestors of modern groups. The diversity of the glossopterid clade is based on the megasporangiate structures assigned to the group, because the vegetative and pollen-bearing structures vary little. The presence of numerous reproductive genera from a single Upper Permian locality in the central Transantarctic Mountains provides important data on local glossopterid diversity in Antarctica. Impression/compression fossils were imaged with a Leica 5000C digital camera on a dissecting microscope or a Fujifilm FinePix S1pro digital camera. Two megasporangiate taxa are described: Scutum leiophyllum, which represents the first confirmed record of the genus in Antarctica, and Lidgettoniopsis ramulus, a new morphology consisting of a pinnate structure with oppositely attached megasporophylls. Plumsteadia ovata specimens indicate that this genus can be larger than previously recorded and illustrate the vegetative surface with a distinct midrib. The presence of a laminar, multiovulate structure and a pinnate structure at the same site indicates that local-level glossopterid diversity in Antarctica is greater than previously hypothesized. The discovery of a new megasporophyll morphology in Antarctica (confirming the presence of three distinctive morphologies on the continent) shows that Antarctic glossopterid heterogeneity is on a par with other Gondwanan continents. The diversity of the Antarctic landscape reveals that high polar latitudes can sustain a diverse ecosystem during times of global warming.

  8. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  9. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  10. "Time Flies in California": Multiliteracies Bridging Local Diversity and Global Connectedness through a "Reggio"-Inspired Approach

    Science.gov (United States)

    Hesterman, Sandra

    2017-01-01

    A pedagogy of multiliteracies is based on the theoretical perspective that in order to find our way around our mass media, multimedia and electronic hypermedia communication environments and accommodate the realities of increasing local diversity and global connectedness, a broadened definition of literacy is required. New ways of making sense of…

  11. Comparative genomics of phylogenetically diverse unicellular eukaryotes provide new insights into the genetic basis for the evolution of the programmed cell death machinery.

    Science.gov (United States)

    Nedelcu, Aurora M

    2009-03-01

    Programmed cell death (PCD) represents a significant component of normal growth and development in multicellular organisms. Recently, PCD-like processes have been reported in single-celled eukaryotes, implying that some components of the PCD machinery existed early in eukaryotic evolution. This study provides a comparative analysis of PCD-related sequences across more than 50 unicellular genera from four eukaryotic supergroups: Unikonts, Excavata, Chromalveolata, and Plantae. A complex set of PCD-related sequences that correspond to domains or proteins associated with all main functional classes--from ligands and receptors to executors of PCD--was found in many unicellular lineages. Several PCD domains and proteins previously thought to be restricted to animals or land plants are also present in unicellular species. Noteworthy, the yeast, Saccharomyces cerevisiae--used as an experimental model system for PCD research, has a rather reduced set of PCD-related sequences relative to other unicellular species. The phylogenetic distribution of the PCD-related sequences identified in unicellular lineages suggests that the genetic basis for the evolution of the complex PCD machinery present in extant multicellular lineages has been established early in the evolution of eukaryotes. The shaping of the PCD machinery in multicellular lineages involved the duplication, co-option, recruitment, and shuffling of domains already present in their unicellular ancestors.

  12. Preservation of the genetic diversity of a local common carp in the agricultural heritage rice–fish system

    Science.gov (United States)

    Ren, Weizheng; Hu, Liangliang; Guo, Liang; Zhang, Jian; Tang, Lu; Zhang, Entao; Zhang, Jiaen; Luo, Shiming; Tang, Jianjun; Chen, Xin

    2018-01-01

    We examined how traditional farmers preserve the genetic diversity of a local common carp (Cyprinus carpio), which is locally referred to as “paddy field carp” (PF-carp), in a “globally important agricultural heritage system” (GIAHS), i.e., the 1,200-y-old rice–fish coculture system in Zhejiang Province, China. Our molecular and morphological analysis showed that the PF-carp has changed into a distinct local population with higher genetic diversity and diverse color types. Within this GIAHS region, PF-carps exist as a continuous metapopulation, although three genetic groups could be identified by microsatellite markers. Thousands of small farmer households interdependently obtained fry and parental carps for their own rice–fish production, resulting in a high gene flow and large numbers of parent carps distributing in a mosaic pattern in the region. Landscape genetic analysis indicated that farmers’ connectivity was one of the major factors that shaped this genetic pattern. Population viability analysis further revealed that the numbers of these interconnected small farmer households and their connection intensity affect the carps’ inherent genetic diversity. The practice of mixed culturing of carps with diverse color types helped to preserve a wide range of genetic resources in the paddy field. This widespread traditional practice increases fish yield and resource use, which, in return, encourages famers to continue their practice of selecting and conserving diverse color types of PF-carp. Our results suggested that traditional farmers secure the genetic diversity of PF-carp and its viability over generations in this region through interdependently incubating and mixed-culturing practices within the rice−fish system. PMID:29295926

  13. Micro-evolutionary diversification among Indian Ocean parrots: temporal and spatial changes in phylogenetic diversity as a consequence of extinction and invasion

    OpenAIRE

    Jackson, H; Jones, C G; Agapow, P-M; Tatayah, V; Groombridge, Jim J.

    2015-01-01

    Almost 90% of global bird extinctions have occurred on islands. The loss of endemic spe- cies from island systems can dramatically alter evolutionary trajectories of insular species biodiversity, resulting in a loss of evolutionary diversity important for species adaptation to changing environments. The Western Indian Ocean islands have been the scene of evolution for a large number of endemic parrots. Since their discovery in the 16th cen- tury, many of these parrots have become extinct or h...

  14. Phylogenetic perspectives on reef fish functional traits.

    Science.gov (United States)

    Floeter, Sergio R; Bender, Mariana G; Siqueira, Alexandre C; Cowman, Peter F

    2018-02-01

    Functional traits have been fundamental to the evolution and diversification of entire fish lineages on coral reefs. Yet their relationship with the processes promoting speciation, extinction and the filtering of local species pools remains unclear. We review the current literature exploring the evolution of diet, body size, water column use and geographic range size in reef-associated fishes. Using published and new data, we mapped functional traits on to published phylogenetic trees to uncover evolutionary patterns that have led to the current functional diversity of fishes on coral reefs. When examining reconstructed patterns for diet and feeding mode, we found examples of independent transitions to planktivory across different reef fish families. Such transitions and associated morphological alterations may represent cases in which ecological opportunity for the exploitation of different resources drives speciation and adaptation. In terms of body size, reconstructions showed that both large and small sizes appear multiple times within clades of mid-sized fishes and that extreme body sizes have arisen mostly in the last 10 million years (Myr). The reconstruction of range size revealed many cases of disparate range sizes among sister species. Such range size disparity highlights potential vicariant processes through isolation in peripheral locations. When accounting for peripheral speciation processes in sister pairs, we found a significant relationship between labrid range size and lineage age. The diversity and evolution of traits within lineages is influenced by trait-environment interactions as well as by species and trait-trait interactions, where the presence of a given trait may trigger the development of related traits or behaviours. Our effort to assess the evolution of functional diversity across reef fish clades adds to the burgeoning research focusing on the evolutionary and ecological roles of functional traits. We argue that the combination of a

  15. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus "Ferrovum".

    Directory of Open Access Journals (Sweden)

    Sophie R Ullrich

    Full Text Available Members of the genus "Ferrovum" are ubiquitously distributed in acid mine drainage (AMD waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain "Ferrovum myxofaciens" P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus "Ferrovum" is extremely scarce.In order to access the wider genetic pool of the genus "Ferrovum" we sequenced the genome of a "Ferrovum"-containing mixed culture and successfully assembled the almost complete genome sequence of the novel "Ferrovum" strain JA12.The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct "Ferrovum" species. "Ferrovum" strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that "Ferrovum" strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively.The potential utilisation of urea by "Ferrovum" strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs "Ferrovum" strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin and Acidithiobacillus ferrivorans (iron oxidase indicates the existence of a modified pathway in "Ferrovum" strain JA12

  16. Molecular diversity of bacterial endosymbionts associated with dagger nematodes of the genus Xiphinema (Nematoda: Longidoridae) reveals a high degree of phylogenetic congruence with their host.

    Science.gov (United States)

    Palomares-Rius, Juan E; Archidona-Yuste, Antonio; Cantalapiedra-Navarrete, Carolina; Prieto, Pilar; Castillo, Pablo

    2016-12-01

    Bacterial endosymbionts have been detected in some groups of plant-parasitic nematodes, but few cases have been reported compared to other groups in the phylum Nematoda, such as animal-parasitic or free-living nematodes. This study was performed on a wide variety of plant-parasitic nematode families and species from different host plants and nematode populations. A total of 124 nematode populations (previously identified morphologically and molecularly) were screened for the presence of potential bacterial endosymbionts using the partial 16S rRNA gene and fluorescence in situ hybridization (FISH) and confocal microscopy. Potential bacterial endosymbionts were only detected in nematode species belonging to the genus Xiphinema and specifically in the X. americanum group. Fifty-seven partial 16S rRNA sequences were obtained from bacterial endosymbionts in this study. One group of sequences was closely related to the genus 'Candidatus Xiphinematobacter' (19 bacterial endosymbiont sequences were associated with seven nematode host species, including two that have already been described and three unknown bacterial endosymbionts). The second bacterial endosymbiont group (38 bacterial endosymbiont sequences associated with six nematode species) was related to the family Burkholderiaceae, which includes fungal and soil-plant bacterial endosymbionts. These endosymbionts were reported for the first time in the phylum Nematoda. Our findings suggest that there is a highly specific symbiotic relationship between nematode host and bacterial endosymbionts. Overall, these results were corroborated by a phylogeny of nematode host and bacterial endosymbionts that suggested that there was a high degree of phylogenetic congruence and long-term evolutionary persistence between hosts and endosymbionts. © 2016 John Wiley & Sons Ltd.

  17. Determinants of plant community assembly in a mosaic of landscape units in central Amazonia: ecological and phylogenetic perspectives.

    Directory of Open Access Journals (Sweden)

    María Natalia Umaña

    Full Text Available The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace and flooded forests (Igapó. We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties.

  18. Determinants of Plant Community Assembly in a Mosaic of Landscape Units in Central Amazonia: Ecological and Phylogenetic Perspectives

    Science.gov (United States)

    Umaña, María Natalia; Norden, Natalia; Cano, Ángela; Stevenson, Pablo R.

    2012-01-01

    The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace) and flooded forests (Igapó). We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties. PMID:23028844

  19. Morphological characterization and phylogenetic distance among ...

    African Journals Online (AJOL)

    The genetic diversity was calculated with Nei and Li's index, and the phylogenetic tree (dendrogram) was generated with a neighbor-joining program. The dendrogram indicates the diversity of the genotypes, which are grouped into three distinctive large groups. The largest group includes species from the Mediolobivia and ...

  20. Evaluation of haplotype diversity of Achatina fulica (Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its phylogenetic relationships with other global populations.

    Science.gov (United States)

    Ayyagari, Vijaya Sai; Sreerama, Krupanidhi

    2017-08-01

    Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.

  1. Phylogenetic and Physiological Diversity of Subseafloor Microbial Communities at Axial Seamount, Juan de Fuca Ridge: Summary of Results From the New Millenium Observatory (NeMO), 1998-2004

    Science.gov (United States)

    Baross, J. A.; Huber, J. A.; Mehta, M. P.; Opatkiewicz, A.; Bolton, S. A.; Butterfield, D. A.; Sogin, M. L.; Embley, R. W.

    2005-12-01

    Axial Seamount (45 ° 58' N; 130 ° 00' W) is an active submarine volcano located on the Juan de Fuca Ridge, approximately 300 miles off the coast of Oregon. Lying at the intersection of a seamount chain and a spreading axis, Axial is a unique study site from both the geological and biological perspective. In January of 1998, Axial experienced a week-long series of earthquakes, and subsequent water column and seafloor observations on the southeast portion of the caldera found temperature and chemical anomalies, extensive new seafloor lava flows, large "snow blower" type vents, and other characteristics commonly associated with diking-eruptive events. Due to its high activity and close proximity to shore, Axial was chosen as a site for a multi-year observatory (New Millenium Observatory, NeMO) to document changes and interactions between geology, chemistry, and biology on the mid-ocean ridge system. From 1998 through 2004, we extensively sampled diffuse vents at Axial Seamount to determine the physiological and phylogenetic diversity of subseafloor microbial communities and their relationship to the geochemical environment. Here we present a summary of those studies, including molecular-based phylogenetic surveys of bacteria, archaea, and potential nitrogen-fixing organisms, culturing results of thermophiles and hyperthermophiles from over 20 sites, and the distribution of one particular group of hyperthermophiles at diffuse vents throughout the caldera and how that distribution may be linked to the geochemical habitat. Results indicate that Axial supports a diverse subseafloor microbial community, including hydrogen and sulfur oxidizers, hyperthermophilic methane producers and heterotrophs, and many organisms with the potential to fix nitrogen. In addition, we find that the species composition of the microbial community changes in response to changes in the physical and chemical conditions at each vent site. The extent of seawater mixing with hydrothermal fluids

  2. Lack of congruence in species diversity indices and community structures of planktonic groups based on local environmental factors.

    Science.gov (United States)

    Doi, Hideyuki; Chang, Kwang-Hyeon; Nishibe, Yuichiro; Imai, Hiroyuki; Nakano, Shin-ichi

    2013-01-01

    The importance of analyzing the determinants of biodiversity and community composition by using multiple trophic levels is well recognized; however, relevant data are lacking. In the present study, we investigated variations in species diversity indices and community structures of the plankton taxonomic groups-zooplankton, rotifers, ciliates, and phytoplankton-under a range of local environmental factors in pond ecosystems. For each planktonic group, we estimated the species diversity index by using linear models and analyzed the community structure by using canonical correspondence analysis. We showed that the species diversity indices and community structures varied among the planktonic groups and according to local environmental factors. The observed lack of congruence among the planktonic groups may have been caused by niche competition between groups with similar trophic guilds or by weak trophic interactions. Our findings highlight the difficulty of predicting total biodiversity within a system, based upon a single taxonomic group. Thus, to conserve the biodiversity of an ecosystem, it is crucial to consider variations in species diversity indices and community structures of different taxonomic groups, under a range of local conditions.

  3. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  4. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus “Ferrovum”

    Science.gov (United States)

    Ullrich, Sophie R.; Poehlein, Anja; Tischler, Judith S.; González, Carolina; Ossandon, Francisco J.; Daniel, Rolf; Holmes, David S.; Schlömann, Michael; Mühling, Martin

    2016-01-01

    Background Members of the genus “Ferrovum” are ubiquitously distributed in acid mine drainage (AMD) waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain “Ferrovum myxofaciens” P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus “Ferrovum” is extremely scarce. Objective In order to access the wider genetic pool of the genus “Ferrovum” we sequenced the genome of a “Ferrovum”-containing mixed culture and successfully assembled the almost complete genome sequence of the novel “Ferrovum” strain JA12. Phylogeny and Lifestyle The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct “Ferrovum” species. “Ferrovum” strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that “Ferrovum” strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively. Unique Metabolic Features The potential utilisation of urea by “Ferrovum” strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs “Ferrovum” strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin) and Acidithiobacillus

  5. Diversity of Sarcocystis spp shed by opossums in Brazil inferred with phylogenetic analysis of DNA coding ITS1, cytochrome B, and surface antigens.

    Science.gov (United States)

    Valadas, Samantha Y O B; da Silva, Juliana I G; Lopes, Estela Gallucci; Keid, Lara B; Zwarg, Ticiana; de Oliveira, Alice S; Sanches, Thaís C; Joppert, Adriana M; Pena, Hilda F J; Oliveira, Tricia M F S; Ferreira, Helena L; Soares, Rodrigo M

    2016-05-01

    Although few species of Sarcocystis are known to use marsupials of the genus Didelphis as definitive host, an extensive diversity of alleles of surface antigen genes (sag2, sag3, and sag4) has been described in samples of didelphid opossums in Brazil. In this work, we studied 25 samples of Sarcocystis derived from gastrointestinal tract of opossums of the genus Didelphis by accessing the variability of sag2, sag3, sag4, gene encoding cytochrome b (cytB) and first internal transcribed spacer (ITS1). Reference samples of Sarcocystis neurona (SN138) and Sarcocystis falcatula (SF1) maintained in cell culture were also analyzed. We found four allele variants of cytB, seven allele variants of ITS1, 10 allele variants of sag2, 13 allele variants of sag3, and 6 allele variants of sag4. None of the sporocyst-derived sequences obtained from Brazilian opossums revealed 100% identity to SN138 at cytB gene, nor to SN138 or SF1 at ITS1 locus. In addition, none of the sag alleles were found identical to either SF1 or SN138 homologous sequences, and a high number of new sag allele types were found other than those previously described in Brazil. Out of ten sag2 alleles, four are novel, while eight out of 13 sag3 alleles are novel and one out of six sag4 alleles is novel. Further studies are needed to clarify if such a vast repertoire of allele variants of Sarcocystis is the consequence of re-assortments driven by sexual exchange, in order to form individuals with highly diverse characteristics, such as pathogenicity, host spectrum, among others or if it only represents allele variants of different species with different biological traits. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  7. Global to local genetic diversity indicators of evolutionary potential in tree species within and outside forests

    DEFF Research Database (Denmark)

    Graudal, Lars; Aravanopoulos, Filippos; Bennadji, Zohra

    2014-01-01

    -monitoring schemes. Here, we provide a review and an assessment of the different attempts made to provide such indicators for tree genetic diversity from the global level down to the level of the management unit. So far, no generally accepted indicators have been provided as international standards, nor tested...... for their possible use in practice. We suggest that indicators for monitoring genetic diversity and dynamics should be based on ecological and demographic surrogates of adaptive diversity as well as genetic markers capable of identifying genetic erosion and gene flow. A comparison of past and present genecological...... distributions (patterns of genetic variation of key adaptive traits in the ecological space) of selected species is a realistic way of assessing the trend of intra-specific variation, and thus provides a state indicator of tree genetic diversity also able to reflect possible pressures threatening genetic...

  8. Epigenetic variation predicts regional and local intraspecific functional diversity in a perennial herb.

    Science.gov (United States)

    Medrano, Mónica; Herrera, Carlos M; Bazaga, Pilar

    2014-10-01

    The ecological significance of epigenetic variation has been generally inferred from studies on model plants under artificial conditions, but the importance of epigenetic differences between individuals as a source of intraspecific diversity in natural plant populations remains essentially unknown. This study investigates the relationship between epigenetic variation and functional plant diversity by conducting epigenetic (methylation-sensitive amplified fragment length polymorphisms, MSAP) and genetic (amplified fragment length polymorphisms, AFLP) marker-trait association analyses for 20 whole-plant, leaf and regenerative functional traits in a large sample of wild-growing plants of the perennial herb Helleborus foetidus from ten sampling sites in south-eastern Spain. Plants differed widely in functional characteristics, and exhibited greater epigenetic than genetic diversity, as shown by per cent polymorphism of MSAP fragments (92%) or markers (69%) greatly exceeding that for AFLP ones (41%). After controlling for genetic structuring and possible cryptic relatedness, every functional trait considered exhibited a significant association with at least one AFLP or MSAP marker. A total of 27 MSAP (13.0% of total) and 12 AFLP (4.4%) markers were involved in significant associations, which explained on average 8.2% and 8.0% of trait variance, respectively. Individual MSAP markers were more likely to be associated with functional traits than AFLP markers. Between-site differences in multivariate functional diversity were directly related to variation in multilocus epigenetic diversity after multilocus genetic diversity was statistically accounted for. Results suggest that epigenetic variation can be an important source of intraspecific functional diversity in H. foetidus, possibly endowing this species with the capacity to exploit a broad range of ecological conditions despite its modest genetic diversity. © 2014 John Wiley & Sons Ltd.

  9. Evolution of Chemical Diversity in a Group of Non-Reduced Polyketide Gene Clusters: Using Phylogenetics to Inform the Search for Novel Fungal Natural Products

    Directory of Open Access Journals (Sweden)

    Kurt Throckmorton

    2015-09-01

    Full Text Available Fungal polyketides are a diverse class of natural products, or secondary metabolites (SMs, with a wide range of bioactivities often associated with toxicity. Here, we focus on a group of non-reducing polyketide synthases (NR-PKSs in the fungal phylum Ascomycota that lack a thioesterase domain for product release, group V. Although widespread in ascomycete taxa, this group of NR-PKSs is notably absent in the mycotoxigenic genus Fusarium and, surprisingly, found in genera not known for their secondary metabolite production (e.g., the mycorrhizal genus Oidiodendron, the powdery mildew genus Blumeria, and the causative agent of white-nose syndrome in bats, Pseudogymnoascus destructans. This group of NR-PKSs, in association with the other enzymes encoded by their gene clusters, produces a variety of different chemical classes including naphthacenediones, anthraquinones, benzophenones, grisandienes, and diphenyl ethers. We discuss the modification of and transitions between these chemical classes, the requisite enzymes, and the evolution of the SM gene clusters that encode them. Integrating this information, we predict the likely products of related but uncharacterized SM clusters, and we speculate upon the utility of these classes of SMs as virulence factors or chemical defenses to various plant, animal, and insect pathogens, as well as mutualistic fungi.

  10. [A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].

    Science.gov (United States)

    Shulakov, A A; Egorov, A V; Onipchenko, V G

    2016-01-01

    Phylogenetic analysis of communities is based on the comparison of distances on the phylogenetic tree between species of a community under study and those distances in random samples taken out of local flora. It makes it possible to determine to what extent a community composition is formed by more closely related species (i.e., "clustered") or, on the opposite, it is more even and includes species that are less related with each other. The first case is usually interpreted as a result of strong influence caused by abiotic factors, due to which species with similar ecology, a priori more closely related, would remain: In the second case, biotic factors, such as competition, may come to the fore and lead to forming a community out of distant clades due to divergence of their ecological niches: The aim of this' study Was Ad explore the phylogenetic structure in communities of the northwestern Caucasus at two spatial scales - the scale of area from 4 to 100 m2 and the smaller scale within a community. The list of local flora of the alpine belt has been composed using the database of geobotanic descriptions carried out in Teberda Biosphere Reserve at true altitudes exceeding.1800 m. It includes 585 species of flowering plants belonging to 57 families. Basal groups of flowering plants are.not represented in the list. At the scale of communities of three classes, namely Thlaspietea rotundifolii - commumties formed on screes and pebbles, Calluno-Ulicetea - alpine meadow, and Mulgedio-Aconitetea subalpine meadows, have not demonstrated significant distinction of phylogenetic structure. At intra level, for alpine meadows the larger share of closely related species. (clustered community) is detected. Significantly clustered happen to be those communities developing on rocks (class Asplenietea trichomanis) and alpine (class Juncetea trifidi). At the same time, alpine lichen proved to have even phylogenetic structure at the small scale. Alpine (class Salicetea herbaceae) that

  11. Seeding method influences warm-season grass abundance and distribution but not local diversity in grassland restoration

    Science.gov (United States)

    Yurkonis, Kathryn A.; Wilsey, Brian J.; Moloney, Kirk A.; Drobney, Pauline; Larson, Diane L.

    2010-01-01

    Ecological theory predicts that the arrangement of seedlings in newly restored communities may influence future species diversity and composition. We test the prediction that smaller distances between neighboring seeds in drill seeded grassland plantings would result in lower species diversity, greater weed abundance, and larger conspecific patch sizes than otherwise similar broadcast seeded plantings. A diverse grassland seed mix was either drill seeded, which places seeds in equally spaced rows, or broadcast seeded, which spreads seeds across the ground surface, into 24 plots in each of three sites in 2005. In summer 2007, we measured species abundance in a 1 m2 quadrat in each plot and mapped common species within the quadrat by recording the most abundant species in each of 64 cells. Quadrat-scale diversity and weed abundance were similar between drilled and broadcast plots, suggesting that processes that limited establishment and controlled invasion were not affected by such fine-scale seed distribution. However, native warm-season (C4) grasses were more abundant and occurred in less compact patches in drilled plots. This difference in C4 grass abundance and distribution may result from increased germination or vegetative propagation of C4 grasses in drilled plots. Our findings suggest that local plant density may control fine-scale heterogeneity and species composition in restored grasslands, processes that need to be further investigated to determine whether seed distributions can be manipulated to increase diversity in restored grasslands.

  12. Effects of local tree diversity on herbivore communities diminish with increasing forest fragmentation on the landscape scale.

    Directory of Open Access Journals (Sweden)

    Franziska Peter

    Full Text Available Forest fragmentation and plant diversity have been shown to play a crucial role for herbivorous insects (herbivores, hereafter. In turn, herbivory-induced leaf area loss is known to have direct implications for plant growth and reproduction as well as long-term consequences for ecosystem functioning and forest regeneration. So far, previous studies determined diverging responses of herbivores to forest fragmentation and plant diversity. Those inconsistent results may be owed to complex interactive effects of both co-occurring environmental factors albeit they act on different spatial scales. In this study, we investigated whether forest fragmentation on the landscape scale and tree diversity on the local habitat scale show interactive effects on the herbivore community and leaf area loss in subtropical forests in South Africa. We applied standardized beating samples and a community-based approach to estimate changes in herbivore community composition, herbivore abundance, and the effective number of herbivore species on the tree species-level. We further monitored leaf area loss to link changes in the herbivore community to the associated process of herbivory. Forest fragmentation and tree diversity interactively affected the herbivore community composition, mainly by a species turnover within the family of Curculionidae. Furthermore, herbivore abundance increased and the number of herbivore species decreased with increasing tree diversity in slightly fragmented forests whereas the effects diminished with increasing forest fragmentation. Surprisingly, leaf area loss was neither affected by forest fragmentation or tree diversity, nor by changes in the herbivore community. Our study highlights the need to consider interactive effects of environmental changes across spatial scales in order to draw reliable conclusions for community and interaction patterns. Moreover, forest fragmentation seems to alter the effect of tree diversity on the herbivore

  13. Trophic phylogenetics: evolutionary influences on body size, feeding, and species associations in grassland arthropods.

    Science.gov (United States)

    Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T

    2015-04-01

    Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid

  14. Molecular phylogenetic reconstruction and localization of the (TTAGG)n telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863) suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera).

    Science.gov (United States)

    Pereira, Tássia Tatiane Pontes; Dos Reis, Ana Caroline Coelho Corrêa; Cardoso, Danon Clemes; Cristiano, Maykon Passos

    2018-01-01

    Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG) 6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus . Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  15. Recovering Sample Diversity in Rao-Blackwellized Particle Filters for Simultaneous Localization and Mapping

    National Research Council Canada - National Science Library

    Anderson, Andrew D

    2006-01-01

    ...) in simultaneous localization and mapping (SLAM) situations that arises when precise feature measurements yield a limited perceptual distribution relative to a motion-based proposal distribution...

  16. Identification of unknown apple cultivars demonstrates the impact of local breeding program on cultivar diversity

    Science.gov (United States)

    Apple trees, either abandoned or cared for, are common on the North American landscape. These trees can live for decades, and therefore represent a record of large- and small-scale agricultural practices through time. Here, we assessed the genetic diversity and identity of 330 unknown apple trees in...

  17. Variability in seed traits, oil content and genetic diversity in local and ...

    African Journals Online (AJOL)

    Variability in seed traits, oil content and genetic diversity of Jatropha curcas L. according to rainfall gradient in Senegal are hereby reported and discussed. Seed oil variability ranged from 58.61% in Sudanian zone to 46.94% in Sahelian zone. Seed oil content and seed thickness were correlated to rainfall with a correlation ...

  18. Spatial patterns of diversity at local and regional scales in a tropical lagoon

    Directory of Open Access Journals (Sweden)

    José Adán Caballero-Vázquez

    Full Text Available The present study reports estimates of alpha (α, beta (β and gamma (Γ diversity for the fish community of Chacmochuch Lagoon (SE Mexico, a natural protected area located in the northern portion of the Mesoamerican Barrier Reef System. Fish specimens were sampled in 2004 and 2006. Field work was carried out at three climatic peaks: at 13 stations using a 70 m-long beach seine. The collected data were supplemented with information obtained from a previous work conducted in 2002 and were then analyzed with multivariate statistical methods. In addition, fish composition results from this study were compared to those reported for other similar ecosystems of the region. A total of 68 fish species were recorded, determined as peripheral (high-salinity species, usually marine affinity most of them. Most of the fish species collected were determined as rare, and a few number of species were determined as common and dominant. Salinity, TSD, temperature, dissolved oxygen and other variables were measured to determine the influence over the fish communities, four groups of sites where determined. Results indicated a gradual decrease in the degree of species replacement towards the interior of the system (away from the coast. The estimated value of gamma diversity was high compared to that reported for other coastal systems of the region and, due to the high degree of habitat heterogeneity found in this system; beta diversity had a greater contribution to gamma diversity than alpha diversity. This lagoon acts as a nursing area for many of the fish species collected in this study as indicated by the presence of juvenile stages.

  19. The local knowledge of medicinal plants trader and diversity of medicinal plants in the Kabanjahe traditional market, North Sumatra, Indonesia.

    Science.gov (United States)

    Silalahi, Marina; Nisyawati; Walujo, Eko Baroto; Supriatna, Jatna; Mangunwardoyo, Wibowo

    2015-12-04

    Market is the main place for transactions of medicinal plants and traditional ingredients by local community in the Karo regency, North Sumatra, Indonesia. This is the first study to document the local knowledge of traders on and the diversity of the medicinal plants. The investigation was carried out in the Kabanjahe traditional market, in the Karo regency. The research goal was to reveal the local knowledge, diversity and utilization of medicinal plants, which have been traded in the Kabanjahe traditional market, as a basis for conservation efforts. The study was conducted through ethnobotanical approach using market surveys. All traders of medicinal plants were surveyed applying in-depth interviews and participative observations. Data were analyzed qualitatively using descriptive statistics. The diversity of medicinal plants was expressed in term of the Shannon-Wiener diversity index (H'), whereas the similarity among traders was indicated by Jaccard index (Ji). Traders of medicinal plants stored the simplicia of medicinal plants in chest of drawers, plastic baskets, plastic bags, and in the air by suspending them from the the stall ceilings. We recorded 344 species, 217 genera and 90 families of medicinal plants. Those that were sold mostly belong to Zingeberaceae (20 species), Poaceae (19 species), and Asclepiadaceae (17 species), and the species received high consumers demand, mostly belong to Zingiberaceae, Rutaceae, and Asclepidiaceae. Asclepidiaceae was used to treat diseases like cancer and heart problems. The Shannon-Wiener diversity index of medicinal plants at the Kabanjahe traditional market was high (H'= 5.637). The high Jaccard similarity index (Ji>0.56) suggested that the traders were trading similar species of medicinal plants. Kabanjahe traditional market is the center for the sale of of medicinal plants as traditional ingredients. Several species are well known for their pharmacological properties but others, [such as: Dischidia imbricata (Blume

  20. Habitat connectivity and local conditions shape taxonomic and functional diversity of arthropods on green roofs.

    Science.gov (United States)

    Braaker, Sonja; Obrist, Martin Karl; Ghazoul, Jaboury; Moretti, Marco

    2017-05-01

    Increasing development of urban environments creates high pressure on green spaces with potential negative impacts on biodiversity and ecosystem services. There is growing evidence that green roofs - rooftops covered with vegetation - can contribute mitigate the loss of urban green spaces by providing new habitats for numerous arthropod species. Whether green roofs can contribute to enhance taxonomic and functional diversity and increase connectivity across urbanized areas remains, however, largely unknown. Furthermore, only limited information is available on how environmental conditions shape green roof arthropod communities. We investigated the community composition of arthropods (Apidae, Curculionidae, Araneae and Carabidae) on 40 green roofs and 40 green sites at ground level in the city of Zurich, Switzerland. We assessed how the site's environmental variables (such as area, height, vegetation, substrate and connectivity among sites) affect species richness and functional diversity using generalized linear models. We used an extension of co-inertia analysis (RLQ) and fourth-corner analysis to highlight the mechanism underlying community assemblages across taxonomic groups on green roof and ground communities. Species richness was higher at ground-level sites, while no difference in functional diversity was found between green roofs and ground sites. Green roof arthropod diversity increased with higher connectivity and plant species richness, irrespective of substrate depth, height and area of green roofs. The species trait analysis reviewed the mechanisms related to the environmental predictors that shape the species assemblages of the different taxa at ground and roof sites. Our study shows the important contribution of green roofs in maintaining high functional diversity of arthropod communities across different taxonomic groups, despite their lower species richness compared with ground sites. Species communities on green roofs revealed to be characterized

  1. Local loss and spatial homogenization of plant diversity reduce ecosystem multifunctionality

    Science.gov (United States)

    Experimental studies show that local plant species loss decreases ecosystem functioning and services, but it remains unclear how other changes in biodiversity, such as spatial homogenization, alter multiple processes (multifunctionality) in natural ecosystems. We present a global analysis of eight ...

  2. The diversity of local sorghum (Sorghum bicolor L. Moench) in Nusa Tenggara Timur province

    Science.gov (United States)

    Mukkun, L.; Lalel, H. J. D.; Richana, N.; Pabendon, M. B.; Kleden, S. R.

    2018-04-01

    Sorghum (Sorghum bicolor L. Moench) is an important food crop in the dry land including Nusa Tenggara Timur (NTT) Province. This plant has a high adaptability to drought, can produce on marginal land, and is relatively resistant to pests and diseases. The study aims to collect and identify the species of local sorghum being cultivated by farmers, and the purposes of cultivation. In addition, this study will preserve germ plasm of local sorghum by providing bank seeds for the next growing season. A collection of local sorghum samples was conducted in 7 districts using survey and observation method. A total of 53 species of sorghum were collected, with various characteristics and different local names. Based on the skin color of the seeds, the accessions were grouped into white groups (26.42%), light yellow (15.09%), black (20.75%), brown (24.52%), and red (13.20 %). Sorghum is used for complementary food for rice, consumption in times of food insecurity, fodder, and as a fence for corn and rice. It is necessary to characterize the type of local sorghum that has the potential to be developed for food, industrial raw materials, and for functional food.

  3. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    1CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow ... used to characterize and identify the cultivars; however, it is often difficult and even .... complete deletion of the missing/gap sites from all the sequences (table 2).

  4. Genetic fingerprinting and phylogenetic diversity of Staphylococcus ...

    African Journals Online (AJOL)

    Genetic fingerprinting of 18 different isolates of Staphylococcus aureus from Nigeria using random amplified polymorphic DNA (RAPD) was carried out. Ten out of 100 Operon primers showed polymorphism among the isolates tested generating 88 bands, 51 of which were polymorphic with sizes ranging between 200 and ...

  5. PHYLOGENETIC DIVERSITY OF CASSAVA GREEN MITE ...

    African Journals Online (AJOL)

    ACSS

    All rights reserved. ©2016, African Crop ... A comparative search from the NCBI Gene bank resulted into identical ... Previous studies have reported success in biological control of ..... Australian Systematic Botany 19: 479-559. Murega, T.N. ...

  6. Phylogenetic diversity of Mesorhizobium in chickpea

    Indian Academy of Sciences (India)

    2014-04-29

    Apr 29, 2014 ... uniform flowering/fruiting and seed maturation, etc., hap- pened several ... partnered with legume plants that were found to be ineffective nitrogen fixers ..... vides a rich resource for development of functional markers. PLoS ONE 7 ... Amarger N 2001 Classification of rhizobia based on nodC and. nifH gene ...

  7. Local climatic conditions constrain soil yeast diversity patterns in Mediterranean forests, woodlands and scrub biome.

    Science.gov (United States)

    Yurkov, Andrey M; Röhl, Oliver; Pontes, Ana; Carvalho, Cláudia; Maldonado, Cristina; Sampaio, José Paulo

    2016-02-01

    Soil yeasts represent a poorly known fraction of the soil microbiome due to limited ecological surveys. Here, we provide the first comprehensive inventory of cultivable soil yeasts in a Mediterranean ecosystem, which is the leading biodiversity hotspot for vascular plants and vertebrates in Europe. We isolated and identified soil yeasts from forested sites of Serra da Arrábida Natural Park (Portugal), representing the Mediterranean forests, woodlands and scrub biome. Both cultivation experiments and the subsequent species richness estimations suggest the highest species richness values reported to date, resulting in a total of 57 and 80 yeast taxa, respectively. These values far exceed those reported for other forest soils in Europe. Furthermore, we assessed the response of yeast diversity to microclimatic environmental factors in biotopes composed of the same plant species but showing a gradual change from humid broadleaf forests to dry maquis. We observed that forest properties constrained by precipitation level had strong impact on yeast diversity and on community structure and lower precipitation resulted in an increased number of rare species and decreased evenness values. In conclusion, the structure of soil yeast communities mirrors the environmental factors that affect aboveground phytocenoses, aboveground biomass and plant projective cover. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Genetic diversity in a population of rhinoclemmys nasuta (Testudines: Geoemydidae) associated with an insular locality in the Choco biogeographic region

    International Nuclear Information System (INIS)

    Castillo Cutiva, Leslie Anais; Giraldo, Alan; Barreto, Guillermo

    2014-01-01

    Characterization of the genetic diversity of Rhinoclemmys nasuta population inhabits Isla Palma (Malaga Bay, Valle del Cauca) was carried out using three microsatellite systems (cm72, cm58 and cm"3). In this locality, individuals of R. nasuta are widely distributed in the inland streams and creeks system. 100 to 200 ml of peripheral blood was taken off from ten turtles in five streams of the island, preserving samples in a 0.5 m EDTA. DNA was extracted using salting-out and chelex solution techniques. PCR amplified products were visualized and measured in polyacrylamide gels stained with silver nitrate. successful amplification products were obtained for all systems analyzed, two of which (cm72 and cm3) were found to be monomorphic, while the system cm58 had a high pic (0.698) allowing to estimate the genetic diversity of this population. The observed heterozygosity was low (ho = 0.26) and inbreeding indices fis and fit were high (0.67857 and 0.67881), indicating an excess of homozygotes in each of the rivers and for the all population. The molecular analysis of variance suggested that there is no difference in genetic structure of the population (FST = 0.00075, p= 0.95112). Therefore, the results suggest that the genetic diversity of R. nasutapopulation in Isla Palma was low and exhibited a highly inbred index.

  9. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  10. The Influence of Local Ethnic Diversity on Group-Centric Crime Attitudes

    DEFF Research Database (Denmark)

    Hjorth, Frederik

    2017-01-01

    Several studies provide evidence of group-centric policy attitudes, that is, citizens evaluating policies based on linkages with visible social groups. The existing literature generally points to the role of media imagery, rhetoric and prominent political sponsors in driving group-centric attitudes......-down’ influence on group-centric attitudes by elite actors is complemented by ‘bottom-up’ local processes of experiential learning about group–policy linkages....

  11. Increased phylogenetic resolution using target enrichment in Rubus

    Science.gov (United States)

    Phylogenetic analyses in Rubus L. have been challenging due to polyploidy, hybridization, and apomixis within the genus. Wide morphological diversity occurs within and between species, contributing to challenges at lower and higher systematic levels. Phylogenetic inferences to date have been based o...

  12. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  13. Local community knowledge and participation for animal diversity conservation in SSWP IV Sidoarjo, East Java, Indonesia

    Science.gov (United States)

    Ashuri, Nova Maulidina; Oktafitria, Dwi; Wirawan, Indra; Muttaqin, Zainul; Alfarisy, M. Ulya; Azis, Abdul; Argiyanti, Sherly Eka; Fadilah, Via Nur

    2017-06-01

    Key to animal biodiversity conservation are the local communities that live in and around these sites as their livelihoods depend on the natural resources these sites provide. SSWP (Sub Satuan Wilayah Pembangunan) IV Sidoarjo covers Krian, Balongbendo, Tarik, Prambon, and Wonoayu subdistrict with the main function as technical agricultural, industrial zones supported by the low density of settlement activity. Development in this region which tend not balanced between technical agricultural and industrial activities, it is necessary to study in depth so that rapid industrial development can still pay attention to the environment because there is a trend change in agricultural land use and settlements for industrial activities. Take a look at the projections of potential future threats and potential huge biodiversity in SSWP IV is necessary to do a program with a strategic approach to community support efforts to efficiently manage potential biodiversity. As well as the development and diversification of food security program in the region is an abundant source of food. The purpose of this study was to determine the biodiversity of animals in SSWP IV Sidoarjo and knowing how the knowledge and participation of local communities on biodiversity of animals in the region. The study was conducted in August-September 2016 through direct field surveys for collecting animal biodiversity primary data. It also conducted a structured interview to determine how much knowledge and participation of local communities towards the conservation of biodiversity of animals in SSWP IV Sidoarjo. The results of field studies obtained 28 Aves species, 48 species of Insect, 14 species of Pisces, 4 species of Reptiles, 6 species of Mammals. It was known that there were a bird species with protected status in accordance with UU No. 5 1990 and least concern status in accordance with IUCN. While the results of the interview obtained 63% of 19 respondents did not know about the definition of

  14. Phylogenetic analysis of anemone fishes of the Persian Gulf using ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-17

    Jun 17, 2008 ... genetic diversity among samples was investigated by phylogenetic analysis. Results show that there is ... more about the living organisms found in this region. Many marine ... Kish (modified from Pous et al., 2004). Table 2.

  15. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  16. Organic farming benefits local plant diversity in vineyard farms located in intensive agricultural landscapes.

    Science.gov (United States)

    Nascimbene, Juri; Marini, Lorenzo; Paoletti, Maurizio G

    2012-05-01

    The majority of research on organic farming has considered arable and grassland farming systems in Central and Northern Europe, whilst only a few studies have been carried out in Mediterranean agro-systems, such as vineyards, despite their economic importance. The main aim of the study was to test whether organic farming enhances local plant species richness in both crop and non-crop areas of vineyard farms located in intensive conventional landscapes. Nine conventional and nine organic farms were selected in an intensively cultivated region (i.e. no gradient in landscape composition) in northern Italy. In each farm, vascular plants were sampled in one vineyard and in two non-crop linear habitats, grass strips and hedgerows, adjacent to vineyards and therefore potentially influenced by farming. We used linear mixed models to test the effect of farming, and species longevity (annual vs. perennial) separately for the three habitat types. In our intensive agricultural landscapes organic farming promoted local plant species richness in vineyard fields, and grassland strips while we found no effect for linear hedgerows. Differences in species richness were not associated to differences in species composition, indicating that similar plant communities were hosted in vineyard farms independently of the management type. This negative effect of conventional farming was probably due to the use of herbicides, while mechanical operations and mowing regime did not differ between organic and conventional farms. In grassland strips, and only marginally in vineyards, we found that the positive effect of organic farming was more pronounced for perennial than annual species.

  17. Interactive Exhibits Foster Partnership and Engage Diverse Learners at Their Local Libraries

    Science.gov (United States)

    LaConte, K.; Dusenbery, P.; Fitzhugh, G.; Harold, J. B.; Holland, A.

    2016-12-01

    Learners frequently need to access increasingly complex information to help them understand our changing world. More and more libraries are transforming themselves into places where learners not only access STEM information, but interact with professionals and undertake hands-on learning. Libraries are beginning to position themselves as part of learning ecosystems that contribute to a collective impact on the community. Traveling STEM exhibits are catalyzing these partnerships and engaging students, families, and adults in repeat visits through an accessible venue: their public library. The impact of the STAR Library Education Network's (STAR_Net) Discover Earth: A Century of Change exhibit on partnerships, the circulation of STEM resources, and the engagement of learners was studied by an external evaluation team. The STAR_Net project's summative evaluation utilized mixed methods to investigate project implementation and its outcomes. Methods included pre- and post-exhibit surveys administered to staff from each library that hosted the exhibits; interviews with staff from host libraries; patron surveys; exhibit-related circulation records; web metrics regarding the online STAR_Net community of practice; and site visits. A subset of host libraries recruited professionals, who delivered programming that connected Earth systems science, weather, climate, and conservation themes from the exhibit to local issues. Library patrons improved their knowledge about STEM topics presented in the exhibits and associated programming, and patrons viewing the exhibit reflected the demographics of their communities. In a follow-up survey, patrons reported spending an average of 60 minutes looking at the exhibit over their cumulative visits to the library. In contrast, visitors might visit a museum only once to look at a comparably-sized traveling exhibit due to barriers such as cost and distance. Exhibit host libraries reported an increase in the circulation of Earth science

  18. An Overview: Distribution, Production, and Diversity of Local Landraces of Buckwheat in Nepal

    Directory of Open Access Journals (Sweden)

    Dol Raj Luitel

    2017-01-01

    Full Text Available Buckwheat is a sixth staple food crop after rice, wheat, maize, finger millet, and barley in Nepal. It is considered as an alternate cereal and poor man’s crop, representing an important food supply in remote places of Himalayas. It is the best crop in higher altitude in terms of adaptation to different climatic variables and easily fitted to different cropping patterns due to short duration. It is cultivated on marginal land in 61 out of 75 districts of Nepal from some 60 m to 4500 m asl, especially hilly and mountain districts like Rukum, Rolpa, Jajarkot, Dolpa, Humla, Jumla, Kalikot, Kavre, Dolakha, and Okhaldhunga. Sweet buckwheat varieties are generally grown in midhill and Terai but Tartary buckwheat varieties are grown in higher altitude. There are altogether 19 local landraces of sweat buckwheat and 37 for Tartary buckwheat listed from Nepal. The largest producers are China, USA, and Russia and Japan is principal user of global buckwheat grown in the world. In Nepal, it is cultivated in 10510 ha area with production of 10355 t/yr and yield of 0.983 t/ha. It has also medicinal value used in different forms including all its parts so the demand of buckwheat is increasing.

  19. Local protest and resistance to the Rupert Diversion Project, Northern Quebec

    Energy Technology Data Exchange (ETDEWEB)

    Atkinson, M.; Mulrennan, M.E. [Concordia Univ., Montreal, PQ (Canada). Dept. of Geography, Planning and Environment

    2009-12-15

    The political strategies used by Nemaska Crees to defend their land and way of life against a hydroelectric project located in northern Quebec were discussed. The case study was based on a literature review and field research conducted over a 2-year period with the Nemaska Cree community in eastern James Bay. Social and environmental assessments were not required when the original hydroelectric project was constructed in the region in 1971. An injunction on the project was sought by the Crees and Inuits in 1972, in which the Crees and Inuit successfully won access rights to resources and wildlife harvesting under a 3-tiered land regime. A later agreement for an expansion of the project signed in secrecy by Cree leaders was rejected by other members of the Cree community as the decision-making process occurred 3 years before the environmental impacts assessment took place. The local opposition group is comprised of Native leaders and environmental activists dedicated to increasing awareness about the potential impacts of the hydroelectric project. Strategies used by the group have included protest walks; confrontations with the regional Cree leadership; forming alliances with other activist groups; promoting wind energy; using information and communication technologies to support protest efforts; engaging with the public consultation process; and identifying weaknesses and gaps in technical and environmental impact studies. It was concluded that the strategies have resulted in increased media coverage and public awareness. 57 refs., 1 fig.

  20. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  1. Differential influences of local subpopulations on regional diversity and differentiation for greater sage-grouse (Centrocercus urophasianus)

    Science.gov (United States)

    Row, Jeffery R.; Oyler-McCance, Sara J.; Fedy, Brad C.

    2016-01-01

    The distribution of spatial genetic variation across a region can shape evolutionary dynamics and impact population persistence. Local population dynamics and among-population dispersal rates are strong drivers of this spatial genetic variation, yet for many species we lack a clear understanding of how these population processes interact in space to shape within-species genetic variation. Here, we used extensive genetic and demographic data from 10 subpopulations of greater sage-grouse to parameterize a simulated approximate Bayesian computation (ABC) model and (i) test for regional differences in population density and dispersal rates for greater sage-grouse subpopulations in Wyoming, and (ii) quantify how these differences impact subpopulation regional influence on genetic variation. We found a close match between observed and simulated data under our parameterized model and strong variation in density and dispersal rates across Wyoming. Sensitivity analyses suggested that changes in dispersal (via landscape resistance) had a greater influence on regional differentiation, whereas changes in density had a greater influence on mean diversity across all subpopulations. Local subpopulations, however, varied in their regional influence on genetic variation. Decreases in the size and dispersal rates of central populations with low overall and net immigration (i.e. population sources) had the greatest negative impact on genetic variation. Overall, our results provide insight into the interactions among demography, dispersal and genetic variation and highlight the potential of ABC to disentangle the complexity of regional population dynamics and project the genetic impact of changing conditions.

  2. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  3. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  4. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  5. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  6. Salers Protected Designation of Origin cheese, France. The diversity and paradox of local knowledge in geographical indications

    Directory of Open Access Journals (Sweden)

    Bérard, Laurence

    2016-06-01

    Full Text Available Our case study of Salers cheese production in south-central France highlights how place-specific knowledge grounds the various networks shaping the rise of geographical indications (GI in food production. In 1961, Salers cheese producers created a “Protected Designation of Origin” (PDO. To preserve the distinctive character of their product, they opted to require use of the gerle, a traditional wooden vat, and an on-farm cheese making process. The gerle came recently under scrutiny from French governmental hygiene regulation enforcement, and the subsequent public controversy jeopardized the entire supply chain and destabilized Salers cheese-making methods. Prevailing in their efforts to protect Salers, producers established the gerle as mandatory and have since set up a governance board to ensure PDO brand integrity. Our analysis suggests that the diversity of technical choices and associated set of knowledge in Salers cheese production has paradoxically been both its strength and weakness. Local agricultural know-how forges links among participants in Salers networks, connecting cheese producers and consumers, to cattle, microbes, landscapes, wooden tools, and cheeses. Yet, diversity of local expertise creates a tension among producers who must collaborate to achieve unified standards within a PDO while resisting homogeneity. Such results contribute to discussing on PDO governance: an arena to share, compare, and unite local knowledge is critical for GI and thus for sustainable agricultural systems.Nuestro caso de estudio sobre producción de queso de Salers, en el centro-sur de Francia, ilustra cómo los saberes específicos locales explican el origen de la formación de una indicación geográfica (IG. En 1961, los productores del queso de Salers crearon una denominación de origen protegida (DOP. Para preservar el carácter distintivo de sus productos, optaron por requerir como condiciones necesarias tanto el uso de la «gerle», una

  7. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation

    OpenAIRE

    Guevara Andino, Juan Ernesto; Pitman, Nigel C. A.; ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V. A.

    2017-01-01

    Abstract Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one‐hectare plots in terra firme forests of Ecuadorian Amazon. In these plots...

  8. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  9. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  10. Genetic Structure and Molecular Diversity of Cacao Plants Established as Local Varieties for More than Two Centuries: The Genetic History of Cacao Plantations in Bahia, Brazil.

    Science.gov (United States)

    Santos, Elisa S L; Cerqueira-Silva, Carlos Bernard M; Mori, Gustavo M; Ahnert, Dário; Mello, Durval L N; Pires, José Luis; Corrêa, Ronan X; de Souza, Anete P

    2015-01-01

    Bahia is the most important cacao-producing state in Brazil, which is currently the sixth-largest country worldwide to produce cacao seeds. In the eighteenth century, the Comum, Pará and Maranhão varieties of cacao were introduced into southern Bahia, and their descendants, which are called 'Bahian cacao' or local Bahian varieties, have been cultivated for over 200 years. Comum plants have been used to start plantations in African countries and extended as far as countries in South Asia and Oceania. In Brazil, two sets of clones selected from Bahian varieties and their mutants, the Agronomic Institute of East (SIAL) and Bahian Cacao Institute (SIC) series, represent the diversity of Bahian cacao in germplasm banks. Because the genetic diversity of Bahian varieties, which is essential for breeding programs, remains unknown, the objective of this work was to assess the genetic structure and diversity of local Bahian varieties collected from farms and germplasm banks. To this end, 30 simple sequence repeat (SSR) markers were used to genotype 279 cacao plants from germplasm and local farms. The results facilitated the identification of 219 cacao plants of Bahian origin, and 51 of these were SIAL or SIC clones. Bahian cacao showed low genetic diversity. It could be verified that SIC and SIAL clones do not represent the true diversity of Bahian cacao, with the greatest amount of diversity found in cacao trees on the farms. Thus, a core collection to aid in prioritizing the plants to be sampled for Bahian cacao diversity is suggested. These results provide information that can be used to conserve Bahian cacao plants and applied in breeding programs to obtain more productive Bahian cacao with superior quality and tolerance to major diseases in tropical cacao plantations worldwide.

  11. local

    Directory of Open Access Journals (Sweden)

    Abílio Amiguinho

    2005-01-01

    Full Text Available The process of socio-educational territorialisation in rural contexts is the topic of this text. The theme corresponds to a challenge to address it having as main axis of discussion either the problem of social exclusion or that of local development. The reasons to locate the discussion in this last field of analysis are discussed in the first part of the text. Theoretical and political reasons are there articulated because the question is about projects whose intentions and practices call for the political both in the theoretical debate and in the choices that anticipate intervention. From research conducted for several years, I use contributions that aim at discuss and enlighten how school can be a potential locus of local development. Its identification and recognition as local institution (either because of those that work and live in it or because of those that act in the surrounding context are crucial steps to progressively constitute school as a partner for development. The promotion of the local values and roots, the reconstruction of socio-personal and local identities, the production of sociabilities and the equation and solution of shared problems were the dimensions of a socio-educative intervention, markedly globalising. This scenario, as it is argued, was also, intentionally, one of transformation and of deliberate change of school and of the administration of the educative territoires.

  12. Long-term data from a small mammal community reveal loss of diversity and potential effects of local climate change.

    Science.gov (United States)

    Santoro, Simone; Sanchez-Suarez, Cristina; Rouco, Carlos; Palomo, L Javier; Fernández, M Carmen; Kufner, Maura B; Moreno, Sacramento

    2017-10-01

    Climate change affects distribution and persistence of species. However, forecasting species' responses to these changes requires long-term data series that are often lacking in ecological studies. We used 15 years of small mammal trapping data collected between 1978 and 2015 in 3 areas at Doñana National Park (southwest Spain) to (i) describe changes in species composition and (ii) test the association between local climate conditions and size of small mammal populations. Overall, 5 species were captured: wood mouse Apodemus sylvaticus , algerian mouse Mus spretus , greater white-toothed shrew Crocidura russula , garden dormouse Eliomys quercinus , and black rat Rattus rattus . The temporal pattern in the proportion of captures of each species suggests that the small mammal diversity declined with time. Although the larger species (e.g., E. quercinus ), better adapted to colder climate, have disappeared from our trapping records, M. spretus , a small species inhabiting southwest Europe and the Mediterranean coast of Africa, currently is almost the only trapped species. We used 2-level hierarchical models to separate changes in abundance from changes in probability of capture using records of A. sylvaticus in all 3 areas and of M. spretus in 1. We found that heavy rainfall and low temperatures were positively related to abundance of A. sylvaticus , and that the number of extremely hot days was negatively related to abundance of M. spretus . Despite other mechanisms are likely to be involved, our findings support the importance of climate for the distribution and persistence of these species and raise conservation concerns about potential cascading effects in the Doñana ecosystem.

  13. Short-Term Local Adaptation of Historical Common Bean (Phaseolus vulgaris L. Varieties and Implications for In Situ Management of Bean Diversity

    Directory of Open Access Journals (Sweden)

    Stephanie M. Klaedtke

    2017-02-01

    Full Text Available Recognizing both the stakes of traditional European common bean diversity and the role farmers’ and gardeners’ networks play in maintaining this diversity, the present study examines the role that local adaptation plays for the management of common bean diversity in situ. To the purpose, four historical bean varieties and one modern control were multiplied on two organic farms for three growing seasons. The fifteen resulting populations, the initial ones and two populations of each variety obtained after the three years of multiplication, were then grown in a common garden. Twenty-two Simple Sequence Repeat (SSR markers and 13 phenotypic traits were assessed. In total, 68.2% of tested markers were polymorphic and a total of 66 different alleles were identified. FST analysis showed that the genetic composition of two varieties multiplied in different environments changed. At the phenotypic level, differences were observed in flowering date and leaf length. Results indicate that three years of multiplication suffice for local adaptation to occur. The spatial dynamics of genetic and phenotypic bean diversity imply that the maintenance of diversity should be considered at the scale of the network, rather than individual farms and gardens. The microevolution of bean populations within networks of gardens and farms emerges as a research perspective.

  14. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation.

    Science.gov (United States)

    Guevara Andino, Juan Ernesto; Pitman, Nigel C A; Ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V A

    2017-11-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one-hectare plots in terra firme forests of Ecuadorian Amazon. In these plots, we tagged, collected, and identified every single adult tree with dbh ≥10 cm. These data were combined with a regional community phylogenetic tree to calculate different phylogenetic diversity (PD) metrics in order to create spatial models. We used Loess regression to estimate the spatial variation of taxonomic and phylogenetic beta diversity as well as phylogenetic endemism and evolutionary distinctiveness. We found evidence for the definition of three floristic districts in the Ecuadorian Amazon, supported by both taxonomic and phylogenetic diversity data. Areas with high levels of phylogenetic endemism and evolutionary distinctiveness in Ecuadorian Amazon forests are unprotected. Furthermore, these areas are severely threatened by proposed plans of oil and mining extraction at large scales and should be prioritized in conservation planning for this region.

  15. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  16. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  17. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  18. Identification of elite pure-lines from local lentil germplasm using diversity index based on quantitative traits

    International Nuclear Information System (INIS)

    Sultana, T.; Nadeem, S.; Fatima, Z.

    2010-01-01

    Three hundred and seventeen accessions of lentil collected from all over the country were evaluated for six quantitative traits to investigate inter and intra-accession diversity in association with geographic pattern. Variation indicated that areas with high geographic diversity that is supposed to present high biological diversity are yet to be explored. Classification of germplasm gave rise to some elite lines for specific characters and the accessions for days to flowering (45), days to maturity (7), plant height (12), pods per cluster (17) and seed weight (27) have been selected and suggested for exploitation in breeding programme. Twelve clusters were observed with varying degrees of intercluster dissimilarity that suggested the selection of diverse superior parents for hybridization. Some of the characters associated with origin as high seed weight of germplasm collected from Baluchistan is needed to exploit for specific trait/s. Germplasm distribution revealed that Punjab and Sindh represented a high collections along with high diversity, whereas other areas are yet to be explored. Similarly zone 3a, 6, 7, 9 and 10 along with high mountains lack complete representation that indicated the importance for future collection mission to these areas. (author)

  19. Rapid recovery of genetic diversity of dogwhelk (Nucella lapillus L.) populations after local extinction and recolonization contradicts predictions from life-history characteristics.

    Science.gov (United States)

    Colson, I; Hughes, R N

    2004-08-01

    The dogwhelk Nucella lapillus is a predatory marine gastropod populating North Atlantic rocky shores. As with many other gastropod species, N. lapillus was affected by tributyltin (TBT) pollution during the 1970s and 1980s, when local populations became extinct. After a partial ban on TBT in the United Kingdom in 1987, vacant sites have been recolonized. N. lapillus lacks a planktonic larval stage and is therefore expected to have limited dispersal ability. Relatively fast recolonization of some sites, however, contradicts this assumption. We compared levels of genetic diversity and genetic structuring between recolonized sites and sites that showed continuous population at three localities across the British Isles. No significant genetic effects of extinction/recolonization events were observed in SW Scotland and NE England. In SW England we observed a decrease in genetic diversity and an increase in genetic structure in recolonized populations. This last result could be an artefact, however, due to the superposition of other local factors influencing the genetic structuring of dogwhelk populations. We conclude that recolonization of vacant sites was accomplished by a relatively high number of individuals originating from several source populations (the 'migrant-pool' model of recolonization), implying that movements are more widespread than expected on the basis of development mode alone. Comparison with published data on genetic structure of marine organisms with contrasted larval dispersal supports this hypothesis. Our results also stress the importance of local factors (geographical or ecological) in determining genetic structure of dogwhelk populations. Copyright 2004 Blackwell Publishing Ltd

  20. Uncovering genes and ploidy involved in the high diversity in root hair density, length and response to local scarce phosphate in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Markus G Stetter

    Full Text Available Plant root hairs increase the root surface to enhance the uptake of sparingly soluble and immobile nutrients, such as the essential nutrient phosphorus, from the soil. Here, root hair traits and the response to scarce local phosphorus concentration were studied in 166 accessions of Arabidopsis thaliana using split plates. Root hair density and length were correlated, but highly variable among accessions. Surprisingly, the well-known increase in root hair density under low phosphorus was mostly restricted to genotypes that had less and shorter root hairs under P sufficient conditions. By contrast, several accessions with dense and long root hairs even had lower hair density or shorter hairs in local scarce phosphorus. Furthermore, accessions with whole-genome duplications developed more dense but phosphorus-insensitive root hairs. The impact of genome duplication on root hair density was confirmed by comparing tetraploid accessions with their diploid ancestors. Genome-wide association mapping identified candidate genes potentially involved in root hair responses tp scarce local phosphate. Knock-out mutants in identified candidate genes (CYR1, At1g32360 and RLP48 were isolated and differences in root hair traits in the mutants were confirmed. The large diversity in root hair traits among accessions and the diverse response when local phosphorus is scarce is a rich resource for further functional analyses.

  1. Community phylogenetics at the biogeographical scale: cold tolerance, niche conservatism and the structure of North American forests.

    Science.gov (United States)

    Hawkins, Bradford A; Rueda, Marta; Rangel, Thiago F; Field, Richard; Diniz-Filho, José Alexandre F; Linder, Peter

    2014-01-01

    Aim The fossil record has led to a historical explanation for forest diversity gradients within the cool parts of the Northern Hemisphere, founded on a limited ability of woody angiosperm clades to adapt to mid-Tertiary cooling. We tested four predictions of how this should be manifested in the phylogenetic structure of 91,340 communities: (1) forests to the north should comprise species from younger clades (families) than forests to the south; (2) average cold tolerance at a local site should be associated with the mean family age (MFA) of species; (3) minimum temperature should account for MFA better than alternative environmental variables; and (4) traits associated with survival in cold climates should evolve under a niche conservatism constraint. Location The contiguous United States. Methods We extracted angiosperms from the US Forest Service's Forest Inventory and Analysis database. MFA was calculated by assigning age of the family to which each species belongs and averaging across the species in each community. We developed a phylogeny to identify phylogenetic signal in five traits: realized cold tolerance, seed size, seed dispersal mode, leaf phenology and height. Phylogenetic signal representation curves and phylogenetic generalized least squares were used to compare patterns of trait evolution against Brownian motion. Eleven predictors structured at broad or local scales were generated to explore relationships between environment and MFA using random forest and general linear models. Results Consistent with predictions, (1) southern communities comprise angiosperm species from older families than northern communities, (2) cold tolerance is the trait most strongly associated with local MFA, (3) minimum temperature in the coldest month is the environmental variable that best describes MFA, broad-scale variables being much stronger correlates than local-scale variables, and (4) the phylogenetic structures of cold tolerance and at least one other trait

  2. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  3. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  4. Climate-driven extinctions shape the phylogenetic structure of temperate tree floras.

    Science.gov (United States)

    Eiserhardt, Wolf L; Borchsenius, Finn; Plum, Christoffer M; Ordonez, Alejandro; Svenning, Jens-Christian

    2015-03-01

    When taxa go extinct, unique evolutionary history is lost. If extinction is selective, and the intrinsic vulnerabilities of taxa show phylogenetic signal, more evolutionary history may be lost than expected under random extinction. Under what conditions this occurs is insufficiently known. We show that late Cenozoic climate change induced phylogenetically selective regional extinction of northern temperate trees because of phylogenetic signal in cold tolerance, leading to significantly and substantially larger than random losses of phylogenetic diversity (PD). The surviving floras in regions that experienced stronger extinction are phylogenetically more clustered, indicating that non-random losses of PD are of increasing concern with increasing extinction severity. Using simulations, we show that a simple threshold model of survival given a physiological trait with phylogenetic signal reproduces our findings. Our results send a strong warning that we may expect future assemblages to be phylogenetically and possibly functionally depauperate if anthropogenic climate change affects taxa similarly. © 2015 John Wiley & Sons Ltd/CNRS.

  5. Regional and local influence of grazing activity on the diversity of a semi-arid dung beetle community

    DEFF Research Database (Denmark)

    Lobo, Jorge M.; Hortal, Joaquín; Cabrero-Sañudo, Francisco J.

    2006-01-01

    richness variance. A cluster analysis of localities identified two main groups, one characterized by a lower abundance and species richness that can be considered a nested subsample of the species-rich group. The mean and maximum amount of sheep dung in the sites separated by less than 2 km are the only...... could be affecting the population dynamics and dispersion of dung beetles within a locality, sites with larger populations, and greater species numbers would not be able to exercise enough influence as to bring about a complete local faunistic homogenization....

  6. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  7. Toward the prevention of childhood undernutrition: Diet diversity strategies using locally produced food can overcome gaps in nutrient supply

    DEFF Research Database (Denmark)

    Parlesak, Alexandr; Geelhoed, Diederike; Robertson, Aileen

    2014-01-01

    nutritious food baskets (FNFB) by stepwise addition of micronutrient-dense local foods. Results. Only the top quintile of Mozambican households, using average expenditure data, could afford the FNFB that was designed using linear programming from a spectrum of local standard foods. The addition of beef heart...... programming, to investigate whether diet diversification using local foods should be prioritized in order to reduce the prevalence of chronic undernutrition. Methods. Market prices of local foods were collected in Tete City, Mozambique. Linear programming was applied to calculate the cheapest possible fully...... or liver, dried fish and fresh moringa leaves, before applying linear programming decreased the price by a factor of up to 2.6. As a result, the top three quintiles could afford the FNFB optimized using both diversification strategy and linear programming. CDFPs, when added to the baskets, were unable...

  8. Global and local genetic diversity at two microsatellite loci in Plasmodium vivax parasites from Asia, Africa and South America

    DEFF Research Database (Denmark)

    Schousboe, Mette L; Ranjitkar, Samir; Rajakaruna, Rupika S

    2014-01-01

    diversity are vital to the evaluation of drug and vaccine efficacy, tracking of P. vivax outbreaks, and assessing geographical differentiation between parasite populations. METHODS: The genetic diversity of eight P. vivax populations (n = 543) was investigated by using two microsatellites (MS), m1501 and m......3502, chosen because of their seven and eight base-pair (bp) repeat lengths, respectively. These were compared with published data of the same loci from six other P. vivax populations. RESULTS: In total, 1,440 P. vivax samples from 14 countries on three continents were compared. There was highest...... heterozygosity within Asian populations, where expected heterozygosity (He) was 0.92-0.98, and alleles with a high repeat number were more common. Pairwise FST revealed significant differentiation between most P. vivax populations, with the highest divergence found between Asian and South American populations...

  9. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards

    NARCIS (Netherlands)

    Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.

    2017-01-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the

  10. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  11. Phylogenetic impoverishment of Amazonian tree communities in an experimentally fragmented forest landscape.

    Science.gov (United States)

    Santos, Bráulio A; Tabarelli, Marcelo; Melo, Felipe P L; Camargo, José L C; Andrade, Ana; Laurance, Susan G; Laurance, William F

    2014-01-01

    Amazonian rainforests sustain some of the richest tree communities on Earth, but their ecological and evolutionary responses to human threats remain poorly known. We used one of the largest experimental datasets currently available on tree dynamics in fragmented tropical forests and a recent phylogeny of angiosperms to test whether tree communities have lost phylogenetic diversity since their isolation about two decades previously. Our findings revealed an overall trend toward phylogenetic impoverishment across the experimentally fragmented landscape, irrespective of whether tree communities were in 1-ha, 10-ha, or 100-ha forest fragments, near forest edges, or in continuous forest. The magnitude of the phylogenetic diversity loss was low (phylogenetic diversity, we observed a significant decrease of 50% in phylogenetic dispersion since forest isolation, irrespective of plot location. Analyses based on tree genera that have significantly increased (28 genera) or declined (31 genera) in abundance and basal area in the landscape revealed that increasing genera are more phylogenetically related than decreasing ones. Also, the loss of phylogenetic diversity was greater in tree communities where increasing genera proliferated and decreasing genera reduced their importance values, suggesting that this taxonomic replacement is partially underlying the phylogenetic impoverishment at the landscape scale. This finding has clear implications for the current debate about the role human-modified landscapes play in sustaining biodiversity persistence and key ecosystem services, such as carbon storage. Although the generalization of our findings to other fragmented tropical forests is uncertain, it could negatively affect ecosystem productivity and stability and have broader impacts on coevolved organisms.

  12. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  13. A Phylogenetic and Phenotypic Analysis of Salmonella enterica Serovar Weltevreden, an Emerging Agent of Diarrheal Disease in Tropical Regions.

    Directory of Open Access Journals (Sweden)

    Carine Makendi

    2016-02-01

    Full Text Available Salmonella enterica serovar Weltevreden (S. Weltevreden is an emerging cause of diarrheal and invasive disease in humans residing in tropical regions. Despite the regional and international emergence of this Salmonella serovar, relatively little is known about its genetic diversity, genomics or virulence potential in model systems. Here we used whole genome sequencing and bioinformatics analyses to define the phylogenetic structure of a diverse global selection of S. Weltevreden. Phylogenetic analysis of more than 100 isolates demonstrated that the population of S. Weltevreden can be segregated into two main phylogenetic clusters, one associated predominantly with continental Southeast Asia and the other more internationally dispersed. Subcluster analysis suggested the local evolution of S. Weltevreden within specific geographical regions. Four of the isolates were sequenced using long read sequencing to produce high quality reference genomes. Phenotypic analysis in Hep-2 cells and in a murine infection model indicated that S. Weltevreden were significantly attenuated in these models compared to the classical S. Typhimurium reference strain SL1344. Our work outlines novel insights into this important emerging pathogen and provides a baseline understanding for future research studies.

  14. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  15. Diversity and phylogenetic relationships of hemosporidian parasites in birds of Socorro Island, México, and their role in the re-introduction of the Socorro dove (Zenaida graysoni).

    Science.gov (United States)

    Carlson, Jenny S; Martínez-Gómez, Juan E; Valkiūnas, Gediminas; Loiseau, Claire; Bell, Douglas A; Sehgal, Ravinder N M

    2013-04-01

    The Socorro dove Zenaida graysoni , endemic to Socorro Island, was last reported in the wild in 1972. Fortunately, the species has been propagated in zoos in Europe and the United States, and plans are under way to re-introduce it to its native habitat. This will be the first known attempt to return a bird species extinct in the wild to its ancestral island. In order to assess the disease threats the Socorro dove may face, the avifauna of Socorro Island, with a specific focus on Socorro ground doves Columbina passerina socorroensis and mourning doves Zenaida macroura , as well as Socorro doves in captivity, were screened for blood parasites of the genera Plasmodium , Haemoproteus, Leucocytozoon, and Trypanosoma spp. We found Haemoproteus spp. in 17 (74%) of 23 Socorro ground doves, 23 (92%) of 25 mourning doves, and 3 (14%) of 21 northern mockingbirds; none of the other bird species showed infections. Here, we report the phylogenetic analysis of 19 distinct lineages of Haemoproteus spp. detected in birds of Socorro Island and compare their evolutionary relationships to parasites detected in the avifauna of the Galápagos Islands, continental Latin America, and Europe. Microscopic examination revealed 1 mourning dove infected with Plasmodium ( Haemamoeba ), thus underscoring the importance of using both PCR and microscopy when analyzing avian blood samples for hemosporidian parasites. The study confirms that the Socorro dove will most likely be exposed to Haemoproteus spp. that currently infect mourning doves and Socorro ground doves of Socorro Island. A monitoring program for both birds and vectors should be implemented to establish the prevalence of Plasmodium sp. and as a necessary conservation measure for critically endangered birds on the island.

  16. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  17. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Glucosinolate diversity within a phylogenetic framework of the tribe Cardamineae (Brassicaceae) unraveled with HPLC-MS/MS and NMR-based analytical distinction of 70 desulfoglucosinolates.

    Science.gov (United States)

    Olsen, Carl Erik; Huang, Xiao-Chen; Hansen, Cecilie I C; Cipollini, Don; Ørgaard, Marian; Matthes, Annemarie; Geu-Flores, Fernando; Koch, Marcus A; Agerbirk, Niels

    2016-12-01

    As a basis for future investigations of evolutionary trajectories and biosynthetic mechanisms underlying variations in glucosinolate structures, we screened members of the crucifer tribe Cardamineae by HPLC-MS/MS, isolated and identified glucosinolates by NMR, searched the literature for previous data for the tribe, and collected HPLC-MS/MS data for nearly all glucosinolates known from the tribe as well as some related structures (70 in total). This is a considerable proportion of the approximately 142 currently documented natural glucosinolates. Calibration with authentic references allowed distinction (or elucidation) of isomers in many cases, such as distinction of β-hydroxyls, methylthios, methylsulfinyls and methylsulfonyls. A mechanism for fragmentation of secondary β-hydroxyls in MS was elucidated, and two novel glucosinolates were discovered: 2-hydroxy-3-methylpentylglucosinolate in roots of Cardamine pratensis and 2-hydroxy-8-(methylsulfinyl)octylglucosinolate in seeds of Rorippa amphibia. A large number of glucosinolates (ca. 54 with high structural certainty and a further 28 or more suggested from tandem MS), representing a wide structural variation, is documented from the tribe. This included glucosinolates apparently derived from Met, Phe, Trp, Val/Leu, Ile and higher homologues. Normal side chain elongation and side chain decoration by oxidation or methylation was observed, as well as rare abnormal side chain decoration (hydroxylation of aliphatics at the δ rather than β-position). Some species had diverse profiles, e.g. R. amphibia and C. pratensis (19 and 16 individual glucosinolates, respectively), comparable to total diversity in literature reports of Armoracia rusticana (17?), Barbarea vulgaris (20-24), and Rorippa indica (>20?). The ancestor or the tribe would appear to have used Trp, Met, and homoPhe as glucosinolate precursor amino acids, and to exhibit oxidation of thio to sulfinyl, formation of alkenyls, β-hydroxylation of aliphatic

  19. Phylogenetic distribution of fungal sterols.

    Directory of Open Access Journals (Sweden)

    John D Weete

    Full Text Available BACKGROUND: Ergosterol has been considered the "fungal sterol" for almost 125 years; however, additional sterol data superimposed on a recent molecular phylogeny of kingdom Fungi reveals a different and more complex situation. METHODOLOGY/PRINCIPAL FINDINGS: The interpretation of sterol distribution data in a modern phylogenetic context indicates that there is a clear trend from cholesterol and other Delta(5 sterols in the earliest diverging fungal species to ergosterol in later diverging fungi. There are, however, deviations from this pattern in certain clades. Sterols of the diverse zoosporic and zygosporic forms exhibit structural diversity with cholesterol and 24-ethyl -Delta(5 sterols in zoosporic taxa, and 24-methyl sterols in zygosporic fungi. For example, each of the three monophyletic lineages of zygosporic fungi has distinctive major sterols, ergosterol in Mucorales, 22-dihydroergosterol in Dimargaritales, Harpellales, and Kickxellales (DHK clade, and 24-methyl cholesterol in Entomophthorales. Other departures from ergosterol as the dominant sterol include: 24-ethyl cholesterol in Glomeromycota, 24-ethyl cholest-7-enol and 24-ethyl-cholesta-7,24(28-dienol in rust fungi, brassicasterol in Taphrinales and hypogeous pezizalean species, and cholesterol in Pneumocystis. CONCLUSIONS/SIGNIFICANCE: Five dominant end products of sterol biosynthesis (cholesterol, ergosterol, 24-methyl cholesterol, 24-ethyl cholesterol, brassicasterol, and intermediates in the formation of 24-ethyl cholesterol, are major sterols in 175 species of Fungi. Although most fungi in the most speciose clades have ergosterol as a major sterol, sterols are more varied than currently understood, and their distribution supports certain clades of Fungi in current fungal phylogenies. In addition to the intellectual importance of understanding evolution of sterol synthesis in fungi, there is practical importance because certain antifungal drugs (e.g., azoles target reactions in

  20. Oral Health Promotion for Linguistically and Culturally Diverse Populations: Understanding the Local Non-English-Speaking Population

    Science.gov (United States)

    Clarke, Wendy; Periam, Catherine; Zoitopoulos, Liana

    2009-01-01

    Changes in the prevalence of oral diseases and the funding of National Health Service Dentistry in the United Kingdom have combined to emphasize the role of the dental team in the prevention of disease. As part of this, oral health promotion plays a vital role in local communities and educational settings. Like many other inner-city London…

  1. Identification, genetic localization, and allelic diversity of selectively amplified microsatellite polymorphic loci in lettuce and wild relatives (Lactuca spp.).

    Science.gov (United States)

    Witsenboer, H; Michelmore, R W; Vogel, J

    1997-12-01

    Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.

  2. Distribution, management and diversity of yam local varieties in Brazil: a study on Dioscorea alataL.

    Directory of Open Access Journals (Sweden)

    MVBM Siqueira

    Full Text Available Widely spread in the tropics, yams were introduced into Brazil during the colonial period and are currently grown throughout the country. Despite its importance as a pharmacological and food source, there is a lack of studies describing how and where this tuber is grown in Brazil. The aim of this study was to provide an overview of the cultivation and distribution of Dioscorea alata in different Brazilian regions. A total of 63 farmers were visited in different municipalities and communities in four regions in the country: South, Southeast, Northeast and Midwest. Semi-structured interviews were conducted to collect socio-economic, use, management and diversity data for this crop. The majority of interviewers were men, married, with children, using retirement benefits and agriculture as income and family labour as the main support in the yam cultivation. A wide distribution of this species was found, with the occurrence of D. alata in the four sampled regions. A variety of vernacular names for this species was collected, differing according to the region where it is cultivated. Most farmers cultivate yams in fields, however an increased usage of home gardens for the cultivation of this tuber was found. Also, most farmers cultivate yams in association with other crops in areas of different sizes and slash and burn practices, although mostly disappearing, are still being used by many farmers. The results of this study provide more concrete data on the distribution and diversity of this important crop.

  3. Diversity, local knowledge and use of stingless bees (Apidae: Meliponini) in the municipality of Nocupétaro, Michoacan, Mexico.

    Science.gov (United States)

    Reyes-González, Alejandro; Camou-Guerrero, Andrés; Reyes-Salas, Octavio; Argueta, Arturo; Casas, Alejandro

    2014-06-05

    Stingless bees were significant resources managed by Mesoamerican peoples during pre-Columbian times and remain important in particular areas. Our study aimed at inventorying stingless bees' species, traditional knowledge and forms of use and management of them at the municipality of Nocupetaro, Michoacán, Mexico, a region of the Balsas River Basin. We inventoried the stingless bees of the municipality of Nocupétaro, Michoacán, México, through extensive collecting of bee specimens in different vegetation types. We then conducted semi-structured interviews to local experts in order to document their knowledge and management techniques of stingless bees' species. We identified a total of eight stingless bees' species in the study area as well as three additional unidentified taxa recognized by people through the local names. Our inventory included one new record of species for the region (Lestrimelitta chamelensis Ayala, 1999). The taxa identified are all used by local people. Scaptotrigona hellwegeri Friese, 1900; Melipona fasciata Latreille, 1811; Frieseomelitta nigra Cresson, 1878 and Geotrigona acapulconis Strand, 1919 are particularly valued as food (honey), medicinal (honey and pollen), and material for handcrafts (wax). All species recorded are wild and their products are obtained through gathering. On average, local experts were able to collect 4 nests of stingless bees per year obtaining on average 6 L of honey and 4 Kg of wax but some came to collect up 10-12 hives per year (18 L of honey and 24 Kg of wax). Local knowledge about use, management and ecological issues on stingless bees is persistent and deep in the study area. Information about this group of bees is progressively scarcer in Mexico and significant effort should be done from ethnobiological and ecological perspectives in order to complement the national inventory of bee resources and traditional knowledge and management of them.

  4. Diversity, local knowledge and use of stingless bees (Apidae: Meliponini) in the municipality of Nocupétaro, Michoacan, Mexico

    Science.gov (United States)

    2014-01-01

    Background Stingless bees were significant resources managed by Mesoamerican peoples during pre-Columbian times and remain important in particular areas. Our study aimed at inventorying stingless bees’ species, traditional knowledge and forms of use and management of them at the municipality of Nocupetaro, Michoacán, Mexico, a region of the Balsas River Basin. Methods We inventoried the stingless bees of the municipality of Nocupétaro, Michoacán, México, through extensive collecting of bee specimens in different vegetation types. We then conducted semi-structured interviews to local experts in order to document their knowledge and management techniques of stingless bees’ species. Results We identified a total of eight stingless bees’ species in the study area as well as three additional unidentified taxa recognized by people through the local names. Our inventory included one new record of species for the region (Lestrimelitta chamelensis Ayala, 1999). The taxa identified are all used by local people. Scaptotrigona hellwegeri Friese, 1900; Melipona fasciata Latreille, 1811; Frieseomelitta nigra Cresson, 1878 and Geotrigona acapulconis Strand, 1919 are particularly valued as food (honey), medicinal (honey and pollen), and material for handcrafts (wax). All species recorded are wild and their products are obtained through gathering. On average, local experts were able to collect 4 nests of stingless bees per year obtaining on average 6 L of honey and 4 Kg of wax but some came to collect up 10–12 hives per year (18 L of honey and 24 Kg of wax). Conclusions Local knowledge about use, management and ecological issues on stingless bees is persistent and deep in the study area. Information about this group of bees is progressively scarcer in Mexico and significant effort should be done from ethnobiological and ecological perspectives in order to complement the national inventory of bee resources and traditional knowledge and management of them. PMID:24903644

  5. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  6. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  7. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  8. Local-scale spatial variation in diversity of social wasps in an Amazonian rain forest in Caxiuanã, Pará, Brazil (Hymenoptera, Vespidae, Polistinae

    Directory of Open Access Journals (Sweden)

    Orlando Tobias Silveira

    2012-09-01

    Full Text Available Polistine wasps are important in Neotropical ecosystems due to their ubiquity and diversity. Inventories have not adequately considered spatial attributes of collected specimens. Spatial data on biodiversity are important for study and mitigation of anthropogenic impacts over natural ecosystems and for protecting species. We described and analyzed local-scale spatial patterns of collecting records of wasp species, as well as spatial variation of diversity descriptors in a 2500-hectare area of an Amazon forest in Brazil. Rare species comprised the largest fraction of the fauna. Close range spatial effects were detected for most of the more common species, with clustering of presence-data at short distances. Larger spatial lag effects could also be identified in some species, constituting probably cases of exogenous autocorrelation and candidates for explanations based on environmental factors. In a few cases, significant or near significant correlations were found between five species (of Agelaia, Angiopolybia, and Mischocyttarus and three studied environmental variables: distance to nearest stream, terrain altitude, and the type of forest canopy. However, association between these factors and biodiversity variables were generally low. When used as predictors of polistine richness in a linear multiple regression, only the coefficient for the forest canopy variable resulted significant. Some level of prediction of wasp diversity variables can be attained based on environmental variables, especially vegetation structure. Large-scale landscape and regional studies should be scheduled to address this issue.

  9. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Phylogenetic Variants of Rickettsia africae, and Incidental Identification of "Candidatus Rickettsia Moyalensis" in Kenya.

    Science.gov (United States)

    Kimita, Gathii; Mutai, Beth; Nyanjom, Steven Ger; Wamunyokoli, Fred; Waitumbi, John

    2016-07-01

    Rickettsia africae, the etiological agent of African tick bite fever, is widely distributed in sub-Saharan Africa. Contrary to reports of its homogeneity, a localized study in Asembo, Kenya recently reported high genetic diversity. The present study aims to elucidate the extent of this heterogeneity by examining archived Rickettsia africae DNA samples collected from different eco-regions of Kenya. To evaluate their phylogenetic relationships, archived genomic DNA obtained from 57 ticks a priori identified to contain R. africae by comparison to ompA, ompB and gltA genes was used to amplify five rickettsial genes i.e. gltA, ompA, ompB, 17kDa and sca4. The resulting amplicons were sequenced. Translated amino acid alignments were used to guide the nucleotide alignments. Single gene and concatenated alignments were used to infer phylogenetic relationships. Out of the 57 DNA samples, three were determined to be R. aeschlimanii and not R. africae. One sample turned out to be a novel rickettsiae and an interim name of "Candidatus Rickettsia moyalensis" is proposed. The bonafide R. africae formed two distinct clades. Clade I contained 9% of the samples and branched with the validated R. africae str ESF-5, while clade II (two samples) formed a distinct sub-lineage. This data supports the use of multiple genes for phylogenetic inferences. It is determined that, despite its recent emergence, the R. africae lineage is diverse. This data also provides evidence of a novel Rickettsia species, Candidatus Rickettsia moyalensis.

  11. Diversity, Localization, and Physiological Properties of Filamentous Microbes Belonging to Chloroflexi Subphylum I in Mesophilic and Thermophilic Methanogenic Sludge Granules

    Science.gov (United States)

    Yamada, Takeshi; Sekiguchi, Yuji; Imachi, Hiroyuki; Kamagata, Yoichi; Ohashi, Akiyoshi; Harada, Hideki

    2005-01-01

    We previously reported that the thermophilic filamentous anaerobe Anaerolinea thermophila, which is the first cultured representative of subphylum I of the bacterial phylum Chloroflexi, not only was one of the predominant constituents of thermophilic sludge granules but also was a causative agent of filamentous sludge bulking in a thermophilic (55°C) upflow anaerobic sludge blanket (UASB) reactor in which high-strength organic wastewater was treated (Y. Sekiguchi, H. Takahashi, Y. Kamagata, A. Ohashi, and H. Harada, Appl. Environ. Microbiol. 67:5740-5749, 2001). To further elucidate the ecology and function of Anaerolinea-type filamentous microbes in UASB sludge granules, we surveyed the diversity, distribution, and physiological properties of Chloroflexi subphylum I microbes residing in UASB granules. Five different types of mesophilic and thermophilic UASB sludge were used to analyze the Chloroflexi subphylum I populations. 16S rRNA gene cloning-based analyses using a 16S rRNA gene-targeted Chloroflexi-specific PCR primer set revealed that all clonal sequences were affiliated with the Chloroflexi subphylum I group and that a number of different phylotypes were present in each clone library, suggesting the ubiquity and vast genetic diversity of these populations in UASB sludge granules. Subsequent fluorescence in situ hybridization (FISH) of the three different types of mesophilic sludge granules using a Chloroflexi-specific probe suggested that all probe-reactive cells had a filamentous morphology and were widely distributed within the sludge granules. The FISH observations also indicated that the Chloroflexi subphylum I bacteria were not always the predominant populations within mesophilic sludge granules, in contrast to thermophilic sludge granules. We isolated two mesophilic strains and one thermophilic strain belonging to the Chloroflexi subphylum I group. The physiological properties of these isolates suggested that these populations may contribute to the

  12. An Efficient Normalized Rank Based SVM for Room Level Indoor WiFi Localization with Diverse Devices

    Directory of Open Access Journals (Sweden)

    Yasmine Rezgui

    2017-01-01

    Full Text Available This paper proposes an efficient and effective WiFi fingerprinting-based indoor localization algorithm, which uses the Received Signal Strength Indicator (RSSI of WiFi signals. In practical harsh indoor environments, RSSI variation and hardware variance can significantly degrade the performance of fingerprinting-based localization methods. To address the problem of hardware variance and signal fluctuation in WiFi fingerprinting-based localization, we propose a novel normalized rank based Support Vector Machine classifier (NR-SVM. Moving from RSSI value based analysis to the normalized rank transformation based analysis, the principal features are prioritized and the dimensionalities of signature vectors are taken into account. The proposed method has been tested using sixteen different devices in a shopping mall with 88 shops. The experimental results demonstrate its robustness with no less than 98.75% correct estimation in 93.75% of the tested cases and 100% correct rate in 56.25% of cases. In the experiments, the new method shows better performance over the KNN, Naïve Bayes, Random Forest, and Neural Network algorithms. Furthermore, we have compared the proposed approach with three popular calibration-free transformation based methods, including difference method (DIFF, Signal Strength Difference (SSD, and the Hyperbolic Location Fingerprinting (HLF based SVM. The results show that the NR-SVM outperforms these popular methods.

  13. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  14. Constructing level-2 phylogenetic networks from triplets

    OpenAIRE

    Iersel, Leo; Keijsper, J.C.M.; Kelk, Steven; Stougie, Leen; Hagen, F.; Boekhout, T.; Vingron, M.; Wong, L.

    2009-01-01

    htmlabstractJansson and Sung showed that, given a dense set of input triplets T (representing hypotheses about the local evolutionary relationships of triplets of taxa), it is possible to determine in polynomial time whether there exists a level-1 network consistent with T, and if so to construct such a network (Inferring a Level-1 Phylogenetic Network from a Dense Set of Rooted Triplets, Theoretical Computer Science, 363, pp. 60-68 (2006)). Here we extend this work by showing that this probl...

  15. The Fair Proportion is a Shapley Value on phylogenetic networks too

    OpenAIRE

    Coronado, Tomás M.; Riera, Gabriel; Rosselló, Francesc

    2018-01-01

    The Fair Proportion of a species in a phylogenetic tree is a very simple measure that has been used to assess its value relative to the overall phylogenetic diversity represented by the tree. It has recently been proved by Fuchs and Jin to be equal to the Shapley Value of the coallitional game that sends each subset of species to its rooted Phylogenetic Diversity in the tree. We prove in this paper that this result extends to the natural translations of the Fair Proportion and the rooted Phyl...

  16. Phylogenetic lineages in Pseudocercospora.

    Science.gov (United States)

    Crous, P W; Braun, U; Hunter, G C; Wingfield, M J; Verkley, G J M; Shin, H-D; Nakashima, C; Groenewald, J Z

    2013-06-30

    Pseudocercospora is a large cosmopolitan genus of plant pathogenic fungi that are commonly associated with leaf and fruit spots as well as blights on a wide range of plant hosts. They occur in arid as well as wet environments and in a wide range of climates including cool temperate, sub-tropical and tropical regions. Pseudocercospora is now treated as a genus in its own right, although formerly recognised as either an anamorphic state of Mycosphaerella or having mycosphaerella-like teleomorphs. The aim of this study was to sequence the partial 28S nuclear ribosomal RNA gene of a selected set of isolates to resolve phylogenetic generic limits within the Pseudocercospora complex. From these data, 14 clades are recognised, six of which cluster in Mycosphaerellaceae. Pseudocercospora s. str. represents a distinct clade, sister to Passalora eucalypti, and a clade representing the genera Scolecostigmina, Trochophora and Pallidocercospora gen. nov., taxa formerly accommodated in the Mycosphaerella heimii complex and characterised by smooth, pale brown conidia, as well as the formation of red crystals in agar media. Other clades in Mycosphaerellaceae include Sonderhenia, Microcyclosporella, and Paracercospora. Pseudocercosporella resides in a large clade along with Phloeospora, Miuraea, Cercospora and Septoria. Additional clades represent Dissoconiaceae, Teratosphaeriaceae, Cladosporiaceae, and the genera Xenostigmina, Strelitziana, Cyphellophora and Thedgonia. The genus Phaeomycocentrospora is introduced to accommodate Mycocentrospora cantuariensis, primarily distinguished from Pseudocercospora based on its hyaline hyphae, broad conidiogenous loci and hila. Host specificity was considered for 146 species of Pseudocercospora occurring on 115 host genera from 33 countries. Partial nucleotide sequence data for three gene loci, ITS, EF-1α, and ACT suggest that the majority of these species are host specific. Species identified on the basis of host, symptomatology and general

  17. Diversity And Abundance Of Deep-Water Coral Mounds In The Straits Of Florida: A Result of Adaptability To Local Environments?

    Science.gov (United States)

    Correa, T. B.; Grasmueck, M.; Eberli, G.; Viggiano, D. A.; Rosenberg, A.; Reed, J. K.

    2007-12-01

    is lessened. Corals in these raised locations also benefit from increased exposure to nutrient-rich tidal currents, supporting a denser live coral coverage. Sub-bottom profiles of the MT site show undulating coral ridges developed on top of a relatively flat sub-surface, indicating that antecedent topography is not the only factor determining mound distribution. The integrated AUV data suggest that variable environmental factors, such as sedimentation and current patterns, contribute to the high diversity between coral mound sites of the Straits of Florida. Environmental conditions change over distances of only a few kilometers creating localized and diverse deep-water coral habitats. The deepwater fauna adapts to the local oceanographic and geological conditions. This results in an unexpectedly high abundance of deep-water coral communities with diverse expressions.

  18. Molecular phylogenetics and species delimitation of leaf-toed geckos (Phyllodactylidae: Phyllodactylus) throughout the Mexican tropical dry forest.

    Science.gov (United States)

    Blair, Christopher; Méndez de la Cruz, Fausto R; Law, Christopher; Murphy, Robert W

    2015-03-01

    Methods and approaches for accurate species delimitation continue to be a highly controversial subject in the systematics community. Inaccurate assessment of species' limits precludes accurate inference of historical evolutionary processes. Recent evidence suggests that multilocus coalescent methods show promise in delimiting species in cryptic clades. We combine multilocus sequence data with coalescence-based phylogenetics in a hypothesis-testing framework to assess species limits and elucidate the timing of diversification in leaf-toed geckos (Phyllodactylus) of Mexico's dry forests. Tropical deciduous forests (TDF) of the Neotropics are among the planet's most diverse ecosystems. However, in comparison to moist tropical forests, little is known about the mode and tempo of biotic evolution throughout this threatened biome. We find increased speciation and substantial, cryptic molecular diversity originating following the formation of Mexican TDF 30-20million years ago due to orogenesis of the Sierra Madre Occidental and Mexican Volcanic Belt. Phylogenetic results suggest that the Mexican Volcanic Belt, the Rio Fuerte, and Isthmus of Tehuantepec may be important biogeographic barriers. Single- and multilocus coalescent analyses suggest that nearly every sampling locality may be a distinct species. These results suggest unprecedented levels of diversity, a complex evolutionary history, and that the formation and expansion of TDF vegetation in the Miocene may have influenced subsequent cladogenesis of leaf-toed geckos throughout western Mexico. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Charles Darwin, beetles and phylogenetics

    Science.gov (United States)

    Beutel, Rolf G.; Friedrich, Frank; Leschen, Richard A. B.

    2009-11-01

    Here, we review Charles Darwin’s relation to beetles and developments in coleopteran systematics in the last two centuries. Darwin was an enthusiastic beetle collector. He used beetles to illustrate different evolutionary phenomena in his major works, and astonishingly, an entire sub-chapter is dedicated to beetles in “The Descent of Man”. During his voyage on the Beagle, Darwin was impressed by the high diversity of beetles in the tropics, and he remarked that, to his surprise, the majority of species were small and inconspicuous. However, despite his obvious interest in the group, he did not get involved in beetle taxonomy, and his theoretical work had little immediate impact on beetle classification. The development of taxonomy and classification in the late nineteenth and earlier twentieth century was mainly characterised by the exploration of new character systems (e.g. larval features and wing venation). In the mid-twentieth century, Hennig’s new methodology to group lineages by derived characters revolutionised systematics of Coleoptera and other organisms. As envisioned by Darwin and Ernst Haeckel, the new Hennigian approach enabled systematists to establish classifications truly reflecting evolution. Roy A. Crowson and Howard E. Hinton, who both made tremendous contributions to coleopterology, had an ambivalent attitude towards the Hennigian ideas. The Mickoleit school combined detailed anatomical work with a classical Hennigian character evaluation, with stepwise tree building, comparatively few characters and a priori polarity assessment without explicit use of the outgroup comparison method. The rise of cladistic methods in the 1970s had a strong impact on beetle systematics. Cladistic computer programs facilitated parsimony analyses of large data matrices, mostly morphological characters not requiring detailed anatomical investigations. Molecular studies on beetle phylogeny started in the 1990s with modest taxon sampling and limited DNA data

  20. Charles Darwin, beetles and phylogenetics.

    Science.gov (United States)

    Beutel, Rolf G; Friedrich, Frank; Leschen, Richard A B

    2009-11-01

    Here, we review Charles Darwin's relation to beetles and developments in coleopteran systematics in the last two centuries. Darwin was an enthusiastic beetle collector. He used beetles to illustrate different evolutionary phenomena in his major works, and astonishingly, an entire sub-chapter is dedicated to beetles in "The Descent of Man". During his voyage on the Beagle, Darwin was impressed by the high diversity of beetles in the tropics, and he remarked that, to his surprise, the majority of species were small and inconspicuous. However, despite his obvious interest in the group, he did not get involved in beetle taxonomy, and his theoretical work had little immediate impact on beetle classification. The development of taxonomy and classification in the late nineteenth and earlier twentieth century was mainly characterised by the exploration of new character systems (e.g. larval features and wing venation). In the mid-twentieth century, Hennig's new methodology to group lineages by derived characters revolutionised systematics of Coleoptera and other organisms. As envisioned by Darwin and Ernst Haeckel, the new Hennigian approach enabled systematists to establish classifications truly reflecting evolution. Roy A. Crowson and Howard E. Hinton, who both made tremendous contributions to coleopterology, had an ambivalent attitude towards the Hennigian ideas. The Mickoleit school combined detailed anatomical work with a classical Hennigian character evaluation, with stepwise tree building, comparatively few characters and a priori polarity assessment without explicit use of the outgroup comparison method. The rise of cladistic methods in the 1970s had a strong impact on beetle systematics. Cladistic computer programs facilitated parsimony analyses of large data matrices, mostly morphological characters not requiring detailed anatomical investigations. Molecular studies on beetle phylogeny started in the 1990s with modest taxon sampling and limited DNA data. This has

  1. Phylogenetic signals in the climatic niches of the world's amphibians

    DEFF Research Database (Denmark)

    Hof, Christian; Rahbek, Carsten; Araújo, Miguel B.

    2010-01-01

    amphibian orders and across biogeographical regions. To our knowledge, this is the first study providing a comprehensive analysis of the phylogenetic signal in species climatic niches for an entire clade across the world. Even though our results do not provide a strong test of the niche conservatism......The question of whether closely related species share similar ecological requirements has attracted increasing attention, because of its importance for understanding global diversity gradients and the impacts of climate change on species distributions. In fact, the assumption that related species...... are also ecologically similar has often been made, although the prevalence of such a phylogenetic signal in ecological niches remains heavily debated. Here, we provide a global analysis of phylogenetic niche relatedness for the world's amphibians. In particular, we assess which proportion of the variance...

  2. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  3. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  4. Phylogenetically-informed priorities for amphibian conservation.

    Science.gov (United States)

    Isaac, Nick J B; Redding, David W; Meredith, Helen M; Safi, Kamran

    2012-01-01

    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  5. Phylogenetically-informed priorities for amphibian conservation.

    Directory of Open Access Journals (Sweden)

    Nick J B Isaac

    Full Text Available The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  6. Endogenous spar tin, mutated in hereditary spastic paraplegia, has a complex subcellular localization suggesting diverse roles in neurons

    International Nuclear Information System (INIS)

    Robay, Dimitri; Patel, Heema; Simpson, Michael A.; Brown, Nigel A.; Crosby, Andrew H.

    2006-01-01

    Mutation of spartin (SPG20) underlies a complicated form of hereditary spastic paraplegia, a disorder principally defined by the degeneration of upper motor neurons. Using a polyclonal antibody against spartin to gain insight into the function of the endogenous molecule, we show that the endogenous molecule is present in two main isoforms of 85 kDa and 100 kDa, and 75 kDa and 85 kDa in human and murine, respectively, with restricted subcellular localization. Immunohistochemical studies on human and mouse embryo sections and in vitro cell studies indicate that spartin is likely to possess both nuclear and cytoplasmic functions. The nuclear expression of spartin closely mirrors that of the snRNP (small nuclear ribonucleoprotein) marker α-Sm, a component of the spliceosome. Spartin is also enriched at the centrosome within mitotic structures. Notably we show that spartin protein undergoes dynamic positional changes in differentiating human SH-SY5Y cells. In undifferentiated non-neuronal cells, spartin displays a nuclear and diffuse cytosolic profile, whereas spartin transiently accumulates in the trans-Golgi network and subsequently decorates discrete puncta along neurites in terminally differentiated neuroblastic cells. Investigation of these spartin-positive vesicles reveals that a large proportion colocalizes with the synaptic vesicle marker synaptotagmin. Spartin is also enriched in synaptic-like structures and in synaptic vesicle-enriched fraction

  7. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  8. An endoplasmic reticulum-localized Coffea arabica BURP domain-containing protein affects the response of transgenic Arabidopsis plants to diverse abiotic stresses.

    Science.gov (United States)

    Dinh, Sy Nguyen; Kang, Hunseung

    2017-11-01

    The Coffea arabica BURP domain-containing gene plays an important role in the response of transgenic Arabidopsis plants to abiotic stresses via regulating the level of diverse proteins. Although the functions of plant-specific BURP domain-containing proteins (BDP) have been determined for a few plants, their roles in the growth, development, and stress responses of most plant species, including coffee plant (Coffea arabica), are largely unknown. In this study, the function of a C. arabica BDP, designated CaBDP1, was investigated in transgenic Arabidopsis plants. The expression of CaBDP1 was highly modulated in coffee plants subjected to drought, cold, salt, or ABA. Confocal analysis of CaBDP1-GFP fusion proteins revealed that CaBDP1 is localized in the endoplasmic reticulum. The ectopic expression of CaBDP1 in Arabidopsis resulted in delayed germination of the transgenic plants under abiotic stress and in the presence of ABA. Cotyledon greening and seedling growth of the transgenic plants were inhibited in the presence of ABA due to the upregulation of ABA signaling-related genes like ABI3, ABI4, and ABI5. Proteome analysis revealed that the levels of several proteins are modulated in CaBDP1-expressing transgenic plants. The results of this study underscore the importance of BURP domain proteins in plant responses to diverse abiotic stresses.

  9. Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

    Science.gov (United States)

    Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

    2013-01-01

    The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

  10. Conservation Action Based on Threatened Species Capture Taxonomic and Phylogenetic Richness in Breeding and Wintering Populations of Central Asian Birds

    Science.gov (United States)

    Schweizer, Manuel; Ayé, Raffael; Kashkarov, Roman; Roth, Tobias

    2014-01-01

    Although phylogenetic diversity has been suggested to be relevant from a conservation point of view, its role is still limited in applied nature conservation. Recently, the practice of investing conservation resources based on threatened species was identified as a reason for the slow integration of phylogenetic diversity in nature conservation planning. One of the main arguments is based on the observation that threatened species are not evenly distributed over the phylogenetic tree. However this argument seems to dismiss the fact that conservation action is a spatially explicit process, and even if threatened species are not evenly distributed over the phylogenetic tree, the occurrence of threatened species could still indicate areas with above average phylogenetic diversity and consequently could protect phylogenetic diversity. Here we aim to study the selection of important bird areas in Central Asia, which were nominated largely based on the presence of threatened bird species. We show that although threatened species occurring in Central Asia do not capture phylogenetically more distinct species than expected by chance, the current spatially explicit conservation approach of selecting important bird areas covers above average taxonomic and phylogenetic diversity of breeding and wintering birds. We conclude that the spatially explicit processes of conservation actions need to be considered in the current discussion of whether new prioritization methods are needed to complement conservation action based on threatened species. PMID:25337861

  11. ARP2/3 localization in Arabidopsis leaf pavement cells: a diversity of intracellular pools and cytoskeletal interactions.

    Science.gov (United States)

    Zhang, Chunhua; Mallery, Eileen L; Szymanski, Daniel B

    2013-01-01

    In plant cells the actin cytoskeleton adopts many configurations, but is best understood as an unstable, interconnected track that rearranges to define the patterns of long distance transport of organelles during growth. Actin filaments do not form spontaneously; instead filament nucleators, such as the evolutionarily conserved actin-related protein (ARP) 2/3 complex, can efficiently generate new actin filament networks when in a fully activated state. A growing number of genetic experiments have shown that ARP2/3 is necessary for morphogenesis in processes that range from tip growth during root nodule formation to the diffuse polarized growth of leaf trichomes and pavement cells. Although progress has been rapid in the identification of proteins that function in series to positively regulate ARP2/3, less has been learned about the actual function of ARP2/3 in cells. In this paper, we analyze the localization of ARP2/3 in Arabidopsis leaf pavement cells. We detect a pool of ARP2/3 in the nucleus, and also find that ARP2/3 is efficiently and specifically clustered on multiple organelle surfaces and associates with both the actin filament and microtubule cytoskeletons. Our mutant analyses and ARP2/3 and actin double labeling experiments indicate that the clustering of ARP2/3 on organelle surfaces and an association with actin bundles does not necessarily reflect an active pool of ARP2/3, and instead most of the complex appears to exist as a latent organelle-associated pool.

  12. Phylogenetic classification of the world's tropical forests

    DEFF Research Database (Denmark)

    Slik, J. W. Ferry; Franklin, Janet; Arroyo-Rodriguez, Victor

    2018-01-01

    -Pacific counterparts. We also find indications for the existence of a global dry forest region, with representatives in America, Africa, Madagascar, and India. Additionally, a northern-hemisphere Subtropical forest region was identified with representatives in Asia and America, providing support for a link between......Knowledge about the biogeographic affinities of the world's tropical forests helps to better understand regional differences in forest structure, diversity, composition, and dynamics. Such understanding will enable anticipation of region-specific responses to global environmental change. Modern...... phylogenies, in combination with broad coverage of species inventory data, now allow for global biogeographic analyses that take species evolutionary distance into account. Here we present a classification of the world's tropical forests based on their phylogenetic similarity. We identify five principal...

  13. Estimating phylogenetic trees from genome-scale data.

    Science.gov (United States)

    Liu, Liang; Xi, Zhenxiang; Wu, Shaoyuan; Davis, Charles C; Edwards, Scott V

    2015-12-01

    The heterogeneity of signals in the genomes of diverse organisms poses challenges for traditional phylogenetic analysis. Phylogenetic methods known as "species tree" methods have been proposed to directly address one important source of gene tree heterogeneity, namely the incomplete lineage sorting that occurs when evolving lineages radiate rapidly, resulting in a diversity of gene trees from a single underlying species tree. Here we review theory and empirical examples that help clarify conflicts between species tree and concatenation methods, and misconceptions in the literature about the performance of species tree methods. Considering concatenation as a special case of the multispecies coalescent model helps explain differences in the behavior of the two methods on phylogenomic data sets. Recent work suggests that species tree methods are more robust than concatenation approaches to some of the classic challenges of phylogenetic analysis, including rapidly evolving sites in DNA sequences and long-branch attraction. We show that approaches, such as binning, designed to augment the signal in species tree analyses can distort the distribution of gene trees and are inconsistent. Computationally efficient species tree methods incorporating biological realism are a key to phylogenetic analysis of whole-genome data. © 2015 New York Academy of Sciences.

  14. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  15. Fire modifies the phylogenetic structure of soil bacterial co-occurrence networks.

    Science.gov (United States)

    Pérez-Valera, Eduardo; Goberna, Marta; Faust, Karoline; Raes, Jeroen; García, Carlos; Verdú, Miguel

    2017-01-01

    Fire alters ecosystems by changing the composition and community structure of soil microbes. The phylogenetic structure of a community provides clues about its main assembling mechanisms. While environmental filtering tends to reduce the community phylogenetic diversity by selecting for functionally (and hence phylogenetically) similar species, processes like competitive exclusion by limiting similarity tend to increase it by preventing the coexistence of functionally (and phylogenetically) similar species. We used co-occurrence networks to detect co-presence (bacteria that co-occur) or exclusion (bacteria that do not co-occur) links indicative of the ecological interactions structuring the community. We propose that inspecting the phylogenetic structure of co-presence or exclusion links allows to detect the main processes simultaneously assembling the community. We monitored a soil bacterial community after an experimental fire and found that fire altered its composition, richness and phylogenetic diversity. Both co-presence and exclusion links were more phylogenetically related than expected by chance. We interpret such a phylogenetic clustering in co-presence links as a result of environmental filtering, while that in exclusion links reflects competitive exclusion by limiting similarity. This suggests that environmental filtering and limiting similarity operate simultaneously to assemble soil bacterial communities, widening the traditional view that only environmental filtering structures bacterial communities. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Interpreting the universal phylogenetic tree

    Science.gov (United States)

    Woese, C. R.

    2000-01-01

    The universal phylogenetic tree not only spans all extant life, but its root and earliest branchings represent stages in the evolutionary process before modern cell types had come into being. The evolution of the cell is an interplay between vertically derived and horizontally acquired variation. Primitive cellular entities were necessarily simpler and more modular in design than are modern cells. Consequently, horizontal gene transfer early on was pervasive, dominating the evolutionary dynamic. The root of the universal phylogenetic tree represents the first stage in cellular evolution when the evolving cell became sufficiently integrated and stable to the erosive effects of horizontal gene transfer that true organismal lineages could exist.

  17. Assembly and phylogenetic structure of Neotropical palm communities

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Svenning, J.-C.; Balslev, Henrik

    Diversity, composition and dynamics of Neotropical palm communities are receiving an increasing amount of attention due to their economic importance, but also because their high species richness and functional diversity render them valuable model systems for overall forest biodiversity. However......, to better understand these palm communities, it is crucial to gain insight into the mechanisms responsible for their assembly. These can be dispersal limitation, environmental filtering, or biotic interactions. If the degree of niche conservatism is known for a group of organisms, patterns of community...... an unspecific assumption of “general niche conservatism”, phylogenetic signal will be analysed for Neotropical palms. Moreover, as an example for evolutionary mechanisms disrupting phylogenetic signal, speciation modes will be examined in selected genera. With the combined results we aim to show the relative...

  18. Brazilian underutilised species to promote dietary diversity, local food procurement, and biodiversity conservation: a food composition gap analysis

    Directory of Open Access Journals (Sweden)

    Daniela Moura de Oliveira Beltrame, PhD

    2018-05-01

    Full Text Available Background: Brazil is home to a large portion of the world's biodiversity, but, paradoxically, the country's agriculture and food security are very reliant on exotic or introduced crops or species. Native species are being neglected and forgotten with natural landscapes and traditional foods being replaced by monocultures of commodity crops and pasture for livestock, causing habitat and biodiversity loss. At the same time, Brazil faces dietary simplification and high levels of malnutrition. Much of the neglected native biodiversity is highly nutritious and exploring these food sources could help provide sustainable solutions to diversifying diets, tackling malnutrition problems, and promoting agricultural development through local food procurement, while also promoting biodiversity conservation and climate change adaptation and resilience. However, notable knowledge and evidence gaps still need to be addressed to better integrate biodiversity for enhancing food and nutrition security, including scientific data on the nutritional value and composition of native underutilised species. In Brazil, the Biodiversity for Food and Nutrition (BFN project generated food composition data, developed recipes, and increased appreciation and awareness of the value of underutilised, nutrient-rich biodiversity through strategic research partnerships with universities and research institutes. Methods: For this food composition gap analysis of native Brazilian biodiversity, the BFN project established partnerships with universities and research institutes for the generation of food composition data (macronutrients, vitamins, and minerals and the development of recipes for 70 native underutilised species of fruits and vegetables of economic potential. Food composition data was gathered by doing a literature review, using compilation methods developed by the Food and Agriculture Organization of the United Nations and the International Network for Food Data Systems

  19. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  20. Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis

    OpenAIRE

    Young, Douglas B.; Comas, I?aki; de Carvalho, Luiz P. S.

    2015-01-01

    Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii, and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms (SNPs) with predicted impact on protein function and transcriptional regulation...

  1. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  2. Consistent patterns of high alpha and low beta diversity in tropical parasitic and free-living protists.

    Science.gov (United States)

    Lentendu, Guillaume; Mahé, Frédéric; Bass, David; Rueckert, Sonja; Stoeck, Thorsten; Dunthorn, Micah

    2018-05-30

    Tropical animals and plants are known to have high alpha diversity within forests, but low beta diversity between forests. By contrast, it is unknown whether microbes inhabiting the same ecosystems exhibit similar biogeographic patterns. To evaluate the biogeographies of tropical protists, we used metabarcoding data of species sampled in the soils of three lowland Neotropical rainforests. Taxa-area and distance-decay relationships for three of the dominant protist taxa and their subtaxa were estimated at both the OTU and phylogenetic levels, with presence-absence and abundance-based measures. These estimates were compared to null models. High local alpha and low regional beta diversity patterns were consistently found for both the parasitic Apicomplexa and the largely free-living Cercozoa and Ciliophora. Similar to animals and plants, the protists showed spatial structures between forests at the OTU and phylogenetic levels, and only at the phylogenetic level within forests. These results suggest that the biogeographies of macro- and micro-organismal eukaryotes in lowland Neotropical rainforests are partially structured by the same general processes. However, and unlike the animals and plants, the protist OTUs did not exhibit spatial structures within forests, which hinders our ability to estimate the local and regional diversity of protists in tropical forests. © 2018 John Wiley & Sons Ltd.

  3. Landscape patterns in rainforest phylogenetic signal: isolated islands of refugia or structured continental distributions?

    Directory of Open Access Journals (Sweden)

    Robert M Kooyman

    Full Text Available OBJECTIVES: Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. METHODS: We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD, phylogenetic endemism (PE and phylogenetic structure (net relatedness index; NRI. Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. RESULTS: Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. CONCLUSIONS/SIGNIFICANCE: Concentrations of rainforest evolutionary history (phylo-diversity were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community

  4. Landscape Patterns in Rainforest Phylogenetic Signal: Isolated Islands of Refugia or Structured Continental Distributions?

    Science.gov (United States)

    Kooyman, Robert M.; Rossetto, Maurizio; Sauquet, Hervé; Laffan, Shawn W.

    2013-01-01

    Objectives Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. Methods We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD), phylogenetic endemism (PE) and phylogenetic structure (net relatedness index; NRI). Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. Results Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance) in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. Conclusions/Significance Concentrations of rainforest evolutionary history (phylo-diversity) were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community distribution, our findings of

  5. Inferring influenza global transmission networks without complete phylogenetic information.

    Science.gov (United States)

    Aris-Brosou, Stéphane

    2014-03-01

    Influenza is one of the most severe respiratory infections affecting humans throughout the world, yet the dynamics of its global transmission network are still contentious. Here, I describe a novel combination of phylogenetics, time series, and graph theory to analyze 14.25 years of data stratified in space and in time, focusing on the main target of the human immune response, the hemagglutinin gene. While bypassing the complete phylogenetic inference of huge data sets, the method still extracts information suggesting that waves of genetic or of nucleotide diversity circulate continuously around the globe for subtypes that undergo sustained transmission over several seasons, such as H3N2 and pandemic H1N1/09, while diversity of prepandemic H1N1 viruses had until 2009 a noncontinuous transmission pattern consistent with a source/sink model. Irrespective of the shift in the structure of H1N1 diversity circulation with the emergence of the pandemic H1N1/09 strain, US prevalence peaks during the winter months when genetic diversity is at its lowest. This suggests that a dominant strain is generally responsible for epidemics and that monitoring genetic and/or nucleotide diversity in real time could provide public health agencies with an indirect estimate of prevalence.

  6. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  7. Phylogenetic congruence between subtropical trees and their associated fungi.

    Science.gov (United States)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S; Gilbert, Gregory S; Yu, Shixiao

    2016-12-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi in has rarely been investigated. Using next-generation high-throughput DNA sequencing techniques, we analyzed fungal taxa associated with diseased leaves, rotten seeds, and infected seedlings of subtropical trees. We compared the topologies of the phylogenetic trees of the soil and foliar fungi based on the internal transcribed spacer (ITS) region with the phylogeny of host tree species based on matK , rbcL , atpB, and 5.8S genes. We identified 37 foliar and 103 soil pathogenic fungi belonging to the Ascomycota and Basidiomycota phyla and detected significantly nonrandom host-fungus combinations, which clustered on both the fungus phylogeny and the host phylogeny. The explicit evidence of congruent phylogenies between tree hosts and their potential fungal pathogens suggests either diffuse coevolution among the plant-fungal interaction networks or that the distribution of fungal species tracked spatially associated hosts with phylogenetically conserved traits and habitat preferences. Phylogenetic conservatism in plant-fungal interactions within a local community promotes host and parasite specificity, which is integral to the important role of fungi in promoting species coexistence and maintaining biodiversity of forest communities.

  8. Phylogenetic analysis of fungal ABC transporters.

    Science.gov (United States)

    Kovalchuk, Andriy; Driessen, Arnold J M

    2010-03-16

    The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.

  9. Plant traits determine the phylogenetic structure of arbuscular mycorrhizal fungal communities.

    Science.gov (United States)

    López-García, Álvaro; Varela-Cervero, Sara; Vasar, Martti; Öpik, Maarja; Barea, José M; Azcón-Aguilar, Concepción

    2017-12-01

    Functional diversity in ecosystems has traditionally been studied using aboveground plant traits. Despite the known effect of plant traits on the microbial community composition, their effects on the microbial functional diversity are only starting to be assessed. In this study, the phylogenetic structure of arbuscular mycorrhizal (AM) fungal communities associated with plant species differing in life cycle and growth form, that is, plant life forms, was determined to unravel the effect of plant traits on the functional diversity of this fungal group. The results of the 454 pyrosequencing showed that the AM fungal community composition differed across plant life forms and this effect was dependent on the soil collection date. Plants with ruderal characteristics tended to associate with phylogenetically clustered AM fungal communities. By contrast, plants with resource-conservative traits associated with phylogenetically overdispersed AM fungal communities. Additionally, the soil collected in different seasons yielded AM fungal communities with different phylogenetic dispersion. In summary, we found that the phylogenetic structure, and hence the functional diversity, of AM fungal communities is dependent on plant traits. This finding adds value to the use of plant traits for the evaluation of belowground ecosystem diversity, functions and processes. © 2017 John Wiley & Sons Ltd.

  10. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  11. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  12. Phylogenetic relationships and genetic diversity of Nemesis Risso ...

    African Journals Online (AJOL)

    Nemesi s is one of 12 genera in the family Eudactylinidae and includes about nine species. In this study, we investigated whether there is any population structure among Nemesis lamna individuals infecting the white shark Carcharodon carcharias and the shortfin mako Isurus oxyrinchus according to host species or ...

  13. Genomic diversity and phylogenetic relationships in the genus Parthenium (Asteraceae)

    Science.gov (United States)

    Guayule (Parthenium argentatum A. Gray) is a perennial hardwood shrub native to the North American Chihuahuan Desert that holds promise as a sustainable source of natural rubber and hypoallergenic latex. The improvement of guayule for commercial-scale production could be potentially accelerated thro...

  14. Molecular diversity and phylogenetic relationships of the gastropod ...

    African Journals Online (AJOL)

    The freshwater snails belonging to the genus Melanoides Olivier, 1804 are widespread across tropical regions of the world and endemic species have evolved in the African Lakes Malawi, Mweru and Tanganyika. The endemic Melanoides species of Lake Malawi have been investigated several times during the last century ...

  15. Genetic diversity within the genus Cynotilapia and its phylogenetic ...

    African Journals Online (AJOL)

    Cynotilapia's unicuspid teeth, a unique character used to delineate it from all other mbuna genera, leaves evolutionary biologists wondering which is the closest relative to this genus among mbuna cichlids. This genus has only two described species out of the 10-13 species/taxa, whereby the undescribed taxa are either ...

  16. Diversity and Phylogenetic Structure of Two Complex Marine Microbial Communities

    Science.gov (United States)

    2004-09-01

    q Ja 1,4 1 S., fn.i.to) 47. 145-1 156 (19r . lntiutoide Geologia ’ Mineria, Universidad Nactonalde Jujuy, Avenida Bolwiva . V~a. C 3. j kLmnnnaommntal...grandfather. 27 Pbl O. G. &R am-aw A. ^ NItL -Mhmuhniodsr•ngrop hsoll rYfonm -ine-4tar Phylov Holotype. Museo de Geologia , Mineralogia y Paleontologia

  17. Taxonomic, phylogenetic, and ecological diversity of methanogenic Archaea

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, J.-L.; Ollivier, B. [Universite de Provence, Marseille (France). Laboratoire de Microbiologist; Patel, B.K.C. [Griffith University, Brisbane (Australia). Microbial Discovery Research Unit

    2000-07-01

    Methanogens are strict anaerobes which share a complex biochemistry for methane synthesis as part of their energy metabolism. The discovery of the unique biochemical and genetic properties of these organisms led to the concept of Archaebacteria at the end of the seventies and the proposal in 1990 for the domain Archaea. A number of studies have provided evidence that they are of economic value. The successive petroleum crisis since 1973 has led to great interest in alternative forms of energy, including recovery of methane via anaerobic digestion of wastes. Improvements in the design of digestors have been made possible by advances in understanding the ecology and physiology of methanogens. In the cattle industry, the knowledge of the fermentation processes in the rumen demonstrated a net loss of energy via the methanogenesis, and inhibitors such as Rumensin have been developed to enhance meat yields. Oil companies try to distinguish between natural gas produced by methanogens or by the thermocatalytic reactions associated with petroleum generation. Finally, studies on the global distribution of methane in the earth's atmosphere are increasing due to the sudden awareness of its possible role in the enhancement of the greenhouse effect from CO-2 accumulation, and on the reversal of stratospheric ozone depletion. This paper summarizes the recent knowledge of methanogenic Archaea with emphasis on their taxonomy and ecology. (author)

  18. Traditional agroforestry practices in Atlantic Nicaragua promote biodiversity and natural resource diversity

    Science.gov (United States)

    Sistla, S.; Roddy, A. B.; Williams, N. E.; Kramer, D.; Stevens, K.; Allison, S. D.

    2016-12-01

    The conversion of forest to pasture and other agricultural uses has increased interest in the role that small-scale agroforestry systems can play in linking sustainable agriculture to biodiversity conservation, particularly in rapidly developing areas of the tropics. Complementing the provisioning of natural resources (i.e. food, medicine, lumber), agroforestry systems tend to maintain higher levels of biodiversity and greater biomass than lower diversity crop or pasture systems. Greater plant diversity may also enhance soil quality, further supporting agricultural productivity in nutrient-limited tropical systems. We studied the relationships between plant diversity (including species richness, phylogenetic diversity, and natural resource diversity), and soil quality within pasture, agroforest, and secondary forest: three common land use types maintained by small-scale farmers in the Pearl Lagoon Basin, Nicaragua. The area is undergoing accelerated globalization following the 2007 completion of the region's first major road; a change which is expected to increase forest conversion for agriculture. However, farmer agrobiodiversity maintenance in the Basin was previously found to be positively correlated with affiliation to local agricultural NGOs through the maintenance of agroforestry systems, despite these farmers residing in the communities closest to the new road, highlighting the potential for maintaining diverse agroforestry agricultural strategies despite heightened globalization pressures. We found that agroforestry sites tended to have higher surface soil %C, %N, and pH relative to neighboring to secondary forest, while maintaining comparable plant diversity. In contrast, pasture reduced species richness, phylogenetic diversity, and natural resource diversity. No significant relationships were found between plant diversity and the soil properties assessed; however higher species richness and phylodiversity was positively correlated with natural resource

  19. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  20. Phylogenetic footprints in organizational behavior

    OpenAIRE

    Witt, Ulrich; Schwesinger, Georg

    2012-01-01

    An evolutionary tool kit is applied in this paper to explain how innate social behavior traits evolved in early human groups. These traits were adapted to the particular production requirements of the group in human phylogeny. They shaped the group members' attitudes towards contributing to the group's goals and towards other group members. We argue that these attitudes are still present in modern humans and leave their phylogenetic footprints also in present-day organizational life. We discu...

  1. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  2. Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.

    Directory of Open Access Journals (Sweden)

    Luis F Aguirre

    Full Text Available Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups. Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for

  3. Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.

    Science.gov (United States)

    Aguirre, Luis F; Montaño-Centellas, Flavia A; Gavilanez, M Mercedes; Stevens, Richard D

    2016-01-01

    Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups). Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement) was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia) create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for patterns of functional

  4. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  5. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  6. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  7. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure.

    Science.gov (United States)

    Zappi, Daniela C; Moro, Marcelo F; Meagher, Thomas R; Nic Lughadha, Eimear

    2017-01-01

    Old, climate-buffered infertile landscapes (Ocbils) have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil's campos rupestres (rupestrian grasslands) are home to almost 15% of Brazil's native flora in less than 0.8% of Brazil's territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ) and on ironstone substrates, commonly termed canga . Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC), which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be effective

  8. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure

    Directory of Open Access Journals (Sweden)

    Daniela C. Zappi

    2017-12-01

    Full Text Available Old, climate-buffered infertile landscapes (Ocbils have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil’s campos rupestres (rupestrian grasslands are home to almost 15% of Brazil’s native flora in less than 0.8% of Brazil’s territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ and on ironstone substrates, commonly termed canga. Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC, which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be

  9. Maximum Parsimony on Phylogenetic networks

    Science.gov (United States)

    2012-01-01

    Background Phylogenetic networks are generalizations of phylogenetic trees, that are used to model evolutionary events in various contexts. Several different methods and criteria have been introduced for reconstructing phylogenetic trees. Maximum Parsimony is a character-based approach that infers a phylogenetic tree by minimizing the total number of evolutionary steps required to explain a given set of data assigned on the leaves. Exact solutions for optimizing parsimony scores on phylogenetic trees have been introduced in the past. Results In this paper, we define the parsimony score on networks as the sum of the substitution costs along all the edges of the network; and show that certain well-known algorithms that calculate the optimum parsimony score on trees, such as Sankoff and Fitch algorithms extend naturally for networks, barring conflicting assignments at the reticulate vertices. We provide heuristics for finding the optimum parsimony scores on networks. Our algorithms can be applied for any cost matrix that may contain unequal substitution costs of transforming between different characters along different edges of the network. We analyzed this for experimental data on 10 leaves or fewer with at most 2 reticulations and found that for almost all networks, the bounds returned by the heuristics matched with the exhaustively determined optimum parsimony scores. Conclusion The parsimony score we define here does not directly reflect the cost of the best tree in the network that displays the evolution of the character. However, when searching for the most parsimonious network that describes a collection of characters, it becomes necessary to add additional cost considerations to prefer simpler structures, such as trees over networks. The parsimony score on a network that we describe here takes into account the substitution costs along the additional edges incident on each reticulate vertex, in addition to the substitution costs along the other edges which are

  10. Genetic diversity of a Daugava basin brown trout (Salmo trutta brood stock

    Directory of Open Access Journals (Sweden)

    Schmidt Thomas

    2017-01-01

    Full Text Available Genetics play an increasingly important role in the conservation of threatened fish populations. We have examined twelve microsatellite markers to determine the genetic diversity of a brood stock of brown trout from the Latvian Daugava river basin, used in a local supportive breeding program and compared diversity values to other Baltic populations. Allelic data was further inspected for indications of increased inbreeding. Additionally, we have analyzed the mitochondrial control region to classify the population within a broader phylogenetic framework. We found that the genetic diversity was comparatively low, but there was no strong evidence of high inbreeding. A newly detected mitochondrial haplotype indicates unnoticed genetic diversity of “Atlantic lineage” brown trout in the Daugava basin region. Our study provides first genetic details on resident brown trout from the Baltic Daugava river basin to improve the regional conservation management of this valuable genetic resource and contributes phylogeographically useful information.

  11. Diversity patterns of microbial eukaryotes mirror those of bacteria in Antarctic cryoconite holes.

    Science.gov (United States)

    Sommers, Pacifica; Darcy, John L; Gendron, Eli M S; Stanish, Lee F; Bagshaw, Elizabeth A; Porazinska, Dorota L; Schmidt, Steven K

    2018-01-01

    Ice-lidded cryoconite holes on glaciers in the Taylor Valley, Antarctica, provide a unique system of natural mesocosms for studying community structure and assembly. We used high-throughput DNA sequencing to characterize both microbial eukaryotic communities and bacterial communities within cryoconite holes across three glaciers to study similarities in their spatial patterns. We expected that the alpha (phylogenetic diversity) and beta (pairwise community dissimilarity) diversity patterns of eukaryotes in cryoconite holes would be related to those of bacteria, and that they would be related to the biogeochemical gradient within the Taylor Valley. We found that eukaryotic alpha and beta diversity were strongly related to those of bacteria across scales ranging from 140 m to 41 km apart. Alpha diversity of both was significantly related to position in the valley and surface area of the cryoconite hole, with pH also significantly correlated with the eukaryotic diversity. Beta diversity for both bacteria and eukaryotes was significantly related to position in the valley, with bacterial beta diversity also related to nitrate. These results are consistent with transport of sediments onto glaciers occurring primarily at local scales relative to the size of the valley, thus creating feedbacks in local chemistry and diversity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. On the Shapley Value of Unrooted Phylogenetic Trees.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-01-17

    The Shapley value, a solution concept from cooperative game theory, has recently been considered for both unrooted and rooted phylogenetic trees. Here, we focus on the Shapley value of unrooted trees and first revisit the so-called split counts of a phylogenetic tree and the Shapley transformation matrix that allows for the calculation of the Shapley value from the edge lengths of a tree. We show that non-isomorphic trees may have permutation-equivalent Shapley transformation matrices and permutation-equivalent null spaces. This implies that estimating the split counts associated with a tree or the Shapley values of its leaves does not suffice to reconstruct the correct tree topology. We then turn to the use of the Shapley value as a prioritization criterion in biodiversity conservation and compare it to a greedy solution concept. Here, we show that for certain phylogenetic trees, the Shapley value may fail as a prioritization criterion, meaning that the diversity spanned by the top k species (ranked by their Shapley values) cannot approximate the total diversity of all n species.

  13. Comparing Complementary and Alternative Medicine Use with or without Including Prayer as a Modality in a Local and Diverse United States Jurisdiction.

    Science.gov (United States)

    Robles, Brenda; Upchurch, Dawn M; Kuo, Tony

    2017-01-01

    Few studies to date have examined the utilization of complementary and alternative medicine (CAM) in a local, ethnically diverse population in the United States (U.S.). Fewer have addressed the differences in their use based on inclusion or exclusion of prayer as a modality. Variable definitions of CAM are known to affect public health surveillance (i.e., continuous, systematic data collection, analysis, and interpretation) or benchmarking (i.e., identifying and comparing key indicators of health to inform community planning) related to this non-mainstream collection of health and wellness therapies. The present study sought to better understand how including or excluding prayer could affect reporting of CAM use among residents of a large, urban U.S. jurisdiction. Using population-weighted data from a cross-sectional Internet panel survey collected as part of a larger countywide population health survey, the study compared use of CAM based on whether prayer or no prayer was included in its definition. Patterns of CAM use by socio-demographic characteristics were described for the two operationalized definitions. Multivariable binomial regression analyses were performed to control for gender, age, race/ethnicity, education, employment, income, and health insurance status. One of the analyses explored the associations between CAM use and racial/ethnic characteristics in the study sample. Los Angeles County, California. A socio-demographically diverse sample of Los Angeles County residents. CAM use (with prayer) and CAM use (excluding prayer). Blacks were among the highest users of CAM when compared to Whites, especially when prayer was included as a CAM modality. Regardless of prayer inclusion, being a woman predicted higher use of CAM. How CAM is defined matters in gauging the utilization of this non-mainstream collection of therapies. Given that surveillance and/or benchmarking data are often used to inform resource allocation and planning decisions, results from

  14. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  16. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  17. A guide to phylogenetic metrics for conservation, community ecology and macroecology

    Science.gov (United States)

    Cadotte, Marc W.; Carvalho, Silvia B.; Davies, T. Jonathan; Ferrier, Simon; Fritz, Susanne A.; Grenyer, Rich; Helmus, Matthew R.; Jin, Lanna S.; Mooers, Arne O.; Pavoine, Sandrine; Purschke, Oliver; Redding, David W.; Rosauer, Dan F.; Winter, Marten; Mazel, Florent

    2016-01-01

    ABSTRACT The use of phylogenies in ecology is increasingly common and has broadened our understanding of biological diversity. Ecological sub‐disciplines, particularly conservation, community ecology and macroecology, all recognize the value of evolutionary relationships but the resulting development of phylogenetic approaches has led to a proliferation of phylogenetic diversity metrics. The use of many metrics across the sub‐disciplines hampers potential meta‐analyses, syntheses, and generalizations of existing results. Further, there is no guide for selecting the appropriate metric for a given question, and different metrics are frequently used to address similar questions. To improve the choice, application, and interpretation of phylo‐diversity metrics, we organize existing metrics by expanding on a unifying framework for phylogenetic information. Generally, questions about phylogenetic relationships within or between assemblages tend to ask three types of question: how much; how different; or how regular? We show that these questions reflect three dimensions of a phylogenetic tree: richness, divergence, and regularity. We classify 70 existing phylo‐diversity metrics based on their mathematical form within these three dimensions and identify ‘anchor’ representatives: for α‐diversity metrics these are PD (Faith's phylogenetic diversity), MPD (mean pairwise distance), and VPD (variation of pairwise distances). By analysing mathematical formulae and using simulations, we use this framework to identify metrics that mix dimensions, and we provide a guide to choosing and using the most appropriate metrics. We show that metric choice requires connecting the research question with the correct dimension of the framework and that there are logical approaches to selecting and interpreting metrics. The guide outlined herein will help researchers navigate the current jungle of indices. PMID:26785932

  18. Environmental factors determining ammonia-oxidizing organism distribution and diversity in marine environments.

    Science.gov (United States)

    Bouskill, Nicholas J; Eveillard, Damien; Chien, Diana; Jayakumar, Amal; Ward, Bess B

    2012-03-01

    Ammonia-oxidizing bacteria (AOB) and archaea (AOA) play a vital role in bridging the input of fixed nitrogen, through N-fixation and remineralization, to its loss by denitrification and anammox. Yet the major environmen