WorldWideScience

Sample records for phylogenetic diversity localization

  1. Local-scale Partitioning of Functional and Phylogenetic Beta Diversity in a Tropical Tree Assemblage.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Zhang, Guocheng; Ci, Xiuqin; Cao, Min; Sha, Liqing; Li, Jie; Ferry Slik, J W; Lin, Luxiang

    2015-08-03

    The relative degree to which stochastic and deterministic processes underpin community assembly is a central problem in ecology. Quantifying local-scale phylogenetic and functional beta diversity may shed new light on this problem. We used species distribution, soil, trait and phylogenetic data to quantify whether environmental distance, geographic distance or their combination are the strongest predictors of phylogenetic and functional beta diversity on local scales in a 20-ha tropical seasonal rainforest dynamics plot in southwest China. The patterns of phylogenetic and functional beta diversity were generally consistent. The phylogenetic and functional dissimilarity between subplots (10 × 10 m, 20 × 20 m, 50 × 50 m and 100 × 100 m) was often higher than that expected by chance. The turnover of lineages and species function within habitats was generally slower than that across habitats. Partitioning the variation in phylogenetic and functional beta diversity showed that environmental distance was generally a better predictor of beta diversity than geographic distance thereby lending relatively more support for deterministic environmental filtering over stochastic processes. Overall, our results highlight that deterministic processes play a stronger role than stochastic processes in structuring community composition in this diverse assemblage of tropical trees.

  2. Partitioning the regional and local drivers of phylogenetic and functional diversity along temperate elevational gradients on an East Asian peninsula.

    Science.gov (United States)

    Chun, Jung-Hwa; Lee, Chang-Bae

    2018-02-12

    Species-centric approaches to biodiversity in ecological research are limited in their ability to reflect the evolutionary history and functional diversity of community assembly. Recently, the introduction of alternative facets of biodiversity, such as phylogenetic and functional diversity, has shed light on this problem and improved our understanding of the processes underlying biodiversity patterns. Here, we investigated the phylogenetic and functional diversity patterns of α, β and γ components in woody plant assemblages along regional and local elevational gradients in South Korea. Although the patterns of phylogenetic and functional diversity varied along regional and local elevational transects, the main drivers were partitioned into two categories: regional area or climate for phylogenetic diversity, depending on whether the transect was at a regional or local scale; and habitat heterogeneity for functional diversity, which was derived in elevational bands. Moreover, environmental distance was more important than was geographic distance for phylogenetic and functional β diversity between paired elevational bands. These results support the hypothesis that niche-based deterministic processes such as environmental filtering and competitive exclusion are fundamental in structuring woody plant assemblages along temperate elevational gradients regardless of scale (regional vs. local) in our study areas.

  3. Relative roles of local disturbance, current climate and palaeoclimate in determining phylogenetic and functional diversity in Chinese forests

    DEFF Research Database (Denmark)

    Feng, Gang; Mi, Xiangcheng; Bøcher, Peder Klith

    2014-01-01

    their relative roles in determining woody plant phylogenetic and functional diversity in this important hotspot for woody plant diversity. Local disturbance was the best predictor of functional diversity as represented by maximum canopy height (Hmax), probably reflecting the dominant role of competition...... studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese forest plots to data on current and Last Glacial Maximum (LGM) climate as well as local disturbance regimes to study...

  4. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  6. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  7. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  8. Edge-related loss of tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

    Science.gov (United States)

    Santos, Bráulio A; Arroyo-Rodríguez, Víctor; Moreno, Claudia E; Tabarelli, Marcelo

    2010-09-08

    Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

  9. Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity

    Science.gov (United States)

    Thompson, Patrick L.; Davies, T. Jonathan; Gonzalez, Andrew

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures. PMID:25693188

  10. Phylogenetically diverse macrophyte community promotes species diversity of mobile epi-benthic invertebrates

    Science.gov (United States)

    Nakamoto, Kenta; Hayakawa, Jun; Kawamura, Tomohiko; Kodama, Masafumi; Yamada, Hideaki; Kitagawa, Takashi; Watanabe, Yoshiro

    2018-07-01

    Various aspects of plant diversity such as species diversity and phylogenetic diversity enhance the species diversity of associated animals in terrestrial systems. In marine systems, however, the effects of macrophyte diversity on the species diversity of associated animals have received little attention. Here, we sampled in a subtropical seagrass-seaweed mixed bed to elucidate the effect of the macrophyte phylogenetic diversity based on the taxonomic relatedness as well as the macrophyte species diversity on species diversity of mobile epi-benthic invertebrates. Using regression analyses for each macrophyte parameter as well as multiple regression analyses, we found that the macrophyte phylogenetic diversity (taxonomic diversity index: Delta) positively influenced the invertebrate species richness and diversity index (H‧). Although the macrophyte species richness and H‧ also positively influenced the invertebrate species richness, the best fit model for invertebrate species richness did not include them, suggesting that the macrophyte species diversity indirectly influenced invertebrate species diversity. Possible explanations of the effects of macrophyte Delta on the invertebrate species diversity were the niche complementarity effect and the selection effect. This is the first study which demonstrates that macrophyte phylogenetic diversity has a strong effect on the species diversity of mobile epi-benthic invertebrates.

  11. Maximizing the phylogenetic diversity of seed banks.

    Science.gov (United States)

    Griffiths, Kate E; Balding, Sharon T; Dickie, John B; Lewis, Gwilym P; Pearce, Tim R; Grenyer, Richard

    2015-04-01

    Ex situ conservation efforts such as those of zoos, botanical gardens, and seed banks will form a vital complement to in situ conservation actions over the coming decades. It is therefore necessary to pay the same attention to the biological diversity represented in ex situ conservation facilities as is often paid to protected-area networks. Building the phylogenetic diversity of ex situ collections will strengthen our capacity to respond to biodiversity loss. Since 2000, the Millennium Seed Bank Partnership has banked seed from 14% of the world's plant species. We assessed the taxonomic, geographic, and phylogenetic diversity of the Millennium Seed Bank collection of legumes (Leguminosae). We compared the collection with all known legume genera, their known geographic range (at country and regional levels), and a genus-level phylogeny of the legume family constructed for this study. Over half the phylogenetic diversity of legumes at the genus level was represented in the Millennium Seed Bank. However, pragmatic prioritization of species of economic importance and endangerment has led to the banking of a less-than-optimal phylogenetic diversity and prioritization of range-restricted species risks an underdispersed collection. The current state of the phylogenetic diversity of legumes in the Millennium Seed Bank could be substantially improved through the strategic banking of relatively few additional taxa. Our method draws on tools that are widely applied to in situ conservation planning, and it can be used to evaluate and improve the phylogenetic diversity of ex situ collections. © 2014 Society for Conservation Biology.

  12. Edge-related loss of tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

    Directory of Open Access Journals (Sweden)

    Bráulio A Santos

    Full Text Available Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (<80 ha forest fragments. This was attributed to a reduction of 11% in the average phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

  13. White-tailed deer are a biotic filter during community assembly, reducing species and phylogenetic diversity.

    Science.gov (United States)

    Begley-Miller, Danielle R; Hipp, Andrew L; Brown, Bethany H; Hahn, Marlene; Rooney, Thomas P

    2014-06-09

    Community assembly entails a filtering process, where species found in a local community are those that can pass through environmental (abiotic) and biotic filters and successfully compete. Previous research has demonstrated the ability of white-tailed deer (Odocoileus virginianus) to reduce species diversity and favour browse-tolerant plant communities. In this study, we expand on our previous work by investigating deer as a possible biotic filter altering local plant community assembly. We used replicated 23-year-old deer exclosures to experimentally assess the effects of deer on species diversity (H'), richness (SR), phylogenetic community structure and phylogenetic diversity in paired browsed (control) and unbrowsed (exclosed) plots. Additionally, we developed a deer-browsing susceptibility index (DBSI) to assess the vulnerability of local species to deer. Deer browsing caused a 12 % reduction in H' and 17 % reduction in SR, consistent with previous studies. Furthermore, browsing reduced phylogenetic diversity by 63 %, causing significant phylogenetic clustering. Overall, graminoids were the least vulnerable to deer browsing based on DBSI calculations. These findings demonstrate that deer are a significant driver of plant community assembly due to their role as a selective browser, or more generally, as a biotic filter. This study highlights the importance of knowledge about the plant tree of life in assessing the effects of biotic filters on plant communities. Application of such knowledge has considerable potential to advance our understanding of plant community assembly. Published by Oxford University Press on behalf of the Annals of Botany Company.

  14. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  15. Diversity structure of culturable bacteria isolated from the Fildes Peninsula (King George Island, Antarctica): A phylogenetic analysis perspective.

    Science.gov (United States)

    González-Rocha, Gerardo; Muñoz-Cartes, Gabriel; Canales-Aguirre, Cristian B; Lima, Celia A; Domínguez-Yévenes, Mariana; Bello-Toledo, Helia; Hernández, Cristián E

    2017-01-01

    It has been proposed that Antarctic environments select microorganisms with unique biochemical adaptations, based on the tenet 'Everything is everywhere, but, the environment selects' by Baas-Becking. However, this is a hypothesis that has not been extensively evaluated. This study evaluated the fundamental prediction contained in this hypothesis-in the sense that species are structured in the landscape according to their local habitats-, using as study model the phylogenetic diversity of the culturable bacteria of Fildes Peninsula (King George Island, Antarctica). Eighty bacterial strains isolated from 10 different locations in the area, were recovered. Based on phylogenetic analysis of 16S rRNA gene sequences, the isolates were grouped into twenty-six phylotypes distributed in three main clades, of which only six are exclusive to Antarctica. Results showed that phylotypes do not group significantly by habitat type; however, local habitat types had phylogenetic signal, which support the phylogenetic niche conservatism hypothesis and not a selective role of the environment like the Baas-Becking hypothesis suggests. We propose that, more than habitat selection resulting in new local adaptations and diversity, local historical colonization and species sorting (i.e. differences in speciation and extinction rates that arise by interaction of species level traits with the environment) play a fundamental role on the culturable bacterial diversity in Antarctica.

  16. A phylogenetic perspective on species diversity, β-diversity and biogeography for the microbial world.

    Science.gov (United States)

    Barberán, Albert; Casamayor, Emilio O

    2014-12-01

    There is an increasing interest to combine phylogenetic data with distributional and ecological records to assess how natural communities arrange under an evolutionary perspective. In the microbial world, there is also a need to go beyond the problematic species definition to deeply explore ecological patterns using genetic data. We explored links between evolution/phylogeny and community ecology using bacterial 16S rRNA gene information from a high-altitude lakes district data set. We described phylogenetic community composition, spatial distribution, and β-diversity and biogeographical patterns applying evolutionary relatedness without relying on any particular operational taxonomic unit definition. High-altitude lakes districts usually contain a large mosaic of highly diverse small water bodies and conform a fine biogeographical model of spatially close but environmentally heterogeneous ecosystems. We sampled 18 lakes in the Pyrenees with a selection criteria focused on capturing the maximum environmental variation within the smallest geographical area. The results showed highly diverse communities nonrandomly distributed with phylogenetic β-diversity patterns mainly shaped by the environment and not by the spatial distance. Community similarity based on both bacterial taxonomic composition and phylogenetic β-diversity shared similar patterns and was primarily structured by similar environmental drivers. We observed a positive relationship between lake area and phylogenetic diversity with a slope consistent with highly dispersive planktonic organisms. The phylogenetic approach incorporated patterns of common ancestry into bacterial community analysis and emerged as a very convenient analytical tool for direct inter- and intrabiome biodiversity comparisons and sorting out microbial habitats with potential application in conservation studies. © 2014 John Wiley & Sons Ltd.

  17. Continental scale patterns and predictors of fern richness and phylogenetic diversity

    Directory of Open Access Journals (Sweden)

    Nathalie eNagalingum

    2015-04-01

    Full Text Available Because ferns have a wide range of habitat preferences and are widely distributed, they are an ideal group for understanding how diversity is distributed. Here we examine fern diversity on a broad-scale using standard and corrected richness measures as well as phylogenetic indices; in addition we determine the environmental predictors of each diversity metric. Using the combined records of Australian herbaria, a dataset of over 60,000 records was obtained for 89 genera to infer richness. A phylogenetic tree of all the genera was constructed and combined with the herbarium records to obtain phylogenetic diversity patterns. A hotspot of both taxic and phylogenetic diversity occurs in the Wet Tropics of northeastern Australia. Although considerable diversity is distributed along the eastern coast, some important regions of diversity are identified only after sample-standardization of richness and through the phylogenetic metric. Of all of the metrics, annual precipitation was identified as the most explanatory variable, in part, in agreement with global and regional fern studies. Precipitation was combined with a different variable for each different metric. For corrected richness, precipitation is combined with temperature seasonality, while correlation of phylogenetic diversity to precipitation plus radiation indicates support for the species-energy hypothesis. Significantly high and significantly low phylogenetic diversity were found in geographically separate areas. These areas are correlated with different climatic conditions such as seasonality in precipitation. The use of phylogenetic metrics identifies additional areas of significant diversity, some of which have not been revealed using traditional taxonomic analyses, suggesting that different ecological and evolutionary processes have operated over the continent. Our study demonstrates that it is possible and vital to incorporate evolutionary metrics when inferring biodiversity hotspots

  18. Turnover of plant lineages shapes herbivore phylogenetic beta diversity along ecological gradients.

    Science.gov (United States)

    Pellissier, Loïc; Ndiribe, Charlotte; Dubuis, Anne; Pradervand, Jean-Nicolas; Salamin, Nicolas; Guisan, Antoine; Rasmann, Sergio

    2013-05-01

    Understanding drivers of biodiversity patterns is of prime importance in this era of severe environmental crisis. More diverse plant communities have been postulated to represent a larger functional trait-space, more likely to sustain a diverse assembly of herbivore species. Here, we expand this hypothesis to integrate environmental, functional and phylogenetic variation of plant communities as factors explaining the diversity of lepidopteran assemblages along elevation gradients in the Swiss Western Alps. According to expectations, we found that the association between butterflies and their host plants is highly phylogenetically structured. Multiple regression analyses showed the combined effect of climate, functional traits and phylogenetic diversity in structuring butterfly communities. Furthermore, we provide the first evidence that plant phylogenetic beta diversity is the major driver explaining butterfly phylogenetic beta diversity. Along ecological gradients, the bottom up control of herbivore diversity is thus driven by phylogenetically structured turnover of plant traits as well as environmental variables. © 2013 Blackwell Publishing Ltd/CNRS.

  19. Dimensions of biodiversity loss: Spatial mismatch in land-use impacts on species, functional and phylogenetic diversity of European bees.

    Science.gov (United States)

    De Palma, Adriana; Kuhlmann, Michael; Bugter, Rob; Ferrier, Simon; Hoskins, Andrew J; Potts, Simon G; Roberts, Stuart P M; Schweiger, Oliver; Purvis, Andy

    2017-12-01

    Agricultural intensification and urbanization are important drivers of biodiversity change in Europe. Different aspects of bee community diversity vary in their sensitivity to these pressures, as well as independently influencing ecosystem service provision (pollination). To obtain a more comprehensive understanding of human impacts on bee diversity across Europe, we assess multiple, complementary indices of diversity. One Thousand four hundred and forty six sites across Europe. We collated data on bee occurrence and abundance from the published literature and supplemented them with the PREDICTS database. Using Rao's Quadratic Entropy, we assessed how species, functional and phylogenetic diversity of 1,446 bee communities respond to land-use characteristics including land-use class, cropland intensity, human population density and distance to roads. We combined these models with statistically downscaled estimates of land use in 2005 to estimate and map-at a scale of approximately 1 km 2 -the losses in diversity relative to semi-natural/natural baseline (the predicted diversity of an uninhabited grid square, consisting only of semi-natural/natural vegetation). We show that-relative to the predicted local diversity in uninhabited semi-natural/natural habitat-half of all EU27 countries have lost over 10% of their average local species diversity and two-thirds of countries have lost over 5% of their average local functional and phylogenetic diversity. All diversity measures were generally lower in pasture and higher-intensity cropland than in semi-natural/natural vegetation, but facets of diversity showed less consistent responses to human population density. These differences have led to marked spatial mismatches in losses: losses in phylogenetic diversity were in some areas almost 20 percentage points (pp.) more severe than losses in species diversity, but in other areas losses were almost 40 pp. less severe. These results highlight the importance of exploring

  20. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  1. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  2. Phylogenetic and Functional Diversity of Fleshy-Fruited Plants Are Positively Associated with Seedling Diversity in a Tropical Montane Forest

    Directory of Open Access Journals (Sweden)

    Marcia C. Muñoz

    2017-08-01

    Full Text Available Mutualistic interactions between plants and animals can affect both plant and animal communities, and potentially leave imprints on plant demography. Yet, no study has simultaneously tested how trait variation in plant resources shapes the diversity of animal consumers, and how these interactions influence seedling recruitment. Here, we analyzed whether (i phylogenetic diversity and functional diversity of fruiting plants were correlated with the corresponding diversity of frugivorous birds, and (ii whether phylogenetic diversity and functional identity of plant and bird communities influenced the corresponding diversity and identity of seedling communities. We recorded mutualistic interactions between fleshy-fruited plants and frugivorous birds and seedling communities in 10 plots along an elevational gradient in the Colombian Andes. We built a phylogeny for plants/seedlings and birds and measured relevant morphological plant and bird traits that influence plant-bird interactions and seedling recruitment. We found that phylogenetic diversity and functional diversity of frugivorous birds were positively associated with the corresponding diversities of fruiting plants, consistent with a bottom-up effect of plants on birds. Moreover, the phylogenetic diversity of seedlings was related to the phylogenetic diversity of plants, but was unrelated to the phylogenetic diversity of frugivorous birds, suggesting that top-down effects of animals on seedlings were weak. Mean seed mass of seedling communities was positively associated with the mean fruit mass of plants, but was not associated with the mean avian body mass in the frugivore communities. Our study shows that variation in the traits of fleshy-fruited plants was associated with the diversity of frugivorous birds and affected the future trajectory of seedling recruitment, whereas the morphological traits of animal seed dispersers were unrelated to the phylogenetic and functional structure of

  3. Fast Computations for Measures of Phylogenetic Beta Diversity.

    Directory of Open Access Journals (Sweden)

    Constantinos Tsirogiannis

    Full Text Available For many applications in ecology, it is important to examine the phylogenetic relations between two communities of species. More formally, let [Formula: see text] be a phylogenetic tree and let A and B be two samples of its tips, representing the examined communities. We want to compute a value that expresses the phylogenetic diversity between A and B in [Formula: see text]. There exist several measures that can do this; these are the so-called phylogenetic beta diversity (β-diversity measures. Two popular measures of this kind are the Community Distance (CD and the Common Branch Length (CBL. In most applications, it is not sufficient to compute the value of a beta diversity measure for two communities A and B; we also want to know if this value is relatively large or small compared to all possible pairs of communities in [Formula: see text] that have the same size. To decide this, the ideal approach is to compute a standardised index that involves the mean and the standard deviation of this measure among all pairs of species samples that have the same number of elements as A and B. However, no method exists for computing exactly and efficiently this index for CD and CBL. We present analytical expressions for computing the expectation and the standard deviation of CD and CBL. Based on these expressions, we describe efficient algorithms for computing the standardised indices of the two measures. Using standard algorithmic analysis, we provide guarantees on the theoretical efficiency of our algorithms. We implemented our algorithms and measured their efficiency in practice. Our implementations compute the standardised indices of CD and CBL in less than twenty seconds for a hundred pairs of samples on trees with 7 ⋅ 10(4 tips. Our implementations are available through the R package PhyloMeasures.

  4. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  5. Host specialization and phylogenetic diversity of Corynespora cassiicola.

    Science.gov (United States)

    Dixon, L J; Schlub, R L; Pernezny, K; Datnoff, L E

    2009-09-01

    The fungus Corynespora cassiicola is primarily found in the tropics and subtropics, and is widely diverse in substrate utilization and host association. Isolate characterization within C. cassiicola was undertaken to investigate how genetic diversity correlates with host specificity, growth rate, and geographic distribution. C. cassiicola isolates were collected from 68 different plant species in American Samoa, Brazil, Malaysia, and Micronesia, and Florida, Mississippi, and Tennessee within the United States. Phylogenetic analyses using four loci were performed with 143 Corynespora spp. isolates, including outgroup taxa obtained from culture collections: C. citricola, C. melongenae, C. olivacea, C. proliferata, C. sesamum, and C. smithii. Phylogenetic trees were congruent from the ribosomal DNA internal transcribed spacer region, two random hypervariable loci (caa5 and ga4), and the actin-encoding locus act1, indicating a lack of recombination within the species and asexual propagation. Fifty isolates were tested for pathogenicity on eight known C. cassiicola crop hosts: basil, bean, cowpea, cucumber, papaya, soybean, sweet potato, and tomato. Pathogenicity profiles ranged from one to four hosts, with cucumber appearing in 14 of the 16 profiles. Bootstrap analyses and Bayesian posterior probability values identified six statistically significant phylogenetic lineages. The six phylogenetic lineages correlated with host of origin, pathogenicity, and growth rate but not with geographic location. Common fungal genotypes were widely distributed geographically, indicating long-distance and global dispersal of clonal lineages. This research reveals an abundance of previously unrecognized genetic diversity within the species and provides evidence for host specialization on papaya.

  6. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities

    Directory of Open Access Journals (Sweden)

    Anthony Stuart Amend

    2015-02-01

    Full Text Available Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity. This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between phylogenetic diversity and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial phylogenetic diversity, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of sixty-six days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial phylogenetic diversity failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which phylogenetic diversity predicts ecosystem function will depend on environmental context.

  7. The Cladistic Basis for the Phylogenetic Diversity (PD Measure Links Evolutionary Features to Environmental Gradients and Supports Broad Applications of Microbial Ecology’s “Phylogenetic Beta Diversity” Framework

    Directory of Open Access Journals (Sweden)

    Rob Knight

    2009-11-01

    Full Text Available The PD measure of phylogenetic diversity interprets branch lengths cladistically to make inferences about feature diversity. PD calculations extend conventional specieslevel ecological indices to the features level. The “phylogenetic beta diversity” framework developed by microbial ecologists calculates PD-dissimilarities between community localities. Interpretation of these PD-dissimilarities at the feature level explains the framework’s success in producing ordinations revealing environmental gradients. An example gradients space using PD-dissimilarities illustrates how evolutionary features form unimodal response patterns to gradients. This features model supports new application of existing species-level methods that are robust to unimodal responses, plus novel applications relating to climate change, commercial products discovery, and community assembly.

  8. Evolutionary history determines how plant productivity responds to phylogenetic diversity and species richness

    Directory of Open Access Journals (Sweden)

    Mark A. Genung

    2014-03-01

    Full Text Available The relationship between biodiversity and ecosystem function has received a great deal of attention in ecological research and recent results, from re-analyses, suggest that ecosystem function improves with increases in phylogenetic diversity. However, many of these results have been generalized across a range of different species and clades, and plants with different evolutionary histories could display different relationships between biodiversity and ecosystem function. To experimentally test this hypothesis, we manipulated species richness and phylogenetic diversity using 26 species from two subgenera of the genus Eucalyptus (subgenus Eucalyptus and subgenus Symphyomyrtus. We found that plant biomass (a measurement of ecosystem function sometimes, but not always, responded to increases in species richness and phylogenetic diversity. Specifically, Symphyomyrtus plants showed a positive response while no comparable effect was observed for Eucalyptus plants, showing that responses to biodiversity can vary across different phylogenetic groups. Our results show that the impacts of evolutionary history may complicate the relationship between the diversity of plant communities and plant biomass.

  9. Incorporating phylogenetic information for the definition of floristic districts in hyper-diverse Amazon forests: implications for conservation

    NARCIS (Netherlands)

    Guevara, J.E.; Pitman, N.C.A.; ter Steege, H.; Mogollón, H.; Ceron, C.; Palacios, W.; Oleas, N.; Fine, P.V.A.

    2017-01-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the

  10. A comparative test of phylogenetic diversity indices.

    Science.gov (United States)

    Schweiger, Oliver; Klotz, Stefan; Durka, Walter; Kühn, Ingolf

    2008-09-01

    Traditional measures of biodiversity, such as species richness, usually treat species as being equal. As this is obviously not the case, measuring diversity in terms of features accumulated over evolutionary history provides additional value to theoretical and applied ecology. Several phylogenetic diversity indices exist, but their behaviour has not yet been tested in a comparative framework. We provide a test of ten commonly used phylogenetic diversity indices based on 40 simulated phylogenies of varying topology. We restrict our analysis to a topological fully resolved tree without information on branch lengths and species lists with presence-absence data. A total of 38,000 artificial communities varying in species richness covering 5-95% of the phylogenies were created by random resampling. The indices were evaluated based on their ability to meet a priori defined requirements. No index meets all requirements, but three indices turned out to be more suitable than others under particular conditions. Average taxonomic distinctness (AvTD) and intensive quadratic entropy (J) are calculated by averaging and are, therefore, unbiased by species richness while reflecting phylogeny per se well. However, averaging leads to the violation of set monotonicity, which requires that species extinction cannot increase the index. Total taxonomic distinctness (TTD) sums up distinctiveness values for particular species across the community. It is therefore strongly linked to species richness and reflects phylogeny per se weakly but satisfies set monotonicity. We suggest that AvTD and J are best applied to studies that compare spatially or temporally rather independent communities that potentially vary strongly in their phylogenetic composition-i.e. where set monotonicity is a more negligible issue, but independence of species richness is desired. In contrast, we suggest that TTD be used in studies that compare rather interdependent communities where changes occur more gradually by

  11. Using tree diversity to compare phylogenetic heuristics.

    Science.gov (United States)

    Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

    2009-04-29

    Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

  12. Ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses.

    Science.gov (United States)

    Fouquier, Jennifer; Rideout, Jai Ram; Bolyen, Evan; Chase, John; Shiffer, Arron; McDonald, Daniel; Knight, Rob; Caporaso, J Gregory; Kelley, Scott T

    2016-02-24

    Fungi play critical roles in many ecosystems, cause serious diseases in plants and animals, and pose significant threats to human health and structural integrity problems in built environments. While most fungal diversity remains unknown, the development of PCR primers for the internal transcribed spacer (ITS) combined with next-generation sequencing has substantially improved our ability to profile fungal microbial diversity. Although the high sequence variability in the ITS region facilitates more accurate species identification, it also makes multiple sequence alignment and phylogenetic analysis unreliable across evolutionarily distant fungi because the sequences are hard to align accurately. To address this issue, we created ghost-tree, a bioinformatics tool that integrates sequence data from two genetic markers into a single phylogenetic tree that can be used for diversity analyses. Our approach starts with a "foundation" phylogeny based on one genetic marker whose sequences can be aligned across organisms spanning divergent taxonomic groups (e.g., fungal families). Then, "extension" phylogenies are built for more closely related organisms (e.g., fungal species or strains) using a second more rapidly evolving genetic marker. These smaller phylogenies are then grafted onto the foundation tree by mapping taxonomic names such that each corresponding foundation-tree tip would branch into its new "extension tree" child. We applied ghost-tree to graft fungal extension phylogenies derived from ITS sequences onto a foundation phylogeny derived from fungal 18S sequences. Our analysis of simulated and real fungal ITS data sets found that phylogenetic distances between fungal communities computed using ghost-tree phylogenies explained significantly more variance than non-phylogenetic distances. The phylogenetic metrics also improved our ability to distinguish small differences (effect sizes) between microbial communities, though results were similar to non-phylogenetic

  13. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa.

    Science.gov (United States)

    Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel

    2015-01-01

    The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.

  14. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa

    Science.gov (United States)

    Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel

    2015-01-01

    The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation. PMID:25978319

  15. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa.

    Directory of Open Access Journals (Sweden)

    Julian Martin Corbelli

    Full Text Available The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD, functional (FBD and phylogenetic (PBD facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants from two contrasting biomes (subtropical forest and grassland and land uses (tree plantations and cropfields in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland, and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.

  16. Soil phosphorus heterogeneity promotes tree species diversity and phylogenetic clustering in a tropical seasonal rainforest.

    Science.gov (United States)

    Xu, Wumei; Ci, Xiuqin; Song, Caiyun; He, Tianhua; Zhang, Wenfu; Li, Qiaoming; Li, Jie

    2016-12-01

    The niche theory predicts that environmental heterogeneity and species diversity are positively correlated in tropical forests, whereas the neutral theory suggests that stochastic processes are more important in determining species diversity. This study sought to investigate the effects of soil nutrient (nitrogen and phosphorus) heterogeneity on tree species diversity in the Xishuangbanna tropical seasonal rainforest in southwestern China. Thirty-nine plots of 400 m 2 (20 × 20 m) were randomly located in the Xishuangbanna tropical seasonal rainforest. Within each plot, soil nutrient (nitrogen and phosphorus) availability and heterogeneity, tree species diversity, and community phylogenetic structure were measured. Soil phosphorus heterogeneity and tree species diversity in each plot were positively correlated, while phosphorus availability and tree species diversity were not. The trees in plots with low soil phosphorus heterogeneity were phylogenetically overdispersed, while the phylogenetic structure of trees within the plots became clustered as heterogeneity increased. Neither nitrogen availability nor its heterogeneity was correlated to tree species diversity or the phylogenetic structure of trees within the plots. The interspecific competition in the forest plots with low soil phosphorus heterogeneity could lead to an overdispersed community. However, as heterogeneity increase, more closely related species may be able to coexist together and lead to a clustered community. Our results indicate that soil phosphorus heterogeneity significantly affects tree diversity in the Xishuangbanna tropical seasonal rainforest, suggesting that deterministic processes are dominant in this tropical forest assembly.

  17. The mean and variance of phylogenetic diversity under rarefaction

    OpenAIRE

    Nipperess, David A.; Matsen, Frederick A.

    2013-01-01

    Phylogenetic diversity (PD) depends on sampling intensity, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD. We have derived exact formulae for t...

  18. Seed plant phylogenetic diversity and species richness in conservation planning within a global biodiversity hotspot in eastern Asia.

    Science.gov (United States)

    Li, Rong; Kraft, Nathan J B; Yu, Haiying; Li, Heng

    2015-12-01

    One of the main goals of conservation biology is to understand the factors shaping variation in biodiversity across the planet. This understanding is critical for conservation planners to be able to develop effective conservation strategies. Although many studies have focused on species richness and the protection of rare and endemic species, less attention has been paid to the protection of the phylogenetic dimension of biodiversity. We explored how phylogenetic diversity, species richness, and phylogenetic community structure vary in seed plant communities along an elevational gradient in a relatively understudied high mountain region, the Dulong Valley, in southeastern Tibet, China. As expected, phylogenetic diversity was well correlated with species richness among the elevational bands and among communities. At the community level, evergreen broad-leaved forests had the highest levels of species richness and phylogenetic diversity. Using null model analyses, we found evidence of nonrandom phylogenetic structure across the region. Evergreen broad-leaved forests were phylogenetically overdispersed, whereas other vegetation types tended to be phylogenetically clustered. We suggest that communities with high species richness or overdispersed phylogenetic structure should be a focus for biodiversity conservation within the Dulong Valley because these areas may help maximize the potential of this flora to respond to future global change. In biodiversity hotspots worldwide, we suggest that the phylogenetic structure of a community may serve as a useful measure of phylogenetic diversity in the context of conservation planning. © 2015 Society for Conservation Biology.

  19. High phylogenetic diversity is preserved in species-poor high-elevation temperate moth assemblages

    NARCIS (Netherlands)

    Zou, Yi; Sang, Weiguo; Hausmann, Axel; Axmacher, Jan Christoph

    2016-01-01

    Understanding the diversity and composition of species assemblages and identifying underlying biotic and abiotic determinants represent great ecological challenges. Addressing some of these issues, we investigated the α-diversity and phylogenetic composition of species-rich geometrid moth

  20. Evolution and Phylogenetic Diversity of Yam Species (Dioscorea spp.: Implication for Conservation and Agricultural Practices.

    Directory of Open Access Journals (Sweden)

    Marie Florence Sandrine Ngo Ngwe

    Full Text Available Yams (Dioscorea spp. consist of approximately 600 species. Presently, these species are threatened by genetic erosion due to many factors such as pest attacks and farming practices. In parallel, complex taxonomic boundaries in this genus makes it more challenging to properly address the genetic diversity of yam and manage its germplasm. As a first step toward evaluating and preserving the genetic diversity yam species, we use a phylogenetic diversity (PD approach that has the advantage to investigate phylogenetic relationships and test hypotheses of species monophyly while alleviating to the problem of ploidy variation within and among species. The Bayesian phylogenetic analysis of 62 accessions from 7 species from three regions of Cameroon showed that most Dioscorea sections were monophyletic, but species within sections were generally non-monophyletic. The wild species D. praehensilis and cultivated D. cayenensis were the species with the highest PD. At the opposite, D. esculenta has a low PD and future studies should focus on this species to properly address its conservation status. We also show that wild species show a stronger genetic structure than cultivated species, which potentially reflects the management of the yam germplasm by farmers. These findings show that phylogenetic diversity is a promising approach for an initial investigation of genetic diversity in a crop consisting of closely related species.

  1. Phylogenetic diversity of macromycetes and woody plants along an elevational gradient in Eastern Mexico

    Science.gov (United States)

    Marko Gomez-Hernandez; Guadalupe Williams-Linera; D. Jean Lodge; Roger Guevara; Eduardo Ruiz-Sanchez; Etelvina Gandara

    2016-01-01

    Phylogenetic information provides insight into the ecological and evolutionary processes that organize species assemblages. We compared patterns of phylogenetic diversity among macromycete and woody plant communities along a steep elevational gradient in eastern Mexico to better understand the evolutionary processes that structure their communities. Macrofungi and...

  2. Phylogenetic diversity of bacteria associated with toxic and non-toxic ...

    African Journals Online (AJOL)

    Phylogenetic diversity of bacteria associated with toxic and non-toxic strains of Alexandrium minutum. L Palacios, B Reguera, J Franco, I Marín. Abstract. Marine planktonic dinoflagellates are usually associated with bacteria, some of which seem to have a symbiotic relation with the dinoflagellate cells. The role of bacteria in ...

  3. Phylogenetic diversity and biogeography of the Mamiellophyceae lineage of eukaryotic phytoplankton across the oceans.

    Science.gov (United States)

    Monier, Adam; Worden, Alexandra Z; Richards, Thomas A

    2016-08-01

    High-throughput diversity amplicon sequencing of marine microbial samples has revealed that members of the Mamiellophyceae lineage are successful phytoplankton in many oceanic habitats. Indeed, these eukaryotic green algae can dominate the picoplanktonic biomass, however, given the broad expanses of the oceans, their geographical distributions and the phylogenetic diversity of some groups remain poorly characterized. As these algae play a foundational role in marine food webs, it is crucial to assess their global distribution in order to better predict potential changes in abundance and community structure. To this end, we analyzed the V9-18S small subunit rDNA sequences deposited from the Tara Oceans expedition to evaluate the diversity and biogeography of these phytoplankton. Our results show that the phylogenetic composition of Mamiellophyceae communities is in part determined by geographical provenance, and do not appear to be influenced - in the samples recovered - by water depth, at least at the resolution possible with the V9-18S. Phylogenetic classification of Mamiellophyceae sequences revealed that the Dolichomastigales order encompasses more sequence diversity than other orders in this lineage. These results indicate that a large fraction of the Mamiellophyceae diversity has been hitherto overlooked, likely because of a combination of size fraction, sequencing and geographical limitations. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Decoupling phylogenetic and functional diversity to reveal hidden signals in community assembly

    Czech Academy of Sciences Publication Activity Database

    de Bello, Francesco; Šmilauer, P.; Diniz-Filho, J. A. F.; Carmona, C. P.; Lososová, Z.; Herben, Tomáš; Götzenberger, Lars

    2017-01-01

    Roč. 8, č. 10 (2017), s. 1200-1211 ISSN 2041-210X R&D Projects: GA ČR(CZ) GA16-15012S; GA ČR GB14-36079G EU Projects: European Commission(XE) 267243 Institutional support: RVO:67985939 Keywords : community ecology * phylogenetic diversity * functional diversity Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 5.708, year: 2016

  5. Diversity of chloroplast genome among local clones of cocoa (Theobroma cacao, L.) from Central Sulawesi

    Science.gov (United States)

    Suwastika, I. Nengah; Pakawaru, Nurul Aisyah; Rifka, Rahmansyah, Muslimin, Ishizaki, Yoko; Cruz, André Freire; Basri, Zainuddin; Shiina, Takashi

    2017-02-01

    Chloroplast genomes typically range in size from 120 to 170 kilo base pairs (kb), which relatively conserved among plant species. Recent evaluation on several species, certain unique regions showed high variability which can be utilized in the phylogenetic analysis. Many fragments of coding regions, introns, and intergenic spacers, such as atpB-rbcL, ndhF, rbcL, rpl16, trnH-psbA, trnL-F, trnS-G, etc., have been used for phylogenetic reconstructions at various taxonomic levels. Based on that status, we would like to analysis the diversity of chloroplast genome within species of local cacao (Theobroma cacao L.) from Central Sulawesi. Our recent data showed, there were more than 20 clones from local farming in Central Sulawesi, and it can be detected based on phenotypic and nuclear-genome-based characterization (RAPD- Random Amplified Polymorphic DNA and SSR- Simple Sequences Repeat) markers. In developing DNA marker for this local cacao, here we also included analysis based on the variation of chloroplast genome. At least several regions such as rpl32-TurnL, it can be considered as chloroplast markers on our local clone of cocoa. Furthermore, we could develop phylogenetic analysis in between clones of cocoa.

  6. Phylogenetic and Diversity Analysis of Dactylis glomerata Subspecies Using SSR and IT-ISJ Markers.

    Science.gov (United States)

    Yan, Defei; Zhao, Xinxin; Cheng, Yajuan; Ma, Xiao; Huang, Linkai; Zhang, Xinquan

    2016-10-31

    The genus Dactylis , an important forage crop, has a wide geographical distribution in temperate regions. While this genus is thought to include a single species, Dactylis glomerata , this species encompasses many subspecies whose relationships have not been fully characterized. In this study, the genetic diversity and phylogenetic relationships of nine representative Dactylis subspecies were examined using SSR and IT-ISJ markers. In total, 21 pairs of SSR primers and 15 pairs of IT-ISJ primers were used to amplify 295 polymorphic bands with polymorphic rates of 100%. The average polymorphic information contents (PICs) of SSR and IT-ISJ markers were 0.909 and 0.780, respectively. The combined data of the two markers indicated a high level of genetic diversity among the nine D. glomerata subspecies, with a Nei's gene diversity index value of 0.283 and Shannon's diversity of 0.448. Preliminarily phylogenetic analysis results revealed that the 20 accessions could be divided into three groups (A, B, C). Furthermore, they could be divided into five clusters, which is similar to the structure analysis with K = 5. Phylogenetic placement in these three groups may be related to the distribution ranges and the climate types of the subspecies in each group. Group A contained eight accessions of four subspecies, originating from the west Mediterranean, while Group B contained seven accessions of three subspecies, originating from the east Mediterranean.

  7. Exploring the determinants of phylogenetic diversity and assemblage structure in conifers across temporal, spatial, and taxonomic scales

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Borchsenius, Finn; Sandel, Brody Steven

    -environmental models are important elements in this framework. Here, we integrate both types of data in order to explore the determinants of forest tree diversity using the conifers as a model group. Conifers are an old, diverse (ca. 650 spp. in 6 families) and widespread group of woody plants of high ecological...... and economic importance. They are better studied than most other globally distributed groups of forest trees, allowing integrative studies with high phylogenetic and spatial resolution. We analyse phylogenetic diversity, assemblage structure, and diversification rates for regional conifer assemblages...

  8. Phylogenetic diversity and ecological pattern of ammonia-oxidizing archaea in the surface sediments of the western Pacific.

    Science.gov (United States)

    Cao, Huiluo; Hong, Yiguo; Li, Meng; Gu, Ji-Dong

    2011-11-01

    The phylogenetic diversity of ammonia-oxidizing archaea (AOA) was surveyed in the surface sediments from the northern part of the South China Sea (SCS). The distribution pattern of AOA in the western Pacific was discussed through comparing the SCS with other areas in the western Pacific including Changjiang Estuary and the adjacent East China Sea where high input of anthropogenic nitrogen was evident, the tropical West Pacific Continental Margins close to the Philippines, the deep-sea methane seep sediments in the Okhotsk Sea, the cold deep sea of Northeastern Japan Sea, and the hydrothermal field in the Southern Okinawa Trough. These various environments provide a wide spectrum of physical and chemical conditions for a better understanding of the distribution pattern and diversities of AOA in the western Pacific. Under these different conditions, the distinct community composition between shallow and deep-sea sediments was clearly delineated based on the UniFrac PCoA and Jackknife Environmental Cluster analyses. Phylogenetic analyses showed that a few ammonia-oxidizing archaeal subclades in the marine water column/sediment clade and endemic lineages were indicative phylotypes for some environments. Higher phylogenetic diversity was observed in the Philippines while lower diversity in the hydrothermal vent habitat. Water depth and possibly with other environmental factors could be the main driving forces to shape the phylogenetic diversity of AOA observed, not only in the SCS but also in the whole western Pacific. The multivariate regression tree analysis also supported this observation consistently. Moreover, the functions of current and other climate factors were also discussed in comparison of phylogenetic diversity. The information collectively provides important insights into the ecophysiological requirements of uncultured ammonia-oxidizing archaeal lineages in the western Pacific Ocean.

  9. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Science.gov (United States)

    Howard, Marion G; McDonald, William J F; Forster, Paul I; Kress, W John; Erickson, David; Faith, Daniel P; Shapcott, Alison

    2016-01-01

    Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ), Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD) measures as well as species richness (SR) for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD). Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness and higher than

  10. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Directory of Open Access Journals (Sweden)

    Marion G Howard

    Full Text Available Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ, Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD measures as well as species richness (SR for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD. Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness

  11. Trends over time in tree and seedling phylogenetic diversity indicate regional differences in forest biodiversity change.

    Science.gov (United States)

    Potter, Kevin M; Woodall, Christopher W

    2012-03-01

    Changing climate conditions may impact the short-term ability of forest tree species to regenerate in many locations. In the longer term, tree species may be unable to persist in some locations while they become established in new places. Over both time frames, forest tree biodiversity may change in unexpected ways. Using repeated inventory measurements five years apart from more than 7000 forested plots in the eastern United States, we tested three hypotheses: phylogenetic diversity is substantially different from species richness as a measure of biodiversity; forest communities have undergone recent changes in phylogenetic diversity that differ by size class, region, and seed dispersal strategy; and these patterns are consistent with expected early effects of climate change. Specifically, the magnitude of diversity change across broad regions should be greater among seedlings than in trees, should be associated with latitude and elevation, and should be greater among species with high dispersal capacity. Our analyses demonstrated that phylogenetic diversity and species richness are decoupled at small and medium scales and are imperfectly associated at large scales. This suggests that it is appropriate to apply indicators of biodiversity change based on phylogenetic diversity, which account for evolutionary relationships among species and may better represent community functional diversity. Our results also detected broadscale patterns of forest biodiversity change that are consistent with expected early effects of climate change. First, the statistically significant increase over time in seedling diversity in the South suggests that conditions there have become more favorable for the reproduction and dispersal of a wider variety of species, whereas the significant decrease in northern seedling diversity indicates that northern conditions have become less favorable. Second, we found weak correlations between seedling diversity change and latitude in both zones

  12. Phylogenetic congruence of lichenised fungi and algae is affected by spatial scale and taxonomic diversity

    Directory of Open Access Journals (Sweden)

    Hannah L. Buckley

    2014-09-01

    Full Text Available The role of species’ interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran’s eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners’ genetic variation. Different lichen taxa showed some variation in

  13. Phylogenetic congruence of lichenised fungi and algae is affected by spatial scale and taxonomic diversity.

    Science.gov (United States)

    Buckley, Hannah L; Rafat, Arash; Ridden, Johnathon D; Cruickshank, Robert H; Ridgway, Hayley J; Paterson, Adrian M

    2014-01-01

    The role of species' interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran's eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners' genetic variation. Different lichen taxa showed some variation in their phylogenetic congruence

  14. Tree phylogenetic diversity promotes host-parasitoid interactions.

    Science.gov (United States)

    Staab, Michael; Bruelheide, Helge; Durka, Walter; Michalski, Stefan; Purschke, Oliver; Zhu, Chao-Dong; Klein, Alexandra-Maria

    2016-07-13

    Evidence from grassland experiments suggests that a plant community's phylogenetic diversity (PD) is a strong predictor of ecosystem processes, even stronger than species richness per se This has, however, never been extended to species-rich forests and host-parasitoid interactions. We used cavity-nesting Hymenoptera and their parasitoids collected in a subtropical forest as a model system to test whether hosts, parasitoids, and their interactions are influenced by tree PD and a comprehensive set of environmental variables, including tree species richness. Parasitism rate and parasitoid abundance were positively correlated with tree PD. All variables describing parasitoids decreased with elevation, and were, except parasitism rate, dependent on host abundance. Quantitative descriptors of host-parasitoid networks were independent of the environment. Our study indicates that host-parasitoid interactions in species-rich forests are related to the PD of the tree community, which influences parasitism rates through parasitoid abundance. We show that effects of tree community PD are much stronger than effects of tree species richness, can cascade to high trophic levels, and promote trophic interactions. As during habitat modification phylogenetic information is usually lost non-randomly, even species-rich habitats may not be able to continuously provide the ecosystem process parasitism if the evolutionarily most distinct plant lineages vanish. © 2016 The Author(s).

  15. Elevational gradients in phylogenetic structure of ant communities reveal the interplay of biotic and abiotic constraints on diversity

    DEFF Research Database (Denmark)

    Machac, Antonin; Janda, Milan; Dunn, Robert R.

    2011-01-01

    A central focus of ecology and biogeography is to determine the factors that govern spatial variation in biodiversity. Here, we examined patterns of ant diversity along climatic gradients in three temperate montane systems: Great Smoky Mountains National Park (USA), Chiricahua Mountains (USA......), and Vorarlberg (Austria). To identify the factors which potentially shape these elevational diversity gradients, we analyzed patterns of community phylogenetic structure (i.e. the evolutionary relationships among species coexisting in local communities). We found that species at low-elevation sites tended...... to be evenly dispersed across phylogeny, suggesting that these communities are structured by interspecific competition. In contrast, species occurring at high-elevation sites tended to be more closely related than expected by chance, implying that these communities are structured primarily by environmental...

  16. Microbial network, phylogenetic diversity and community membership in the active layer across a permafrost thaw gradient.

    Science.gov (United States)

    Mondav, Rhiannon; McCalley, Carmody K; Hodgkins, Suzanne B; Frolking, Steve; Saleska, Scott R; Rich, Virginia I; Chanton, Jeff P; Crill, Patrick M

    2017-08-01

    Biogenic production and release of methane (CH 4 ) from thawing permafrost has the potential to be a strong source of radiative forcing. We investigated changes in the active layer microbial community of three sites representative of distinct permafrost thaw stages at a palsa mire in northern Sweden. The palsa site (intact permafrost and low radiative forcing signature) had a phylogenetically clustered community dominated by Acidobacteria and Proteobacteria. The bog (thawing permafrost and low radiative forcing signature) had lower alpha diversity and midrange phylogenetic clustering, characteristic of ecosystem disturbance affecting habitat filtering. Hydrogenotrophic methanogens and Acidobacteria dominated the bog shifting from palsa-like to fen-like at the waterline. The fen (no underlying permafrost, high radiative forcing signature) had the highest alpha, beta and phylogenetic diversity, was dominated by Proteobacteria and Euryarchaeota and was significantly enriched in methanogens. The Mire microbial network was modular with module cores consisting of clusters of Acidobacteria, Euryarchaeota or Xanthomonodales. Loss of underlying permafrost with associated hydrological shifts correlated to changes in microbial composition, alpha, beta and phylogenetic diversity associated with a higher radiative forcing signature. These results support the complex role of microbial interactions in mediating carbon budget changes and climate feedback in response to climate forcing. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  18. Partitioning the impact of environment and spatial structure on alpha and beta components of taxonomic, functional, and phylogenetic diversity in European ants.

    Science.gov (United States)

    Arnan, Xavier; Cerdá, Xim; Retana, Javier

    2015-01-01

    We analyze the relative contribution of environmental and spatial variables to the alpha and beta components of taxonomic (TD), phylogenetic (PD), and functional (FD) diversity in ant communities found along different climate and anthropogenic disturbance gradients across western and central Europe, in order to assess the mechanisms structuring ant biodiversity. To this aim we calculated alpha and beta TD, PD, and FD for 349 ant communities, which included a total of 155 ant species; we examined 10 functional traits and phylogenetic relatedness. Variation partitioning was used to examine how much variation in ant diversity was explained by environmental and spatial variables. Autocorrelation in diversity measures and each trait's phylogenetic signal were also analyzed. We found strong autocorrelation in diversity measures. Both environmental and spatial variables significantly contributed to variation in TD, PD, and FD at both alpha and beta scales; spatial structure had the larger influence. The different facets of diversity showed similar patterns along environmental gradients. Environment explained a much larger percentage of variation in FD than in TD or PD. All traits demonstrated strong phylogenetic signals. Our results indicate that environmental filtering and dispersal limitations structure all types of diversity in ant communities. Strong dispersal limitations appear to have led to clustering of TD, PD, and FD in western and central Europe, probably because different historical and evolutionary processes generated different pools of species. Remarkably, these three facets of diversity showed parallel patterns along environmental gradients. Trait-mediated species sorting and niche conservatism appear to structure ant diversity, as evidenced by the fact that more variation was explained for FD and that all traits had strong phylogenetic signals. Since environmental variables explained much more variation in FD than in PD, functional diversity should be a

  19. Structure and phylogenetic diversity of post-fire ectomycorrhizal communities of maritime pine.

    Science.gov (United States)

    Rincón, A; Santamaría, B P; Ocaña, L; Verdú, M

    2014-02-01

    Environmental disturbances define the diversity and assemblage of species, affecting the functioning of ecosystems. Fire is a major disturbance of Mediterranean pine forests. Pines are highly dependent on the ectomycorrhizal (EM) fungal symbiosis, which is critical for tree recruitment under primary succession. To determine the effects of time since fire on the structure and recovery of EM fungal communities, we surveyed the young Pinus pinaster regenerate in three sites differing in the elapsed time after the last fire event. Pine roots were collected, and EM fungi characterized by sequencing the internal transcribed spacer (ITS) and the large subunit (LSU) regions of the nuclear ribosomal (nr)-DNA. The effects of the elapsed time after fire on the EM community structure (richness, presence/absence of fungi, phylogenetic diversity) and on soil properties were analysed.Fungal richness decreased with the elapsed time since the fire; although, the phylogenetic diversity of the EM community increased. Soil properties were different depending on the elapsed time after fire and particularly, the organic matter, carbon-to-nitrogen (C/N) ratio, nitrogen and iron significantly correlated with the assemblage of fungal species. Ascomycetes, particularly Tuberaceae and Pezizales, were significantly over-represented on saplings in the burned site. On seedlings, a significant over-representation of Rhizopogonaceae and Atheliaceae was observed in the most recently burned site, while other fungi (i.e. Cortinariaceae) were significantly under-represented. Our results are consistent with the hypothesis that fire can act as a selective agent by printing a phylogenetic signal on the EM fungal communities associated with naturally regenerated pines, pointing out to some groups as potential fire-adapted fungi.

  20. Phylogenetic analysis of local-scale tree soil associations in a lowland moist tropical forest.

    Directory of Open Access Journals (Sweden)

    Laura A Schreeg

    Full Text Available BACKGROUND: Local plant-soil associations are commonly studied at the species-level, while associations at the level of nodes within a phylogeny have been less well explored. Understanding associations within a phylogenetic context, however, can improve our ability to make predictions across systems and can advance our understanding of the role of evolutionary history in structuring communities. METHODOLOGY/PRINCIPAL FINDINGS: Here we quantified evolutionary signal in plant-soil associations using a DNA sequence-based community phylogeny and several soil variables (e.g., extractable phosphorus, aluminum and manganese, pH, and slope as a proxy for soil water. We used published plant distributional data from the 50-ha plot on Barro Colorado Island (BCI, Republic of Panamá. Our results suggest some groups of closely related species do share similar soil associations. Most notably, the node shared by Myrtaceae and Vochysiaceae was associated with high levels of aluminum, a potentially toxic element. The node shared by Apocynaceae was associated with high extractable phosphorus, a nutrient that could be limiting on a taxon specific level. The node shared by the large group of Laurales and Magnoliales was associated with both low extractable phosphorus and with steeper slope. Despite significant node-specific associations, this study detected little to no phylogeny-wide signal. We consider the majority of the 'traits' (i.e., soil variables evaluated to fall within the category of ecological traits. We suggest that, given this category of traits, phylogeny-wide signal might not be expected while node-specific signals can still indicate phylogenetic structure with respect to the variable of interest. CONCLUSIONS: Within the BCI forest dynamics plot, distributions of some plant taxa are associated with local-scale differences in soil variables when evaluated at individual nodes within the phylogenetic tree, but they are not detectable by phylogeny

  1. Phylogenetic diversity of ceftriaxone resistance and the presence of extended-spectrum β-lactamase genes in the culturable soil resistome.

    Science.gov (United States)

    Pagaling, Eulyn; Gatica, Joao; Yang, Kun; Cytryn, Eddie; Yan, Tao

    2016-09-01

    The aim of this study was to determine the phylogenetic diversity of ceftriaxone resistance and the presence of known extended-spectrum β-lactamase (ESBL) genes in culturable soil resistomes. Libraries of soil bacterial isolates resistant to ceftriaxone were established from six physicochemically diverse soils collected in Hawaii (USA) and Israel. The phylogenetic affiliation, ceftriaxone and multidrug resistance levels, and presence of known ESBL genes of the isolates were determined. The soil bacterial isolates were phylogenetically grouped with the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes and Bacteroidetes. Ceftriaxone minimum inhibitory concentrations (MICs) largely followed the phylogeny structure and higher levels of ceftriaxone resistance corresponded to higher multidrug resistance. Three distinct blaTEM variants were detected in soil bacterial isolates belonging to nine different genera. In conclusion, the culturable soil resistomes for ceftriaxone exhibited high phylogenetic diversity and multidrug resistance. blaTEM was the only known ESBL detected in the soil resistomes, and its distribution in different phylogenetic groups suggests its ubiquitous presence and/or possible horizontal gene transfer within the soil microbiomes. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  2. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    KAUST Repository

    Miyake, Sou

    2016-03-14

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  3. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    Science.gov (United States)

    Miyake, Sou; Ngugi, David K.; Stingl, Ulrich

    2016-01-01

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  4. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    KAUST Repository

    Miyake, Sou; Ngugi, David; Stingl, Ulrich

    2016-01-01

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  5. Community phylogenetic diversity of cyanobacterial mats associated with geothermal springs along a tropical intertidal gradient.

    Science.gov (United States)

    Jing, Hongmei; Lacap, Donnabella C; Lau, Chui Yim; Pointing, Stephen B

    2006-04-01

    The 16S rRNA gene-defined bacterial diversity of tropical intertidal geothermal vents subject to varying degrees of seawater inundation was investigated. Shannon-Weaver diversity estimates of clone library-derived sequences revealed that the hottest pools located above the mean high-water mark that did not experience seawater inundation were most diverse, followed by those that were permanently submerged below the mean low-water mark. Pools located in the intertidal were the least biodiverse, and this is attributed to the fluctuating conditions caused by periodic seawater inundation rather than physicochemical conditions per se. Phylogenetic analysis revealed that a ubiquitous Oscillatoria-like phylotype accounted for 83% of clones. Synechococcus-like phylotypes were also encountered at each location, whilst others belonging to the Chroococcales, Oscillatoriales, and other non-phototrophic bacteria occurred only at specific locations along the gradient. All cyanobacterial phylotypes displayed highest phylogenetic affinity to terrestrial thermophilic counterparts rather than marine taxa.

  6. Factors shaping bacterial phylogenetic and functional diversity in coastal waters of the NW Mediterranean Sea

    Science.gov (United States)

    Boras, Julia A.; Vaqué, Dolors; Maynou, Francesc; Sà, Elisabet L.; Weinbauer, Markus G.; Sala, Maria Montserrat

    2015-03-01

    To evaluate the main factors shaping bacterioplankton phylogenetic and functional diversity in marine coastal waters, we carried out a two-year study based on a monthly sampling in Blanes Bay (NW Mediterranean). We expected the key factors driving bacterial diversity to be (1) temperature and nutrient concentration, together with chlorophyll a concentration as an indicator of phytoplankton biomass and, hence, a carbon source for bacteria (here called bottom-up factors), and (2) top-down pressure (virus- and protist-mediated mortality of bacteria). Phylogenetic diversity was analyzed by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA. Functional diversity was assessed by using monomeric carbon sources in Biolog EcoPlates and by determining the activity of six extracellular enzymes. Our results indicate that the bacterial phylogenetic and functional diversity in this coastal system is shaped mainly by bottom-up factors. A dendrogram analysis of the DGGE banding patterns revealed three main sample clusters. Two clusters differed significantly in temperature, nitrate and chlorophyll a concentration, and the third was characterized by the highest losses of bacterial production due to viral lysis detected over the whole study period. Protistan grazing had no effect on bacterial functional diversity, since there were no correlations between protist-mediated mortality (PMM) and extracellular enzyme activities, and utilization of only two out of the 31 carbon sources (N-acetyl-D-glucosamine and α-cyclodextrin) was correlated with PMM. In contrast, virus-mediated mortality correlated with changes in the percentage of use of four carbon sources, and also with specific leu-aminopeptidase and β-glucosidase activity. This suggests that viral lysate provides a pool of labile carbon sources, presumably including amino acids and glucose, which may inhibit proteolytic and glucosidic activity. Our results indicate that bottom-up factors play a more important role than

  7. Disentangling environmental and spatial effects on phylogenetic structure of angiosperm tree communities in China.

    Science.gov (United States)

    Qian, Hong; Chen, Shengbin; Zhang, Jin-Long

    2017-07-17

    Niche-based and neutrality-based theories are two major classes of theories explaining the assembly mechanisms of local communities. Both theories have been frequently used to explain species diversity and composition in local communities but their relative importance remains unclear. Here, we analyzed 57 assemblages of angiosperm trees in 0.1-ha forest plots across China to examine the effects of environmental heterogeneity (relevant to niche-based processes) and spatial contingency (relevant to neutrality-based processes) on phylogenetic structure of angiosperm tree assemblages distributed across a wide range of environment and space. Phylogenetic structure was quantified with six phylogenetic metrics (i.e., phylogenetic diversity, mean pairwise distance, mean nearest taxon distance, and the standardized effect sizes of these three metrics), which emphasize on different depths of evolutionary histories and account for different degrees of species richness effects. Our results showed that the variation in phylogenetic metrics explained independently by environmental variables was on average much greater than that explained independently by spatial structure, and the vast majority of the variation in phylogenetic metrics was explained by spatially structured environmental variables. We conclude that niche-based processes have played a more important role than neutrality-based processes in driving phylogenetic structure of angiosperm tree species in forest communities in China.

  8. AST: an automated sequence-sampling method for improving the taxonomic diversity of gene phylogenetic trees.

    Science.gov (United States)

    Zhou, Chan; Mao, Fenglou; Yin, Yanbin; Huang, Jinling; Gogarten, Johann Peter; Xu, Ying

    2014-01-01

    A challenge in phylogenetic inference of gene trees is how to properly sample a large pool of homologous sequences to derive a good representative subset of sequences. Such a need arises in various applications, e.g. when (1) accuracy-oriented phylogenetic reconstruction methods may not be able to deal with a large pool of sequences due to their high demand in computing resources; (2) applications analyzing a collection of gene trees may prefer to use trees with fewer operational taxonomic units (OTUs), for instance for the detection of horizontal gene transfer events by identifying phylogenetic conflicts; and (3) the pool of available sequences is biased towards extensively studied species. In the past, the creation of subsamples often relied on manual selection. Here we present an Automated sequence-Sampling method for improving the Taxonomic diversity of gene phylogenetic trees, AST, to obtain representative sequences that maximize the taxonomic diversity of the sampled sequences. To demonstrate the effectiveness of AST, we have tested it to solve four problems, namely, inference of the evolutionary histories of the small ribosomal subunit protein S5 of E. coli, 16 S ribosomal RNAs and glycosyl-transferase gene family 8, and a study of ancient horizontal gene transfers from bacteria to plants. Our results show that the resolution of our computational results is almost as good as that of manual inference by domain experts, hence making the tool generally useful to phylogenetic studies by non-phylogeny specialists. The program is available at http://csbl.bmb.uga.edu/~zhouchan/AST.php.

  9. Phylogenetic diversity and biological activity of culturable Actinobacteria isolated from freshwater fish gut microbiota.

    Science.gov (United States)

    Jami, Mansooreh; Ghanbari, Mahdi; Kneifel, Wolfgang; Domig, Konrad J

    2015-06-01

    The diversity of Actinobacteria isolated from the gut microbiota of two freshwater fish species namely Schizothorax zarudnyi and Schizocypris altidorsalis was investigated employing classical cultivation techniques, repetitive sequence-based PCR (rep-PCR), partial and full 16S rDNA sequencing followed by phylogenetic analysis. A total of 277 isolates were cultured by applying three different agar media. Based on rep-PCR profile analysis a subset of 33 strains was selected for further phylogenetic investigations, antimicrobial activity testing and diversity analysis of secondary-metabolite biosynthetic genes. The identification based on 16S rRNA gene sequencing revealed that the isolates belong to eight genera distributed among six families. At the family level, 72% of the 277 isolates belong to the family Streptomycetaceae. Among the non-streptomycetes group, the most dominant group could be allocated to the family of Pseudonocardiaceae followed by the members of Micromonosporaceae. Phylogenetic analysis clearly showed that many of the isolates in the genera Streptomyces, Saccharomonospora, Micromonospora, Nocardiopsis, Arthrobacter, Kocuria, Microbacterium and Agromyces formed a single and distinct cluster with the type strains. Notably, there is no report so far about the occurrence of these Actinobacteria in the microbiota of freshwater fish. Of the 33 isolates, all the strains exhibited antibacterial activity against a set of tested human and fish pathogenic bacteria. Then, to study their associated potential capacity to synthesize diverse bioactive natural products, diversity of genes associated with secondary-metabolite biosynthesis including PKS I, PKS II, NRPS, the enzyme PhzE of the phenazine pathways, the enzyme dTGD of 6-deoxyhexoses glycosylation pathway, the enzyme Halo of halogenation pathway and the enzyme CYP in polyene polyketide biosynthesis were investigated among the isolates. All the strains possess at least two types of the investigated

  10. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  11. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  12. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  13. Characteristics of phylogenetic diversity in airborne bacterial populations in China

    Science.gov (United States)

    Chaudhry, Zahra; Santarpia, Joshua L.; Martins, J. V.

    2011-05-01

    Considering their potential implications for human health, agricultural productivity, and ecosystem stability, surprisingly little is known about the composition or dynamics of the atmosphere's biological aerosols. The few studies that have examined phylogenetic diversity in China focused on a single sampling period, whereas this study spans 3 months and includes over 300 samples. The 300+ samples were categorized by month and direction of their back-trajectory. DNA extraction was carried out on the pooled samples in a quantitative manner to allow for comparison between the amount of extracted material and the amount of initial total aerosol mass. Within an individual month, samples originating from similar land types and approximately equidistant to the sampling location exhibited similar diversity, whereas samples originating from much greater distances and from different land types included phyla unique to that location. Phyla from the same origin also varied from one month to the next. The biological diversity found from the Phylochips reinforces the hypothesis that air samples carry a biological record of their history.

  14. Phylogenetic and structural diversity in the feline leukemia virus env gene.

    Directory of Open Access Journals (Sweden)

    Shinya Watanabe

    Full Text Available Feline leukemia virus (FeLV belongs to the genus Gammaretrovirus, and causes a variety of neoplastic and non-neoplastic diseases in cats. Alteration of viral env sequences is thought to be associated with disease specificity, but the way in which genetic diversity of FeLV contributes to the generation of such variants in nature is poorly understood. We isolated FeLV env genes from naturally infected cats in Japan and analyzed the evolutionary dynamics of these genes. Phylogenetic reconstructions separated our FeLV samples into three distinct genetic clusters, termed Genotypes I, II, and III. Genotype I is a major genetic cluster and can be further classified into Clades 1-7 in Japan. Genotypes were correlated with geographical distribution; Genotypes I and II were distributed within Japan, whilst FeLV samples from outside Japan belonged to Genotype III. These results may be due to geographical isolation of FeLVs in Japan. The observed structural diversity of the FeLV env gene appears to be caused primarily by mutation, deletion, insertion and recombination, and these variants may be generated de novo in individual cats. FeLV interference assay revealed that FeLV genotypes did not correlate with known FeLV receptor subgroups. We have identified the genotypes which we consider to be reliable for evaluating phylogenetic relationships of FeLV, which embrace the high structural diversity observed in our sample. Overall, these findings extend our understanding of Gammaretrovirus evolutionary patterns in the field, and may provide a useful basis for assessing the emergence of novel strains and understanding the molecular mechanisms of FeLV transmission in cats.

  15. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.

    Directory of Open Access Journals (Sweden)

    Jianbin Liu

    Full Text Available The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau.

  16. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Science.gov (United States)

    Erickson, David L.; Jones, Frank A.; Swenson, Nathan G.; Pei, Nancai; Bourg, Norman A.; Chen, Wenna; Davies, Stuart J.; Ge, Xue-jun; Hao, Zhanqing; Howe, Robert W.; Huang, Chun-Lin; Larson, Andrew J.; Lum, Shawn K. Y.; Lutz, James A.; Ma, Keping; Meegaskumbura, Madhava; Mi, Xiangcheng; Parker, John D.; Fang-Sun, I.; Wright, S. Joseph; Wolf, Amy T.; Ye, W.; Xing, Dingliang; Zimmerman, Jess K.; Kress, W. John

    2014-01-01

    Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK, and psbA-trnH) and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance (PD) metrics that are commonly used to infer assembly processes were estimated for each plot [PD, Mean Phylogenetic Distance (MPD), and Mean Nearest Taxon Distance (MNTD)]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for individual plots, estimates of

  17. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  18. Phylogenetic diversity of Pasteurellaceae and horizontal gene transfer of leukotoxin in wild and domestic sheep.

    Science.gov (United States)

    Kelley, Scott T; Cassirer, E Frances; Weiser, Glen C; Safaee, Shirin

    2007-01-01

    Wild and domestic animal populations are known to be sources and reservoirs of emerging diseases. There is also a growing recognition that horizontal genetic transfer (HGT) plays an important role in bacterial pathogenesis. We used molecular phylogenetic methods to assess diversity and cross-transmission rates of Pasteurellaceae bacteria in populations of bighorn sheep, Dall's sheep, domestic sheep and domestic goats. Members of the Pasteurellaceae cause an array of deadly illnesses including bacterial pneumonia known as "pasteurellosis", a particularly devastating disease for bighorn sheep. A phylogenetic analysis of a combined dataset of two RNA genes (16S ribosomal RNA and RNAse P RNA) revealed remarkable evolutionary diversity among Pasteurella trehalosi and Mannheimia (Pasteurella) haemolytica bacteria isolated from sheep and goats. Several phylotypes appeared to associate with particular host species, though we found numerous instances of apparent cross-transmission among species and populations. Statistical analyses revealed that host species, geographic locale and biovariant classification, but not virulence, correlated strongly with Pasteurellaceae phylogeny. Sheep host species correlated with P. trehalosi isolates phylogeny (PTP test; P=0.002), but not with the phylogeny of M. haemolytica isolates, suggesting that P. trehalosi bacteria may be more host specific. With regards to populations within species, we also discovered a strong correlation between geographic locale and isolate phylogeny in the Rocky Mountain bighorn sheep (PTP test; P=0.001). We also investigated the potential for HGT of the leukotoxin A (lktA) gene, which produces a toxin that plays an integral role in causing disease. Comparative analysis of the combined RNA gene phylogeny and the lktA phylogenies revealed considerable incongruence between the phylogenies, suggestive of HGT. Furthermore, we found identical lktA alleles in unrelated bacterial species, some of which had been isolated

  19. Environmental quality of a stream can be better predicted by phylogenetic than by taxonomic diversity

    Directory of Open Access Journals (Sweden)

    Koperski Paweł

    2017-01-01

    Full Text Available Different indices of taxonomic diversity (TD and phylogenetic diversity (PD of the macrobenthos were compared to determine the efficient predictors of environmental quality (EQ in different types of watercourses in Poland. Archived data of 864 samples of benthic invertebrates identified to the family level were analysed on the basis of linear and non-linear multiply regression. The strengths of the correlations between two measures of EQ:BMWPpl (British Monitoring Working Party score system, Polish modification and MMI (Multimetric Macroinvertebrate Index and the values of taxonomic richness and three well-known TD indices: Shannon, Margalef and J' Evenness were compared to those for values of three PD indices, based on taxonomic distinctness. Taxonomic richness and all PD indices correlated more strongly with both measures of EQ than all TD indices. Correlations with both types of diversity indices were visibly stronger for BMWPpl when compared with MMI. We suggest that analysed indices of PD, especially MDis (mean phylogenetic distance between families in a sample, are related with EQ strongly enough to be taken into account as potential metrics in selection procedures of biological assessment.

  20. Phylogenetic diversity does not capture body size variation at risk in the world's mammals

    DEFF Research Database (Denmark)

    Fritz, Susanne A; Purvis, Andy

    2010-01-01

    Mammals contribute to important ecosystem processes and services, but many mammalian species are threatened with extinction. We compare how global patterns in three measures of mammalian diversity--species richness, phylogenetic diversity (PD) and body mass variance (BMV)--would change if all...... currently threatened species were lost. Given that many facets of species' ecology and life history scale predictably with body mass, the BMV in a region roughly reflects the diversity of species' roles within ecosystems and so is a simple proxy for functional diversity (FD). PD is also often considered...... more BMV than under random extinction, while only 11 per cent would lose significantly more PD. Ecosystem consequences of these selective losses may be profound, especially throughout the tropics, but are not captured by PD. This low surrogacy stresses a need for conservation prioritization based...

  1. Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

    Science.gov (United States)

    Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

    2004-01-01

    We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

  2. Why and how might genetic and phylogenetic diversity be reflected in the identification of key biodiversity areas?

    Science.gov (United States)

    Brooks, T M; Cuttelod, A; Faith, D P; Garcia-Moreno, J; Langhammer, P; Pérez-Espona, S

    2015-02-19

    'Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326-337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for 'threatened species' to consider 'threatened taxa' and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites.

  3. Local phylogenetic divergence and global evolutionary convergence of skull function in reef fishes of the family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E; Wainwright, Peter C; Bellwood, David R; Grubich, Justin R; Fessler, Jennifer L; Clements, Kendall D; Smith, Lydia L

    2005-05-22

    The Labridae is one of the most structurally and functionally diversified fish families on coral and rocky reefs around the world, providing a compelling system for examination of evolutionary patterns of functional change. Labrid fishes have evolved a diverse array of skull forms for feeding on prey ranging from molluscs, crustaceans, plankton, detritus, algae, coral and other fishes. The species richness and diversity of feeding ecology in the Labridae make this group a marine analogue to the cichlid fishes. Despite the importance of labrids to coastal reef ecology, we lack evolutionary analysis of feeding biomechanics among labrids. Here, we combine a molecular phylogeny of the Labridae with the biomechanics of skull function to reveal a broad pattern of repeated convergence in labrid feeding systems. Mechanically fast jaw systems have evolved independently at least 14 times from ancestors with forceful jaws. A repeated phylogenetic pattern of functional divergence in local regions of the labrid tree produces an emergent family-wide pattern of global convergence in jaw function. Divergence of close relatives, convergence among higher clades and several unusual 'breakthroughs' in skull function characterize the evolution of functional complexity in one of the most diverse groups of reef fishes.

  4. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  5. A new support measure to quantify the impact of local optima in phylogenetic analyses.

    KAUST Repository

    Brammer, Grant

    2011-09-29

    Phylogentic analyses are often incorrectly assumed to have stabilized to a single optimum. However, a set of trees from a phylogenetic analysis may contain multiple distinct local optima with each optimum providing different levels of support for each clade. For situations with multiple local optima, we propose p-support which is a clade support measure that shows the impact optima have on a final consensus tree. Our p-support measure is implemented in our PeakMapper software package. We study our approach on two published, large-scale biological tree collections. PeakMapper shows that each data set contains multiple local optima. p-support shows that both datasets contain clades in the majority consensus tree that are only supported by a subset of the local optima. Clades with low p-support are most likely to benefit from further investigation. These tools provide researchers with new information regarding phylogenetic analyses beyond what is provided by other support measures alone.

  6. Determinants of plant community assembly in a mosaic of landscape units in central Amazonia: ecological and phylogenetic perspectives.

    Directory of Open Access Journals (Sweden)

    María Natalia Umaña

    Full Text Available The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace and flooded forests (Igapó. We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties.

  7. Determinants of Plant Community Assembly in a Mosaic of Landscape Units in Central Amazonia: Ecological and Phylogenetic Perspectives

    Science.gov (United States)

    Umaña, María Natalia; Norden, Natalia; Cano, Ángela; Stevenson, Pablo R.

    2012-01-01

    The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace) and flooded forests (Igapó). We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties. PMID:23028844

  8. Biodiversity assessment among two Nebraska prairies: a comparison between traditional and phylogenetic diversity indices.

    Science.gov (United States)

    Aust, Shelly K; Ahrendsen, Dakota L; Kellar, P Roxanne

    2015-01-01

    Conservation of the evolutionary diversity among organisms should be included in the selection of priority regions for preservation of Earth's biodiversity. Traditionally, biodiversity has been determined from an assessment of species richness (S), abundance, evenness, rarity, etc. of organisms but not from variation in species' evolutionary histories. Phylogenetic diversity (PD) measures evolutionary differences between taxa in a community and is gaining acceptance as a biodiversity assessment tool. However, with the increase in the number of ways to calculate PD, end-users and decision-makers are left wondering how metrics compare and what data are needed to calculate various metrics. In this study, we used massively parallel sequencing to generate over 65,000 DNA characters from three cellular compartments for over 60 species in the asterid clade of flowering plants. We estimated asterid phylogenies from character datasets of varying nucleotide quantities, and then assessed the effect of varying character datasets on resulting PD metric values. We also compared multiple PD metrics with traditional diversity indices (including S) among two endangered grassland prairies in Nebraska (U.S.A.). Our results revealed that PD metrics varied based on the quantity of genes used to infer the phylogenies; therefore, when comparing PD metrics between sites, it is vital to use comparable datasets. Additionally, various PD metrics and traditional diversity indices characterize biodiversity differently and should be chosen depending on the research question. Our study provides empirical results that reveal the value of measuring PD when considering sites for conservation, and it highlights the usefulness of using PD metrics in combination with other diversity indices when studying community assembly and ecosystem functioning. Ours is just one example of the types of investigations that need to be conducted across the tree of life and across varying ecosystems in order to build

  9. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  10. Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology

    DEFF Research Database (Denmark)

    Hansen, K.; Læssøe, Thomas; Pfister, D.H.

    2002-01-01

    Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....

  11. The mean and variance of phylogenetic diversity under rarefaction.

    Science.gov (United States)

    Nipperess, David A; Matsen, Frederick A

    2013-06-01

    Phylogenetic diversity (PD) depends on sampling depth, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD.We have derived exact formulae for the mean and variance of PD under rarefaction. We confirm that these formulae are correct by comparing exact solution mean and variance to that calculated by repeated random (Monte Carlo) subsampling of a dataset of stem counts of woody shrubs of Toohey Forest, Queensland, Australia. We also demonstrate the application of the method using two examples: identifying hotspots of mammalian diversity in Australasian ecoregions, and characterising the human vaginal microbiome.There is a very high degree of correspondence between the analytical and random subsampling methods for calculating mean and variance of PD under rarefaction, although the Monte Carlo method requires a large number of random draws to converge on the exact solution for the variance.Rarefaction of mammalian PD of ecoregions in Australasia to a common standard of 25 species reveals very different rank orderings of ecoregions, indicating quite different hotspots of diversity than those obtained for unrarefied PD. The application of these methods to the vaginal microbiome shows that a classical score used to quantify bacterial vaginosis is correlated with the shape of the rarefaction curve.The analytical formulae for the mean and variance of PD under rarefaction are both exact and more efficient than repeated subsampling. Rarefaction of PD allows for many applications where comparisons of samples of different depth is required.

  12. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  13. Spatial Patterns of Species Diversity and Phylogenetic Structure of Plant Communities in the Tianshan Mountains, Arid Central Asia

    Directory of Open Access Journals (Sweden)

    Hong-Xiang Zhang

    2017-12-01

    Full Text Available The Tianshan Mountains, located in arid Central Asia, have a humid climate and are biodiversity hotspots. Here, we aimed to clarify whether the pattern of species diversity and the phylogenetic structure of plant communities is affected by environmental variables and glacial refugia. In this study, plant community assemblies of 17 research sites with a total of 35 sample plots were investigated at the grassland/woodland boundaries on the Tianshan Mountains. Community phylogeny of these plant communities was constructed based on two plant DNA barcode regions. The indices of phylogenetic diversity and phylogenetic community structure were calculated for these sample plots. We first estimated the correlation coefficients between species richness (SR and environmental variables as well as the presence of glacial refugia. We then mapped the significant values of indices of community phylogeny (PD, RPD, NRI, and NTI to investigate the correlation between community phylogeny and environmental structure or macrozones in the study area. The results showed that a significantly higher value of SR was obtained for the refugial groups than for the colonizing groups (P < 0.05; presence of refugia and environmental variables were highly correlated to the pattern of variation in SR. Indices of community phylogeny were not significantly different between refugial and colonizing regions. Comparison with the humid western part showed that plant communities in the arid eastern part of the Tianshan Mountains tended to display more significant phylogenetic overdispersion. The variation tendency of the PhyloSor index showed that the increase in macro-geographical and environmental distance did not influence obvious phylogenetic dissimilarities between different sample plots. In conclusion, glacial refugia and environmental factors profoundly influenced the pattern of SR, but community phylogenetic structure was not affected by glacial refugia among different plant

  14. The effects of habitat management on the species, phylogenetic and functional diversity of bees are modified by the environmental context.

    Science.gov (United States)

    Sydenham, Markus A K; Moe, Stein R; Stanescu-Yadav, Diana N; Totland, Ørjan; Eldegard, Katrine

    2016-02-01

    Anthropogenic landscape elements, such as roadsides, hedgerows, field edges, and power line clearings, can be managed to provide important habitats for wild bees. However, the effects of habitat improvement schemes in power line clearings on components of diversity are poorly studied. We conducted a large-scale experiment to test the effects of different management practices on the species, phylogenetic, and functional diversity of wild bees in power line clearings (n = 19 sites across southeastern Norway) and explored whether any treatment effects were modified by the environmental context. At each site, we conducted the following treatments: (1) Cut: all trees cut and left to decay in the clearing; (2) Cut + Remove: all trees cut and removed from the plot; and (3) Uncut: uncleared. The site-specific environmental context (i.e., elevation and floral diversity) influenced the species, phylogenetic, and functional diversity within bee species assemblages. The largest number of species was found in the Cut + Remove treatment in plots with a high forb species richness, indicating that the outcome of management practices depends on the environmental context. Clearing of treatment plots with many forb species also appeared to alter the phylogenetic composition of bee species assemblages, that is, more closely related species were found in the Cut and the Cut + Remove plots than in the Uncut plots. Synthesis and applications: Our experimental simulation of management practices in power line clearings influenced the species, phylogenetic, and functional diversity of bee species assemblages. Frequent clearing and removal of the woody debris at low elevations with a high forb species richness can increase the value of power line clearings for solitary bees. It is therefore important for managers to consider the environmental context when designing habitat improvement schemes for solitary bees.

  15. Evolution of species diversity in the genus Chamaecostus (Costaceae): molecular phylogenetics and morphometric approaches

    OpenAIRE

    Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania

    2015-01-01

    While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...

  16. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Directory of Open Access Journals (Sweden)

    David Lee Erickson

    2014-11-01

    Full Text Available Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1,347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK and psbA-trnH and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance metrics that are commonly used to infer assembly processes were estimated for each plot (Phylogenetic Distance [PD], Mean Phylogenetic Distance [MPD], and Mean Nearest Taxon Distance [MNTD]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for

  17. Some Like it High! Phylogenetic Diversity of High-Elevation Cyanobacterial Community from Biological Soil Crusts of Western Himalaya.

    Science.gov (United States)

    Čapková, Kateřina; Hauer, Tomáš; Řeháková, Klára; Doležal, Jiří

    2016-01-01

    The environment of high-altitudinal cold deserts of Western Himalaya is characterized by extensive development of biological soil crusts, with cyanobacteria as dominant component. The knowledge of their taxonomic composition and dependency on soil chemistry and elevation is still fragmentary. We studied the abundance and the phylogenetic diversity of the culturable cyanobacteria and eukaryotic microalgae in soil crusts along altitudinal gradients (4600-5900 m) at two sites in the dry mountains of Ladakh (SW Tibetan Plateau and Eastern Karakoram), using both microscopic and molecular approaches. The effects of environmental factors (altitude, mountain range, and soil physico-chemical parameters) on the composition and biovolume of phototrophs were tested by multivariate redundancy analysis and variance partitioning. Both phylogenetic diversity and composition of morphotypes were similar between Karakorum and Tibetan Plateau. Phylogenetic analysis of 16S rRNA gene revealed strains belonging to at least five genera. Besides clusters of common soil genera, e.g., Microcoleus, Nodosilinea, or Nostoc, two distinct clades of simple trichal taxa were newly discovered. The most abundant cyanobacterial orders were Oscillatoriales and Nostacales, whose biovolume increased with increasing elevation, while that of Chroococales decreased. Cyanobacterial species richness was low in that only 15 morphotypes were detected. The environmental factors accounted for 52 % of the total variability in microbial data, 38.7 % of which was explained solely by soil chemical properties, 14.5 % by altitude, and 8.4 % by mountain range. The elevation, soil phosphate, and magnesium were the most important predictors of soil phototrophic communities in both mountain ranges despite their different bedrocks and origin. The present investigation represents a first record on phylogenetic diversity of the cyanobacterial community of biological soil crusts from Western Himalayas and first record

  18. Trophic phylogenetics: evolutionary influences on body size, feeding, and species associations in grassland arthropods.

    Science.gov (United States)

    Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T

    2015-04-01

    Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid

  19. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    Science.gov (United States)

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

  20. Phylogenetic Diversity of aprA Genes in Subseafloor Sediments on the Northwestern Pacific Margin off Japan.

    Science.gov (United States)

    Aoki, Masataka; Kakiuchi, Ryota; Yamaguchi, Takashi; Takai, Ken; Inagaki, Fumio; Imachi, Hiroyuki

    2015-01-01

    Markedly diverse sequences of the adenosine-5'-phosphosulfate reductase alpha subunit gene (aprA), which encodes a key enzyme in microbial sulfate reduction and sulfur oxidation, were detected in subseafloor sediments on the northwestern Pacific off Japan. The aprA gene sequences were grouped into 135 operational taxonomic units (90% sequence identity), including genes related to putative sulfur-oxidizing bacteria predominantly detected in sulfate-depleted deep sediments. Our results suggest that microbial ecosystems in the subseafloor biosphere have phylogenetically diverse genetic potentials to mediate cryptic sulfur cycles in sediments, even where sulfate is rarely present.

  1. The Role of the Phylogenetic Diversity Measure, PD, in Bio-informatics: Getting the Definition Right

    Directory of Open Access Journals (Sweden)

    Daniel P. Faith

    2006-01-01

    Full Text Available A recent paper in this journal (Faith and Baker, 2006 described bio-informatics challenges in the application of the PD (phylogenetic diversity measure of Faith (1992a, and highlighted the use of the root of the phylogenetic tree, as implied by the original definition of PD. A response paper (Crozier et al. 2006 stated that 1 the (Faith, 1992a PD definition did not include the use of the root of the tree, and 2 Moritz and Faith (1998 changed the PD definition to include the root. Both characterizations are here refuted. Examples from Faith (1992a,b document the link from the definition to the use of the root of the overall tree, and a survey of papers over the past 15 years by Faith and colleagues demonstrate that the stated PD definition has remained the same as that in the original 1992 study. PD’s estimation of biodiversity at the level of “feature diversity” is seen to have provided the original rationale for the measure’s consideration of the root of the phylogenetic tree.

  2. Species richness, but not phylogenetic diversity, influences community biomass production and temporal stability in a re-examination of 16 grassland biodiversity studies

    NARCIS (Netherlands)

    Venail, P.; Gross, K.; Oakley, T.H.; Narwani, A.; Allan, E.; Flombaum, P.; Isbell, F.; Joshi, J.; Reich, P.B.; Tilman, D.; Ruijven, van J.; Cardinale, B.J.

    2015-01-01

    1.Hundreds of experiments have now manipulated species richness of various groups of organisms and examined how this aspect of biological diversity influences ecosystem functioning. Ecologists have recently expanded this field to look at whether phylogenetic diversity among species, often quantified

  3. A new support measure to quantify the impact of local optima in phylogenetic analyses.

    KAUST Repository

    Brammer, Grant; Sul, Seung-Jin; Williams, Tiffani L

    2011-01-01

    Phylogentic analyses are often incorrectly assumed to have stabilized to a single optimum. However, a set of trees from a phylogenetic analysis may contain multiple distinct local optima with each optimum providing different levels of support

  4. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  5. [Phylogenetic diversity of microorganisms associated with the deep-water sponge Baikalospongia intermedia].

    Science.gov (United States)

    Kalyzhnaya, O V; Itskovich, V B

    2014-07-01

    The diversity of bacteria associated with deep-water sponge Baikalospongia intermedia was evaluated by sequence analysis of 16S rRNA genes from two sponge samples collected in Lake Baikal from depths of 550 and 1204 m. A total of 64 operational taxonomic units, belonging to nine bacterial phyla, Proteobacteria (classes Alphaproteobacteria,. Betaproteobacteria, Gammaproteobacteria, and Deltaproteobacteria), Actinobacteria, Planctomycetes, Cloroflexi, Verrucomicrobia, Acidobacteria, Chlorobi, and Nitrospirae, including candidate phylum WS5, were identified. Phylogenetic analysis showed that the examined communities contained phylotypes exhibiting homology to uncultured bacteria from different lake ecosystems, freshwater sediments, soil and geological formations. Moreover, a number of phylotypes were relative to psychrophilic, methane-oxidizing, sulfate-reducing bacteria, and to microorganisms resistant to the influence of heavy metals. It seems likely that the unusual habitation conditions of deep-water sponges contribute to the taxonomic diversity of associated bacteria and have an influence on the presence of functionally important microorganisms in bacterial communities.

  6. Phylogenetic niche conservatism explains an inverse latitudinal diversity gradient in freshwater arthropods

    Science.gov (United States)

    Morinière, Jérôme; van Dam, Matthew H.; Hawlitschek, Oliver; Bergsten, Johannes; Michat, Mariano C.; Hendrich, Lars; Ribera, Ignacio; Toussaint, Emmanuel F. A.; Balke, Michael

    2016-05-01

    The underlying mechanisms responsible for the general increase in species richness from temperate regions to the tropics remain equivocal. Many hypotheses have been proposed to explain this astonishing pattern but additional empirical studies are needed to shed light on the drivers at work. Here we reconstruct the evolutionary history of the cosmopolitan diving beetle subfamily Colymbetinae, the majority of which are found in the Northern hemisphere, hence exhibiting an inversed latitudinal diversity gradient. We reconstructed a dated phylogeny using 12 genes, to investigate the biogeographical history and diversification dynamics in the Colymbetinae. We aimed to identify the role that phylogenetic niche conservatism plays in the inversed diversification pattern seen in this group. Our results suggest that Colymbetinae originated in temperate climates, which supports the hypothesis that their distribution is the result of an ancestral adaptation to temperate environmental conditions rather than tropical origins, and that temperate niche conservatism can generate and/or maintain inverse latitudinal diversity gradients.

  7. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  8. Region effects influence local tree species diversity.

    Science.gov (United States)

    Ricklefs, Robert E; He, Fangliang

    2016-01-19

    Global patterns of biodiversity reflect both regional and local processes, but the relative importance of local ecological limits to species coexistence, as influenced by the physical environment, in contrast to regional processes including species production, dispersal, and extinction, is poorly understood. Failure to distinguish regional influences from local effects has been due, in part, to sampling limitations at small scales, environmental heterogeneity within local or regional samples, and incomplete geographic sampling of species. Here, we use a global dataset comprising 47 forest plots to demonstrate significant region effects on diversity, beyond the influence of local climate, which together explain more than 92% of the global variation in local forest tree species richness. Significant region effects imply that large-scale processes shaping the regional diversity of forest trees exert influence down to the local scale, where they interact with local processes to determine the number of coexisting species.

  9. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008.

    Science.gov (United States)

    Choi, Seon Young; Rashed, Shah M; Hasan, Nur A; Alam, Munirul; Islam, Tarequl; Sadique, Abdus; Johura, Fatema-Tuz; Eppinger, Mark; Ravel, Jacques; Huq, Anwar; Cravioto, Alejandro; Colwell, Rita R

    2016-03-15

    An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997). Nontoxigenic (CTX(-)) V. cholerae El Tor dominated toxigenic (CTX(+)) strains (2001 to 2003), but V. cholerae CTX(+) variant El Tor was isolated during 2004 to 2008, outcompeting CTX(-) V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX(+) El Tor, two were CTX(-) El Tor, and the remaining strain was a CTX(+) classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX(-) isolate is ancestral to the 6th and 7th pandemic CTX(+) V. cholerae isolates. The other CTX(-) isolate joined with CTX(-) non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX(+) isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX(+) El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II) are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX(+) El Tor isolate contained West African-South American (WASA) recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs) and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity. Sequencing of genomes of V. cholerae is critical if genetic changes occurring over time in the circulating population of an area of endemicity are to be understood. Although cholera outbreaks occurred rarely

  10. Activity and phylogenetic diversity of bacterial cells with high and low nucleic acid content and electron transport system activity in an upwelling ecosystem.

    Science.gov (United States)

    Longnecker, K; Sherr, B F; Sherr, E B

    2005-12-01

    We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea.

  11. Phylogenetic and functional diversity of metagenomic libraries of phenol degrading sludge from petroleum refinery wastewater treatment system.

    Science.gov (United States)

    Silva, Cynthia C; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; Kruger, Ricardo H; Rodrigues, Marili Vn; Costa, Gustavo Gl; Vidal, Ramon O; Sousa, Maíra P; Torres, Ana Paula R; Santiago, Vânia Mj; Oliveira, Valéria M

    2012-03-27

    In petrochemical refinery wastewater treatment plants (WWTP), different concentrations of pollutant compounds are received daily in the influent stream, including significant amounts of phenolic compounds, creating propitious conditions for the development of particular microorganisms that can rapidly adapt to such environment. In the present work, the microbial sludge from a refinery WWTP was enriched for phenol, cloned into fosmid vectors and pyrosequenced. The fosmid libraries yielded 13,200 clones and a comprehensive bioinformatic analysis of the sequence data set revealed a complex and diverse bacterial community in the phenol degrading sludge. The phylogenetic analyses using MEGAN in combination with RDP classifier showed a massive predominance of Proteobacteria, represented mostly by the genera Diaphorobacter, Pseudomonas, Thauera and Comamonas. The functional classification of phenol degrading sludge sequence data set generated by MG-RAST showed the wide metabolic diversity of the microbial sludge, with a high percentage of genes involved in the aerobic and anaerobic degradation of phenol and derivatives. In addition, genes related to the metabolism of many other organic and xenobiotic compounds, such as toluene, biphenyl, naphthalene and benzoate, were found. Results gathered herein demonstrated that the phenol degrading sludge has complex phylogenetic and functional diversities, showing the potential of such community to degrade several pollutant compounds. This microbiota is likely to represent a rich resource of versatile and unknown enzymes which may be exploited for biotechnological processes such as bioremediation.

  12. Phylogenetic insights into the diversity of homocytous cyanobacteria from Amazonian rivers.

    Science.gov (United States)

    Genuário, Diego Bonaldo; Vaz, Marcelo Gomes Marçal Vieira; Melo, Itamar Soares de

    2017-11-01

    The Amazon Rainforest holds great tropical biodiversity, mainly because of its favourable climatic conditions. The high temperatures, luminosity and humidity coupled with the nutritional simplicity of cyanobacteria allow undiscovered diversity to flourish within this group of microorganisms. Some efforts to reveal this diversity have been attempted; however, most were focused on the microscopic observation of environmental samples without any genetic information. Very few studies focusing on morphological, ecological and molecular criteria have been conducted, and none have been devoted to homocytous cyanobacteria forms in Amazonia region. Therefore, the genetic relationships amongst strains retrieved from this ecosystem with regard to other environments from Brazil and the world have not been tested and, consequently, the Amazonian strains would naturally be assumed as novel to science. To examine these relationships, cultured homocytous cyanobacteria isolated from two Amazonian rivers (Amazonas and Solimões) were evaluated using a phylogenetic perspective, considering the 16S rRNA gene sequence. A total of eleven homocytous cyanobacterial strains were isolated. Morphologically, they were identified as Pseudanabaena, Leptolyngbya, Planktothrix and Phormidium, but genetically they were included in the typical clusters of Planktothrix, Pseudanabaena, Cephalothrix, Pantanalinema and Alkalinema. These three latter genera have been detected in other Brazilian ecosystems only (Pantanal, Atlantic Rainforest and Pampa), while those remaining have been extensively found in many parts of the world. The data provided here indicate that Amazonian rivers support a homocytous cyanobacterial diversity previously reported from other geographical and ecological environments. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Ecological Diversity in South American Mammals: Their Geographical Distribution Shows Variable Associations with Phylogenetic Diversity and Does Not Follow the Latitudinal Richness Gradient.

    Directory of Open Access Journals (Sweden)

    Paula Nilda Fergnani

    Full Text Available The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR is informative in terms of ecological diversity (ED, an approximation to functional diversity and phylogenetic diversity (AvPD using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans, mid-Cenozoic immigrants (hystricognaths, primates and newcomers (carnivorans, artiodactyls. If closely related species are ecologically more similar than distantly related species, AvPD will be a strong predictor of ED; however, lower ED than predicted from AvPD may be due to species retaining most of their ancestral characters, suggesting niche conservatism. This pattern could occur in tropical rainforests for taxa of tropical affinity (old autochthonous and mid-Cenozoic immigrants and in open and arid habitats for newcomers. In contrast, higher ED than expected from AvPD could occur, possibly in association with niche evolution, in arid and open habitats for taxa of tropical affinity and in forested habitats for newcomers. We found that TR was a poor predictor of ED and AvPD. After controlling for TR, there was considerable variability in the extent to which AvPD accounted for ED. Taxa of tropical affinity did not support the prediction of ED deficit within tropical rainforests, rather, they showed a mosaic of regions with an excess of ED interspersed with zones of ED deficit within the tropics; newcomers showed ED deficit in arid and open regions. Some taxa of tropical affinity showed excess of ED in tropical desert areas (hystricognaths or temperate semideserts (xenarthrans; newcomers showed excess of ED at cold-temperate latitudes in the Northern Hemisphere. This result suggests that extreme climatic conditions at both temperate and tropical latitudes may have promoted niche evolution in

  14. Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

    Science.gov (United States)

    Erwin, Patrick M; Olson, Julie B; Thacker, Robert W

    2011-01-01

    Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP), might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods. We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6%) of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil). The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the ambient

  15. Phylogenetic analysis of a spontaneous cocoa bean fermentation metagenome reveals new insights into its bacterial and fungal community diversity.

    Directory of Open Access Journals (Sweden)

    Koen Illeghems

    Full Text Available This is the first report on the phylogenetic analysis of the community diversity of a single spontaneous cocoa bean box fermentation sample through a metagenomic approach involving 454 pyrosequencing. Several sequence-based and composition-based taxonomic profiling tools were used and evaluated to avoid software-dependent results and their outcome was validated by comparison with previously obtained culture-dependent and culture-independent data. Overall, this approach revealed a wider bacterial (mainly γ-Proteobacteria and fungal diversity than previously found. Further, the use of a combination of different classification methods, in a software-independent way, helped to understand the actual composition of the microbial ecosystem under study. In addition, bacteriophage-related sequences were found. The bacterial diversity depended partially on the methods used, as composition-based methods predicted a wider diversity than sequence-based methods, and as classification methods based solely on phylogenetic marker genes predicted a more restricted diversity compared with methods that took all reads into account. The metagenomic sequencing analysis identified Hanseniaspora uvarum, Hanseniaspora opuntiae, Saccharomyces cerevisiae, Lactobacillus fermentum, and Acetobacter pasteurianus as the prevailing species. Also, the presence of occasional members of the cocoa bean fermentation process was revealed (such as Erwinia tasmaniensis, Lactobacillus brevis, Lactobacillus casei, Lactobacillus rhamnosus, Lactococcus lactis, Leuconostoc mesenteroides, and Oenococcus oeni. Furthermore, the sequence reads associated with viral communities were of a restricted diversity, dominated by Myoviridae and Siphoviridae, and reflecting Lactobacillus as the dominant host. To conclude, an accurate overview of all members of a cocoa bean fermentation process sample was revealed, indicating the superiority of metagenomic sequencing over previously used techniques.

  16. Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia.

    Science.gov (United States)

    Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D

    2011-12-01

    Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.

  17. Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore

    Science.gov (United States)

    Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

    2016-01-01

    INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667

  18. Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore.

    Science.gov (United States)

    Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

    2016-12-01

    Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association

  19. Diversity Dynamics in Nymphalidae Butterflies: Effect of Phylogenetic Uncertainty on Diversification Rate Shift Estimates

    Science.gov (United States)

    Peña, Carlos; Espeland, Marianne

    2015-01-01

    The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC) is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE) and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution. PMID:25830910

  20. Diversity dynamics in Nymphalidae butterflies: effect of phylogenetic uncertainty on diversification rate shift estimates.

    Directory of Open Access Journals (Sweden)

    Carlos Peña

    Full Text Available The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution.

  1. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  2. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities.

    Science.gov (United States)

    Amend, Anthony S; Matulich, Kristin L; Martiny, Jennifer B H

    2015-01-01

    Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity (PD). This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between PD and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial PD, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of 66 days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial PD failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which PD predicts ecosystem function will depend on environmental context.

  3. Phylogenetic analysis in Myrcia section Aulomyrcia and inferences on plant diversity in the Atlantic rainforest.

    Science.gov (United States)

    Staggemeier, Vanessa Graziele; Diniz-Filho, José Alexandre Felizola; Forest, Félix; Lucas, Eve

    2015-04-01

    Myrcia section Aulomyrcia includes ∼120 species that are endemic to the Neotropics and disjunctly distributed in the moist Amazon and Atlantic coastal forests of Brazil. This paper presents the first comprehensive phylogenetic study of this group and this phylogeny is used as a basis to evaluate recent classification systems and to test alternative hypotheses associated with the history of this clade. Fifty-three taxa were sampled out of the 120 species currently recognized, plus 40 outgroup taxa, for one nuclear marker (ribosomal internal transcribed spacer) and four plastid markers (psbA-trnH, trnL-trnF, trnQ-rpS16 and ndhF). The relationships were reconstructed based on Bayesian and maximum likelihood analyses. Additionally, a likelihood approach, 'geographic state speciation and extinction', was used to estimate region- dependent rates of speciation, extinction and dispersal, comparing historically climatic stable areas (refugia) and unstable areas. Maximum likelihood and Bayesian inferences indicate that Myrcia and Marlierea are polyphyletic, and the internal groupings recovered are characterized by combinations of morphological characters. Phylogenetic relationships support a link between Amazonian and north-eastern species and between north-eastern and south-eastern species. Lower extinction rates within glacial refugia suggest that these areas were important in maintaining diversity in the Atlantic forest biodiversity hotspot. This study provides a robust phylogenetic framework to address important ecological questions for Myrcia s.l. within an evolutionary context, and supports the need to unite taxonomically the two traditional genera Myrcia and Marlierea in an expanded Myrcia s.l. Furthermore, this study offers valuable insights into the diversification of plant species in the highly impacted Atlantic forest of South America; evidence is presented that the lowest extinction rates are found inside refugia and that range expansion from unstable areas

  4. Spatial phylogenetics of the vascular flora of Chile.

    Science.gov (United States)

    Scherson, Rosa A; Thornhill, Andrew H; Urbina-Casanova, Rafael; Freyman, William A; Pliscoff, Patricio A; Mishler, Brent D

    2017-07-01

    Current geographic patterns of biodiversity are a consequence of the evolutionary history of the lineages that comprise them. This study was aimed at exploring how evolutionary features of the vascular flora of Chile are distributed across the landscape. Using a phylogeny at the genus level for 87% of the Chilean vascular flora, and a geographic database of sample localities, we calculated phylogenetic diversity (PD), phylogenetic endemism (PE), relative PD (RPD), and relative PE (RPE). Categorical Analyses of Neo- and Paleo-Endemism (CANAPE) were also performed, using a spatial randomization to assess statistical significance. A cluster analysis using range-weighted phylogenetic turnover was used to compare among grid cells, and with known Chilean bioclimates. PD patterns were concordant with known centers of high taxon richness and the Chilean biodiversity hotspot. In addition, several other interesting areas of concentration of evolutionary history were revealed as potential conservation targets. The south of the country shows areas of significantly high RPD and a concentration of paleo-endemism, and the north shows areas of significantly low PD and RPD, and a concentration of neo-endemism. Range-weighted phylogenetic turnover shows high congruence with the main macrobioclimates of Chile. Even though the study was done at the genus level, the outcome provides an accurate outline of phylogenetic patterns that can be filled in as more fine-scaled information becomes available. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. [A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].

    Science.gov (United States)

    Shulakov, A A; Egorov, A V; Onipchenko, V G

    2016-01-01

    Phylogenetic analysis of communities is based on the comparison of distances on the phylogenetic tree between species of a community under study and those distances in random samples taken out of local flora. It makes it possible to determine to what extent a community composition is formed by more closely related species (i.e., "clustered") or, on the opposite, it is more even and includes species that are less related with each other. The first case is usually interpreted as a result of strong influence caused by abiotic factors, due to which species with similar ecology, a priori more closely related, would remain: In the second case, biotic factors, such as competition, may come to the fore and lead to forming a community out of distant clades due to divergence of their ecological niches: The aim of this' study Was Ad explore the phylogenetic structure in communities of the northwestern Caucasus at two spatial scales - the scale of area from 4 to 100 m2 and the smaller scale within a community. The list of local flora of the alpine belt has been composed using the database of geobotanic descriptions carried out in Teberda Biosphere Reserve at true altitudes exceeding.1800 m. It includes 585 species of flowering plants belonging to 57 families. Basal groups of flowering plants are.not represented in the list. At the scale of communities of three classes, namely Thlaspietea rotundifolii - commumties formed on screes and pebbles, Calluno-Ulicetea - alpine meadow, and Mulgedio-Aconitetea subalpine meadows, have not demonstrated significant distinction of phylogenetic structure. At intra level, for alpine meadows the larger share of closely related species. (clustered community) is detected. Significantly clustered happen to be those communities developing on rocks (class Asplenietea trichomanis) and alpine (class Juncetea trifidi). At the same time, alpine lichen proved to have even phylogenetic structure at the small scale. Alpine (class Salicetea herbaceae) that

  6. Genetic Diversity and Phylogenetic Analysis of the Iranian Leishmania Parasites Based on HSP70 Gene PCR-RFLP and Sequence Analysis.

    Science.gov (United States)

    Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah

    2017-08-01

    Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.

  7. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation.

    Science.gov (United States)

    Guevara Andino, Juan Ernesto; Pitman, Nigel C A; Ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V A

    2017-11-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one-hectare plots in terra firme forests of Ecuadorian Amazon. In these plots, we tagged, collected, and identified every single adult tree with dbh ≥10 cm. These data were combined with a regional community phylogenetic tree to calculate different phylogenetic diversity (PD) metrics in order to create spatial models. We used Loess regression to estimate the spatial variation of taxonomic and phylogenetic beta diversity as well as phylogenetic endemism and evolutionary distinctiveness. We found evidence for the definition of three floristic districts in the Ecuadorian Amazon, supported by both taxonomic and phylogenetic diversity data. Areas with high levels of phylogenetic endemism and evolutionary distinctiveness in Ecuadorian Amazon forests are unprotected. Furthermore, these areas are severely threatened by proposed plans of oil and mining extraction at large scales and should be prioritized in conservation planning for this region.

  8. Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

    Directory of Open Access Journals (Sweden)

    Patrick M Erwin

    Full Text Available Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP, might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods.We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6% of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil.The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the

  9. Plant traits determine the phylogenetic structure of arbuscular mycorrhizal fungal communities.

    Science.gov (United States)

    López-García, Álvaro; Varela-Cervero, Sara; Vasar, Martti; Öpik, Maarja; Barea, José M; Azcón-Aguilar, Concepción

    2017-12-01

    Functional diversity in ecosystems has traditionally been studied using aboveground plant traits. Despite the known effect of plant traits on the microbial community composition, their effects on the microbial functional diversity are only starting to be assessed. In this study, the phylogenetic structure of arbuscular mycorrhizal (AM) fungal communities associated with plant species differing in life cycle and growth form, that is, plant life forms, was determined to unravel the effect of plant traits on the functional diversity of this fungal group. The results of the 454 pyrosequencing showed that the AM fungal community composition differed across plant life forms and this effect was dependent on the soil collection date. Plants with ruderal characteristics tended to associate with phylogenetically clustered AM fungal communities. By contrast, plants with resource-conservative traits associated with phylogenetically overdispersed AM fungal communities. Additionally, the soil collected in different seasons yielded AM fungal communities with different phylogenetic dispersion. In summary, we found that the phylogenetic structure, and hence the functional diversity, of AM fungal communities is dependent on plant traits. This finding adds value to the use of plant traits for the evaluation of belowground ecosystem diversity, functions and processes. © 2017 John Wiley & Sons Ltd.

  10. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  11. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  12. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota)

    Science.gov (United States)

    József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor

    2010-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...

  13. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  14. A guide to phylogenetic metrics for conservation, community ecology and macroecology

    Science.gov (United States)

    Cadotte, Marc W.; Carvalho, Silvia B.; Davies, T. Jonathan; Ferrier, Simon; Fritz, Susanne A.; Grenyer, Rich; Helmus, Matthew R.; Jin, Lanna S.; Mooers, Arne O.; Pavoine, Sandrine; Purschke, Oliver; Redding, David W.; Rosauer, Dan F.; Winter, Marten; Mazel, Florent

    2016-01-01

    ABSTRACT The use of phylogenies in ecology is increasingly common and has broadened our understanding of biological diversity. Ecological sub‐disciplines, particularly conservation, community ecology and macroecology, all recognize the value of evolutionary relationships but the resulting development of phylogenetic approaches has led to a proliferation of phylogenetic diversity metrics. The use of many metrics across the sub‐disciplines hampers potential meta‐analyses, syntheses, and generalizations of existing results. Further, there is no guide for selecting the appropriate metric for a given question, and different metrics are frequently used to address similar questions. To improve the choice, application, and interpretation of phylo‐diversity metrics, we organize existing metrics by expanding on a unifying framework for phylogenetic information. Generally, questions about phylogenetic relationships within or between assemblages tend to ask three types of question: how much; how different; or how regular? We show that these questions reflect three dimensions of a phylogenetic tree: richness, divergence, and regularity. We classify 70 existing phylo‐diversity metrics based on their mathematical form within these three dimensions and identify ‘anchor’ representatives: for α‐diversity metrics these are PD (Faith's phylogenetic diversity), MPD (mean pairwise distance), and VPD (variation of pairwise distances). By analysing mathematical formulae and using simulations, we use this framework to identify metrics that mix dimensions, and we provide a guide to choosing and using the most appropriate metrics. We show that metric choice requires connecting the research question with the correct dimension of the framework and that there are logical approaches to selecting and interpreting metrics. The guide outlined herein will help researchers navigate the current jungle of indices. PMID:26785932

  15. High frequency of phylogenetically diverse reductive dehalogenase-homologous genes in deep subseafloor sedimentary metagenomes

    Directory of Open Access Journals (Sweden)

    Mikihiko eKawai

    2014-03-01

    Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.

  16. Phylogenetic and chemical diversity of MAR4 streptomycete lineage

    Directory of Open Access Journals (Sweden)

    Marisa Paulino

    2014-06-01

    To date, phylogenetic characterization of 6 representative isolates, based on partial sequence of gene encoding 16S rRNA, confirm that these strains belong to the specie Streptomyces aculeolatus. Figure 2. Neighbour-joining phylogenetic tree created from 6 partial 16S rRNA gene sequence from Streptomyces aculeolatus strains cultured from Madeira Archipelago, based on 1000 bootstrap replicates. BLAST matches (deposited in GenBank are included with species and strain name followed by accession number. Verrucosispora maris and Micromonospora aurantiaca were used as outgroups.

  17. Increased phylogenetic resolution using target enrichment in Rubus

    Science.gov (United States)

    Phylogenetic analyses in Rubus L. have been challenging due to polyploidy, hybridization, and apomixis within the genus. Wide morphological diversity occurs within and between species, contributing to challenges at lower and higher systematic levels. Phylogenetic inferences to date have been based o...

  18. Quantification of non-coding RNA target localization diversity and its application in cancers.

    Science.gov (United States)

    Cheng, Lixin; Leung, Kwong-Sak

    2018-04-01

    Subcellular localization is pivotal for RNAs and proteins to implement biological functions. The localization diversity of protein interactions has been studied as a crucial feature of proteins, considering that the protein-protein interactions take place in various subcellular locations. Nevertheless, the localization diversity of non-coding RNA (ncRNA) target proteins has not been systematically studied, especially its characteristics in cancers. In this study, we provide a new algorithm, non-coding RNA target localization coefficient (ncTALENT), to quantify the target localization diversity of ncRNAs based on the ncRNA-protein interaction and protein subcellular localization data. ncTALENT can be used to calculate the target localization coefficient of ncRNAs and measure how diversely their targets are distributed among the subcellular locations in various scenarios. We focus our study on long non-coding RNAs (lncRNAs), and our observations reveal that the target localization diversity is a primary characteristic of lncRNAs in different biotypes. Moreover, we found that lncRNAs in multiple cancers, differentially expressed cancer lncRNAs, and lncRNAs with multiple cancer target proteins are prone to have high target localization diversity. Furthermore, the analysis of gastric cancer helps us to obtain a better understanding that the target localization diversity of lncRNAs is an important feature closely related to clinical prognosis. Overall, we systematically studied the target localization diversity of the lncRNAs and uncovered its association with cancer.

  19. Morphological characterization and phylogenetic distance among ...

    African Journals Online (AJOL)

    The genetic diversity was calculated with Nei and Li's index, and the phylogenetic tree (dendrogram) was generated with a neighbor-joining program. The dendrogram indicates the diversity of the genotypes, which are grouped into three distinctive large groups. The largest group includes species from the Mediolobivia and ...

  20. Integrated Automatic Workflow for Phylogenetic Tree Analysis Using Public Access and Local Web Services.

    Science.gov (United States)

    Damkliang, Kasikrit; Tandayya, Pichaya; Sangket, Unitsa; Pasomsub, Ekawat

    2016-11-28

    At the present, coding sequence (CDS) has been discovered and larger CDS is being revealed frequently. Approaches and related tools have also been developed and upgraded concurrently, especially for phylogenetic tree analysis. This paper proposes an integrated automatic Taverna workflow for the phylogenetic tree inferring analysis using public access web services at European Bioinformatics Institute (EMBL-EBI) and Swiss Institute of Bioinformatics (SIB), and our own deployed local web services. The workflow input is a set of CDS in the Fasta format. The workflow supports 1,000 to 20,000 numbers in bootstrapping replication. The workflow performs the tree inferring such as Parsimony (PARS), Distance Matrix - Neighbor Joining (DIST-NJ), and Maximum Likelihood (ML) algorithms of EMBOSS PHYLIPNEW package based on our proposed Multiple Sequence Alignment (MSA) similarity score. The local web services are implemented and deployed into two types using the Soaplab2 and Apache Axis2 deployment. There are SOAP and Java Web Service (JWS) providing WSDL endpoints to Taverna Workbench, a workflow manager. The workflow has been validated, the performance has been measured, and its results have been verified. Our workflow's execution time is less than ten minutes for inferring a tree with 10,000 replicates of the bootstrapping numbers. This paper proposes a new integrated automatic workflow which will be beneficial to the bioinformaticians with an intermediate level of knowledge and experiences. All local services have been deployed at our portal http://bioservices.sci.psu.ac.th.

  1. High local genetic diversity of canine parvovirus from Ecuador.

    Science.gov (United States)

    Aldaz, Jaime; García-Díaz, Juan; Calleros, Lucía; Sosa, Katia; Iraola, Gregorio; Marandino, Ana; Hernández, Martín; Panzera, Yanina; Pérez, Ruben

    2013-09-27

    Canine parvovirus (CPV) comprises three antigenic variants (2a, 2b, and 2c) that are distributed globally with different frequencies and levels of genetic variability. CPVs from central Ecuador were herein analyzed to characterize the strains and to provide new insights into local viral diversity, evolution, and pathogenicity. Variant prevalence was analyzed by PCR and partial sequencing for 53 CPV-positive samples collected during 2011 and 2012. The full-length VP2 gene was sequenced in 24 selected strains and a maximum-likelihood phylogenetic tree was constructed using both Ecuadorian and worldwide strains. Ecuadorian CPVs have a remarkable genetic diversity that includes the circulation of all three variants and the existence of different evolutionary groups or lineages. CPV-2c was the most prevalent variant (54.7%), confirming the spread of this variant in America. Ecuadorian CPV-2c strains clustered in two lineages, which represent the first evidence of polyphyletic CPV-2c circulating in South America. CPV-2a strains constituted 41.5% of the samples and clustered in a single lineage. The two detected CPV-2b strains (3.8%) were clearly polyphyletic and appeared related to Ecuadorian CPV-2a or foreign CPV-2b strains. Besides the substitution at residue 426 that is used to identify the variants, two amino acid changes occurred in Ecuadorian strains: Val139Iso and Thr440Ser. Ser(440) occurred in a biologically relevant domain of VP2 and is here described for the first time in CPV. The associations of Ecuadorian CPV-2c and CPV-2a with clinical symptoms indicate that dull mentation, hemorrhagic gastroenteritis and hypothermia occurred more frequently in infection with CPV-2c than with CPV-2a. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure.

    Science.gov (United States)

    Zappi, Daniela C; Moro, Marcelo F; Meagher, Thomas R; Nic Lughadha, Eimear

    2017-01-01

    Old, climate-buffered infertile landscapes (Ocbils) have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil's campos rupestres (rupestrian grasslands) are home to almost 15% of Brazil's native flora in less than 0.8% of Brazil's territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ) and on ironstone substrates, commonly termed canga . Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC), which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be effective

  3. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure

    Directory of Open Access Journals (Sweden)

    Daniela C. Zappi

    2017-12-01

    Full Text Available Old, climate-buffered infertile landscapes (Ocbils have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil’s campos rupestres (rupestrian grasslands are home to almost 15% of Brazil’s native flora in less than 0.8% of Brazil’s territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ and on ironstone substrates, commonly termed canga. Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC, which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be

  4. Consistent patterns of high alpha and low beta diversity in tropical parasitic and free-living protists.

    Science.gov (United States)

    Lentendu, Guillaume; Mahé, Frédéric; Bass, David; Rueckert, Sonja; Stoeck, Thorsten; Dunthorn, Micah

    2018-05-30

    Tropical animals and plants are known to have high alpha diversity within forests, but low beta diversity between forests. By contrast, it is unknown whether microbes inhabiting the same ecosystems exhibit similar biogeographic patterns. To evaluate the biogeographies of tropical protists, we used metabarcoding data of species sampled in the soils of three lowland Neotropical rainforests. Taxa-area and distance-decay relationships for three of the dominant protist taxa and their subtaxa were estimated at both the OTU and phylogenetic levels, with presence-absence and abundance-based measures. These estimates were compared to null models. High local alpha and low regional beta diversity patterns were consistently found for both the parasitic Apicomplexa and the largely free-living Cercozoa and Ciliophora. Similar to animals and plants, the protists showed spatial structures between forests at the OTU and phylogenetic levels, and only at the phylogenetic level within forests. These results suggest that the biogeographies of macro- and micro-organismal eukaryotes in lowland Neotropical rainforests are partially structured by the same general processes. However, and unlike the animals and plants, the protist OTUs did not exhibit spatial structures within forests, which hinders our ability to estimate the local and regional diversity of protists in tropical forests. © 2018 John Wiley & Sons Ltd.

  5. Phylogenetic impoverishment of Amazonian tree communities in an experimentally fragmented forest landscape.

    Science.gov (United States)

    Santos, Bráulio A; Tabarelli, Marcelo; Melo, Felipe P L; Camargo, José L C; Andrade, Ana; Laurance, Susan G; Laurance, William F

    2014-01-01

    Amazonian rainforests sustain some of the richest tree communities on Earth, but their ecological and evolutionary responses to human threats remain poorly known. We used one of the largest experimental datasets currently available on tree dynamics in fragmented tropical forests and a recent phylogeny of angiosperms to test whether tree communities have lost phylogenetic diversity since their isolation about two decades previously. Our findings revealed an overall trend toward phylogenetic impoverishment across the experimentally fragmented landscape, irrespective of whether tree communities were in 1-ha, 10-ha, or 100-ha forest fragments, near forest edges, or in continuous forest. The magnitude of the phylogenetic diversity loss was low (phylogenetic diversity, we observed a significant decrease of 50% in phylogenetic dispersion since forest isolation, irrespective of plot location. Analyses based on tree genera that have significantly increased (28 genera) or declined (31 genera) in abundance and basal area in the landscape revealed that increasing genera are more phylogenetically related than decreasing ones. Also, the loss of phylogenetic diversity was greater in tree communities where increasing genera proliferated and decreasing genera reduced their importance values, suggesting that this taxonomic replacement is partially underlying the phylogenetic impoverishment at the landscape scale. This finding has clear implications for the current debate about the role human-modified landscapes play in sustaining biodiversity persistence and key ecosystem services, such as carbon storage. Although the generalization of our findings to other fragmented tropical forests is uncertain, it could negatively affect ecosystem productivity and stability and have broader impacts on coevolved organisms.

  6. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  7. Phylogenetic analysis of New Zealand earthworms (Oligochaeta: Megascolecidae) reveals ancient clades and cryptic taxonomic diversity.

    Science.gov (United States)

    Buckley, Thomas R; James, Sam; Allwood, Julia; Bartlam, Scott; Howitt, Robyn; Prada, Diana

    2011-01-01

    We have constructed the first ever phylogeny for the New Zealand earthworm fauna (Megascolecinae and Acanthodrilinae) including representatives from other major continental regions. Bayesian and maximum likelihood phylogenetic trees were constructed from 427 base pairs from the mitochondrial large subunit (16S) rRNA gene and 661 base pairs from the nuclear large subunit (28S) rRNA gene. Within the Acanthodrilinae we were able to identify a number of well-supported clades that were restricted to continental landmasses. Estimates of nodal support for these major clades were generally high, but relationships among clades were poorly resolved. The phylogenetic analyses revealed several independent lineages in New Zealand, some of which had a comparable phylogenetic depth to monophyletic groups sampled from Madagascar, Africa, North America and Australia. These results are consistent with at least some of these clades having inhabited New Zealand since rifting from Gondwana in the Late Cretaceous. Within the New Zealand Acanthodrilinae, major clades tended to be restricted to specific regions of New Zealand, with the central North Island and Cook Strait representing major biogeographic boundaries. Our field surveys of New Zealand and subsequent identification has also revealed extensive cryptic taxonomic diversity with approximately 48 new species sampled in addition to the 199 species recognized by previous authors. Our results indicate that further survey and taxonomic work is required to establish a foundation for future biogeographic and ecological research on this vitally important component of the New Zealand biota. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  9. Activity and Phylogenetic Diversity of Bacterial Cells with High and Low Nucleic Acid Content and Electron Transport System Activity in an Upwelling Ecosystem

    OpenAIRE

    Longnecker, K.; Sherr, B. F.; Sherr, E. B.

    2005-01-01

    We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters...

  10. The Fair Proportion is a Shapley Value on phylogenetic networks too

    OpenAIRE

    Coronado, Tomás M.; Riera, Gabriel; Rosselló, Francesc

    2018-01-01

    The Fair Proportion of a species in a phylogenetic tree is a very simple measure that has been used to assess its value relative to the overall phylogenetic diversity represented by the tree. It has recently been proved by Fuchs and Jin to be equal to the Shapley Value of the coallitional game that sends each subset of species to its rooted Phylogenetic Diversity in the tree. We prove in this paper that this result extends to the natural translations of the Fair Proportion and the rooted Phyl...

  11. Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.

    Directory of Open Access Journals (Sweden)

    Luis F Aguirre

    Full Text Available Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups. Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for

  12. Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.

    Science.gov (United States)

    Aguirre, Luis F; Montaño-Centellas, Flavia A; Gavilanez, M Mercedes; Stevens, Richard D

    2016-01-01

    Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups). Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement) was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia) create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for patterns of functional

  13. Phylogenetic Diversity of Archaea and Bacteria in the Anoxic Zone of a Meromictic Lake (Lake Pavin, France)▿ †

    Science.gov (United States)

    Lehours, Anne-Catherine; Evans, Paul; Bardot, Corinne; Joblin, Keith; Gérard, Fonty

    2007-01-01

    The compositions of archaeal and bacterial populations at different depths (60 m [mixolimnion-chemocline interface], 70 m [chemocline-subchemocline interface], 90 m, and 92 m [the water-sediment interface]) in the anoxic zone of the water column in Lake Pavin, a freshwater permanently stratified mountain lake in France, were determined. Phylogenetic trees were constructed from sequences to assess archaeal and bacterial diversity at the four sites. PMID:17261512

  14. Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

    Science.gov (United States)

    Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

    2003-01-01

    The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

  15. Phylogenetic diversity analysis of Trichoderma species based on ...

    African Journals Online (AJOL)

    vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...

  16. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan

    2014-05-12

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  17. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan; Yang, Chen; Horn, Hannes; Hajjar, Dina A.; Ravasi, Timothy; Hentschel, Ute

    2014-01-01

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  18. The influence of biogeographic history on the functional and phylogenetic diversity of passerine birds in savannas and forests of the Brazilian Amazon.

    Science.gov (United States)

    Almeida, Sara Miranda; Juen, Leandro; Sobral, Fernando Landa; Santos, Marcos Pérsio Dantas

    2018-04-01

    Passeriformes is the largest and most diverse avian order in the world and comprises the Passeri and Tyranni suborders. These suborders constitute a monophyletic group, but differ in their ecology and history of occupation of South America. We investigated the influence of biogeographic history on functional and phylogenetic diversities of Passeri and Tyranni in forest and savanna habitats in the Brazilian Amazon. We compiled species composition data for 34 Passeriformes assemblages, 12 in savannas and 22 in forests. We calculated the functional (Rao's quadratic entropy, FD Q ) and phylogenetic diversities (mean pairwise distance, MPD, and mean nearest taxon distance, MNTD), and the functional beta diversity to investigate the potential role of biogeographic history in shaping ecological traits and species lineages of both suborders. The functional diversity of Passeri was higher than for Tyranni in both habitats. The MPD for Tyranni was higher than for Passeri in forests; however, there was no difference between the suborders in savannas. In savannas, Passeri presented higher MNTD than Tyranni, while in forest areas, Tyranni assemblages showed higher MNTD than Passeri. We found a high functional turnover (~75%) between Passeri and Tyranni in both habitats. The high functional diversity of Passeri in both habitats is due to the high diversity of ecological traits exhibited by species of this group, which enables the exploitation of a wide variety of resources and foraging strategies. The higher Tyranni MPD and MNTD in forests is likely due to Tyranni being older settlers in this habitat, resulting in the emergence and persistence of more lineages. The higher Passeri MNTD in savannas can be explained by the existence of a larger number of different Passeri lineages adapted to this severe habitat. The high functional turnover between the suborders in both habitats suggests an ecological strategy to avoid niche overlap.

  19. Diversity of heavy metal resistant bacteria from Kalimas Surabaya: A phylogenetic taxonomy approach

    Science.gov (United States)

    Zulaika, Enny; Utomo, Andry Prio; Prima, Adisya; Alami, Nur Hidayatul; Kuswytasari, Nengah Dwianita; Shovitri, Maya; Sembiring, Langkah

    2017-06-01

    Bacterial resistance to heavy metal is a genetic and physiological adaptation to the environment which contaminated by heavy metal. Kalimas is an important river in Surabaya that is contaminated by some heavy metals and probably as a habitat for heavy metal resistance bacteria. Bacterial resistance to heavy metals are different for each species, and their diversity can be studied by phylogenetic taxonomy approach. Isolates screening was done using nutrient agar which contained 1 mg/L HgCl2, CdCl2 and K2Cr2O7. Bacterial viability were observed by nutrient broth which contained 10 mg/L HgCl2, 30 mg/L CdCl2 and 50 mg/L K2Cr2O7. Isolates that resistant to heavy metal and viable after exposure to heavy metal were identified using 16S rRNA gene marker by Polymerase Chain Reaction (PCR). Phylogenetic tree reconstruction was done by the neighbor-joining algorithm. Genetic assignment showed isolates that resist and viable after exposure of Hg, Cd and Cr are Bacillus S1, SS19 and DA11. Based on BLAST analysis from NCBI gene bank, 16S rRNA sequences, those isolates were similar with the member of Bacillus cereus. Depend on 16S rRNA nucleotide alignment by the neighbor-joining algorithm, Bacillus S1, SS19 and DA11 were belong to Bacillus cereus sensu-lato group.

  20. Valuing local diversity in palliative care: translating the concept.

    Science.gov (United States)

    Quinn, Sharon; Hickey, Deb

    The contemporary challenges associated with addressing diversity, ethnicity, equality and accessibility in today's healthcare economy, sometimes lead to a reactive response where service providers strive to apply these concepts in practice. This article describes establishing a group that could engage with the broadest spectrum of the local community in ways that would make a lasting and meaningful difference to the local population, including how individuals and groups engage with and access palliative care services. The Valuing Local Diversity in Palliative Care Group was formed in May 2006. The group, whose membership is composed of statutory and voluntary services and members of various community groups, has promoted some innovative and creative partnerships.

  1. Chemical similarity and local community assembly in the species rich tropical genus Piper.

    Science.gov (United States)

    Salazar, Diego; Jaramillo, M Alejandra; Marquis, Robert J

    2016-11-01

    Community ecologists have strived to find mechanisms that mediate the assembly of natural communities. Recent evidence suggests that natural enemies could play an important role in the assembly of hyper-diverse tropical plant systems. Classic ecological theory predicts that in order for coexistence to occur, species differences must be maximized across biologically important niche dimensions. For plant-herbivore interactions, it has been recently suggested that, within a particular community, plant species that maximize the difference in chemical defense profiles compared to neighboring taxa will have a relative competitive advantage. Here we tested the hypothesis that plant chemical diversity can affect local community composition in the hyper-diverse genus Piper at a lowland wet forest location in Costa Rica. We first characterized the chemical composition of 27 of the most locally abundant species of Piper. We then tested whether species with different chemical compositions were more likely to coexist. Finally, we assessed the degree to which Piper phylogenetic relationships are related to differences in secondary chemical composition and community assembly. We found that, on average, co-occurring species were more likely to differ in chemical composition than expected by chance. Contrary to expectations, there was no phylogenetic signal for overall secondary chemical composition. In addition we found that species in local communities were, on average, more phylogenetically closely related than expected by chance, suggesting that functional traits other than those measured here also influence local assembly. We propose that selection by herbivores for divergent chemistries between closely related species facilitates the coexistence of a high diversity of congeneric taxa via apparent competition. © 2016 by the Ecological Society of America.

  2. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  3. Estimating phylogenetic trees from genome-scale data.

    Science.gov (United States)

    Liu, Liang; Xi, Zhenxiang; Wu, Shaoyuan; Davis, Charles C; Edwards, Scott V

    2015-12-01

    The heterogeneity of signals in the genomes of diverse organisms poses challenges for traditional phylogenetic analysis. Phylogenetic methods known as "species tree" methods have been proposed to directly address one important source of gene tree heterogeneity, namely the incomplete lineage sorting that occurs when evolving lineages radiate rapidly, resulting in a diversity of gene trees from a single underlying species tree. Here we review theory and empirical examples that help clarify conflicts between species tree and concatenation methods, and misconceptions in the literature about the performance of species tree methods. Considering concatenation as a special case of the multispecies coalescent model helps explain differences in the behavior of the two methods on phylogenomic data sets. Recent work suggests that species tree methods are more robust than concatenation approaches to some of the classic challenges of phylogenetic analysis, including rapidly evolving sites in DNA sequences and long-branch attraction. We show that approaches, such as binning, designed to augment the signal in species tree analyses can distort the distribution of gene trees and are inconsistent. Computationally efficient species tree methods incorporating biological realism are a key to phylogenetic analysis of whole-genome data. © 2015 New York Academy of Sciences.

  4. Landscape Patterns in Rainforest Phylogenetic Signal: Isolated Islands of Refugia or Structured Continental Distributions?

    Science.gov (United States)

    Kooyman, Robert M.; Rossetto, Maurizio; Sauquet, Hervé; Laffan, Shawn W.

    2013-01-01

    Objectives Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. Methods We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD), phylogenetic endemism (PE) and phylogenetic structure (net relatedness index; NRI). Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. Results Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance) in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. Conclusions/Significance Concentrations of rainforest evolutionary history (phylo-diversity) were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community distribution, our findings of

  5. Landscape patterns in rainforest phylogenetic signal: isolated islands of refugia or structured continental distributions?

    Directory of Open Access Journals (Sweden)

    Robert M Kooyman

    Full Text Available OBJECTIVES: Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. METHODS: We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD, phylogenetic endemism (PE and phylogenetic structure (net relatedness index; NRI. Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. RESULTS: Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. CONCLUSIONS/SIGNIFICANCE: Concentrations of rainforest evolutionary history (phylo-diversity were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community

  6. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  7. Community phylogenetics at the biogeographical scale: cold tolerance, niche conservatism and the structure of North American forests.

    Science.gov (United States)

    Hawkins, Bradford A; Rueda, Marta; Rangel, Thiago F; Field, Richard; Diniz-Filho, José Alexandre F; Linder, Peter

    2014-01-01

    Aim The fossil record has led to a historical explanation for forest diversity gradients within the cool parts of the Northern Hemisphere, founded on a limited ability of woody angiosperm clades to adapt to mid-Tertiary cooling. We tested four predictions of how this should be manifested in the phylogenetic structure of 91,340 communities: (1) forests to the north should comprise species from younger clades (families) than forests to the south; (2) average cold tolerance at a local site should be associated with the mean family age (MFA) of species; (3) minimum temperature should account for MFA better than alternative environmental variables; and (4) traits associated with survival in cold climates should evolve under a niche conservatism constraint. Location The contiguous United States. Methods We extracted angiosperms from the US Forest Service's Forest Inventory and Analysis database. MFA was calculated by assigning age of the family to which each species belongs and averaging across the species in each community. We developed a phylogeny to identify phylogenetic signal in five traits: realized cold tolerance, seed size, seed dispersal mode, leaf phenology and height. Phylogenetic signal representation curves and phylogenetic generalized least squares were used to compare patterns of trait evolution against Brownian motion. Eleven predictors structured at broad or local scales were generated to explore relationships between environment and MFA using random forest and general linear models. Results Consistent with predictions, (1) southern communities comprise angiosperm species from older families than northern communities, (2) cold tolerance is the trait most strongly associated with local MFA, (3) minimum temperature in the coldest month is the environmental variable that best describes MFA, broad-scale variables being much stronger correlates than local-scale variables, and (4) the phylogenetic structures of cold tolerance and at least one other trait

  8. Palaeoamyda messeliana nov. comb. (Testudines, Pan-Trionychidae) from the Eocene Messel Pit and Geiseltal localities, Germany, taxonomic and phylogenetic insights.

    Science.gov (United States)

    Cadena, Edwin

    2016-01-01

    Abundant pan-trionychid (soft-shell) turtles specimens have been found in Eocene sequences of central Europe, particularly from two localities in Germany, the Messel Pit (a UNESCO World Natural Heritage Site) and Geiseltal, traditionally attributed to Trionyx messelianus or Rafetoides austriacus . Over the last two decades new specimens of this taxon from these two localities have been discovered and fully prepared. However, they have remained unstudied, as well as their phylogenetic position inside Pan-Trionychidae is unknown. Five new specimens of Palaeoamyda messeliana nov. comb. from Messel Pit and Geiseltal localities are fully described here. A revised diagnosis for the species is also presented here, together with its inclusion in a phylogenetic analysis of Pan-Trionychidae that shows that this species is sister to the extant Amyda cartilaginea , one of the most abundant pan-trionychid (soft-shell) turtles from Asia, both members of the clade Chitrini. The specimens described in here are among the best and most complete fossil pan-trionychid skeletons so far known.

  9. Phylogenetic diversity and genotypical complexity of H9N2 influenza A viruses revealed by genomic sequence analysis.

    Directory of Open Access Journals (Sweden)

    Guoying Dong

    Full Text Available H9N2 influenza A viruses have become established worldwide in terrestrial poultry and wild birds, and are occasionally transmitted to mammals including humans and pigs. To comprehensively elucidate the genetic and evolutionary characteristics of H9N2 influenza viruses, we performed a large-scale sequence analysis of 571 viral genomes from the NCBI Influenza Virus Resource Database, representing the spectrum of H9N2 influenza viruses isolated from 1966 to 2009. Our study provides a panoramic framework for better understanding the genesis and evolution of H9N2 influenza viruses, and for describing the history of H9N2 viruses circulating in diverse hosts. Panorama phylogenetic analysis of the eight viral gene segments revealed the complexity and diversity of H9N2 influenza viruses. The 571 H9N2 viral genomes were classified into 74 separate lineages, which had marked host and geographical differences in phylogeny. Panorama genotypical analysis also revealed that H9N2 viruses include at least 98 genotypes, which were further divided according to their HA lineages into seven series (A-G. Phylogenetic analysis of the internal genes showed that H9N2 viruses are closely related to H3, H4, H5, H7, H10, and H14 subtype influenza viruses. Our results indicate that H9N2 viruses have undergone extensive reassortments to generate multiple reassortants and genotypes, suggesting that the continued circulation of multiple genotypical H9N2 viruses throughout the world in diverse hosts has the potential to cause future influenza outbreaks in poultry and epidemics in humans. We propose a nomenclature system for identifying and unifying all lineages and genotypes of H9N2 influenza viruses in order to facilitate international communication on the evolution, ecology and epidemiology of H9N2 influenza viruses.

  10. The evolution of reproductive diversity in Afrobatrachia: A phylogenetic comparative analysis of an extensive radiation of African frogs

    Science.gov (United States)

    Portik, Daniel M.; Blackburn, David C.

    2016-01-01

    The reproductive modes of anurans (frogs and toads) are the most diverse of terrestrial vertebrates, and a major challenge is identifying selective factors that promote the evolution or retention of reproductive modes across clades. Terrestrialized anuran breeding strategies have evolved repeatedly from the plesiomorphic fully aquatic reproductive mode, a process thought to occur through intermediate reproductive stages. Several selective forces have been proposed for the evolution of terrestrialized reproductive traits, but factors such as water systems and co‐evolution with ecomorphologies have not been investigated. We examined these topics in a comparative phylogenetic framework using Afrobatrachian frogs, an ecologically and reproductively diverse clade representing more than half of the total frog diversity found in Africa (∼400 species). We infer direct development has evolved twice independently from terrestrialized reproductive modes involving subterranean or terrestrial oviposition, supporting evolution through intermediate stages. We also detect associations between specific ecomorphologies and oviposition sites, and demonstrate arboreal species exhibit an overall shift toward using lentic water systems for breeding. These results indicate that changes in microhabitat use associated with ecomorphology, which allow access to novel sites for reproductive behavior, oviposition, or larval development, may also promote reproductive mode diversity in anurans. PMID:27402182

  11. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008

    Directory of Open Access Journals (Sweden)

    Seon Young Choi

    2016-03-01

    Full Text Available An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997. Nontoxigenic (CTX− V. cholerae El Tor dominated toxigenic (CTX+ strains (2001 to 2003, but V. cholerae CTX+ variant El Tor was isolated during 2004 to 2008, outcompeting CTX−V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX+ El Tor, two were CTX− El Tor, and the remaining strain was a CTX+ classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX− isolate is ancestral to the 6th and 7th pandemic CTX+V. cholerae isolates. The other CTX− isolate joined with CTX− non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX+ isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX+ El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX+ El Tor isolate contained West African-South American (WASA recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity.

  12. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Science.gov (United States)

    Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633

  13. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Directory of Open Access Journals (Sweden)

    Marisa Skaljac

    2017-10-01

    Full Text Available Bemisia tabaci (Gennadius, Trialeurodes vaporariorum (Westwood, and Siphoninus phillyreae (Haliday are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia, which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.

  14. Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

    Science.gov (United States)

    Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

    2013-01-01

    The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

  15. Long-term organic-inorganic fertilization ensures great soil productivity and bacterial diversity after natural-to-agricultural ecosystem conversion.

    Science.gov (United States)

    Xun, Weibing; Xu, Zhihui; Li, Wei; Ren, Yi; Huang, Ting; Ran, Wei; Wang, Boren; Shen, Qirong; Zhang, Ruifu

    2016-09-01

    Natural ecosystems comprise the planet's wild plant and animal resources, but large tracts of land have been converted to agroecosystems to support the demand for agricultural products. This conversion limits the number of plant species and decreases the soil biological diversity. Here we used high-throughput 16S rRNA gene sequencing to evaluate the responses of soil bacterial communities in long-term converted and fertilized red soils (a type of Ferralic Cambisol). We observed that soil bacterial diversity was strongly affected by different types of fertilization management. Oligotrophic bacterial taxa demonstrated large relative abundances in chemically fertilized soil, whereas copiotrophic bacterial taxa were found in large relative abundances in organically fertilized and fallow management soils. Only organic-inorganic fertilization exhibited the same local taxonomic and phylogenetic diversity as that of a natural ecosystem. However, the independent use of organic or inorganic fertilizer reduced local taxonomic and phylogenetic diversity and caused biotic homogenization. This study demonstrated that the homogenization of bacterial communities caused by natural-to-agricultural ecosystem conversion can be mitigated by employing rational organic-inorganic fertilization management.

  16. Fire modifies the phylogenetic structure of soil bacterial co-occurrence networks.

    Science.gov (United States)

    Pérez-Valera, Eduardo; Goberna, Marta; Faust, Karoline; Raes, Jeroen; García, Carlos; Verdú, Miguel

    2017-01-01

    Fire alters ecosystems by changing the composition and community structure of soil microbes. The phylogenetic structure of a community provides clues about its main assembling mechanisms. While environmental filtering tends to reduce the community phylogenetic diversity by selecting for functionally (and hence phylogenetically) similar species, processes like competitive exclusion by limiting similarity tend to increase it by preventing the coexistence of functionally (and phylogenetically) similar species. We used co-occurrence networks to detect co-presence (bacteria that co-occur) or exclusion (bacteria that do not co-occur) links indicative of the ecological interactions structuring the community. We propose that inspecting the phylogenetic structure of co-presence or exclusion links allows to detect the main processes simultaneously assembling the community. We monitored a soil bacterial community after an experimental fire and found that fire altered its composition, richness and phylogenetic diversity. Both co-presence and exclusion links were more phylogenetically related than expected by chance. We interpret such a phylogenetic clustering in co-presence links as a result of environmental filtering, while that in exclusion links reflects competitive exclusion by limiting similarity. This suggests that environmental filtering and limiting similarity operate simultaneously to assemble soil bacterial communities, widening the traditional view that only environmental filtering structures bacterial communities. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Environmental determinants and spatial mismatch of mammal diversity measures in Colombia

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Maya, J.F.; Arias-Alzate, A.; Granados-Peña, R.; Mancera-Rodriguez, N.J.; Ceballos, G.

    2016-07-01

    Including complementary diversity measures into ecological and conservation studies should improve our ability to link species assemblages to ecosystems. Recent measures such as phylogenetic and functional diversity have furthered our understanding of assemblage patterns of ecosystems and species, allowing improved inference of ecosystem function and conservation. We evaluated spatial patterns of taxonomic, phylogenetic and functional diversity of mammals in Colombia and identified their main environmental determinants, as well as interrelationships and spatial mismatch between the three measures. We found significant effects of elevation and precipitation on species richness, slope and species richness on phylogenetic diversity, and slope and phylogenetic diversity on functional diversity. We also identified a spatial mismatch of the three measures in some areas of the country: 12% of the country for species richness and 14% for phylogenetic and functional diversity. Our results highlight the importance of including species relationships within environmental drivers with biogeographical and distribution analyses and could facilitate selection of priority areas for conservation, especially when mismatch occurs between measures. (Author)

  18. What Shapes the Phylogenetic Structure of Anuran Communities in a Seasonal Environment? The Influence of Determinism at Regional Scale to Stochasticity or Antagonistic Forces at Local Scale.

    Science.gov (United States)

    Martins, Clarissa de Araújo; Roque, Fabio de Oliveira; Santos, Bráulio A; Ferreira, Vanda Lúcia; Strüssmann, Christine; Tomas, Walfrido Moraes

    2015-01-01

    Ecological communities are structured by both deterministic and stochastic processes. We investigated phylogenetic patterns at regional and local scales to understand the influences of seasonal processes in shaping the structure of anuran communities in the southern Pantanal wetland, Brazil. We assessed the phylogenetic structure at different scales, using the Net Relatedness Index (NRI), the Nearest Taxon Index (NTI), and phylobetadiversity indexes, as well as a permutation test, to evaluate the effect of seasonality. The anuran community was represented by a non-random set of species with a high degree of phylogenetic relatedness at the regional scale. However, at the local scale the phylogenetic structure of the community was weakly related with the seasonality of the system, indicating that oriented stochastic processes (e.g. colonization, extinction and ecological drift) and/or antagonist forces drive the structure of such communities in the southern Pantanal.

  19. Peptide-Like Nylon-3 Polymers with Activity against Phylogenetically Diverse, Intrinsically Drug-Resistant Pathogenic Fungi.

    Science.gov (United States)

    Rank, Leslie A; Walsh, Naomi M; Lim, Fang Yun; Gellman, Samuel H; Keller, Nancy P; Hull, Christina M

    2018-01-01

    Understanding the dimensions of fungal diversity has major implications for the control of diseases in humans, plants, and animals and in the overall health of ecosystems on the planet. One ancient evolutionary strategy organisms use to manage interactions with microbes, including fungi, is to produce host defense peptides (HDPs). HDPs and their synthetic analogs have been subjects of interest as potential therapeutic agents. Due to increases in fungal disease worldwide, there is great interest in developing novel antifungal agents. Here we describe activity of polymeric HDP analogs against fungi from 18 pathogenic genera composed of 41 species and 72 isolates. The synthetic polymers are members of the nylon-3 family (poly-β-amino acid materials). Three different nylon-3 polymers show high efficacy against surprisingly diverse fungi. Across the phylogenetic spectrum (with the exception of Aspergillus species), yeasts, dermatophytes, dimorphic fungi, and molds were all sensitive to the effects of these polymers. Even fungi intrinsically resistant to current antifungal drugs, such as the causative agents of mucormycosis ( Rhizopus spp.) and those with acquired resistance to azole drugs, showed nylon-3 polymer sensitivity. In addition, the emerging pathogens Pseudogymnoascus destructans (cause of white nose syndrome in bats) and Candida auris (cause of nosocomial infections of humans) were also sensitive. The three nylon-3 polymers exhibited relatively low toxicity toward mammalian cells. These findings raise the possibility that nylon-3 polymers could be useful against fungi for which there are only limited and/or no antifungal agents available at present. IMPORTANCE Fungi reside in all ecosystems on earth and impart both positive and negative effects on human, plant, and animal health. Fungal disease is on the rise worldwide, and there is a critical need for more effective and less toxic antifungal agents. Nylon-3 polymers are short, sequence random, poly

  20. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation

    OpenAIRE

    Guevara Andino, Juan Ernesto; Pitman, Nigel C. A.; ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V. A.

    2017-01-01

    Abstract Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one‐hectare plots in terra firme forests of Ecuadorian Amazon. In these plots...

  1. Palaeoamyda messeliana nov. comb. (Testudines, Pan-Trionychidae from the Eocene Messel Pit and Geiseltal localities, Germany, taxonomic and phylogenetic insights

    Directory of Open Access Journals (Sweden)

    Edwin Cadena

    2016-10-01

    Full Text Available Background Abundant pan-trionychid (soft-shell turtles specimens have been found in Eocene sequences of central Europe, particularly from two localities in Germany, the Messel Pit (a UNESCO World Natural Heritage Site and Geiseltal, traditionally attributed to Trionyx messelianus or Rafetoides austriacus. Over the last two decades new specimens of this taxon from these two localities have been discovered and fully prepared. However, they have remained unstudied, as well as their phylogenetic position inside Pan-Trionychidae is unknown. Results Five new specimens of Palaeoamyda messeliana nov. comb. from Messel Pit and Geiseltal localities are fully described here. A revised diagnosis for the species is also presented here, together with its inclusion in a phylogenetic analysis of Pan-Trionychidae that shows that this species is sister to the extant Amyda cartilaginea, one of the most abundant pan-trionychid (soft-shell turtles from Asia, both members of the clade Chitrini. The specimens described in here are among the best and most complete fossil pan-trionychid skeletons so far known.

  2. A Phylogenetic and Phenotypic Analysis of Salmonella enterica Serovar Weltevreden, an Emerging Agent of Diarrheal Disease in Tropical Regions.

    Directory of Open Access Journals (Sweden)

    Carine Makendi

    2016-02-01

    Full Text Available Salmonella enterica serovar Weltevreden (S. Weltevreden is an emerging cause of diarrheal and invasive disease in humans residing in tropical regions. Despite the regional and international emergence of this Salmonella serovar, relatively little is known about its genetic diversity, genomics or virulence potential in model systems. Here we used whole genome sequencing and bioinformatics analyses to define the phylogenetic structure of a diverse global selection of S. Weltevreden. Phylogenetic analysis of more than 100 isolates demonstrated that the population of S. Weltevreden can be segregated into two main phylogenetic clusters, one associated predominantly with continental Southeast Asia and the other more internationally dispersed. Subcluster analysis suggested the local evolution of S. Weltevreden within specific geographical regions. Four of the isolates were sequenced using long read sequencing to produce high quality reference genomes. Phenotypic analysis in Hep-2 cells and in a murine infection model indicated that S. Weltevreden were significantly attenuated in these models compared to the classical S. Typhimurium reference strain SL1344. Our work outlines novel insights into this important emerging pathogen and provides a baseline understanding for future research studies.

  3. Phylogenetic structure of arbuscular mycorrhizal fungal communities along an elevation gradient.

    Science.gov (United States)

    Egan, Cameron P; Callaway, Ragan M; Hart, Miranda M; Pither, Jason; Klironomos, John

    2017-04-01

    Despite the importance of arbuscular mycorrhizal (AM) fungi within terrestrial ecosystems, we know little about how natural AM fungal communities are structured. To date, the majority of studies examining AM fungal community diversity have focused on single habitats with similar environmental conditions, with relatively few studies having assessed the diversity of AM fungi over large-scale environmental gradients. In this study, we characterized AM fungal communities in the soil along a high-elevation gradient in the North American Rocky Mountains. We focused on phylogenetic patterns of AM fungal communities to gain insight into how AM fungal communities are naturally assembled. We found that alpine AM fungal communities had lower phylogenetic diversity relative to lower elevation communities, as well as being more heterogeneous in composition than either treeline or subalpine communities. AM fungal communities were phylogenetically clustered at all elevations sampled, suggesting that environmental filtering, either selection by host plants or fungal niches, is the primary ecological process structuring communities along the gradient.

  4. Phylogenetic diversity of dissimilatory ferric iron reducers in paddy soil of Hunan, South China

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xin-Jun [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Graduate Univ., Chinese Academy of Sciences, BJ (China); Yang Jing; Chen Xue-Ping; Sun Guo-Xin [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Zhu Yong-Guan [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Key Lab. of Urban Environment and Health, Inst. of Urban Environment, Chinese Academy of Sciences, Xiamen (China)

    2009-12-15

    Purpose: Dissimilatory iron-reducing bacteria have been described by both culture-dependent and -independent methods in various environments, including freshwater, marine sediments, natural wetlands, and contaminated aquifers. However, little is known about iron-reducing microbial communities in paddy soils. The goal of this study was to characterize iron-reducing microbial communities in paddy soil. Moreover, the effect of dissolved and solid-phase iron (III) species on the iron-reducing microbial communities was also investigated by enrichment cultures. Methods: Ferric citrate and ferrihydrite were used respectively to set up enrichment cultures of dissimilatory ironreducing microorganisms using 1% inoculum of soil samples, and the iron reduction was measured. Moreover, bacterial DNA was extracted and 16S rRNA genes were PCR-amplified, and subsequently analyzed by the clone library and terminal restriction fragment length polymorphism (T-RFLP). Results: Phylogenetic analysis of 16S rRNA gene sequences extracted from the enrichment cultures revealed that Bradyrhizobium, Bacteroides, Clostridium and Ralstonia species were the dominant bacteria in the ferric citrate enrichment. However, members of the genera Clostridium, Bacteroides, and Geobacter were the dominant micro-organisms in the ferrihydrite enrichment. Analysis of enrichment cultures by T-RFLP strongly supported the cloning and sequencing results. Conclusions: The present study demonstrated that dissimilatory iron-reducing consortia in As-contaminated paddy soil are phylogenetically diverse. Moreover, iron (III) sources as a key factor have a strong effect on the iron (III)-reducing microbial community structure and relative abundance in the enrichments. In addition, Geobacter species are selectively enriched by ferrihydrite enrichment cultures. (orig.)

  5. Environmental determinants and spatial mismatch of mammal diversity measures in Colombia

    Directory of Open Access Journals (Sweden)

    González–Maya, J. F.

    2016-02-01

    Full Text Available Including complementary diversity measures into ecological and conservation studies should improve our ability to link species assemblages to ecosystems. Recent measures such as phylogenetic and functional diversity have furthered our understanding of assemblage patterns of ecosystems and species, allowing improved inference of ecosystem function and conservation. We evaluated spatial patterns of taxonomic, phylogenetic and functional diversity of mammals in Colombia and identified their main environmental determinants, as well as interrelationships and spatial mismatch between the three measures. We found significant effects of elevation and precipitation on species richness, slope and species richness on phylogenetic diversity, and slope and phylogenetic diversity on functional diversity. We also identified a spatial mismatch of the three measures in some areas of the country: 12% of the country for species richness and 14% for phylogenetic and functional diversity. Our results highlight the importance of including species relationships within environmental drivers with biogeographical and distribution analyses and could facilitate selection of priority areas for conservation, especially when mismatch occurs between measures.

  6. Conservation Action Based on Threatened Species Capture Taxonomic and Phylogenetic Richness in Breeding and Wintering Populations of Central Asian Birds

    Science.gov (United States)

    Schweizer, Manuel; Ayé, Raffael; Kashkarov, Roman; Roth, Tobias

    2014-01-01

    Although phylogenetic diversity has been suggested to be relevant from a conservation point of view, its role is still limited in applied nature conservation. Recently, the practice of investing conservation resources based on threatened species was identified as a reason for the slow integration of phylogenetic diversity in nature conservation planning. One of the main arguments is based on the observation that threatened species are not evenly distributed over the phylogenetic tree. However this argument seems to dismiss the fact that conservation action is a spatially explicit process, and even if threatened species are not evenly distributed over the phylogenetic tree, the occurrence of threatened species could still indicate areas with above average phylogenetic diversity and consequently could protect phylogenetic diversity. Here we aim to study the selection of important bird areas in Central Asia, which were nominated largely based on the presence of threatened bird species. We show that although threatened species occurring in Central Asia do not capture phylogenetically more distinct species than expected by chance, the current spatially explicit conservation approach of selecting important bird areas covers above average taxonomic and phylogenetic diversity of breeding and wintering birds. We conclude that the spatially explicit processes of conservation actions need to be considered in the current discussion of whether new prioritization methods are needed to complement conservation action based on threatened species. PMID:25337861

  7. Phylogenetic diversity of hpnP, the hopanoid methylase, and its implications for 2-methylhopanoids as biomarkers

    Science.gov (United States)

    Ricci, J. N.; Coleman, M. L.; Osburn, M. R.; Sessions, A. L.; Spear, J. R.; Newman, D. K.

    2011-12-01

    Hopanoids are a class of sterols produced by bacteria. Their hydrocarbon skeletons are resistant to degradation making their diagenetic products, hopanes, attractive biomarkers. Particular attention has been paid to 2-methylhopanes, which have been found at discrete times and locations in Earth history as far back as 2,500 Myr. Previously, they were inferred to be markers of oxygenic photosynthesis in cyanobacteria, but the discovery of an anoxygenic phototroph, Rhodopseudomonas palustris TIE-1, capable of producing significant quantities of 2-methylbacteriohopanetetrol, the parent molecule of the fossil 2-methylhopane, challenged this interpretation. In this study, we sought to determine the diversity and origin of the enzyme responsible for methylating hopanoids, HpnP. To accomplish this task, we surveyed a diversity of Yellowstone hot springs using degenerate PCR primers and searched publically available metagenomic databases for hpnP-like sequences. The Yellowstone hot spring samples were dominated by cyanobacterial-like hpnP sequences, while the metagenomic data contained many hpnP-like sequences from a diversity of environments that grouped with all known hpnP-containing phyla. With these additional hpnP sequences, we will report updated phylogenetic trees that attempt to determine the origin of hpnP. Understanding the distribution of 2-methylhopanoid production throughout the tree of life and its origin is important to be able to use 2-methylhopanes as biomarkers for any particular taxonomic group.

  8. Phylogenetic and population genetic analyses of diploid Leucaena (Leguminosae; Mimosoideae) reveal cryptic species diversity and patterns of divergent allopatric speciation.

    Science.gov (United States)

    Govindarajulu, Rajanikanth; Hughes, Colin E; Bailey, C Donovan

    2011-12-01

    Leucaena comprises 17 diploid species, five tetraploid species, and a complex series of hybrids whose evolutionary histories have been influenced by human seed translocation, cultivation, and subsequent spontaneous hybridization. Here we investigated patterns of evolutionary divergence among diploid Leucaena through comprehensively sampled multilocus phylogenetic and population genetic approaches to address species delimitation, interspecific relationships, hybridization, and the predominant mode of speciation among diploids. Parsimony- and maximum-likelihood-based phylogenetic approaches were applied to 59 accessions sequenced for six SCAR-based nuclear loci, nrDNA ITS, and four cpDNA regions. Population genetic comparisons included 1215 AFLP loci representing 42 populations and 424 individuals. Phylogenetic results provided a well-resolved hypothesis of divergent species relationships, recovering previously recognized clades of diploids as well as newly resolved relationships. Phylogenetic and population genetic assessments identified two cryptic species that are consistent with geography and morphology. Findings from this study highlight the importance and utility of multilocus data in the recovery of complex evolutionary histories. The results are consistent with allopatric divergence representing the predominant mode of speciation among diploid Leucaena. These findings contrast with the potential hybrid origin of several tetraploid species and highlight the importance of human translocation of seed to the origin of these tetraploids. The recognition of one previously unrecognized species (L. cruziana) and the elevation of another taxon (L. collinsii subsp. zacapana) to specific status (L. zacapana) is consistent with a growing number of newly diagnosed species from neotropical seasonally dry forests, suggesting these communities harbor greater species diversity than previously recognized.

  9. Genetic diversity of five local Swedish chicken breeds detected by microsatellite markers.

    Directory of Open Access Journals (Sweden)

    Abiye Shenkut Abebe

    Full Text Available This study aimed at investigating the genetic diversity, relationship and population structure of 110 local Swedish chickens derived from five breeds (Gotlandshöna, Hedemorahöna, Öländsk dvärghöna, Skånsk blommehöna, and Bohuslän- Dals svarthöna, in the rest of the paper the shorter name Svarthöna is used using 24 microsatellite markers. In total, one hundred thirteen alleles were detected in all populations, with a mean of 4.7 alleles per locus. For the five chicken breeds, the observed and expected heterozygosity ranged from 0.225 to 0.408 and from 0.231 to 0.515, with the lowest scores for the Svarthöna and the highest scores for the Skånsk blommehöna breeds, respectively. Similarly, the average within breed molecular kinship varied from 0.496 to 0.745, showing high coancestry, with Skånsk blommehöna having the lowest and Svarthöna the highest coancestry. Furthermore, all breeds showed significant deviations from Hardy-Weinberg expectations. Across the five breeds, the global heterozygosity deficit (FIT was 0.545, population differentiation index (FST was 0.440, and the global inbreeding of individuals within breed (FIS was 0.187. The phylogenetic relationships of chickens were examined using neighbor-joining trees constructed at the level of breeds and individual samples. The neighbor-joining tree constructed at breed level revealed two main clusters, with Hedemorahöna and Öländsk dvärghöna breeds in one cluster, and Gotlandshöna and Svarthöna breeds in the second cluster leaving the Skånsk blommehöna in the middle. Based on the results of the STRUCTURE analysis, the most likely number of clustering of the five breeds was at K = 4, with Hedemorahöna, Gotlandshöna and Svarthöna breeds forming their own distinct clusters, while Öländsk dvärghöna and Skånsk blommehöna breeds clustered together. Losses in the overall genetic diversity of local Swedish chickens due to breeds extinction varied from -1.46% to -6

  10. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  11. The eastern Asian and eastern and western North American floristic disjunction: congruent phylogenetic patterns in seven diverse genera.

    Science.gov (United States)

    Xiang, Q Y; Soltis, D E; Soltis, P S

    1998-10-01

    One of the most remarkable examples of intercontinental disjunction of the North Temperate Flora involves eastern Asia and eastern and western North America. Although there has been considerable interest in this phytogeographic pattern for over 150 years (e.g., Gray, 1859; Li, 1952; Graham, 1972; Boufford and Spongberg, 1983; Wu, 1983; Tiffney, 1985a, 1985b), relationships among taxa displaying the disjunction remain obscure. Understanding phylogenetic relationships is, however, a prerequisite for historical biogeographic analyses of this distributional pattern. To understand better the relationships of taxa displaying this intercontinental disjunction, phylogenetic analyses were conducted using a variety of DNA data sets for species of four genera (Cornus, Boykinia, Tiarella, and Trautvetteria) that occur in eastern Asia, eastern North America, and western North America. An area cladogram was constructed for each of the four genera, all of which show a similar pattern of relationship: the eastern Asian species are sister to all North American species. An identical phylogenetic pattern is also found in three other taxa exhibiting this disjunction (Aralia sect. Aralia, Calycanthus, and Adiantum pedatum). The congruent phylogenetic pattern found in these seven diverse genera raises the possibility of a common origin of the eastern Asia, eastern and western North America disjunction. The data are in agreement with the long-standing hypothesis that this well-known floristic disjunction represents the fragmentation of a once continuous Mixed Mesophytic forest community and suggest that the disjunction may have involved only two major vicariance events: an initial split between Eurasia and North America, followed by the isolation of floras between eastern and western North America. However, congruence between phylogenies and geographic distributions does not necessarily indicate an identical phytogeographic history. Taxa exhibiting the same phylogenetic pattern may have

  12. On the Shapley Value of Unrooted Phylogenetic Trees.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-01-17

    The Shapley value, a solution concept from cooperative game theory, has recently been considered for both unrooted and rooted phylogenetic trees. Here, we focus on the Shapley value of unrooted trees and first revisit the so-called split counts of a phylogenetic tree and the Shapley transformation matrix that allows for the calculation of the Shapley value from the edge lengths of a tree. We show that non-isomorphic trees may have permutation-equivalent Shapley transformation matrices and permutation-equivalent null spaces. This implies that estimating the split counts associated with a tree or the Shapley values of its leaves does not suffice to reconstruct the correct tree topology. We then turn to the use of the Shapley value as a prioritization criterion in biodiversity conservation and compare it to a greedy solution concept. Here, we show that for certain phylogenetic trees, the Shapley value may fail as a prioritization criterion, meaning that the diversity spanned by the top k species (ranked by their Shapley values) cannot approximate the total diversity of all n species.

  13. Phylogenetic Variants of Rickettsia africae, and Incidental Identification of "Candidatus Rickettsia Moyalensis" in Kenya.

    Science.gov (United States)

    Kimita, Gathii; Mutai, Beth; Nyanjom, Steven Ger; Wamunyokoli, Fred; Waitumbi, John

    2016-07-01

    Rickettsia africae, the etiological agent of African tick bite fever, is widely distributed in sub-Saharan Africa. Contrary to reports of its homogeneity, a localized study in Asembo, Kenya recently reported high genetic diversity. The present study aims to elucidate the extent of this heterogeneity by examining archived Rickettsia africae DNA samples collected from different eco-regions of Kenya. To evaluate their phylogenetic relationships, archived genomic DNA obtained from 57 ticks a priori identified to contain R. africae by comparison to ompA, ompB and gltA genes was used to amplify five rickettsial genes i.e. gltA, ompA, ompB, 17kDa and sca4. The resulting amplicons were sequenced. Translated amino acid alignments were used to guide the nucleotide alignments. Single gene and concatenated alignments were used to infer phylogenetic relationships. Out of the 57 DNA samples, three were determined to be R. aeschlimanii and not R. africae. One sample turned out to be a novel rickettsiae and an interim name of "Candidatus Rickettsia moyalensis" is proposed. The bonafide R. africae formed two distinct clades. Clade I contained 9% of the samples and branched with the validated R. africae str ESF-5, while clade II (two samples) formed a distinct sub-lineage. This data supports the use of multiple genes for phylogenetic inferences. It is determined that, despite its recent emergence, the R. africae lineage is diverse. This data also provides evidence of a novel Rickettsia species, Candidatus Rickettsia moyalensis.

  14. Phylogenetic perspectives on reef fish functional traits.

    Science.gov (United States)

    Floeter, Sergio R; Bender, Mariana G; Siqueira, Alexandre C; Cowman, Peter F

    2018-02-01

    Functional traits have been fundamental to the evolution and diversification of entire fish lineages on coral reefs. Yet their relationship with the processes promoting speciation, extinction and the filtering of local species pools remains unclear. We review the current literature exploring the evolution of diet, body size, water column use and geographic range size in reef-associated fishes. Using published and new data, we mapped functional traits on to published phylogenetic trees to uncover evolutionary patterns that have led to the current functional diversity of fishes on coral reefs. When examining reconstructed patterns for diet and feeding mode, we found examples of independent transitions to planktivory across different reef fish families. Such transitions and associated morphological alterations may represent cases in which ecological opportunity for the exploitation of different resources drives speciation and adaptation. In terms of body size, reconstructions showed that both large and small sizes appear multiple times within clades of mid-sized fishes and that extreme body sizes have arisen mostly in the last 10 million years (Myr). The reconstruction of range size revealed many cases of disparate range sizes among sister species. Such range size disparity highlights potential vicariant processes through isolation in peripheral locations. When accounting for peripheral speciation processes in sister pairs, we found a significant relationship between labrid range size and lineage age. The diversity and evolution of traits within lineages is influenced by trait-environment interactions as well as by species and trait-trait interactions, where the presence of a given trait may trigger the development of related traits or behaviours. Our effort to assess the evolution of functional diversity across reef fish clades adds to the burgeoning research focusing on the evolutionary and ecological roles of functional traits. We argue that the combination of a

  15. Effects of phylogenetic reconstruction method on the robustness of species delimitation using single-locus data.

    Science.gov (United States)

    Tang, Cuong Q; Humphreys, Aelys M; Fontaneto, Diego; Barraclough, Timothy G; Paradis, Emmanuel

    2014-10-01

    Coalescent-based species delimitation methods combine population genetic and phylogenetic theory to provide an objective means for delineating evolutionarily significant units of diversity. The generalised mixed Yule coalescent (GMYC) and the Poisson tree process (PTP) are methods that use ultrametric (GMYC or PTP) or non-ultrametric (PTP) gene trees as input, intended for use mostly with single-locus data such as DNA barcodes. Here, we assess how robust the GMYC and PTP are to different phylogenetic reconstruction and branch smoothing methods. We reconstruct over 400 ultrametric trees using up to 30 different combinations of phylogenetic and smoothing methods and perform over 2000 separate species delimitation analyses across 16 empirical data sets. We then assess how variable diversity estimates are, in terms of richness and identity, with respect to species delimitation, phylogenetic and smoothing methods. The PTP method generally generates diversity estimates that are more robust to different phylogenetic methods. The GMYC is more sensitive, but provides consistent estimates for BEAST trees. The lower consistency of GMYC estimates is likely a result of differences among gene trees introduced by the smoothing step. Unresolved nodes (real anomalies or methodological artefacts) affect both GMYC and PTP estimates, but have a greater effect on GMYC estimates. Branch smoothing is a difficult step and perhaps an underappreciated source of bias that may be widespread among studies of diversity and diversification. Nevertheless, careful choice of phylogenetic method does produce equivalent PTP and GMYC diversity estimates. We recommend simultaneous use of the PTP model with any model-based gene tree (e.g. RAxML) and GMYC approaches with BEAST trees for obtaining species hypotheses.

  16. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  17. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  18. Phylogenetic diversity and environment-specific distributions of glycosyl hydrolase family 10 xylanases in geographically distant soils.

    Directory of Open Access Journals (Sweden)

    Guozeng Wang

    Full Text Available BACKGROUND: Xylan is one of the most abundant biopolymers on Earth. Its degradation is mediated primarily by microbial xylanase in nature. To explore the diversity and distribution patterns of xylanase genes in soils, samples of five soil types with different physicochemical characters were analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Partial xylanase genes of glycoside hydrolase (GH family 10 were recovered following direct DNA extraction from soil, PCR amplification and cloning. Combined with our previous study, a total of 1084 gene fragments were obtained, representing 366 OTUs. More than half of the OTUs were novel (identities of <65% with known xylanases and had no close relatives based on phylogenetic analyses. Xylanase genes from all the soil environments were mainly distributed in Bacteroidetes, Proteobacteria, Acidobacteria, Firmicutes, Actinobacteria, Dictyoglomi and some fungi. Although identical sequences were found in several sites, habitat-specific patterns appeared to be important, and geochemical factors such as pH and oxygen content significantly influenced the compositions of xylan-degrading microbial communities. CONCLUSION/SIGNIFICANCE: These results provide insight into the GH 10 xylanases in various soil environments and reveal that xylan-degrading microbial communities are environment specific with diverse and abundant populations.

  19. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  20. Genetic diversity and phylogenetic analysis of Tams1 of Theileria annulata isolates from three continents between 2000 and 2012.

    Science.gov (United States)

    Wang, Jiay; Yang, Xianyong; Wang, Yuge; Jing, Zhihong; Meng, Kai; Liu, Jianzhu; Guo, Huijun; Xu, Ruixue; Cheng, Ziqiang

    2014-01-01

    Theileria annulata, which is part of the Theileria sergenti/Theileria buffeli/Theileria orientalis group, preferentially infects cattle and results in high mortality and morbidity in the Mediterranean, Middle East, and Central Asia. The polypeptide Tams1 is an immunodominant major merozoite piroplasm surface antigen of T. annulata that could be used as a marker for epidemiological studies and phylogenetic analysis. In the present study, a total of 155 Tams1 sequences were investigated for genetic diversity and phylogenetic relationships through phylogenetic analysis. Results showed that the Tams1 sequences were divided into two major groups and that distribution for some isolates also exhibited geographic specificity. As targeting polymorphic genes for parasite detection may result in underestimation of infection, polymerase chain reaction (PCR) assay using two different probes targeting tams-1 genes of these two groups can be more credible. In addition, the direction of the spread of the disease was discovered to be from the Mediterranean or the tropical zone to the Eurasian peninsula, Middle East, Southern Asia, and Africa, particularly for Group 2. A similar occurrence was also found between the Ms1 gene of Theileria lestoquardi and the Tams1 gene of T. annulata, which explains cross-immunogenicity to a certain extent. However, no potential glycosylation site in the Tams1 of T. annulata was found in this study, which illustrated that instead of N-glycosylation, other modifications have more significant effects on the immunogenicity of the Tams1 protein.

  1. Rising prevalence of non-B HIV-1 subtypes in North Carolina and evidence for local onward transmission.

    Science.gov (United States)

    Dennis, Ann M; Hué, Stephane; Learner, Emily; Sebastian, Joseph; Miller, William C; Eron, Joseph J

    2017-01-01

    HIV-1 diversity is increasing in North American and European cohorts which may have public health implications. However, little is known about non-B subtype diversity in the southern United States, despite the region being the epicenter of the nation's epidemic. We characterized HIV-1 diversity and transmission clusters to identify the extent to which non-B strains are transmitted locally. We conducted cross-sectional analyses of HIV-1 partial pol sequences collected from 1997 to 2014 from adults accessing routine clinical care in North Carolina (NC). Subtypes were evaluated using COMET and phylogenetic analysis. Putative transmission clusters were identified using maximum-likelihood trees. Clusters involving non-B strains were confirmed and their dates of origin were estimated using Bayesian phylogenetics. Data were combined with demographic information collected at the time of sample collection and country of origin for a subset of patients. Among 24,972 sequences from 15,246 persons, the non-B subtype prevalence increased from 0% to 3.46% over the study period. Of 325 persons with non-B subtypes, diversity was high with over 15 pure subtypes and recombinants; subtype C (28.9%) and CRF02_AG (24.0%) were most common. While identification of transmission clusters was lower for persons with non-B versus B subtypes, several local transmission clusters (≥3 persons) involving non-B subtypes were identified and all were presumably due to heterosexual transmission. Prevalence of non-B subtype diversity remains low in NC but a statistically significant rise was identified over time which likely reflects multiple importation. However, the combined phylogenetic clustering analysis reveals evidence for local onward transmission. Detection of these non-B clusters suggests heterosexual transmission and may guide diagnostic and prevention interventions.

  2. Assembly and phylogenetic structure of Neotropical palm communities

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Svenning, J.-C.; Balslev, Henrik

    Diversity, composition and dynamics of Neotropical palm communities are receiving an increasing amount of attention due to their economic importance, but also because their high species richness and functional diversity render them valuable model systems for overall forest biodiversity. However......, to better understand these palm communities, it is crucial to gain insight into the mechanisms responsible for their assembly. These can be dispersal limitation, environmental filtering, or biotic interactions. If the degree of niche conservatism is known for a group of organisms, patterns of community...... an unspecific assumption of “general niche conservatism”, phylogenetic signal will be analysed for Neotropical palms. Moreover, as an example for evolutionary mechanisms disrupting phylogenetic signal, speciation modes will be examined in selected genera. With the combined results we aim to show the relative...

  3. Energy gradients and the geographic distribution of local ant diversity.

    Science.gov (United States)

    Kaspari, Michael; Ward, Philip S; Yuan, May

    2004-08-01

    Geographical diversity gradients, even among local communities, can ultimately arise from geographical differences in speciation and extinction rates. We evaluated three models--energy-speciation, energy-abundance, and area--that predict how geographic trends in net diversification rates generate trends in diversity. We sampled 96 litter ant communities from four provinces: Australia, Madagascar, North America, and South America. The energy-speciation hypothesis best predicted ant species richness by accurately predicting the slope of the temperature diversity curve, and accounting for most of the variation in diversity. The communities showed a strong latitudinal gradient in species richness as well as inter-province differences in diversity. The former vanished in the temperature-diversity residuals, suggesting that the latitudinal gradient arises primarily from higher diversification rates in the tropics. However, inter-province differences in diversity persisted in those residuals--South American communities remained more diverse than those in North America and Australia even after the effects of temperature were removed.

  4. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. High genetic diversity of equine infectious anaemia virus strains from Slovenia revealed upon phylogenetic analysis of the p15 gag gene region.

    Science.gov (United States)

    Kuhar, U; Malovrh, T

    2016-03-01

    The equine infectious anaemia virus (EIAV), which belongs to the Retroviridae family, infects equids almost worldwide. Every year, sporadic EIAV cases are detected in Slovenia. To characterise the Slovenian EIAV strains in the p15 gag gene region phylogenetically in order to compare the Slovenian EIAV strains with EIAV strains from abroad, especially with the recently published European strains. Cross-sectional study using material derived from post mortem examination. In total, 29 EIAV serologically positive horses from 18 different farms were examined in this study. Primers were designed to amplify the p15 gag gene region. Amplicons of 28 PCRs were subjected to direct DNA sequencing and phylogenetic analysis. Altogether, 28 EIAV sequences were obtained from 17 different farms and were distributed between 4 separate monophyletic groups and 9 branches upon phylogenetic analysis. Among EIAV strains from abroad, the closest relatives to Slovenian EIAV strains were European EIAV strains from Italy. Phylogenetic analysis also showed that some animals from distantly located farms were most probably infected with the same EIAV strains, as well as animals from the same farm and animals from farms located in the same geographical region. This is the first report of such high genetic diversity of EIAV strains from one country. This led to speculation that there is a potential virus reservoir among the populations of riding horses, horses kept for pleasure and horses for meat production, with some farmers or horse-owners not following legislation, thus enabling the spread of infection with EIAV. The low sensitivity of the agar gel immunodiffusion test may also contribute to the spread of infection with EIAV, because some infected horses might have escaped detection. The results of the phylogenetic analysis also provide additional knowledge about the highly heterogeneous nature of the EIAV genome. © 2015 EVJ Ltd.

  6. Phylogenetic diversity of lactic acid bacteria associated with paddy rice silage as determined by 16S ribosomal DNA analysis.

    Science.gov (United States)

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.

  7. Climate-driven extinctions shape the phylogenetic structure of temperate tree floras.

    Science.gov (United States)

    Eiserhardt, Wolf L; Borchsenius, Finn; Plum, Christoffer M; Ordonez, Alejandro; Svenning, Jens-Christian

    2015-03-01

    When taxa go extinct, unique evolutionary history is lost. If extinction is selective, and the intrinsic vulnerabilities of taxa show phylogenetic signal, more evolutionary history may be lost than expected under random extinction. Under what conditions this occurs is insufficiently known. We show that late Cenozoic climate change induced phylogenetically selective regional extinction of northern temperate trees because of phylogenetic signal in cold tolerance, leading to significantly and substantially larger than random losses of phylogenetic diversity (PD). The surviving floras in regions that experienced stronger extinction are phylogenetically more clustered, indicating that non-random losses of PD are of increasing concern with increasing extinction severity. Using simulations, we show that a simple threshold model of survival given a physiological trait with phylogenetic signal reproduces our findings. Our results send a strong warning that we may expect future assemblages to be phylogenetically and possibly functionally depauperate if anthropogenic climate change affects taxa similarly. © 2015 John Wiley & Sons Ltd/CNRS.

  8. Effects of species' similarity and dominance on the functional and phylogenetic structure of a plant meta-community.

    Science.gov (United States)

    Chalmandrier, L; Münkemüller, T; Lavergne, S; Thuiller, W

    2015-01-01

    Different assembly processes drive the spatial structure of meta-communities (beta-diversity). Recently, functional and phylogenetic diversities have been suggested as indicators of these assembly processes. Assuming that diversity is a good proxy for niche overlap, high beta-diversity along environmental gradients should be the result of environmental filtering while low beta-diversity should stem from competitive interactions. So far, studies trying to disentangle the relative importance of these assembly processes have provided mixed results. One reason for this may be that these studies often rely on a single measure of diversity and thus implicitly make a choice on how they account for species relative abundances and how species similarities are captured by functional traits or phylogeny. Here, we tested the effect of gradually scaling the importance of dominance (the weight given to dominant vs. rare species) and species similarity (the weight given to small vs. large similarities) on resulting beta-diversity patterns of an alpine plant meta-community. To this end, we combined recent extensions of the Hill numbers framework with Pagel's phylogenetic tree transformation approach. We included functional (based on the leaf-height-seed spectrum) and phylogenetic facets of beta-diversity in our analysis and explicitly accounted for effects of environmental and spatial covariates. We found that functional beta-diversity, was high when the same weight was given to dominant vs. rare species and to large vs. small species' similarities. In contrast, phylogenetic beta-diversity was low when greater weight was given to dominant species and small species' similarities. Those results suggested that different environments along the gradients filtered different species according to their functional traits, while, the same competitive lineages dominated communities across the gradients. Our results highlight that functional vs. phylogenetic facets, presence-absence vs

  9. Inferring influenza global transmission networks without complete phylogenetic information.

    Science.gov (United States)

    Aris-Brosou, Stéphane

    2014-03-01

    Influenza is one of the most severe respiratory infections affecting humans throughout the world, yet the dynamics of its global transmission network are still contentious. Here, I describe a novel combination of phylogenetics, time series, and graph theory to analyze 14.25 years of data stratified in space and in time, focusing on the main target of the human immune response, the hemagglutinin gene. While bypassing the complete phylogenetic inference of huge data sets, the method still extracts information suggesting that waves of genetic or of nucleotide diversity circulate continuously around the globe for subtypes that undergo sustained transmission over several seasons, such as H3N2 and pandemic H1N1/09, while diversity of prepandemic H1N1 viruses had until 2009 a noncontinuous transmission pattern consistent with a source/sink model. Irrespective of the shift in the structure of H1N1 diversity circulation with the emergence of the pandemic H1N1/09 strain, US prevalence peaks during the winter months when genetic diversity is at its lowest. This suggests that a dominant strain is generally responsible for epidemics and that monitoring genetic and/or nucleotide diversity in real time could provide public health agencies with an indirect estimate of prevalence.

  10. Genetic Diversity of Local and Introduced Sweet Potato [Ipomoea ...

    African Journals Online (AJOL)

    This study was therefore conducted to estimate the genetic diversity of 114 Sweet potato [Ipomoea batatas (L.) Lam] accessions obtained from Nigeria, Asia, Latin America and Local collections along with two improved varieties. Accessions were planted in 2012/13 cropping season at Haramaya University, eastern Ethiopia ...

  11. Taxonomic and phylogenetic diversity of vascular plants at Ma'anling volcano urban park in tropical Haikou, China: Reponses to soil properties.

    Science.gov (United States)

    Cheng, Xia-Lan; Yuan, Lang-Xing; Nizamani, Mir Mohammad; Zhu, Zhi-Xin; Friedman, Cynthia Ross; Wang, Hua-Feng

    2018-01-01

    Anthropogenic processes and socio-economic factors play important roles in shaping plant diversity in urban parks. To investigate how plant diversity of Ma' anling urban volcano park in Hainan Province, China respond to these factors, we carried out a field investigation on the taxonomic and phylogenetic diversity of vascular plants and soil properties in this area. We found 284 species of vascular plants belonging to 88 families and 241 genera, which included 194 native species, 23 invasive species, 31 naturalized species, 40 cultivars, and 4 rare / endangered plant species. Tree composition and richness significantly varied between different vegetation formations (plantation, secondary forest, and abandoned land). Plant species richness and community composition were significantly affected by elevation (El), soil water content (WC), total soil nitrogen (TN) and soil organic matter (SOM). There were significant diversity differences between plantations and abandoned lands, but not between the plantations and secondary forests. The flora in the study site was tropical in nature, characterized by pantropic distributions. Compared to adjacent areas, floristic composition in the study site was most similar to that of Guangdong, followed by that of Vietnam. Our study revealed the diversity patterns of volcanic plants and provided the basis for future planning of plant conservation, such as preserving plant species, maintaining plant habitats, and coordinating plant management in this region.

  12. Herbicide and fertilizers promote analogous phylogenetic responses but opposite functional responses in plant communities

    DEFF Research Database (Denmark)

    Pellissier, Loïc; Wisz, Mary S.; Strandberg, Beate

    2014-01-01

    on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy...... height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were......Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based...

  13. Constancy despite variability: Local and regional macrofaunal diversity in intertidal seagrass beds

    Science.gov (United States)

    Boyé, Aurélien; Legendre, Pierre; Grall, Jacques; Gauthier, Olivier

    2017-12-01

    The importance of seagrass habitat for the diversity of benthic fauna has been extensively studied worldwide. Most of the information available is, however, about α diversity while little consideration has been given to β diversity. To fill the knowledge gaps regarding the variability of epifaunal and infaunal seagrass assemblages at large spatial and temporal scales, we scrutinized an extensive dataset covering five years of monitoring of eight intertidal Zostera marina meadows around Brittany (France). High species richness arose at the regional scale from the combination of high local diversity of the meadows and substantial among-meadows β diversity. Epifauna and infauna appeared as distinct self-communities as they displayed different spatial and temporal patterns and varied in their responses to local hydrological conditions. Infauna had higher total β diversity than epifauna due to a tighter link to the great variability of local environmental conditions in the region. Both exhibited substantial variations in species composition and community structure with variations of dominant species that were accompanied by extensive change in numerous rare species. The dominant epifaunal species were all grazers. Changes in species composition were induced mostly by species replacement and rarely by richness differences between meadows. Indeed, species richness remained within a narrow range for all seagrass beds, suggesting a potential carrying capacity for species richness of the meadows. Overall, all meadows contributed equally to the regional turnover of seagrass macrofauna, emphasizing high variability and complementarity among beds at the regional scale. The implications of this substantial within-seagrass variability for the functioning of benthic ecosystems at broad scale and for conservation purposes in habitat mosaics warrant further investigations but our results clearly advocate taking into account within-habitat variation when evaluating the diversity

  14. Molecular phylogenetics and species delimitation of leaf-toed geckos (Phyllodactylidae: Phyllodactylus) throughout the Mexican tropical dry forest.

    Science.gov (United States)

    Blair, Christopher; Méndez de la Cruz, Fausto R; Law, Christopher; Murphy, Robert W

    2015-03-01

    Methods and approaches for accurate species delimitation continue to be a highly controversial subject in the systematics community. Inaccurate assessment of species' limits precludes accurate inference of historical evolutionary processes. Recent evidence suggests that multilocus coalescent methods show promise in delimiting species in cryptic clades. We combine multilocus sequence data with coalescence-based phylogenetics in a hypothesis-testing framework to assess species limits and elucidate the timing of diversification in leaf-toed geckos (Phyllodactylus) of Mexico's dry forests. Tropical deciduous forests (TDF) of the Neotropics are among the planet's most diverse ecosystems. However, in comparison to moist tropical forests, little is known about the mode and tempo of biotic evolution throughout this threatened biome. We find increased speciation and substantial, cryptic molecular diversity originating following the formation of Mexican TDF 30-20million years ago due to orogenesis of the Sierra Madre Occidental and Mexican Volcanic Belt. Phylogenetic results suggest that the Mexican Volcanic Belt, the Rio Fuerte, and Isthmus of Tehuantepec may be important biogeographic barriers. Single- and multilocus coalescent analyses suggest that nearly every sampling locality may be a distinct species. These results suggest unprecedented levels of diversity, a complex evolutionary history, and that the formation and expansion of TDF vegetation in the Miocene may have influenced subsequent cladogenesis of leaf-toed geckos throughout western Mexico. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Ecosystem productivity is associated with bacterial phylogenetic distance in surface marine waters.

    Science.gov (United States)

    Galand, Pierre E; Salter, Ian; Kalenitchenko, Dimitri

    2015-12-01

    Understanding the link between community diversity and ecosystem function is a fundamental aspect of ecology. Systematic losses in biodiversity are widely acknowledged but the impact this may exert on ecosystem functioning remains ambiguous. There is growing evidence of a positive relationship between species richness and ecosystem productivity for terrestrial macro-organisms, but similar links for marine micro-organisms, which help drive global climate, are unclear. Community manipulation experiments show both positive and negative relationships for microbes. These previous studies rely, however, on artificial communities and any links between the full diversity of active bacterial communities in the environment, their phylogenetic relatedness and ecosystem function remain hitherto unexplored. Here, we test the hypothesis that productivity is associated with diversity in the metabolically active fraction of microbial communities. We show in natural assemblages of active bacteria that communities containing more distantly related members were associated with higher bacterial production. The positive phylogenetic diversity-productivity relationship was independent of community diversity calculated as the Shannon index. From our long-term (7-year) survey of surface marine bacterial communities, we also found that similarly, productive communities had greater phylogenetic similarity to each other, further suggesting that the traits of active bacteria are an important predictor of ecosystem productivity. Our findings demonstrate that the evolutionary history of the active fraction of a microbial community is critical for understanding their role in ecosystem functioning. © 2015 John Wiley & Sons Ltd.

  16. The effects of micro-aeration on the phylogenetic diversity of microorganisms in a thermophilic anaerobic municipal solid-waste digester.

    Science.gov (United States)

    Tang, Yueqin; Shigematsu, Toru; Ikbal; Morimura, Shigeru; Kida, Kenji

    2004-05-01

    We demonstrated previously that micro-aeration allows construction of an effective thermophilic methane-fermentation system for treatment of municipal solid waste (MSW) without production of H(2)S. In the present study, we compared the microbial communities in a thermophilic MSW digester without aeration and with micro-aeration by fluorescence in situ hybridization (FISH), denaturing gradient gel electrophoresis (DGGE), phylogenetic analysis of libraries of 16S rRNA gene clones and quantitative real-time PCR. Moreover, we studied the activity of sulfate-reducing bacteria (SRB) by analysis of the transcription of the gene for dissimilatory sulfite reductase (dsr). Experiments using FISH revealed that microorganisms belonging to the domain Bacteria dominated in the digester both without aeration and with micro-aeration. Phylogenetic analysis based on 16S rRNA gene and analysis of bacteria by DGGE did not reveal any obvious difference within the microbial communities under the two aeration conditions, and bacteria affiliated with the phylum Firmicutes were dominant. In Archaea, the population of Methanosarcina decreased while the population of Methanoculleus increased as a result of micro-aerations as revealed by the analysis of 16S rRNA gene clones and quantitative real-time PCR. Reverse transcription and PCR (RT-PCR) demonstrated the transcription of dsrA not only in the absence of aeration but also in the presence of micro-aeration, even under conditions where no H(2)S was detected in the biogas. In conclusion, micro-aeration has no obvious effects on the phylogenetic diversity of microorganisms. Furthermore, the activity of SRBs in the digester was not repressed even though the concentration of H(2)S in the biogas was very low under the micro-aeration conditions.

  17. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

    Directory of Open Access Journals (Sweden)

    Johannes Asplund-Samuelsson

    Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  18. Keeping All the PIECES: Phylogenetically Informed Ex Situ Conservation of Endangered Species.

    Science.gov (United States)

    Larkin, Daniel J; Jacobi, Sarah K; Hipp, Andrew L; Kramer, Andrea T

    2016-01-01

    Ex situ conservation in germplasm and living collections is a major focus of global plant conservation strategies. Prioritizing species for ex situ collection is a necessary component of this effort for which sound strategies are needed. Phylogenetic considerations can play an important role in prioritization. Collections that are more phylogenetically diverse are likely to encompass more ecological and trait variation, and thus provide stronger conservation insurance and richer resources for future restoration efforts. However, phylogenetic criteria need to be weighed against other, potentially competing objectives. We used ex situ collection and threat rank data for North American angiosperms to investigate gaps in ex situ coverage and phylogenetic diversity of collections and to develop a flexible framework for prioritizing species across multiple objectives. We found that ex situ coverage of 18,766 North American angiosperm taxa was low with respect to the most vulnerable taxa: just 43% of vulnerable to critically imperiled taxa were in ex situ collections, far short of a year-2020 goal of 75%. In addition, species held in ex situ collections were phylogenetically clustered (P species been drawn at random. These patterns support incorporating phylogenetic considerations into ex situ prioritization in a manner balanced with other criteria, such as vulnerability. To meet this need, we present the 'PIECES' index (Phylogenetically Informed Ex situ Conservation of Endangered Species). PIECES integrates phylogenetic considerations into a flexible framework for prioritizing species across competing objectives using multi-criteria decision analysis. Applying PIECES to prioritizing ex situ conservation of North American angiosperms, we show strong return on investment across multiple objectives, some of which are negatively correlated with each other. A spreadsheet-based decision support tool for North American angiosperms is provided; this tool can be customized to

  19. Herbicide and fertilizers promote analogous phylogenetic responses but opposite functional responses in plant communities

    International Nuclear Information System (INIS)

    Pellissier, Loïc; Wisz, Mary S; Strandberg, Beate; Damgaard, Christian

    2014-01-01

    Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were not phylogenetically conserved. Species richness also decreased with increasing levels of nitrogen and glyphosate. Our results suggest that predicting the cumulative effects of agrochemicals is more complex than anticipated due to their distinct selection of traits that may or may not be conserved phylogenetically. Precautionary efforts to mitigate drift of agricultural chemicals into semi-natural habitats are warranted to prevent unforeseeable biodiversity shifts. (paper)

  20. Local Convergence and Global Diversity : From Interpersonal to Social Influence

    NARCIS (Netherlands)

    Flache, Andreas; Macy, Michael W.

    2011-01-01

    How can minority cultures resist assimilation into a global monolith in an increasingly "small world"? Paradoxically, Axelrod found that local convergence can actually preserve global diversity if cultural influence is combined with homophily, the principle that "likes attract." However, follow-up

  1. Long-term nitrogen addition affects the phylogenetic turnover of soil microbial community responding to moisture pulse.

    Science.gov (United States)

    Liu, Chi; Yao, Minjie; Stegen, James C; Rui, Junpeng; Li, Jiabao; Li, Xiangzhen

    2017-12-13

    How press disturbance (long-term) influences the phylogenetic turnover of soil microbial communities responding to pulse disturbances (short-term) is not fully known. Understanding the complex connections between the history of environmental conditions, assembly processes and microbial community dynamics is necessary to predict microbial response to perturbation. We started by investigating phylogenetic spatial turnover (based on DNA) of soil prokaryotic communities after long-term nitrogen (N) deposition and temporal turnover (based on RNA) of communities responding to pulse by conducting short-term rewetting experiments. The results showed that moderate N addition increased ecological stochasticity and phylogenetic diversity. In contrast, high N addition slightly increased homogeneous selection and decreased phylogenetic diversity. Examining the system with higher phylogenetic resolution revealed a moderate contribution of variable selection across the whole N gradient. The moisture pulse experiment showed that high N soils had higher rates of phylogenetic turnover across short phylogenetic distances and significant changes in community compositions through time. Long-term N input history influenced spatial turnover of microbial communities, but the dominant community assembly mechanisms differed across different N deposition gradients. We further revealed an interaction between press and pulse disturbances whereby deterministic processes were particularly important following pulse disturbances in high N soils.

  2. Implementing a cumulative supermatrix approach for a comprehensive phylogenetic study of the Teloschistales (Pezizomycotina, Ascomycota)

    DEFF Research Database (Denmark)

    Gaya, Ester; Högnabba, Filip; Holguin, Ángela

    2012-01-01

    The resolution of the phylogenetic relationships within the order Teloschistales (Ascomycota, lichen-forming-fungi), with nearly 2000 known species and outstanding phenotypic diversity, has been hindered by the limitation in the resolving power that single-locus or two-locus phylogenetic studies...... – the Megalosporaceae – which is sister to the mainly rock-inhabiting, cosmopolitan, and species rich Teloschistaceae, with a diversity of growth habits ranging from crustose to fruticose. Our results confirm the use of a cumulative supermatrix approach as a viable method to generate comprehensive phylogenies...

  3. Diversity patterns of microbial eukaryotes mirror those of bacteria in Antarctic cryoconite holes.

    Science.gov (United States)

    Sommers, Pacifica; Darcy, John L; Gendron, Eli M S; Stanish, Lee F; Bagshaw, Elizabeth A; Porazinska, Dorota L; Schmidt, Steven K

    2018-01-01

    Ice-lidded cryoconite holes on glaciers in the Taylor Valley, Antarctica, provide a unique system of natural mesocosms for studying community structure and assembly. We used high-throughput DNA sequencing to characterize both microbial eukaryotic communities and bacterial communities within cryoconite holes across three glaciers to study similarities in their spatial patterns. We expected that the alpha (phylogenetic diversity) and beta (pairwise community dissimilarity) diversity patterns of eukaryotes in cryoconite holes would be related to those of bacteria, and that they would be related to the biogeochemical gradient within the Taylor Valley. We found that eukaryotic alpha and beta diversity were strongly related to those of bacteria across scales ranging from 140 m to 41 km apart. Alpha diversity of both was significantly related to position in the valley and surface area of the cryoconite hole, with pH also significantly correlated with the eukaryotic diversity. Beta diversity for both bacteria and eukaryotes was significantly related to position in the valley, with bacterial beta diversity also related to nitrate. These results are consistent with transport of sediments onto glaciers occurring primarily at local scales relative to the size of the valley, thus creating feedbacks in local chemistry and diversity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Phylogenetic relationships and cryptic species diversity in the Brazilian egg-brooding tree frog, genus Fritziana Mello-Leitão 1937 (Anura: Hemiphractidae).

    Science.gov (United States)

    Walker, Marina; Lyra, Mariana L; Haddad, Célio F B

    2018-06-01

    The genus Fritziana (Anura: Hemiphractidae) comprises six described species (F. goeldii, F. ohausi, F. fissilis, F. ulei, F. tonimi, and F. izecksohni) that are endemic to the Brazilian Atlantic Forest. Although the genus has been the subject of studies dealing with its taxonomy, phylogeny, and systematics, there is considerable evidence for cryptic diversity hidden among the species. The present study aims to understand the genetic diversity and phylogenetic relationships among the species of Fritziana, as well as the relationships among populations within species. We analyzed 107 individuals throughout the distribution of the genus using three mitochondrial gene fragments (12S, 16S, and COI) and two nuclear genes (RAG1 and SLC8A3). Our data indicated that the species diversity in the genus Fritziana is underestimated by the existence of at least three candidate species hidden amongst the group of species with a closed dorsal pouch (i.e. F. fissilis and F. ulei). We also found four species presenting geographical population structures and high genetic diversity, and thus require further investigations. In addition, we found that two candidate species show a new arrangement for the tRNA-Phe gene, unique in Anura so far. Based on our results, we suggest that the conservation status of the species, as well as the species diversity in the genus Fritziana, needs to be reviewed. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Epidemiological study of phylogenetic transmission clusters in a local HIV-1 epidemic reveals distinct differences between subtype B and non-B infections.

    Science.gov (United States)

    Chalmet, Kristen; Staelens, Delfien; Blot, Stijn; Dinakis, Sylvie; Pelgrom, Jolanda; Plum, Jean; Vogelaers, Dirk; Vandekerckhove, Linos; Verhofstede, Chris

    2010-09-07

    The number of HIV-1 infected individuals in the Western world continues to rise. More in-depth understanding of regional HIV-1 epidemics is necessary for the optimal design and adequate use of future prevention strategies. The use of a combination of phylogenetic analysis of HIV sequences, with data on patients' demographics, infection route, clinical information and laboratory results, will allow a better characterization of individuals responsible for local transmission. Baseline HIV-1 pol sequences, obtained through routine drug-resistance testing, from 506 patients, newly diagnosed between 2001 and 2009, were used to construct phylogenetic trees and identify transmission-clusters. Patients' demographics, laboratory and clinical data, were retrieved anonymously. Statistical analysis was performed to identify subtype-specific and transmission-cluster-specific characteristics. Multivariate analysis showed significant differences between the 59.7% of individuals with subtype B infection and the 40.3% non-B infected individuals, with regard to route of transmission, origin, infection with Chlamydia (p = 0.01) and infection with Hepatitis C virus (p = 0.017). More and larger transmission-clusters were identified among the subtype B infections (p HIV (p = 0.017). Combination of phylogenetics with demographic information, laboratory and clinical data, revealed that HIV-1 subtype B infected Caucasian men-who-have-sex-with-men with high prevalence of sexually transmitted diseases, account for the majority of local HIV-transmissions. This finding elucidates observed epidemiological trends through molecular analysis, and justifies sustained focus in prevention on this high risk group.

  6. Beta-diversity of ectoparasites at two spatial scales: nested hierarchy, geography and habitat type.

    Science.gov (United States)

    Warburton, Elizabeth M; van der Mescht, Luther; Stanko, Michal; Vinarski, Maxim V; Korallo-Vinarskaya, Natalia P; Khokhlova, Irina S; Krasnov, Boris R

    2017-06-01

    Beta-diversity of biological communities can be decomposed into (a) dissimilarity of communities among units of finer scale within units of broader scale and (b) dissimilarity of communities among units of broader scale. We investigated compositional, phylogenetic/taxonomic and functional beta-diversity of compound communities of fleas and gamasid mites parasitic on small Palearctic mammals in a nested hierarchy at two spatial scales: (a) continental scale (across the Palearctic) and (b) regional scale (across sites within Slovakia). At each scale, we analyzed beta-diversity among smaller units within larger units and among larger units with partitioning based on either geography or ecology. We asked (a) whether compositional, phylogenetic/taxonomic and functional dissimilarities of flea and mite assemblages are scale dependent; (b) how geographical (partitioning of sites according to geographic position) or ecological (partitioning of sites according to habitat type) characteristics affect phylogenetic/taxonomic and functional components of dissimilarity of ectoparasite assemblages and (c) whether assemblages of fleas and gamasid mites differ in their degree of dissimilarity, all else being equal. We found that compositional, phylogenetic/taxonomic, or functional beta-diversity was greater on a continental rather than a regional scale. Compositional and phylogenetic/taxonomic components of beta-diversity were greater among larger units than among smaller units within larger units, whereas functional beta-diversity did not exhibit any consistent trend regarding site partitioning. Geographic partitioning resulted in higher values of beta-diversity of ectoparasites than ecological partitioning. Compositional and phylogenetic components of beta-diversity were higher in fleas than mites but the opposite was true for functional beta-diversity in some, but not all, traits.

  7. Phylogenetic analysis of anemone fishes of the Persian Gulf using ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-17

    Jun 17, 2008 ... genetic diversity among samples was investigated by phylogenetic analysis. Results show that there is ... more about the living organisms found in this region. Many marine ... Kish (modified from Pous et al., 2004). Table 2.

  8. Higher speciation and lower extinction rates influence mammal diversity gradients in Asia.

    Science.gov (United States)

    Tamma, Krishnapriya; Ramakrishnan, Uma

    2015-02-04

    Little is known about the patterns and correlates of mammal diversity gradients in Asia. In this study, we examine patterns of species distributions and phylogenetic diversity in Asia and investigate if the observed diversity patterns are associated with differences in diversification rates between the tropical and non-tropical regions. We used species distribution maps and phylogenetic trees to generate species and phylogenetic diversity measures for 1° × 1° cells across mainland Asia. We constructed lineage-through-time plots and estimated diversification shift-times to examine the temporal patterns of diversifications across orders. Finally, we tested if the observed gradients in Asia could be associated with geographical differences in diversification rates across the tropical and non-tropical biomes. We estimated speciation, extinction and dispersal rates across these two regions for mammals, both globally and for Asian mammals. Our results demonstrate strong latitudinal and longitudinal gradients of species and phylogenetic diversity with Southeast Asia and the Himalayas showing highest diversity. Importantly, our results demonstrate that differences in diversification (speciation, extinction and dispersal) rates between the tropical and the non-tropical biomes influence the observed diversity gradients globally and in Asia. For the first time, we demonstrate that Asian tropics act as both cradles and museums of mammalian diversity. Temporal and spatial variation in diversification rates across different lineages of mammals is an important correlate of species diversity gradients observed in Asia.

  9. phylo-node: A molecular phylogenetic toolkit using Node.js.

    Science.gov (United States)

    O'Halloran, Damien M

    2017-01-01

    Node.js is an open-source and cross-platform environment that provides a JavaScript codebase for back-end server-side applications. JavaScript has been used to develop very fast and user-friendly front-end tools for bioinformatic and phylogenetic analyses. However, no such toolkits are available using Node.js to conduct comprehensive molecular phylogenetic analysis. To address this problem, I have developed, phylo-node, which was developed using Node.js and provides a stable and scalable toolkit that allows the user to perform diverse molecular and phylogenetic tasks. phylo-node can execute the analysis and process the resulting outputs from a suite of software options that provides tools for read processing and genome alignment, sequence retrieval, multiple sequence alignment, primer design, evolutionary modeling, and phylogeny reconstruction. Furthermore, phylo-node enables the user to deploy server dependent applications, and also provides simple integration and interoperation with other Node modules and languages using Node inheritance patterns, and a customized piping module to support the production of diverse pipelines. phylo-node is open-source and freely available to all users without sign-up or login requirements. All source code and user guidelines are openly available at the GitHub repository: https://github.com/dohalloran/phylo-node.

  10. Traditional agroforestry practices in Atlantic Nicaragua promote biodiversity and natural resource diversity

    Science.gov (United States)

    Sistla, S.; Roddy, A. B.; Williams, N. E.; Kramer, D.; Stevens, K.; Allison, S. D.

    2016-12-01

    The conversion of forest to pasture and other agricultural uses has increased interest in the role that small-scale agroforestry systems can play in linking sustainable agriculture to biodiversity conservation, particularly in rapidly developing areas of the tropics. Complementing the provisioning of natural resources (i.e. food, medicine, lumber), agroforestry systems tend to maintain higher levels of biodiversity and greater biomass than lower diversity crop or pasture systems. Greater plant diversity may also enhance soil quality, further supporting agricultural productivity in nutrient-limited tropical systems. We studied the relationships between plant diversity (including species richness, phylogenetic diversity, and natural resource diversity), and soil quality within pasture, agroforest, and secondary forest: three common land use types maintained by small-scale farmers in the Pearl Lagoon Basin, Nicaragua. The area is undergoing accelerated globalization following the 2007 completion of the region's first major road; a change which is expected to increase forest conversion for agriculture. However, farmer agrobiodiversity maintenance in the Basin was previously found to be positively correlated with affiliation to local agricultural NGOs through the maintenance of agroforestry systems, despite these farmers residing in the communities closest to the new road, highlighting the potential for maintaining diverse agroforestry agricultural strategies despite heightened globalization pressures. We found that agroforestry sites tended to have higher surface soil %C, %N, and pH relative to neighboring to secondary forest, while maintaining comparable plant diversity. In contrast, pasture reduced species richness, phylogenetic diversity, and natural resource diversity. No significant relationships were found between plant diversity and the soil properties assessed; however higher species richness and phylodiversity was positively correlated with natural resource

  11. Functional and phylogenetic structure of island bird communities.

    Science.gov (United States)

    Si, Xingfeng; Cadotte, Marc W; Zeng, Di; Baselga, Andrés; Zhao, Yuhao; Li, Jiaqi; Wu, Yiru; Wang, Siyu; Ding, Ping

    2017-05-01

    Biodiversity change in anthropogenically transformed habitats is often nonrandom, yet the nature and importance of the different mechanisms shaping community structure are unclear. Here, we extend the classic Theory of Island Biogeography (TIB) to account for nonrandom processes by incorporating species traits and phylogenetic relationships into a study of faunal relaxation following habitat loss and fragmentation. Two possible mechanisms can create nonrandom community patterns on fragment islands. First, small and isolated islands might consist of similar or closely related species because they are environmentally homogeneous or select for certain shared traits, such as dispersal ability. Alternatively, communities on small islands might contain more dissimilar or distantly related species than on large islands because limited space and resource availability result in greater competitive exclusion among species with high niche overlap. Breeding birds were surveyed on 36 islands and two mainland sites annually from 2010 to 2014 in the Thousand Island Lake region, China. We assessed community structure of breeding birds on these subtropical land-bridge islands by integrating species' trait and evolutionary distances. We additionally analysed habitat heterogeneity and variance in size ratios to distinguish biotic and abiotic processes of community assembly. Results showed that functional-phylogenetic diversity increased with island area, and decreased with isolation. Bird communities on the mainland were more diverse and generally less clustered than island bird communities and not different than randomly assembled communities. Bird communities on islands tend to be functionally similar and phylogenetically clustered, especially on small and isolated islands. The nonrandom decline in species diversity and change in bird community structure with island area and isolation, along with the relatively homogeneous habitats on small islands, support the environmental

  12. In Silico Gene-Level Evolution Explains Microbial Population Diversity through Differential Gene Mobility

    NARCIS (Netherlands)

    van Dijk, Bram; Hogeweg, P.

    2016-01-01

    Microbial communities can show astonishing ecological and phylogenetic diversity. What is the role of pervasive horizontal gene transfer (HGT) in shaping this diversity in the presence of clonally expanding "killer strains"? Does HGT of antibiotic production and resistance genes erase phylogenetic

  13. Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis

    OpenAIRE

    Young, Douglas B.; Comas, I?aki; de Carvalho, Luiz P. S.

    2015-01-01

    Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii, and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms (SNPs) with predicted impact on protein function and transcriptional regulation...

  14. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  15. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  16. Environmental factors determining ammonia-oxidizing organism distribution and diversity in marine environments.

    Science.gov (United States)

    Bouskill, Nicholas J; Eveillard, Damien; Chien, Diana; Jayakumar, Amal; Ward, Bess B

    2012-03-01

    Ammonia-oxidizing bacteria (AOB) and archaea (AOA) play a vital role in bridging the input of fixed nitrogen, through N-fixation and remineralization, to its loss by denitrification and anammox. Yet the major environmental factors determining AOB and AOA population dynamics are little understood, despite both groups having a wide environmental distribution. This study examined the relative abundance of both groups of ammonia-oxidizing organisms (AOO) and the diversity of AOA across large-scale gradients in temperature, salinity and substrate concentration and dissolved oxygen. The relative abundance of AOB and AOA varied across environments, with AOB dominating in the freshwater region of the Chesapeake Bay and AOA more abundant in the water column of the coastal and open ocean. The highest abundance of the AOA amoA gene was recorded in the oxygen minimum zones (OMZs) of the Eastern Tropical South Pacific (ETSP) and the Arabian Sea (AS). The ratio of AOA : AOB varied from 0.7 in the Chesapeake Bay to 1600 in the Sargasso Sea. Relative abundance of both groups strongly correlated with ammonium concentrations. AOA diversity, as determined by phylogenetic analysis of clone library sequences and archetype analysis from a functional gene DNA microarray, detected broad phylogenetic differences across the study sites. However, phylogenetic diversity within physicochemically congruent stations was more similar than would be expected by chance. This suggests that the prevailing geochemistry, rather than localized dispersal, is the major driving factor determining OTU distribution. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  17. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  18. Response of pest control by generalist predators to local-scale plant diversity: a meta-analysis.

    Science.gov (United States)

    Dassou, Anicet Gbèblonoudo; Tixier, Philippe

    2016-02-01

    Disentangling the effects of plant diversity on the control of herbivores is important for understanding agricultural sustainability. Recent studies have investigated the relationships between plant diversity and arthropod communities at the landscape scale, but few have done so at the local scale. We conducted a meta-analysis of 32 papers containing 175 independent measures of the relationship between plant diversity and arthropod communities. We found that generalist predators had a strong positive response to plant diversity, that is, their abundance increased as plant diversity increased. Herbivores, in contrast, had an overall weak and negative response to plant diversity. However, specialist and generalist herbivores differed in their response to plant diversity, that is, the response was negative for specialists and not significant for generalists. While the effects of scale remain unclear, the response to plant diversity tended to increase for specialist herbivores, but decrease for generalist herbivores as the scale increased. There was no clear effect of scale on the response of generalist predators to plant diversity. Our results suggest that the response of herbivores to plant diversity at the local scale is a balance between habitat and trophic effects that vary according to arthropod specialization and habitat type. Synthesis and applications. Positive effects of plant diversity on generalist predators confirm that, at the local scale, plant diversification of agroecosystems is a credible and promising option for increasing pest regulation. Results from our meta-analysis suggest that natural control in plant-diversified systems is more likely to occur for specialist than for generalist herbivores. In terms of pest management, our results indicate that small-scale plant diversification (via the planting of cover crops or intercrops and reduced weed management) is likely to increase the control of specialist herbivores by generalist predators.

  19. Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

    Science.gov (United States)

    Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

    2005-10-01

    Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

  20. The relative importance of regional, local, and evolutionary factors structuring cryptobenthic coral-reef assemblages

    Science.gov (United States)

    Ahmadia, Gabby N.; Tornabene, Luke; Smith, David J.; Pezold, Frank L.

    2018-03-01

    Factors shaping coral-reef fish species assemblages can operate over a wide range of spatial scales (local versus regional) and across both proximate and evolutionary time. Niche theory and neutral theory provide frameworks for testing assumptions and generating insights about the importance of local versus regional processes. Niche theory postulates that species assemblages are an outcome of evolutionary processes at regional scales followed by local-scale interactions, whereas neutral theory presumes that species assemblages are formed by largely random processes drawing from regional species pools. Indo-Pacific cryptobenthic coral-reef fishes are highly evolved, ecologically diverse, temporally responsive, and situated on a natural longitudinal diversity gradient, making them an ideal group for testing predictions from niche and neutral theories and effects of regional and local processes on species assemblages. Using a combination of ecological metrics (fish density, diversity, assemblage composition) and evolutionary analyses (testing for phylogenetic niche conservatism), we demonstrate that the structure of cryptobenthic fish assemblages can be explained by a mixture of regional factors, such as the size of regional species pools and broad-scale barriers to gene flow/drivers of speciation, coupled with local-scale factors, such as the relative abundance of specific microhabitat types. Furthermore, species of cryptobenthic fishes have distinct microhabitat associations that drive significant differences in assemblage community structure between microhabitat types, and these distinct microhabitat associations are phylogenetically conserved over evolutionary timescales. The implied differential fitness of cryptobenthic fishes across varied microhabitats and the conserved nature of their ecology are consistent with predictions from niche theory. Neutral theory predictions may still hold true for early life-history stages, where stochastic factors may be more

  1. Phylogenetically Diverse Burkholderia Associated with Midgut Crypts of Spurge Bugs, Dicranocephalus spp. (Heteroptera: Stenocephalidae).

    Science.gov (United States)

    Kuechler, Stefan Martin; Matsuura, Yu; Dettner, Konrad; Kikuchi, Yoshitomo

    2016-06-25

    Diverse phytophagous heteropteran insects, commonly known as stinkbugs, are associated with specific gut symbiotic bacteria, which have been found in midgut cryptic spaces. Recent studies have revealed that members of the stinkbug families Coreidae and Alydidae of the superfamily Coreoidea are consistently associated with a specific group of the betaproteobacterial genus Burkholderia, called the "stinkbug-associated beneficial and environmental (SBE)" group, and horizontally acquire specific symbionts from the environment every generation. However, the symbiotic system of another coreoid family, Stenocephalidae remains undetermined. We herein investigated four species of the stenocephalid genus Dicranocephalus. Examinations via fluorescence in situ hybridization (FISH) and transmission electron microscopy (TEM) revealed the typical arrangement and ultrastructures of midgut crypts and gut symbionts. Cloning and molecular phylogenetic analyses of bacterial genes showed that the midgut crypts of all species are colonized by Burkholderia strains, which were further assigned to different subgroups of the genus Burkholderia. In addition to the SBE-group Burkholderia, a number of stenocephalid symbionts belonged to a novel clade containing B. sordidicola and B. udeis, suggesting a specific symbiont clade for the Stenocephalidae. The symbiotic systems of stenocephalid bugs may provide a unique opportunity to study the ongoing evolution of symbiont associations in the stinkbug-Burkholderia interaction.

  2. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    Science.gov (United States)

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Phylogenetic signals in the climatic niches of the world's amphibians

    DEFF Research Database (Denmark)

    Hof, Christian; Rahbek, Carsten; Araújo, Miguel B.

    2010-01-01

    amphibian orders and across biogeographical regions. To our knowledge, this is the first study providing a comprehensive analysis of the phylogenetic signal in species climatic niches for an entire clade across the world. Even though our results do not provide a strong test of the niche conservatism......The question of whether closely related species share similar ecological requirements has attracted increasing attention, because of its importance for understanding global diversity gradients and the impacts of climate change on species distributions. In fact, the assumption that related species...... are also ecologically similar has often been made, although the prevalence of such a phylogenetic signal in ecological niches remains heavily debated. Here, we provide a global analysis of phylogenetic niche relatedness for the world's amphibians. In particular, we assess which proportion of the variance...

  4. Recovery and phylogenetic diversity of culturable fungi associated with marine sponges Clathrina luteoculcitella and Holoxea sp. in the South China Sea.

    Science.gov (United States)

    Ding, Bo; Yin, Ying; Zhang, Fengli; Li, Zhiyong

    2011-08-01

    Sponge-associated fungi represent an important source of marine natural products, but little is known about the fungal diversity and the relationship of sponge-fungal association, especially no research on the fungal diversity in the South China Sea sponge has been reported. In this study, a total of 111 cultivable fungi strains were isolated from two South China Sea sponges Clathrina luteoculcitella and Holoxea sp. using eight different media. Thirty-two independent representatives were selected for analysis of phylogenetic diversity according to ARDRA and morphological characteristics. The culturable fungal communities consisted of at least 17 genera within ten taxonomic orders of two phyla (nine orders of the phylum Ascomycota and one order of the phylum Basidiomycota) including some potential novel marine fungi. Particularly, eight genera of Apiospora, Botryosphaeria, Davidiella, Didymocrea, Lentomitella, Marasmius, Pestalotiopsis, and Rhizomucor were isolated from sponge for the first time. Sponge C. luteoculcitella has greater culturable fungal diversity than sponge Holoxea sp. Five genera of Aspergillus, Davidiella, Fusarium, Paecilomyces, and Penicillium were isolated from both sponges, while 12 genera of Apiospora, Botryosphaeria, Candida, Marasmius, Cladosporium, Didymocrea, Hypocrea, Lentomitella, Nigrospora, Pestalotiopsis, Rhizomucor, and Scopulariopsis were isolated from sponge C. luteoculcitella only. Order Eurotiales especially genera Penicillium, Aspergillus, and order Hypocreales represented the dominant culturable fungi in these two South China Sea sponges. Nigrospora oryzae strain PF18 isolated from sponge C. luteoculcitella showed a strong and broad spectrum antimicrobial activities suggesting the potential for antimicrobial compounds production.

  5. Effects of logging and recruitment on community phylogenetic structure in 32 permanent forest plots of Kampong Thom, Cambodia.

    Science.gov (United States)

    Toyama, Hironori; Kajisa, Tsuyoshi; Tagane, Shuichiro; Mase, Keiko; Chhang, Phourin; Samreth, Vanna; Ma, Vuthy; Sokh, Heng; Ichihashi, Ryuji; Onoda, Yusuke; Mizoue, Nobuya; Yahara, Tetsukazu

    2015-02-19

    Ecological communities including tropical rainforest are rapidly changing under various disturbances caused by increasing human activities. Recently in Cambodia, illegal logging and clear-felling for agriculture have been increasing. Here, we study the effects of logging, mortality and recruitment of plot trees on phylogenetic community structure in 32 plots in Kampong Thom, Cambodia. Each plot was 0.25 ha; 28 plots were established in primary evergreen forests and four were established in secondary dry deciduous forests. Measurements were made in 1998, 2000, 2004 and 2010, and logging, recruitment and mortality of each tree were recorded. We estimated phylogeny using rbcL and matK gene sequences and quantified phylogenetic α and β diversity. Within communities, logging decreased phylogenetic diversity, and increased overall phylogenetic clustering and terminal phylogenetic evenness. Between communities, logging increased phylogenetic similarity between evergreen and deciduous plots. On the other hand, recruitment had opposite effects both within and between communities. The observed patterns can be explained by environmental homogenization under logging. Logging is biased to particular species and larger diameter at breast height, and forest patrol has been effective in decreasing logging. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  6. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards

    NARCIS (Netherlands)

    Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.

    2017-01-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the

  7. Identification of Four Distinct Phylogenetic Groups in Flavobacterium columnare With Fish Host Associations

    Directory of Open Access Journals (Sweden)

    Benjamin R. LaFrentz

    2018-03-01

    Full Text Available Columnaris disease, caused by the Gram-negative bacterium Flavobacterium columnare, is one of the most prevalent fish diseases worldwide. An exceptionally high level of genetic diversity among isolates of F. columnare has long been recognized, whereby six established genomovars have been described to date. However, little has been done to quantify or characterize this diversity further in a systematic fashion. The objective of this research was to perform phylogenetic analyses of 16S rRNA and housekeeping gene sequences to decipher the genetic diversity of F. columnare. Fifty isolates and/or genomes of F. columnare, originating from diverse years, geographic locations, fish hosts, and representative of the six genomovars were analyzed in this study. A multilocus phylogenetic analysis (MLPA of the 16S rRNA and six housekeeping genes supported four distinct F. columnare genetic groups. There were associations between genomovar and genetic group, but these relationships were imperfect indicating that genomovar assignment does not accurately reflect F. columnare genetic diversity. To expand the dataset, an additional 90 16S rRNA gene sequences were retrieved from GenBank and a phylogenetic analysis of this larger dataset also supported the establishment of four genetic groups. Examination of isolate historical data indicated biological relevance to the identified genetic diversity, with some genetic groups isolated preferentially from specific fish species or families. It is proposed that F. columnare isolates be assigned to the four genetic groups defined in this study rather than genomovar in order to facilitate a standard nomenclature across the scientific community. An increased understanding of which genetic groups are most prevalent in different regions and/or aquaculture industries may allow for the development of improved targeted control and treatment measures for columnaris disease.

  8. Agroforestry Practices Promote Biodiversity and Natural Resource Diversity in Atlantic Nicaragua.

    Science.gov (United States)

    Sistla, Seeta A; Roddy, Adam B; Williams, Nicholas E; Kramer, Daniel B; Stevens, Kara; Allison, Steven D

    2016-01-01

    Tropical forest conversion to pasture, which drives greenhouse gas emissions, soil degradation, and biodiversity loss, remains a pressing socio-ecological challenge. This problem has spurred increased interest in the potential of small-scale agroforestry systems to couple sustainable agriculture with biodiversity conservation, particularly in rapidly developing areas of the tropics. In addition to providing natural resources (i.e. food, medicine, lumber), agroforestry systems have the potential to maintain higher levels of biodiversity and greater biomass than lower diversity crop or pasture systems. Greater plant diversity may also enhance soil quality, further supporting agricultural productivity in nutrient-limited tropical systems. Yet, the nature of these relationships remains equivocal. To better understand how different land use strategies impact ecosystem services, we characterized the relationships between plant diversity (including species richness, phylogenetic diversity, and natural resource diversity), and soil quality within pasture, agroforests, and secondary forests, three common land use types maintained by small-scale farmers in the Pearl Lagoon Basin, Nicaragua. The area is undergoing accelerated globalization following the 2007 completion of the region's first major road; a change which is expected to increase forest conversion for agriculture. However, farmer agrobiodiversity maintenance in the Basin was previously found to be positively correlated with affiliation to local agricultural NGOs through the maintenance of agroforestry systems, despite these farmers residing in the communities closest to the new road, highlighting the potential for maintaining diverse agroforestry agricultural strategies despite heightened globalization pressures. We found that agroforestry sites tended to have higher surface soil %C, %N, and pH relative to neighboring to secondary forest, while maintaining comparable plant diversity. In contrast, pasture reduced

  9. Agroforestry Practices Promote Biodiversity and Natural Resource Diversity in Atlantic Nicaragua.

    Directory of Open Access Journals (Sweden)

    Seeta A Sistla

    Full Text Available Tropical forest conversion to pasture, which drives greenhouse gas emissions, soil degradation, and biodiversity loss, remains a pressing socio-ecological challenge. This problem has spurred increased interest in the potential of small-scale agroforestry systems to couple sustainable agriculture with biodiversity conservation, particularly in rapidly developing areas of the tropics. In addition to providing natural resources (i.e. food, medicine, lumber, agroforestry systems have the potential to maintain higher levels of biodiversity and greater biomass than lower diversity crop or pasture systems. Greater plant diversity may also enhance soil quality, further supporting agricultural productivity in nutrient-limited tropical systems. Yet, the nature of these relationships remains equivocal. To better understand how different land use strategies impact ecosystem services, we characterized the relationships between plant diversity (including species richness, phylogenetic diversity, and natural resource diversity, and soil quality within pasture, agroforests, and secondary forests, three common land use types maintained by small-scale farmers in the Pearl Lagoon Basin, Nicaragua. The area is undergoing accelerated globalization following the 2007 completion of the region's first major road; a change which is expected to increase forest conversion for agriculture. However, farmer agrobiodiversity maintenance in the Basin was previously found to be positively correlated with affiliation to local agricultural NGOs through the maintenance of agroforestry systems, despite these farmers residing in the communities closest to the new road, highlighting the potential for maintaining diverse agroforestry agricultural strategies despite heightened globalization pressures. We found that agroforestry sites tended to have higher surface soil %C, %N, and pH relative to neighboring to secondary forest, while maintaining comparable plant diversity. In contrast

  10. Diversity of bacteria carried by pinewood nematode in USA and phylogenetic comparison with isolates from other countries.

    Directory of Open Access Journals (Sweden)

    Diogo Neves Proença

    Full Text Available Pine wilt disease (PWD is native to North America and has spread to Asia and Europe. Lately, mutualistic relationship has been suggested between the pinewood nematode (PWN, Bursaphelenchus xylophilus the causal nematode agent of PWD, and bacteria. In countries where PWN occurs, nematodes from diseased trees were reported to carry bacteria from several genera. However no data exists for the United States. The objective of this study was to evaluate the diversity of the bacterial community carried by B. xylophilus, isolated from different Pinus spp. with PWD in Nebraska, United States. The bacteria carried by PWN belonged to Gammaproteobacteria (79.9%, Betaproteobacteria (11.7%, Bacilli (5.0%, Alphaproteobacteria (1.7% and Flavobacteriia (1.7%. Strains from the genera Chryseobacterium and Pigmentiphaga were found associated with the nematode for the first time. These results were compared to results from similar studies conducted from other countries of three continents in order to assess the diversity of bacteria with associated with PWN. The isolates from the United States, Portugal and China belonged to 25 different genera and only strains from the genus Pseudomonas were found in nematodes from all countries. The strains from China were closely related to P. fluorescens and the strains isolated from Portugal and USA were phylogenetically related to P. mohnii and P. lutea. Nematodes from the different countries are associated with bacteria of different species, not supporting a relationship between PWN with a particular bacterial species. Moreover, the diversity of the bacteria carried by the pinewood nematode seems to be related to the geographic area and the Pinus species. The roles these bacteria play within the pine trees or when associated with the nematodes, might be independent of the presence of the nematode in the tree and only related on the bacteria's relationship with the tree.

  11. Phylogenetic and Functional Diversity of Total (DNA) and Expressed (RNA) Bacterial Communities in Urban Green Infrastructure Bioswale Soils.

    Science.gov (United States)

    Gill, Aman S; Lee, Angela; McGuire, Krista L

    2017-08-15

    New York City (NYC) is pioneering green infrastructure with the use of bioswales and other engineered soil-based habitats to provide stormwater infiltration and other ecosystem functions. In addition to avoiding the environmental and financial costs of expanding traditional built infrastructure, green infrastructure is thought to generate cobenefits in the form of diverse ecological processes performed by its plant and microbial communities. Yet, although plant communities in these habitats are closely managed, we lack basic knowledge about how engineered ecosystems impact the distribution and functioning of soil bacteria. We sequenced amplicons of the 16S ribosomal subunit, as well as seven genes associated with functional pathways, generated from both total (DNA-based) and expressed (RNA) soil communities in the Bronx, NYC, NY, in order to test whether bioswale soils host characteristic bacterial communities with evidence for enriched microbial functioning, compared to nonengineered soils in park lawns and tree pits. Bioswales had distinct, phylogenetically diverse bacterial communities, including taxa associated with nutrient cycling and metabolism of hydrocarbons and other pollutants. Bioswale soils also had a significantly greater diversity of genes involved in several functional pathways, including carbon fixation ( cbbL-R [ cbbL gene, red-like subunit] and apsA ), nitrogen cycling ( noxZ and amoA ), and contaminant degradation ( bphA ); conversely, no functional genes were significantly more abundant in nonengineered soils. These results provide preliminary evidence that urban land management can shape the diversity and activity of soil communities, with positive consequences for genetic resources underlying valuable ecological functions, including biogeochemical cycling and degradation of common urban pollutants. IMPORTANCE Management of urban soil biodiversity by favoring taxa associated with decontamination or other microbial metabolic processes is a

  12. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  13. Large-scale phylogenetic analyses provide insights into unrecognized diversity and historical biogeography of Asian leaf-litter frogs, genus Leptolalax (Anura: Megophryidae).

    Science.gov (United States)

    Chen, Jin-Min; Poyarkov, Nikolay A; Suwannapoom, Chatmongkon; Lathrop, Amy; Wu, Yun-He; Zhou, Wei-Wei; Yuan, Zhi-Yong; Jin, Jie-Qiong; Chen, Hong-Man; Liu, He-Qun; Nguyen, Truong Quang; Nguyen, Sang Ngoc; Duong, Tang Van; Eto, Koshiro; Nishikawa, Kanto; Matsui, Masafumi; Orlov, Nikolai L; Stuart, Bryan L; Brown, Rafe M; Rowley, Jodi J L; Murphy, Robert W; Wang, Ying-Yong; Che, Jing

    2018-07-01

    Southeast Asia and southern China (SEA-SC) harbor a highly diverse and endemic flora and fauna that is under increasing threat. An understanding of the biogeographical history and drivers of this diversity is lacking, especially in some of the most diverse and threatened groups. The Asian leaf-litter frog genus Leptolalax Dubois 1980 is a forest-dependent genus distributed throughout SEA-SC, making it an ideal study group to examine specific biogeographic hypotheses. In addition, the diversity of this genus remains poorly understood, and the phylogenetic relationships among species of Leptolalax and closely related Leptobrachella Smith 1928 remain unclear. Herein, we evaluate species-level diversity based on 48 of the 53 described species from throughout the distribution of Leptolalax. Molecular analyses reveal many undescribed species, mostly in southern China and Indochina. Our well-resolved phylogeny based on multiple nuclear DNA markers shows that Leptolalax is not monophyletic with respect to Leptobrachella and, thus, we assign the former to being a junior synonym of the latter. Similarly, analyses reject monophyly of the two subgenera of Leptolalax. The diversification pattern of the group is complex, involving a high degree of sympatry and prevalence of microendemic species. Northern Sundaland (Borneo) and eastern Indochina (Vietnam) appear to have played pivotal roles as geographical centers of diversification, and paleoclimatic changes and tectonic movements seem to have driven the major divergence of clades. Analyses fail to reject an "upstream" colonization hypothesis, and, thus, the genus appears to have originated in Sundaland and then colonized mainland Asia. Our results reveal that both vicariance and dispersal are responsible for current distribution patterns in the genus. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. [New isolation methods and phylogenetic diversity of actinobacteria from hypersaline beach in Aksu].

    Science.gov (United States)

    Zhang, Yao; Xia, Zhanfeng; Cao, Xinbo; Li, Jun; Zhang, Lili

    2013-08-04

    We explored 4 new methods to improve the isolation of actinobacterial resources from high salt areas. Optimized media based on 4 new strategies were used for isolating actinobacteria from hypersaline beaches. Glycerin-arginine, trehalose-creatine, glycerol-asparticacid, mannitol-casein, casein-mannitol, mannitol-alanine, chitosan-asparagineand GAUZE' No. 1 were used as basic media. New isolation strategy includes 4 methods: ten-fold dilution culture, simulation of the original environment, actinobacterial culture guided by uncultured molecular technology detected, and reference of actinobacterial media for brackish marine environment. The 16S rRNA genes of the isolates were amplified with bacterial universal primers. The results of 16S rRNA gene sequences were compared with sequences obtained from GenBank databases. We constructed phylogenetic tree with the neighbor-joining method. No actinobacterial strains were isolated by 8 media of control group, while 403 strains were isolated by new strategies. The isolates by new methods were members of 14 genera (Streptomyces, Streptomonospora, Saccharomonospora, Plantactinospora, Nocardia, Amycolatopsis, Glycomyces, Micromonospora, Nocardiopsis, Isoptericola, Nonomuraea, Thermobifida, Actinopolyspora, Actinomadura) of 10 families in 8 suborders. The most abundant and diverse isolates were the two suborders of Streptomycineae (69.96%) and Streptosporangineaesuborder (9.68%) within the phylum Actinobacteria, including 9 potential novel species. New isolation methods significantly improved the actinobacterial culturability of hypersaline areas, and obtained many potential novel species, which provided a new and more effective way to isolate actinobacteria resources in hypersaline environments.

  15. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  16. Phylogenetic analysis of Tibetan mastiffs based on mitochondrial hypervariable region I.

    Science.gov (United States)

    Ren, Zhanjun; Chen, Huiling; Yang, Xuejiao; Zhang, Chengdong

    2017-03-01

    Recently, the number of Tibetan mastiffs, which is a precious germplasm resource and cultural heritage, is decreasing sharply. Therefore, the genetic diversity of Tibetan mastiffs needs to be studied to clarify its phylogenetics relationships and lay the foundation for resource protection, rational development and utilization of Tibetan mastiffs. We sequenced hypervariable region I of mitochondrial DNA (mtDNA) of 110 individuals from Tibet region and Gansu province. A total of 12 polymorphic sites were identified which defined eight haplotypes of which H4 and H8 were unique to Tibetan population with H8 being identified first. The haplotype diversity (Hd: 0.808), nucleotide diversity (Pi: 0.603%), the average number of nucleotide difference (K: 3.917) of Tibetan mastiffs from Gansu were higher than those from Tibet region (Hd: 0.794; Pi: 0.589%; K: 3.831), which revealed higher genetic diversity in Gansu. In terms of total population, the genetic variation was low. The median-joining network and phylogenetic tree based on the mtDNA hypervariable region I showed that Tibetan mastiffs originated from grey wolves, as the other domestic dogs and had different history of maternal origin. The mismatch distribution analysis and neutrality tests indicated that Tibetan mastiffs were in genetic equilibrium or in a population decline.

  17. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  18. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  19. High and distinct range-edge genetic diversity despite local bottlenecks.

    Directory of Open Access Journals (Sweden)

    Jorge Assis

    Full Text Available The genetic consequences of living on the edge of distributional ranges have been the subject of a largely unresolved debate. Populations occurring along persistent low latitude ranges (rear-edge are expected to retain high and unique genetic diversity. In contrast, currently less favourable environmental conditions limiting population size at such range-edges may have caused genetic erosion that prevails over past historical effects, with potential consequences on reducing future adaptive capacity. The present study provides an empirical test of whether population declines towards a peripheral range might be reflected on decreasing diversity and increasing population isolation and differentiation. We compare population genetic differentiation and diversity with trends in abundance along a latitudinal gradient towards the peripheral distribution range of Saccorhiza polyschides, a large brown seaweed that is the main structural species of kelp forests in SW Europe. Signatures of recent bottleneck events were also evaluated to determine whether the recently recorded distributional shifts had a negative influence on effective population size. Our findings show decreasing population density and increasing spatial fragmentation and local extinctions towards the southern edge. Genetic data revealed two well supported groups with a central contact zone. As predicted, higher differentiation and signs of bottlenecks were found at the southern edge region. However, a decrease in genetic diversity associated with this pattern was not verified. Surprisingly, genetic diversity increased towards the edge despite bottlenecks and much lower densities, suggesting that extinctions and recolonizations have not strongly reduced diversity or that diversity might have been even higher there in the past, a process of shifting genetic baselines.

  20. Global biogeography of Prochlorococcus genome diversity in the surface ocean.

    Science.gov (United States)

    Kent, Alyssa G; Dupont, Chris L; Yooseph, Shibu; Martiny, Adam C

    2016-08-01

    Prochlorococcus, the smallest known photosynthetic bacterium, is abundant in the ocean's surface layer despite large variation in environmental conditions. There are several genetically divergent lineages within Prochlorococcus and superimposed on this phylogenetic diversity is extensive gene gain and loss. The environmental role in shaping the global ocean distribution of genome diversity in Prochlorococcus is largely unknown, particularly in a framework that considers the vertical and lateral mechanisms of evolution. Here we show that Prochlorococcus field populations from a global circumnavigation harbor extensive genome diversity across the surface ocean, but this diversity is not randomly distributed. We observed a significant correspondence between phylogenetic and gene content diversity, including regional differences in both phylogenetic composition and gene content that were related to environmental factors. Several gene families were strongly associated with specific regions and environmental factors, including the identification of a set of genes related to lower nutrient and temperature regions. Metagenomic assemblies of natural Prochlorococcus genomes reinforced this association by providing linkage of genes across genomic backbones. Overall, our results show that the phylogeography in Prochlorococcus taxonomy is echoed in its genome content. Thus environmental variation shapes the functional capabilities and associated ecosystem role of the globally abundant Prochlorococcus.

  1. Evidence of Increased Antibiotic Resistance in Phylogenetically-Diverse Aeromonas Isolates from Semi-Intensive Fish Ponds Treated with Antibiotics.

    Science.gov (United States)

    Patil, Hemant J; Benet-Perelberg, Ayana; Naor, Alon; Smirnov, Margarita; Ofek, Tamir; Nasser, Ahmed; Minz, Dror; Cytryn, Eddie

    2016-01-01

    The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain the effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically to fingerling stocks and water column-associated Aeromonas were monitored periodically over an 11-month fish fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a 3-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas isolates were initially screened for sulfadiazine resistance and further screened against five additional antimicrobials. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamicin, and chloramphenicol resistances were low. Multidrug resistant strains as well as sul1, tetA , and intI1 gene-harboring strains were significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically distinct Aeromonas clusters were identified using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were identified, including an A. salmonicida

  2. Genetic diversity of a Daugava basin brown trout (Salmo trutta brood stock

    Directory of Open Access Journals (Sweden)

    Schmidt Thomas

    2017-01-01

    Full Text Available Genetics play an increasingly important role in the conservation of threatened fish populations. We have examined twelve microsatellite markers to determine the genetic diversity of a brood stock of brown trout from the Latvian Daugava river basin, used in a local supportive breeding program and compared diversity values to other Baltic populations. Allelic data was further inspected for indications of increased inbreeding. Additionally, we have analyzed the mitochondrial control region to classify the population within a broader phylogenetic framework. We found that the genetic diversity was comparatively low, but there was no strong evidence of high inbreeding. A newly detected mitochondrial haplotype indicates unnoticed genetic diversity of “Atlantic lineage” brown trout in the Daugava basin region. Our study provides first genetic details on resident brown trout from the Baltic Daugava river basin to improve the regional conservation management of this valuable genetic resource and contributes phylogeographically useful information.

  3. Virulence profile of different phylogenetic groups of locally isolated community acquired uropathogenic E. coli from Faisalabad region of Pakistan

    Directory of Open Access Journals (Sweden)

    Bashir Saira

    2012-08-01

    Full Text Available Abstract Background Uropathogenic E.coli (UPEC are among major pathogens causing urinary tract infections. Virulence factors are mainly responsible for the severity of these emerging infections. This study was planned to investigate the distribution of virulence genes and cytotoxic effects of UPEC isolates with reference to phylogenetic groups (B2, B1, D and A to understand the presence and impact of virulence factors in the severity of infection in Faisalabad region of Pakistan. Methods In this study phylogenetic analysis, virulence gene identification and cytotoxicity of 59 uropathogenic E.coli isolates obtained from non-hospitalized patients was studied. Results Among 59 isolates, phylogenetic group B2 (50% was most dominant followed by groups A, B1 (19% each and D (12%. Isolates present in group D showed highest presence of virulence genes. The prevalence hlyA (37% was highest followed by sfaDE (27%, papC (24%, cnf1 (20%, eaeA (19% and afaBC3 (14%. Highly hemolytic and highly verotoxic isolates mainly belonged to group D and B2. We also found two isolates with simultaneous presence of three fimbrial adhesin genes present on pap, afa, and sfa operons. This has not been reported before and underlines the dynamic nature of these UPEC isolates. Conclusions It was concluded that in local UPEC isolates from non-hospitalized patients, group B2 was more prevalent. However, group D isolates were most versatile as all were equipped with virulence genes and showed highest level of cytotoxicity.

  4. Phylogenetic Paleoecology: Tree-Thinking and Ecology in Deep Time.

    Science.gov (United States)

    Lamsdell, James C; Congreve, Curtis R; Hopkins, Melanie J; Krug, Andrew Z; Patzkowsky, Mark E

    2017-06-01

    The new and emerging field of phylogenetic paleoecology leverages the evolutionary relationships among species to explain temporal and spatial changes in species diversity, abundance, and distribution in deep time. This field is poised for rapid progress as knowledge of the evolutionary relationships among fossil species continues to expand. In particular, this approach will lend new insights to many of the longstanding questions in evolutionary biology, such as: the relationships among character change, ecology, and evolutionary rates; the processes that determine the evolutionary relationships among species within communities and along environmental gradients; and the phylogenetic signal underlying ecological selectivity in background and mass extinctions and in major evolutionary radiations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals.

    Science.gov (United States)

    Asakura, H; Makino, S; Kobori, H; Watarai, M; Shirahata, T; Ikeda, T; Takeshi, K

    2001-08-01

    Nucleotide sequences of Shiga toxin (Stx) genes in STEC from various origins were determined and characterized by phylogenetic analysis based on Shiga toxin (Stx) with those deposited in GenBank. The phylogenetic trees placed Stx1 and Stx2 into two and five groups respectively, and indicated that Stx1 in sheep-origin STEC were placed into a different group from those in other STEC, and that Stx2 of deer-origin STEC also belonged to the unique group and appeared to be distantly related to human-origin STEC. On the other hand, Stx of STEC isolated from cattle, seagulls and flies were closely related to those of human-origin STEC. Such a diversity of Stx suggested that STEC might be widely disseminated in many animal species, and be dependent on their host species or their habitat. In addition, the active sites in both toxins were compared; the active sites in both subunits of Stx in all the animal-origin STEC were identical to those in human-origin STEC, suggesting that all the toxin of STEC from animals might be also cytotoxic, and therefore, such animal-origin STEC might have potential pathogenicity for humans.

  6. Phylogenetic relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae).

    Science.gov (United States)

    Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana

    2011-01-01

    Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.

  7. Phylogenetically-informed priorities for amphibian conservation.

    Science.gov (United States)

    Isaac, Nick J B; Redding, David W; Meredith, Helen M; Safi, Kamran

    2012-01-01

    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  8. Phylogenetically-informed priorities for amphibian conservation.

    Directory of Open Access Journals (Sweden)

    Nick J B Isaac

    Full Text Available The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  9. Phylogenetics and genetic diversity of the Cotesia flavipes complex of parasitoid wasps (Hymenoptera: Braconidae), biological control agents of lepidopteran stemborers.

    Science.gov (United States)

    Muirhead, Kate A; Murphy, Nicholas P; Sallam, Nader; Donnellan, Stephen C; Austin, Andrew D

    2012-06-01

    The Cotesia flavipes complex of parasitoid wasps (Hymenoptera: Braconidae) are economically important for the biological control of lepidopteran stemboring pests associated with gramineous crops. Some members of the complex successfully parasitize numerous stemborer pest species, however certain geographic populations have demonstrated variation in the range of hosts that they parasitize. In addition, the morphology of the complex is highly conserved and considerable confusion surrounds the identity of species and host-associated biotypes. We generated nucleotide sequence data for two mtDNA genes (COI, 16S) and three anonymous nuclear loci (CfBN, CfCN, CfEN) for the C. flavipes complex. To analyze genetic variation and relationships among populations we used (1) concatenated mtDNA and nDNA data, (2) a nDNA multilocus network approach, and (3) two species tree inference methods, i.e. Bayesian estimation of species trees (BEST) and Bayesian inference of species trees from multilocus data with (*)BEAST. All phylogenetic analyses provide strong support for monophyly of the complex and the presence of at least four species, C. chilonis (from China and Japan), C. sesamiae (from Africa), C. flavipes (originating from the Indo-Asia region but introduced into Africa and the New World), and C. nonagriae (from Australia and Papua New Guinea). Haplotype diversity of geographic populations relates to historical biogeographic barriers and biological control introductions, and reflects previous reports of ecological variation in these species. Strong discordance was found between the mitochondrial and nuclear markers in the Papua New Guinea haplotypes, which may be an outcome of hybridization and introgression of C. flavipes and C. nonagriae. The position of Cotesia flavipes from Japan was not well supported in any analysis and was the sister taxon to C. nonagriae (mtDNA, (*)BEAST), C. flavipes (nDNA) or C. flavipes+C. nonagriae (BEST) and, may represent a cryptic species. The

  10. Genetic diversity measures of local European beef cattle breeds for conservation purposes

    Directory of Open Access Journals (Sweden)

    Pereira Albano

    2001-05-01

    Full Text Available Abstract This study was undertaken to determine the genetic structure, evolutionary relationships, and the genetic diversity among 18 local cattle breeds from Spain, Portugal, and France using 16 microsatellites. Heterozygosities, estimates of Fst, genetic distances, multivariate and diversity analyses, and assignment tests were performed. Heterozygosities ranged from 0.54 in the Pirenaica breed to 0.72 in the Barrosã breed. Seven percent of the total genetic variability can be attributed to differences among breeds (mean Fst = 0.07; P

  11. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  12. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  13. Phylogenetic and functional diversity of the cultivable bacterial community associated with the paralytic shellfish poisoning dinoflagellate Gymnodinium catenatum.

    Science.gov (United States)

    Green, David H; Llewellyn, Lyndon E; Negri, Andrew P; Blackburn, Susan I; Bolch, Christopher J S

    2004-03-01

    Gymnodinium catenatum is one of several dinoflagellates that produce a suite of neurotoxins called the paralytic shellfish toxins (PST), responsible for outbreaks of paralytic shellfish poisoning in temperate and tropical waters. Previous research suggested that the bacteria associated with the surface of the sexual resting stages (cyst) were important to the production of PST by G. catenatum. This study sought to characterise the cultivable bacterial diversity of seven different strains of G. catenatum that produce both high and abnormally low amounts of PST, with the long-term aim of understanding the role the bacterial flora has in bloom development and toxicity of this alga. Sixty-one bacterial isolates were cultured and phylogenetically identified as belonging to the Proteobacteria (70%), Bacteroidetes (26%) or Actinobacteria (3%). The Alphaproteobacteria were the most numerous both in terms of the number of isolates cultured (49%) and were also the most abundant type of bacteria in each G. catenatum culture. Two phenotypic (functional) traits inferred from the phylogenetic data were shown to be a common feature of the bacteria present in each G. catenatum culture: firstly, Alphaproteobacteria capable of aerobic anoxygenic photosynthesis, and secondly, Gammaproteobacteria capable of hydrocarbon utilisation and oligotrophic growth. In relation to reports of autonomous production of PST by dinoflagellate-associated bacteria, PST production by bacterial isolates was investigated, but none were shown to produce any PST-like toxins. Overall, this study has identified a number of emergent trends in the bacterial community of G. catenatum which are mirrored in the bacterial flora of other dinoflagellates, and that are likely to be of especial relevance to the population dynamics of natural and harmful algal blooms.

  14. Changes in species diversity of arboreal spiders in Mexican coffee agroecosystems: untangling the web of local and landscape influences driving diversity

    Directory of Open Access Journals (Sweden)

    Zachary Hajian-Forooshani

    2014-11-01

    Full Text Available Agricultural intensification is implicated as a major driver of global biodiversity loss. Local management and landscape scale factors both influence biodiversity in agricultural systems, but there are relatively few studies to date looking at how local and landscape scales influence biodiversity in tropical agroecosystems. Understanding what drives the diversity of groups of organisms such as spiders is important from a pragmatic point of view because of the important biocontrol services they offer to agriculture. Spiders in coffee are somewhat enigmatic because of their positive or lack of response to agricultural intensification. In this study, we provide the first analysis, to our knowledge, of the arboreal spiders in the shade trees of coffee plantations. In the Soconusco region of Chiapas, Mexico we sampled across 38 sites on 9 coffee plantations. Tree and canopy connectedness were found to positively influence overall arboreal spider richness and abundance. We found that different functional groups of spiders are responding to different local and landscape factors, but overall elevation was most important variable influencing arboreal spider diversity. Our study has practical management applications that suggest having shade grown coffee offers more suitable habitat for arboreal spiders due to a variety of the characteristics of the shade trees. Our results which show consistently more diverse arboreal spider communities in lower elevations are important in light of looming global climate change. As the range of suitable elevations for coffee cultivation shrinks promoting arboreal spider diversity will be important in sustaining the viability of coffee.

  15. Distance-Based Phylogenetic Methods Around a Polytomy.

    Science.gov (United States)

    Davidson, Ruth; Sullivant, Seth

    2014-01-01

    Distance-based phylogenetic algorithms attempt to solve the NP-hard least-squares phylogeny problem by mapping an arbitrary dissimilarity map representing biological data to a tree metric. The set of all dissimilarity maps is a Euclidean space properly containing the space of all tree metrics as a polyhedral fan. Outputs of distance-based tree reconstruction algorithms such as UPGMA and neighbor-joining are points in the maximal cones in the fan. Tree metrics with polytomies lie at the intersections of maximal cones. A phylogenetic algorithm divides the space of all dissimilarity maps into regions based upon which combinatorial tree is reconstructed by the algorithm. Comparison of phylogenetic methods can be done by comparing the geometry of these regions. We use polyhedral geometry to compare the local nature of the subdivisions induced by least-squares phylogeny, UPGMA, and neighbor-joining when the true tree has a single polytomy with exactly four neighbors. Our results suggest that in some circumstances, UPGMA and neighbor-joining poorly match least-squares phylogeny.

  16. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  17. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. Correlating Microbial Diversity Patterns with Geochemistry in an Extreme and Heterogeneous Environment of Mine Tailings

    Science.gov (United States)

    Liu, Jun; Hua, Zheng-Shuang; Chen, Lin-Xing; Kuang, Jia-Liang; Li, Sheng-Jin; Shu, Wen-Sheng

    2014-01-01

    Recent molecular surveys have advanced our understanding of the forces shaping the large-scale ecological distribution of microbes in Earth's extreme habitats, such as hot springs and acid mine drainage. However, few investigations have attempted dense spatial analyses of specific sites to resolve the local diversity of these extraordinary organisms and how communities are shaped by the harsh environmental conditions found there. We have applied a 16S rRNA gene-targeted 454 pyrosequencing approach to explore the phylogenetic differentiation among 90 microbial communities from a massive copper tailing impoundment generating acidic drainage and coupled these variations in community composition with geochemical parameters to reveal ecological interactions in this extreme environment. Our data showed that the overall microbial diversity estimates and relative abundances of most of the dominant lineages were significantly correlated with pH, with the simplest assemblages occurring under extremely acidic conditions and more diverse assemblages associated with neutral pHs. The consistent shifts in community composition along the pH gradient indicated that different taxa were involved in the different acidification stages of the mine tailings. Moreover, the effect of pH in shaping phylogenetic structure within specific lineages was also clearly evident, although the phylogenetic differentiations within the Alphaproteobacteria, Deltaproteobacteria, and Firmicutes were attributed to variations in ferric and ferrous iron concentrations. Application of the microbial assemblage prediction model further supported pH as the major factor driving community structure and demonstrated that several of the major lineages are readily predictable. Together, these results suggest that pH is primarily responsible for structuring whole communities in the extreme and heterogeneous mine tailings, although the diverse microbial taxa may respond differently to various environmental conditions

  19. Phylodynamic analysis and molecular diversity of the avian infectious bronchitis virus of chickens in Brazil.

    Science.gov (United States)

    Fraga, Aline Padilha de; Gräf, Tiago; Pereira, Cleiton Schneider; Ikuta, Nilo; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2018-03-21

    Avian infectious bronchitis virus (IBV) is the etiological agent of a highly contagious disease, which results in severe economic losses to the poultry industry. The spike protein (S1 subunit) is responsible for the molecular diversity of the virus and many sero/genotypes are described around the world. Recently a new standardized classification of the IBV molecular diversity was conducted, based on phylogenetic analysis of the S1 gene sequences sampled worldwide. Brazil is one of the biggest poultry producers in the world and the present study aimed to review the molecular diversity and reconstruct the evolutionary history of IBV in the country. All IBV S1 gene sequences, with local and year of collection information available on GenBank, were retrieved. Phylogenetic analyses were carried out based on a maximum likelihood method for the classification of genotypes occurring in Brazil, according to the new classification. Bayesian phylogenetic analyses were performed with the Brazilian clade and related international sequences to determine the evolutionary history of IBV in Brazil. A total of 143 Brazilian sequences were classified as GI-11 and 46 as GI-1 (Mass). Within the GI-11 clade, we have identified a potential recombinant strain circulating in Brazil. Phylodynamic analysis demonstrated that IBV GI-11 lineage was introduced in Brazil in the 1950s (1951, 1917-1975 95% HPD) and population dynamics was mostly constant throughout the time. Despite the national vaccination protocols, our results show the widespread dissemination and maintenance of the IBV GI-11 lineage in Brazil and highlight the importance of continuous surveillance to evaluate the impact of currently used vaccine strains on the observed viral diversity of the country. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Patterns of species diversity and phylogenetic structure of vascular plants on the Qinghai-Tibetan Plateau.

    Science.gov (United States)

    Yan, Yujing; Yang, Xian; Tang, Zhiyao

    2013-11-01

    Large-scale patterns of species richness and the underlying mechanisms regulating these patterns have long been the central issues in biogeography and macroecology. Phylogenetic community structure is a result of combined effects of contemporary ecological interactions, environmental filtering, and evolutionary history, and it links community ecology with biogeography and trait evolution. The Qinghai-Tibetan Plateau provides a good opportunity to test the influence of contemporary climate on shaping species richness because of its unique geological history, cold climate, and high biodiversity. In this study, based on high-resolution distributions of ˜9000 vascular plant species, we explored how species richness and phylogenetic structure of vascular plants correlate with climates on the highest (and species rich) plateau on the Earth. The results showed that most of the vascular plants were distributed on the eastern part of the plateau; there was a strong association between species richness and climate, even after the effects of habitat heterogeneity were controlled. However, the responses of richness to climate remarkably depended on life-forms. Richness of woody plants showed stronger climatic associations than that of herbaceous plants; energy and water availability together regulated richness pattern of woody plants; whereas water availability predominantly regulated richness pattern of herbaceous plants. The phylogenetic structure of vascular species clustered in most areas of the plateau, suggesting that rapid speciation and environment filtering dominated the assembly of communities on the plateau. We further propose that biodiversity conservation in this area should better take into account ecological features for different life-forms and phylogenetic lineages.

  1. Shifts in phylogenetic diversity of archaeal communities in mangrove sediments at different sites and depths in southeastern Brazil.

    Science.gov (United States)

    Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui

    2012-06-01

    This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  2. Characterizing the phylogenetic tree community structure of a protected tropical rain forest area in Cameroon.

    Science.gov (United States)

    Manel, Stéphanie; Couvreur, Thomas L P; Munoz, François; Couteron, Pierre; Hardy, Olivier J; Sonké, Bonaventure

    2014-01-01

    Tropical rain forests, the richest terrestrial ecosystems in biodiversity on Earth are highly threatened by global changes. This paper aims to infer the mechanisms governing species tree assemblages by characterizing the phylogenetic structure of a tropical rain forest in a protected area of the Congo Basin, the Dja Faunal Reserve (Cameroon). We re-analyzed a dataset of 11538 individuals belonging to 372 taxa found along nine transects spanning five habitat types. We generated a dated phylogenetic tree including all sampled taxa to partition the phylogenetic diversity of the nine transects into alpha and beta components at the level of the transects and of the habitat types. The variation in phylogenetic composition among transects did not deviate from a random pattern at the scale of the Dja Faunal Reserve, probably due to a common history and weak environmental variation across the park. This lack of phylogenetic structure combined with an isolation-by-distance pattern of taxonomic diversity suggests that neutral dispersal limitation is a major driver of community assembly in the Dja. To assess any lack of sensitivity to the variation in habitat types, we restricted the analyses of transects to the terra firme primary forest and found results consistent with those of the whole dataset at the level of the transects. Additionally to previous analyses, we detected a weak but significant phylogenetic turnover among habitat types, suggesting that species sort in varying environments, even though it is not predominating on the overall phylogenetic structure. Finer analyses of clades indicated a signal of clustering for species from the Annonaceae family, while species from the Apocynaceae family indicated overdispersion. These results can contribute to the conservation of the park by improving our understanding of the processes dictating community assembly in these hyperdiverse but threatened regions of the world.

  3. Characterizing the Phylogenetic Tree Community Structure of a Protected Tropical Rain Forest Area in Cameroon

    Science.gov (United States)

    Munoz, François; Couteron, Pierre; Hardy, Olivier J.; Sonké, Bonaventure

    2014-01-01

    Tropical rain forests, the richest terrestrial ecosystems in biodiversity on Earth are highly threatened by global changes. This paper aims to infer the mechanisms governing species tree assemblages by characterizing the phylogenetic structure of a tropical rain forest in a protected area of the Congo Basin, the Dja Faunal Reserve (Cameroon). We re-analyzed a dataset of 11538 individuals belonging to 372 taxa found along nine transects spanning five habitat types. We generated a dated phylogenetic tree including all sampled taxa to partition the phylogenetic diversity of the nine transects into alpha and beta components at the level of the transects and of the habitat types. The variation in phylogenetic composition among transects did not deviate from a random pattern at the scale of the Dja Faunal Reserve, probably due to a common history and weak environmental variation across the park. This lack of phylogenetic structure combined with an isolation-by-distance pattern of taxonomic diversity suggests that neutral dispersal limitation is a major driver of community assembly in the Dja. To assess any lack of sensitivity to the variation in habitat types, we restricted the analyses of transects to the terra firme primary forest and found results consistent with those of the whole dataset at the level of the transects. Additionally to previous analyses, we detected a weak but significant phylogenetic turnover among habitat types, suggesting that species sort in varying environments, even though it is not predominating on the overall phylogenetic structure. Finer analyses of clades indicated a signal of clustering for species from the Annonaceae family, while species from the Apocynaceae family indicated overdispersion. These results can contribute to the conservation of the park by improving our understanding of the processes dictating community assembly in these hyperdiverse but threatened regions of the world. PMID:24936786

  4. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  5. Global diversity and phylogeny of the Asteroidea (Echinodermata.

    Directory of Open Access Journals (Sweden)

    Christopher L Mah

    Full Text Available Members of the Asteroidea (phylum Echinodermata, popularly known as starfish or sea stars, are ecologically important and diverse members of marine ecosystems in all of the world's oceans. We present a comprehensive overview of diversity and phylogeny as they have figured into the evolution of the Asteroidea from Paleozoic to the living fauna. Living post-Paleozoic asteroids, the Neoasteroidea, are morphologically separate from those in the Paleozoic. Early Paleozoic asteroid faunas were diverse and displayed morphology that foreshadowed later living taxa. Preservation presents significant difficulties, but fossil occurrence and current accounts suggests a diverse Paleozoic fauna, which underwent extinction around the Permian-Triassic interval was followed by re-diversification of at least one surviving lineage. Ongoing phylogenetic classification debates include the status of the Paxillosida and the Concentricycloidea. Fossil and molecular evidence has been and continues to be part of the ongoing evolution of asteroid phylogenetic research. The modern lineages of asteroids include the Valvatacea, the Forcipulatacea, the Spinlosida, and the Velatida. We present an overview of diversity in these taxa, as well as brief notes on broader significance, ecology, and functional morphology of each. Although much asteroid taxonomy is stable, many new taxa remain to be discovered with many new species currently awaiting description. The Goniasteridae is currently one of the most diverse families within the Asteroidea. New data from molecular phylogenetics and the advent of global biodiversity databases, such as the World Asteroidea Database (http://www.marinespecies.org/Asteroidea/ present important new springboards for understanding the global biodiversity and evolution of asteroids.

  6. Genetic Diversity and Population Genetics of Mosquitoes (Diptera: Culicidae: Culex spp. from the Sonoran Desert of North America

    Directory of Open Access Journals (Sweden)

    Edward Pfeiler

    2013-01-01

    Full Text Available The population genetics and phylogenetic relationships of Culex mosquitoes inhabiting the Sonoran Desert region of North America were studied using mitochondrial DNA and microsatellite molecular markers. Phylogenetic analyses of mitochondrial cytochrome c oxidase subunit I (COI from mosquitoes collected over a wide geographic area, including the Baja California peninsula, and mainland localities in southern Arizona, USA and Sonora, Mexico, showed several well-supported partitions corresponding to Cx. quinquefasciatus, Cx. tarsalis, and two unidentified species, Culex sp. 1 and sp. 2. Culex quinquefasciatus was found at all localities and was the most abundant species collected. Culex tarsalis was collected only at Tucson, Arizona and Guaymas, Sonora. The two unidentified species of Culex were most abundant at Navojoa in southern Sonora. Haplotype and nucleotide diversities in the COI gene segment were substantially lower in Cx. quinquefasciatus compared with the other three species. Analysis of molecular variance revealed little structure among seven populations of Cx. quinquefasciatus, whereas significant structure was found between the two populations of Cx. tarsalis. Evidence for an historical population expansion beginning in the Pleistocene was found for Cx. tarsalis. Possible explanations for the large differences in genetic diversity between Cx. quinquefasciatus and the other species of Culex are presented.

  7. Genetic Diversity and Population Genetics of Mosquitoes (Diptera: Culicidae: Culex spp.) from the Sonoran Desert of North America

    Science.gov (United States)

    Pfeiler, Edward; Flores-López, Carlos A.; Mada-Vélez, Jesús Gerardo; Escalante-Verdugo, Juan; Markow, Therese A.

    2013-01-01

    The population genetics and phylogenetic relationships of Culex mosquitoes inhabiting the Sonoran Desert region of North America were studied using mitochondrial DNA and microsatellite molecular markers. Phylogenetic analyses of mitochondrial cytochrome c oxidase subunit I (COI) from mosquitoes collected over a wide geographic area, including the Baja California peninsula, and mainland localities in southern Arizona, USA and Sonora, Mexico, showed several well-supported partitions corresponding to Cx. quinquefasciatus, Cx. tarsalis, and two unidentified species, Culex sp. 1 and sp. 2. Culex quinquefasciatus was found at all localities and was the most abundant species collected. Culex tarsalis was collected only at Tucson, Arizona and Guaymas, Sonora. The two unidentified species of Culex were most abundant at Navojoa in southern Sonora. Haplotype and nucleotide diversities in the COI gene segment were substantially lower in Cx. quinquefasciatus compared with the other three species. Analysis of molecular variance revealed little structure among seven populations of Cx. quinquefasciatus, whereas significant structure was found between the two populations of Cx. tarsalis. Evidence for an historical population expansion beginning in the Pleistocene was found for Cx. tarsalis. Possible explanations for the large differences in genetic diversity between Cx. quinquefasciatus and the other species of Culex are presented. PMID:24302868

  8. Identification and phylogenetic analysis of local yellow and orange sweet potatoes genotypes in Sumatera Utara

    Science.gov (United States)

    Rosmayati; Bakti, D.

    2018-02-01

    The objectives of this research was to identify and create database about the diversity of local yellow and orange sweet potatoes accessions in Sumatera Utara, have diversity accession local sweet potatoes genotype in Sumatera Utara selection for classifying populations get high production and good fruit quality. The experiment was conducted in areas of production centers of sweet potatoes in the exploration survey methods in 2 districts in Sumatera Utara, which is in the Kabupaten Simalungun and Dairi. The study was conducted on June to July 2017. Observations were made based on the identification and characterization Description List of International Board for Plant Genetic Resources standard and purposive random sampling technique. The result of this research indicate there 15 genotype of sweet potato yellow and orange in KabupatenSimalungun consistedof KecamatanPurba (G3, G4 and G7), Silimakuta (G5, G6 and G14), and Pamatang Silimahuta (G15) in Kabupaten Dairi consists of Kecamatan Parbuluan (G1, G2, G8 and G9), Sidikalang (G10 and G13), Sumbul (G11), and Sitinjo (G12) with nearest relationship is G13 and G15 with a coefficient similarity 23.908 and farthest relationship is G2 and G7 with a coefficient similarity 140.029.

  9. A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

    Science.gov (United States)

    Takahashi, Tetsumi; Moreno, Edmundo

    2015-12-01

    The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  11. Local Plant Diversity Across Multiple Habitats Supports a Diverse Wild Bee Community in Pennsylvania Apple Orchards.

    Science.gov (United States)

    Kammerer, Melanie A; Biddinger, David J; Rajotte, Edwin G; Mortensen, David A

    2016-02-01

    Wild pollinators supply essential, historically undervalued pollination services to crops and other flowering plant communities with great potential to ensure agricultural production against the loss of heavily relied upon managed pollinators. Local plant communities provision wild bees with crucial floral and nesting resources, but the distribution of floristic diversity among habitat types in North American agricultural landscapes and its effect on pollinators are diverse and poorly understood, especially in orchard systems. We documented floristic diversity in typical mid-Atlantic commercial apple (Malus domestica Borkh.) orchards including the forest and orchard-forest edge ("edge") habitats surrounding orchards in a heterogeneous landscape in south-central Pennsylvania, USA. We also assessed the correlation between plant richness and orchard pollinator communities. In this apple production region, edge habitats are the most species rich, supporting 146 out of 202 plant species recorded in our survey. Plant species richness in the orchard and edge habitats were significant predictors of bee species richness and abundance in the orchard, as well as landscape area of the forest and edge habitats. Both the quantity and quality of forest and edges close to orchards play a significant role in provisioning a diverse wild bee community in this agroecosystem. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. A Latitudinal Diversity Gradient in Terrestrial Bacteria of the Genus Streptomyces

    Science.gov (United States)

    Andam, Cheryl P.; Doroghazi, James R.; Campbell, Ashley N.; Kelly, Peter J.; Choudoir, Mallory J.

    2016-01-01

    ABSTRACT We show that Streptomyces biogeography in soils across North America is influenced by the regional diversification of microorganisms due to dispersal limitation and genetic drift. Streptomyces spp. form desiccation-resistant spores, which can be dispersed on the wind, allowing for a strong test of whether dispersal limitation governs patterns of terrestrial microbial diversity. We employed an approach that has high sensitivity for determining the effects of genetic drift. Specifically, we examined the genetic diversity and phylogeography of physiologically similar Streptomyces strains isolated from geographically distributed yet ecologically similar habitats. We found that Streptomyces beta diversity scales with geographic distance and both beta diversity and phylogenetic diversity manifest in a latitudinal diversity gradient. This pattern of Streptomyces biogeography resembles patterns seen for diverse species of plants and animals, and we therefore evaluated these data in the context of ecological and evolutionary hypotheses proposed to explain latitudinal diversity gradients. The data are consistent with the hypothesis that niche conservatism limits dispersal, and historical patterns of glaciation have limited the time for speciation in higher-latitude sites. Most notably, higher-latitude sites have lower phylogenetic diversity, higher phylogenetic clustering, and evidence of range expansion from lower latitudes. In addition, patterns of beta diversity partition with respect to the glacial history of sites. Hence, the data support the hypothesis that extant patterns of Streptomyces biogeography have been driven by historical patterns of glaciation and are the result of demographic range expansion, dispersal limitation, and regional diversification due to drift. PMID:27073097

  13. A Latitudinal Diversity Gradient in Terrestrial Bacteria of the Genus Streptomyces

    Directory of Open Access Journals (Sweden)

    Cheryl P. Andam

    2016-04-01

    Full Text Available We show that Streptomyces biogeography in soils across North America is influenced by the regional diversification of microorganisms due to dispersal limitation and genetic drift. Streptomyces spp. form desiccation-resistant spores, which can be dispersed on the wind, allowing for a strong test of whether dispersal limitation governs patterns of terrestrial microbial diversity. We employed an approach that has high sensitivity for determining the effects of genetic drift. Specifically, we examined the genetic diversity and phylogeography of physiologically similar Streptomyces strains isolated from geographically distributed yet ecologically similar habitats. We found that Streptomyces beta diversity scales with geographic distance and both beta diversity and phylogenetic diversity manifest in a latitudinal diversity gradient. This pattern of Streptomyces biogeography resembles patterns seen for diverse species of plants and animals, and we therefore evaluated these data in the context of ecological and evolutionary hypotheses proposed to explain latitudinal diversity gradients. The data are consistent with the hypothesis that niche conservatism limits dispersal, and historical patterns of glaciation have limited the time for speciation in higher-latitude sites. Most notably, higher-latitude sites have lower phylogenetic diversity, higher phylogenetic clustering, and evidence of range expansion from lower latitudes. In addition, patterns of beta diversity partition with respect to the glacial history of sites. Hence, the data support the hypothesis that extant patterns of Streptomyces biogeography have been driven by historical patterns of glaciation and are the result of demographic range expansion, dispersal limitation, and regional diversification due to drift.

  14. Introductions do not compensate for functional and phylogenetic losses following extinctions in insular bird assemblages.

    Science.gov (United States)

    Sobral, Fernando L; Lees, Alexander C; Cianciaruso, Marcus V

    2016-09-01

    The ratio of species extinctions to introductions has been comparable for many insular assemblages, suggesting that introductions could have 'compensated' for extinctions. However, the capacity for introduced species to replace ecological roles and evolutionary history lost following extinction is unclear. We investigated changes in bird functional and phylogenetic diversity in the wake of extinctions and introductions across a sample of 32 islands worldwide. We found that extinct and introduced species have comparable functional and phylogenetic alpha diversity. However, this was distributed at different positions in functional space and in the phylogeny, indicating a 'false compensation'. Introduced and extinct species did not have equivalent functional roles nor belong to similar lineages. This makes it unlikely that novel island biotas composed of introduced taxa will be able to maintain ecological roles and represent the evolutionary histories of pre-disturbance assemblages and highlights the importance of evaluating changes in alpha and beta diversity concurrently. © 2016 John Wiley & Sons Ltd/CNRS.

  15. Evidence of increased antibiotic resistance in phylogenetically-diverse Aeromonas isolates from semi-intensive fish ponds treated with antibiotics

    Directory of Open Access Journals (Sweden)

    Hemant J Patil

    2016-11-01

    Full Text Available The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically upon fingerling stocking and water column-associated Aeromonas were monitored periodically over an eleven-month fish-fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a three-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas spp. were isolated, initially screened for sulfadiazine resistance and further screened against five additional antibiotics. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamycin and chloramphenicol resistances were low. Abundance of multi-drug resistant strains as well as sul1, tetA and intI1 gene-harboring strains was significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically-distinct Aeromonas clusters were revealed using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were

  16. The relative role of dispersal and local interactions for alpine plant community diversity under simulated climate warming

    Energy Technology Data Exchange (ETDEWEB)

    Klanderud, K.; Totland, Oe. [Norwegian Univ. of Life Science, Dept. of Ecology and Natural Resource Management, Aas (Norway)

    2007-08-15

    Most studies on factors determining diversity are conducted in temperate or warm regions, whereas studies in climatically harsh and low productivity areas, such as alpine regions, are rare. We examined the relative roles of seed availability and different biotic and abiotic factors for the diversity of an alpine plant community in southern Norway. Furthermore, because climate warming is predicted to be an important driver of alpine species diversity, we assessed how the relative impacts of dispersal and local interactions on diversity might change under experimental warming (open top chambers, OTCs). Addition of seeds from 27 regional species increased community diversity. The establishment of the species was negatively related both to the diversity of the existing system and the cover of the abundant dwarf shrub Dryas octopetala. These results show that both species dispersal limitation and local biotic interactions are important factors for alpine plant community diversity. Despite relatively harsh environmental conditions and low productivity, competition from the resident vegetation appeared to have a greater role for species establishment and diversity than facilitation and experimental warming. Higher temperature appeared to increase the negative relationship between resident species diversity and species establishment. This may suggest that climate warming can increase the role of interspecific competition for alpine plant community structure, and thus alter the long-term effects of biotic interactions on diversity. (au)

  17. Phylogenetically poor plant communities receive more alien species, which more easily coexist with natives

    Czech Academy of Sciences Publication Activity Database

    Gerhold, P.; Pärtel, M.; Tackenberg, O.; Hennekens, S.M.; Bartish, Igor; Schaminée, J.H.J.; Fergus, A. J. F.; Ozinga, W.A.; Prinzing, A.

    2011-01-01

    Roč. 177, č. 5 (2011), s. 68-680 ISSN 0003-0147 Institutional research plan: CEZ:AV0Z60050516 Keywords : species richness * phylogenetic diversity * invasions Subject RIV: EF - Botanics Impact factor: 4.725, year: 2011

  18. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  19. The Hidden Diversity of Flagellated Protists in Soil.

    Science.gov (United States)

    Venter, Paul Christiaan; Nitsche, Frank; Arndt, Hartmut

    2018-07-01

    Protists are among the most diverse and abundant eukaryotes in soil. However, gaps between described and sequenced protist morphospecies still present a pending problem when surveying environmental samples for known species using molecular methods. The number of sequences in the molecular PR 2 database (∼130,000) is limited compared to the species richness expected (>1 million protist species) - limiting the recovery rate. This is important, since high throughput sequencing (HTS) methods are used to find associative patterns between functional traits, taxa and environmental parameters. We performed HTS to survey soil flagellates in 150 grasslands of central Europe, and tested the recovery rate of ten previously isolated and cultivated cercomonad species, among locally found diversity. We recovered sequences for reference soil flagellate species, but also a great number of their phylogenetically evaluated genetic variants, among rare and dominant taxa with presumably own biogeography. This was recorded among dominant (cercozoans, Sandona), rare (apusozoans) and a large hidden diversity of predominantly aquatic protists in soil (choanoflagellates, bicosoecids) often forming novel clades associated with uncultured environmental sequences. Evaluating the reads, instead of the OTUs that individual reads are usually clustered into, we discovered that much of this hidden diversity may be lost due to clustering. Copyright © 2018 Elsevier GmbH. All rights reserved.

  20. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Estimating bacterial diversity for ecological studies: methods, metrics, and assumptions.

    Directory of Open Access Journals (Sweden)

    Julia Birtel

    Full Text Available Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5. Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques.

  2. Latitudinal variation in nematode diversity and ecological roles along the Chinese coast.

    Science.gov (United States)

    Wu, Jihua; Chen, Huili; Zhang, Youzheng

    2016-11-01

    To test changes in the phylogenetic relatedness, niche breadth, and life-history strategies of nematodes along a latitudinal gradient. Sixteen wetland locations along the Pacific coast of China, from 20°N to 40°N. Linear regression was used to relate nematode phylogenetic relatedness (average taxonomic distinctness (AvTD) and average phylogenetic diversity [AvPD]), life-history group (based on " c - p " colonizer-persister group classification), and dietary specificity (based on guild classification of feeding selectivity) to latitude. Wetland nematode taxonomic diversity (richness and Shannon diversity indices) decreased with increasing latitude along the Chinese coast. Phylogenetic diversity indices (AvTD and AvPD) significantly increased with increasing latitude. This indicates that at lower latitudes, species within the nematode community were more closely related. With increasing latitude, the nematode relative richness and abundance decreased for selective deposit feeders but increased for nonselective deposit feeders. The proportion of general opportunists decreased with increasing latitude, but persisters showed the opposite trend. The annual temperature range and the pH of sediments were more important than vegetation type in structuring nematode communities. Nematode niche breadth was narrower at lower latitudes with respect to dietary specificity. Higher latitudes with a more variable climate favor r over K life-history strategists. Nematode communities at lower latitudes contained more closely related species.

  3. Phylogenetic diversity and spatial distribution of the microbial community associated with the Caribbean deep-water sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA gene analysis.

    Science.gov (United States)

    Meyer, Birte; Kuever, Jan

    2008-08-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species), whereas 26% appeared to be P. cf. corticata specifically associated microorganisms ("specialists"); 21% of the phylotypes were confirmed to represent seawater- and sediment-derived proteobacterial species ("contaminants") acquired by filtration processes from the host environment. Consistently, the aprA and amoA gene-based analyses indicated the presence of environmentally derived sulfur- and ammonia-oxidizers besides putative sponge-specific sulfur-oxidizing Gammaproteobacteria and Alphaproteobacteria and a sulfate-reducing archaeon. A sponge-specific, endosymbiotic sulfur cycle as described for marine oligochaetes is proposed to be also present in P. cf. corticata. Overall, the results of this work support the recent studies that demonstrated the sponge species specificity of the associated microbial community while the biogeography of the host collection site has only a minor influence on the composition. In P. cf. corticata, the specificity of the sponge-microbe associations is even extended to the spatial distribution of the microorganisms within the sponge body; distinct bacterial populations were associated with the different tissue sections, papillae, outer and inner cortex, and choanosome. The local distribution of a phylotype within P. cf. corticata correlated with its (1) phylogenetic affiliation, (2) classification as sponge-specific or nonspecifically associated microorganism, and (3) potential ecological role in the host sponge.

  4. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Interactions between plants and primates shape community diversity in a rainforest in Madagascar.

    Science.gov (United States)

    Herrera, James P

    2016-07-01

    Models of ecological community assembly predict how communities of interacting organisms may be shaped by abiotic and biotic factors. Competition and environmental filtering are the predominant factors hypothesized to explain community assembly. This study tested the effects of habitat, phylogenetic and phenotypic trait predictors on species co-occurrence patterns and abundances, with the endemic primates of Madagascar as an empirical system. The abundance of 11 primate species was estimated along gradients of elevation, food resource abundance and anthropogenic habitat disturbance at local scales in south-east Madagascar. Community composition was compared to null models to test for phylogenetic and functional structure, and the effects of phylogenetic relatedness of co-occurring species, their trait similarity and environmental variables on species' abundances were tested using mixed models and quantile regressions. Resource abundance was the strongest predictor of community structure. Where food tree abundance was high, closely related species with similar traits dominated communities. High-elevation communities with lower food tree abundance consisted of species that were distantly related and had divergent traits. Closely related species had dissimilar abundances where they co-occurred, partially driven by trait dissimilarity, indicating character displacement. By integrating local-scale variation in primate community composition, evolutionary relatedness and functional diversity, this study found strong evidence that community assembly in this system can be explained by competition and character displacement along ecological gradients. © 2016 The Authors. Journal of Animal Ecology © 2016 British Ecological Society.

  6. Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China

    Science.gov (United States)

    The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...

  7. Knowledge Production beyond Local and National Blindspots: Remedying Professional Ocularcentrism of Diversity in Music Teacher Education

    Science.gov (United States)

    Westerlund, Heidi; Karlsen, Sidsel

    2017-01-01

    In this article, we argue that mainstream discourses of diversity in music education are ocularcentric; that is, they provide a one-sided way of understanding diversity that has prevented music educators from seeing our biases. In remedying these local and national professional blindspots, we propose transnational knowledge production, which we…

  8. Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

    DEFF Research Database (Denmark)

    Nielsen, L; Arctander, P; Jensen, T H

    2009-01-01

    To investigate the possible origin and spread of the dramatic re-emergent 2002 distemper epizootic observed among seals in Danish Waters, we have sequenced wild-type genes of the attachment (H) glycoproteins of viruses from both the 2002 and 1988 epizootics. Phylogenetic analysis of the H genes...... of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...... epizootic in Danish Waters was investigated and determined to be caused by canine distemper virus, the closest relative of PDV, revealing no direct epidemiological link to the seal epizootics. (C) 2009 Elsevier B.V. All rights reserved....

  9. Frugivores bias seed-adult tree associations through nonrandom seed dispersal: a phylogenetic approach.

    Science.gov (United States)

    Razafindratsima, Onja H; Dunham, Amy E

    2016-08-01

    Frugivores are the main seed dispersers in many ecosystems, such that behaviorally driven, nonrandom patterns of seed dispersal are a common process; but patterns are poorly understood. Characterizing these patterns may be essential for understanding spatial organization of fruiting trees and drivers of seed-dispersal limitation in biodiverse forests. To address this, we studied resulting spatial associations between dispersed seeds and adult tree neighbors in a diverse rainforest in Madagascar, using a temporal and phylogenetic approach. Data show that by using fruiting trees as seed-dispersal foci, frugivores bias seed dispersal under conspecific adults and under heterospecific trees that share dispersers and fruiting time with the dispersed species. Frugivore-mediated seed dispersal also resulted in nonrandom phylogenetic associations of dispersed seeds with their nearest adult neighbors, in nine out of the 16 months of our study. However, these nonrandom phylogenetic associations fluctuated unpredictably over time, ranging from clustered to overdispersed. The spatial and phylogenetic template of seed dispersal did not translate to similar patterns of association in adult tree neighborhoods, suggesting the importance of post-dispersal processes in structuring plant communities. Results suggest that frugivore-mediated seed dispersal is important for structuring early stages of plant-plant associations, setting the template for post-dispersal processes that influence ultimate patterns of plant recruitment. Importantly, if biased patterns of dispersal are common in other systems, frugivores may promote tree coexistence in biodiverse forests by limiting the frequency and diversity of heterospecific interactions of seeds they disperse. © 2016 by the Ecological Society of America.

  10. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    ... glycol plus control. All isolates exhibited good drought-tolerant efficiencies at 10% PEG. While most of the isolates could not tolerate up to 20% PEG, isolates of Rlv6, Rlv9, Rlv12 and Rlv13 tolerated up to 20% PEG. Keywords: Rhizobium leguminosarum, 23S rRNA gene, phylogenetic tree, diversity and drought tolerance ...

  11. Preservation of the genetic diversity of a local common carp in the agricultural heritage rice–fish system

    Science.gov (United States)

    Ren, Weizheng; Hu, Liangliang; Guo, Liang; Zhang, Jian; Tang, Lu; Zhang, Entao; Zhang, Jiaen; Luo, Shiming; Tang, Jianjun; Chen, Xin

    2018-01-01

    We examined how traditional farmers preserve the genetic diversity of a local common carp (Cyprinus carpio), which is locally referred to as “paddy field carp” (PF-carp), in a “globally important agricultural heritage system” (GIAHS), i.e., the 1,200-y-old rice–fish coculture system in Zhejiang Province, China. Our molecular and morphological analysis showed that the PF-carp has changed into a distinct local population with higher genetic diversity and diverse color types. Within this GIAHS region, PF-carps exist as a continuous metapopulation, although three genetic groups could be identified by microsatellite markers. Thousands of small farmer households interdependently obtained fry and parental carps for their own rice–fish production, resulting in a high gene flow and large numbers of parent carps distributing in a mosaic pattern in the region. Landscape genetic analysis indicated that farmers’ connectivity was one of the major factors that shaped this genetic pattern. Population viability analysis further revealed that the numbers of these interconnected small farmer households and their connection intensity affect the carps’ inherent genetic diversity. The practice of mixed culturing of carps with diverse color types helped to preserve a wide range of genetic resources in the paddy field. This widespread traditional practice increases fish yield and resource use, which, in return, encourages famers to continue their practice of selecting and conserving diverse color types of PF-carp. Our results suggested that traditional farmers secure the genetic diversity of PF-carp and its viability over generations in this region through interdependently incubating and mixed-culturing practices within the rice−fish system. PMID:29295926

  12. Genetic diversity of archaea in deep-sea hydrothermal vent environments.

    Science.gov (United States)

    Takai, K; Horikoshi, K

    1999-08-01

    Molecular phylogenetic analysis of naturally occurring archaeal communities in deep-sea hydrothermal vent environments was carried out by PCR-mediated small subunit rRNA gene (SSU rDNA) sequencing. As determined through partial sequencing of rDNA clones amplified with archaea-specific primers, the archaeal populations in deep-sea hydrothermal vent environments showed a great genetic diversity, and most members of these populations appeared to be uncultivated and unidentified organisms. In the phylogenetic analysis, a number of rDNA sequences obtained from deep-sea hydrothermal vents were placed in deep lineages of the crenarchaeotic phylum prior to the divergence of cultivated thermophilic members of the crenarchaeota or between thermophilic members of the euryarchaeota and members of the methanogen-halophile clade. Whole cell in situ hybridization analysis suggested that some microorganisms of novel phylotypes predicted by molecular phylogenetic analysis were likely present in deep-sea hydrothermal vent environments. These findings expand our view of the genetic diversity of archaea in deep-sea hydrothermal vent environments and of the phylogenetic organization of archaea.

  13. Genetic Diversity and Phylogenetic Relationships of Coevolving Symbiont-Harboring Insect Trypanosomatids, and Their Neotropical Dispersal by Invader African Blowflies (Calliphoridae

    Directory of Open Access Journals (Sweden)

    Tarcilla C. Borghesan

    2018-02-01

    Full Text Available This study is about the inter- and intra-specific genetic diversity of trypanosomatids of the genus Angomonas, and their association with Calliphoridae (blowflies in Neotropical and Afrotropical regions. Microscopic examination of 3,900 flies of various families, mostly Calliphoridae, revealed that 31% of them harbored trypanosomatids. Small subunit rRNA (SSU rRNA barcoding showed that Angomonas predominated (46% over the other common trypanosomatids of blowflies of genera Herpetomonas and Wallacemonas. Among Angomonas spp., A. deanei was much more common than the two-other species, A. desouzai and A. ambiguus. Phylogenetic analyses based on SSU rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH and internal transcribed spacer rDNA (ITS rDNA sequences revealed a marked genetic diversity within A. deanei, which comprised four infraspecific genotypes (Dea1–Dea4, and four corresponding symbiont genotypes (Kcr1–Kcr4. Host and symbiont phylogenies were highly congruent corroborating their co-divergence, consistent with host-symbiont interdependent metabolism and symbiont reduced genomes shaped by a long coevolutionary history. We compared the diversity of Angomonas/symbionts from three genera of blowflies, Lucilia, Chrysomya and Cochliomyia. A. deanei, A. desouzai, and A. ambiguus were found in the three genera of blowflies in South America. In Africa, A. deanei and A. ambiguus were identified in Chrysomya. The absence of A. desouzai in Africa and its presence in Neotropical Cochliomyia and Lucilia suggests parasite spillback of A. desouzai into Chrysomya, which was most likely introduced four decades ago from Africa into the Neotropic. The absence of correlation between parasite diversity and geographic and genetic distances, with identical genotypes of A. deanei found in the Neotropic and Afrotropic, is consistent with disjunct distribution due to the recent human-mediated transoceanic dispersal of Angomonas by Chrysomya. This

  14. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  15. Molecular phylogenetic analysis of fleshy pored mushrooms: Neoboletus luridiformis and Hortiboletus rubellus from western Himalayan range of Pakistan

    International Nuclear Information System (INIS)

    Sarwar, S.; Khalid, N.; Dentinger, B.M.

    2016-01-01

    Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)

  16. Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

    Science.gov (United States)

    Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

    2016-07-01

    Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Lack of congruence in species diversity indices and community structures of planktonic groups based on local environmental factors.

    Science.gov (United States)

    Doi, Hideyuki; Chang, Kwang-Hyeon; Nishibe, Yuichiro; Imai, Hiroyuki; Nakano, Shin-ichi

    2013-01-01

    The importance of analyzing the determinants of biodiversity and community composition by using multiple trophic levels is well recognized; however, relevant data are lacking. In the present study, we investigated variations in species diversity indices and community structures of the plankton taxonomic groups-zooplankton, rotifers, ciliates, and phytoplankton-under a range of local environmental factors in pond ecosystems. For each planktonic group, we estimated the species diversity index by using linear models and analyzed the community structure by using canonical correspondence analysis. We showed that the species diversity indices and community structures varied among the planktonic groups and according to local environmental factors. The observed lack of congruence among the planktonic groups may have been caused by niche competition between groups with similar trophic guilds or by weak trophic interactions. Our findings highlight the difficulty of predicting total biodiversity within a system, based upon a single taxonomic group. Thus, to conserve the biodiversity of an ecosystem, it is crucial to consider variations in species diversity indices and community structures of different taxonomic groups, under a range of local conditions.

  18. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource.

    Science.gov (United States)

    Sharpton, Thomas J; Jospin, Guillaume; Wu, Dongying; Langille, Morgan G I; Pollard, Katherine S; Eisen, Jonathan A

    2012-10-13

    New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as "Sifting Families," or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology-based analyses. We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/).

  19. Phylogenetic and functional diversity within toluene-degrading, sulphate-reducing consortia enriched from a contaminated aquifer.

    Science.gov (United States)

    Kuppardt, Anke; Kleinsteuber, Sabine; Vogt, Carsten; Lüders, Tillmann; Harms, Hauke; Chatzinotas, Antonis

    2014-08-01

    Three toluene-degrading microbial consortia were enriched under sulphate-reducing conditions from different zones of a benzene, toluene, ethylbenzene and xylenes (BTEX) plume of two connected contaminated aquifers. Two cultures were obtained from a weakly contaminated zone of the lower aquifer, while one culture originated from the highly contaminated upper aquifer. We hypothesised that the different habitat characteristics are reflected by distinct degrader populations. Degradation of toluene with concomitant production of sulphide was demonstrated in laboratory microcosms and the enrichment cultures were phylogenetically characterised. The benzylsuccinate synthase alpha-subunit (bssA) marker gene, encoding the enzyme initiating anaerobic toluene degradation, was targeted to characterise the catabolic diversity within the enrichment cultures. It was shown that the hydrogeochemical parameters in the different zones of the plume determined the microbial composition of the enrichment cultures. Both enrichment cultures from the weakly contaminated zone were of a very similar composition, dominated by Deltaproteobacteria with the Desulfobulbaceae (a Desulfopila-related phylotype) as key players. Two different bssA sequence types were found, which were both affiliated to genes from sulphate-reducing Deltaproteobacteria. In contrast, the enrichment culture from the highly contaminated zone was dominated by Clostridia with a Desulfosporosinus-related phylotype as presumed key player. A distinct bssA sequence type with high similarity to other recently detected sequences from clostridial toluene degraders was dominant in this culture. This work contributes to our understanding of the niche partitioning between degrader populations in distinct compartments of BTEX-contaminated aquifers.

  20. Phylogenetic diversity and community structure of sponge-associated bacteria from mangroves of the Caribbean Sea

    KAUST Repository

    Yang, Jiangke

    2011-02-08

    To gain insight into the species richness and phylogeny of the microbial communities associated with sponges in mangroves, we performed an extensive phylogenetic analysis, based on terminal restriction fragment length polymorphism profiling and 16S ribosomal RNA gene sequences, of the 4 sponge species Aplysina fulva, Haliclona hogarthi, Tedania ignis and Ircinia strobilina as well as of ambient seawater. The sponge-associated bacterial communities contained 13 phyla, including Poribacteria and an unclassified group not found in the ambient seawater community, 98% of which comprised Proteobacteria, Cyanobacteria and Bacteroidetes. Although the sponges themselves were phylogenetically distant and bacterial community variation within the host species was observed, microbial phyla such as Proteobacteria, Acidobacteria, Chloroflexi and the unclassified group were consistently observed as the dominant populations within the communities. The sponge-associated bacterial communities resident in the Caribbean Sea mangroves are phylogenetically similar but significantly distinct from communities found in other biogeographical sites such as the deep-water environments of the Caribbean Sea, the South China Sea and Australia. The interspecific variation within the host species and the distinct biogeographical characteristics that the sponge-associated bacteria exhibited indicate that the acquisition, establishment and formation of functional sponge-associated bacterial communities may initially be the product of both vertical and horizontal transmission, and is then shaped by the internal environment created by the sponge species and certain external environmental factors. © Inter-Research 2011.

  1. FPGA Hardware Acceleration of a Phylogenetic Tree Reconstruction with Maximum Parsimony Algorithm

    OpenAIRE

    BLOCK, Henry; MARUYAMA, Tsutomu

    2017-01-01

    In this paper, we present an FPGA hardware implementation for a phylogenetic tree reconstruction with a maximum parsimony algorithm. We base our approach on a particular stochastic local search algorithm that uses the Progressive Neighborhood and the Indirect Calculation of Tree Lengths method. This method is widely used for the acceleration of the phylogenetic tree reconstruction algorithm in software. In our implementation, we define a tree structure and accelerate the search by parallel an...

  2. The ethnobotany of psychoactive plant use: a phylogenetic perspective

    Directory of Open Access Journals (Sweden)

    Nashmiah Aid Alrashedy

    2016-10-01

    Full Text Available Psychoactive plants contain chemicals that presumably evolved as allelochemicals but target certain neuronal receptors when consumed by humans, altering perception, emotion and cognition. These plants have been used since ancient times as medicines and in the context of religious rituals for their various psychoactive effects (e.g., as hallucinogens, stimulants, sedatives. The ubiquity of psychoactive plants in various cultures motivates investigation of the commonalities among these plants, in which a phylogenetic framework may be insightful. A phylogeny of culturally diverse psychoactive plant taxa was constructed with their psychotropic effects and affected neurotransmitter systems mapped on the phylogeny. The phylogenetic distribution shows multiple evolutionary origins of psychoactive families. The plant families Myristicaceae (e.g., nutmeg, Papaveraceae (opium poppy, Cactaceae (peyote, Convolvulaceae (morning glory, Solanaceae (tobacco, Lamiaceae (mints, Apocynaceae (dogbane have a disproportionate number of psychoactive genera with various indigenous groups using geographically disparate members of these plant families for the same psychoactive effect, an example of cultural convergence. Pharmacological traits related to hallucinogenic and sedative potential are phylogenetically conserved within families. Unrelated families that exert similar psychoactive effects also modulate similar neurotransmitter systems (i.e., mechanistic convergence. However, pharmacological mechanisms for stimulant effects were varied even within families suggesting that stimulant chemicals may be more evolutionarily labile than those associated with hallucinogenic and sedative effects. Chemically similar psychoactive chemicals may also exist in phylogenetically unrelated lineages, suggesting convergent evolution or differential gene regulation of a common metabolic pathway. Our study has shown that phylogenetic analysis of traditionally used psychoactive plants

  3. On the need for phylogenetic ‘corrections’ in functional trait-based approaches

    Czech Academy of Sciences Publication Activity Database

    de Bello, Francesco; Berg, M. P.; Dias, A. T. C.; Diniz-Filho, J. A. F.; Götzenberger, Lars; Hortal, J.; Ladle, L. J.; Lepš, Jan

    2015-01-01

    Roč. 50, č. 4 (2015), 349-357 ISSN 1211-9520 R&D Projects: GA ČR GAP505/12/1296; GA ČR GB14-36079G Institutional support: RVO:67985939 ; RVO:60077344 Keywords : adaptation * functional and phylogenetic diversity * limiting similarity Subject RIV: EH - Ecology, Behaviour Impact factor: 1.433, year: 2015

  4. Phylogenetic congruence between subtropical trees and their associated fungi.

    Science.gov (United States)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S; Gilbert, Gregory S; Yu, Shixiao

    2016-12-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi in has rarely been investigated. Using next-generation high-throughput DNA sequencing techniques, we analyzed fungal taxa associated with diseased leaves, rotten seeds, and infected seedlings of subtropical trees. We compared the topologies of the phylogenetic trees of the soil and foliar fungi based on the internal transcribed spacer (ITS) region with the phylogeny of host tree species based on matK , rbcL , atpB, and 5.8S genes. We identified 37 foliar and 103 soil pathogenic fungi belonging to the Ascomycota and Basidiomycota phyla and detected significantly nonrandom host-fungus combinations, which clustered on both the fungus phylogeny and the host phylogeny. The explicit evidence of congruent phylogenies between tree hosts and their potential fungal pathogens suggests either diffuse coevolution among the plant-fungal interaction networks or that the distribution of fungal species tracked spatially associated hosts with phylogenetically conserved traits and habitat preferences. Phylogenetic conservatism in plant-fungal interactions within a local community promotes host and parasite specificity, which is integral to the important role of fungi in promoting species coexistence and maintaining biodiversity of forest communities.

  5. Some limitations of public sequence data for phylogenetic inference (in plants).

    Science.gov (United States)

    Hinchliff, Cody E; Smith, Stephen Andrew

    2014-01-01

    The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing

  6. Cyanobacterial nitrogenases: phylogenetic diversity, regulation and functional predictions

    Directory of Open Access Journals (Sweden)

    Alberto A. Esteves-Ferreira

    2017-03-01

    Full Text Available Abstract Cyanobacteria is a remarkable group of prokaryotic photosynthetic microorganisms, with several genera capable of fixing atmospheric nitrogen (N2 and presenting a wide range of morphologies. Although the nitrogenase complex is not present in all cyanobacterial taxa, it is spread across several cyanobacterial strains. The nitrogenase complex has also a high theoretical potential for biofuel production, since H2 is a by-product produced during N2 fixation. In this review we discuss the significance of a relatively wide variety of cell morphologies and metabolic strategies that allow spatial and temporal separation of N2 fixation from photosynthesis in cyanobacteria. Phylogenetic reconstructions based on 16S rRNA and nifD gene sequences shed light on the evolutionary history of the two genes. Our results demonstrated that (i sequences of genes involved in nitrogen fixation (nifD from several morphologically distinct strains of cyanobacteria are grouped in similarity with their morphology classification and phylogeny, and (ii nifD genes from heterocytous strains share a common ancestor. By using this data we also discuss the evolutionary importance of processes such as horizontal gene transfer and genetic duplication for nitrogenase evolution and diversification. Finally, we discuss the importance of H2 synthesis in cyanobacteria, as well as strategies and challenges to improve cyanobacterial H2 production.

  7. Origins of altruism diversity I: The diverse ecological roles of altruistic strategies and their evolutionary responses to local competition.

    Science.gov (United States)

    Van Dyken, J David; Wade, Michael J

    2012-08-01

    Nature abounds with a rich variety of altruistic strategies, including public resource enhancement, resource provisioning, communal foraging, alarm calling, and nest defense. Yet, despite their vastly different ecological roles, current theory typically treats diverse altruistic traits as being favored under the same general conditions. Here, we introduce greater ecological realism into social evolution theory and find evidence of at least four distinct modes of altruism. Contrary to existing theory, we find that altruistic traits contributing to "resource-enhancement" (e.g., siderophore production, provisioning, agriculture) and "resource-efficiency" (e.g., pack hunting, communication) are most strongly favored when there is strong local competition. These resource-based modes of helping are "K-strategies" that increase a social group's growth yield, and should characterize species with scarce resources and/or high local crowding caused by low mortality, high fecundity, and/or mortality occurring late in the process of resource-acquisition. The opposite conditions, namely weak local competition (abundant resource, low crowding), favor survival (e.g., nest defense) and fecundity (e.g., nurse workers) altruism, which are "r-strategies" that increase a social group's growth rate. We find that survival altruism is uniquely favored by a novel evolutionary force that we call "sunk cost selection." Sunk cost selection favors helping that prevents resources from being wasted on individuals destined to die before reproduction. Our results contribute to explaining the observed natural diversity of altruistic strategies, reveal the necessary connection between the evolution and the ecology of sociality, and correct the widespread but inaccurate view that local competition uniformly impedes the evolution of altruism. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  8. Phylogenetic conservatism of thermal traits explains dispersal limitation and genomic differentiation of Streptomyces sister-taxa.

    Science.gov (United States)

    Choudoir, Mallory J; Buckley, Daniel H

    2018-06-07

    The latitudinal diversity gradient is a pattern of biogeography observed broadly in plants and animals but largely undocumented in terrestrial microbial systems. Although patterns of microbial biogeography across broad taxonomic scales have been described in a range of contexts, the mechanisms that generate biogeographic patterns between closely related taxa remain incompletely characterized. Adaptive processes are a major driver of microbial biogeography, but there is less understanding of how microbial biogeography and diversification are shaped by dispersal limitation and drift. We recently described a latitudinal diversity gradient of species richness and intraspecific genetic diversity in Streptomyces by using a geographically explicit culture collection. Within this geographically explicit culture collection, we have identified Streptomyces sister-taxa whose geographic distribution is delimited by latitude. These sister-taxa differ in geographic distribution, genomic diversity, and ecological traits despite having nearly identical SSU rRNA gene sequences. Comparative genomic analysis reveals genomic differentiation of these sister-taxa consistent with restricted gene flow across latitude. Furthermore, we show phylogenetic conservatism of thermal traits between the sister-taxa suggesting that thermal trait adaptation limits dispersal and gene flow across climate regimes as defined by latitude. Such phylogenetic conservatism of thermal traits is commonly associated with latitudinal diversity gradients for plants and animals. These data provide further support for the hypothesis that the Streptomyces latitudinal diversity gradient was formed as a result of historical demographic processes defined by dispersal limitation and driven by paleoclimate dynamics.

  9. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  10. Phylogenetic characterization of two echinoid species of the southeastern Mediterranean, off Egypt

    Directory of Open Access Journals (Sweden)

    Taha Soliman

    2015-12-01

    Full Text Available In this study we investigated the phylogenetics of two sea urchin species, Arbacia lixula and Paracentrotus lividus from the Mediterranean Sea. Specimens were collected from the east coast of Alexandria City, Egypt. Pigmentation examination showed four sympatric color morphotypes (black, purple, reddish brown, and olive green. Mitochondrial DNA was extracted from specimens and mitochondrial cytochrome oxidase subunit I (COI and 16S ribosomal RNA (16S were sequenced. The results showed that all black specimens constituted the species A. lixula. All other colors belonged to P. lividus, with no apparent differentiation between color morphotypes. Moreover, P. lividus showed high haplotype diversity (COI; H = 0.9500 and 16S; H = 0.8580 and low values of nucleotide diversity (COI; π = 0.0075 and 16S; π = 0.0049, indicating a high degree of polymorphism within this species. This study represents the first attempt at DNA barcoding of echinoid species in the southeast Mediterranean off the Egyptian coast, and will provide a base for future phylogenetic analyses.

  11. Dynamics of Phylogenetic Diversity and Its Influence on the Production of Extracellular Protease by Moderately Halotolerant Alkaliphilic Bacteria Acinetobacter Baumannii GTCR407 Nov

    Directory of Open Access Journals (Sweden)

    Thiyagarajan Gurunathan

    2010-07-01

    Full Text Available New characters emerge in the population of microorganisms living in the extreme environments due to its adaptation to ecological association. The microorganisms living in saline habitat utilize complex nutrients by adopting different strategies in Deoxyribonucleic Acid (DNA and Ribonucleic Acid (RNA, which are related to their metabolic and ecological diversities. Isolation and characterization of the organisms producing extracellular protease from such environment were the prime focus of this investigation, which can indicate the importance of metabolic diversity in phylogeny. Norberg medium was used to isolate halotolerant microorganisms from salt-cured skin. The isolates were screened for high activity of protease and the strain showing maximum activity of protease was taken for further studies. The biochemical characterization and 16s ribosomal RNA sequencing studies confirm that the isolate is Acinetobacter baumannii. Moreover, hydrolysis positive for starch and casein, negative for gelatin shows that the organism is a variant form of A. baumannii. Cell growth parameters such as pH and temperature were optimized and their values are 8 and 37oC respectively. The extracellular production of protease was optimized in the suitable medium and its enzyme activity was 165μg/ml/min. The results imply that the isolate had acquired operational genes through lateral gene transfer (LGT probably from unrelated species in the environment. This indicates that the isolate identified possesses metabolic and ecological diversities with values of phylogenetic delineation

  12. The diversity and evolution of nematodes (Pharyngodonidae) infecting New Zealand lizards.

    Science.gov (United States)

    Mockett, Sarah; Bell, Trent; Poulin, Robert; Jorge, Fátima

    2017-04-01

    Host-parasite co-evolutionary studies can shed light on diversity and the processes that shape it. Molecular methods have proven to be an indispensable tool in this task, often uncovering unseen diversity. This study used two nuclear markers (18S rRNA and 28S rRNA) and one mitochondrial (cytochrome oxidase subunit I) marker to investigate the diversity of nematodes of the family Pharyngodonidae parasitizing New Zealand (NZ) lizards (lygosomine skinks and diplodactylid geckos) and to explore their co-evolutionary history. A Bayesian approach was used to infer phylogenetic relationships of the parasitic nematodes. Analyses revealed that nematodes parasitizing skinks, currently classified as Skrjabinodon, are more closely related to Spauligodon than to Skrjabinodon infecting NZ geckos. Genetic analyses also uncovered previously undetected diversity within NZ gecko nematodes and provided evidence for several provisionally cryptic species. We also examined the level of host-parasite phylogenetic congruence using a global-fit approach. Significant congruence was detected between gecko-Skrjabinodon phylogenies, but our results indicated that strict co-speciation is not the main co-evolutionary process shaping the associations between NZ skinks and geckos and their parasitic nematodes. However, further sampling is required to fully resolve co-phylogenetic patterns of diversification in this host-parasite system.

  13. Diversity and phylogenetic analyses of bacteria from a shallow-waterhydrothermal vent in Milos island (Greece

    Directory of Open Access Journals (Sweden)

    Donato eGiovannelli

    2013-07-01

    Full Text Available Studies of shallow-water hydrothermal vents have been lagging behind their deep-sea counterparts. Hence, the importance of these systems and their contribution to the local and regional diversity and biogeochemistry is unclear. This study analyzes the bacterial community along a transect at the shallow-water hydrothermal vent system of Milos island, Greece. The abundance and biomass of the prokaryotic community is comparable to areas not affected by hydrothermal activity and was, on average, 1.34×108 cells g-1. The abundance, biomass and diversity of the prokaryotic community increased with the distance from the center of the vent and appeared to be controlled by the temperature gradient rather than the trophic conditions. The retrieved 16S rRNA gene fragments matched sequences from a variety of geothermal environments, although the average similarity was low (94 %, revealing previously undiscovered taxa. Epsilonproteobacteria constituted the majority of the population along the transect, with an average contribution to the total diversity of 60%. The larger cluster of 16S rRNA gene sequences was related to chemolithoautotrophic Sulfurovum spp., an Epsilonproteobacterium so far detected only at deep-sea hydrothermal vents. The presence of previously unknown lineages of Epsilonproteobacteria could be related to the abundance of organic matter in these systems, which may support alternative metabolic strategies to chemolithoautotrophy. The relative contribution of Gammaproteobacteria to the Milos microbial community increased along the transect as the distance from the center of the vent increased. Further attempts to isolate key species from these ecosystems will be critical to shed light on their evolution and ecology.

  14. Structural and regulatory diversity shape HLA-C protein expression levels

    DEFF Research Database (Denmark)

    Kaur, Gurman; Gras, Stephanie; Mobbs, Jesse I

    2017-01-01

    expression of HLA-C allomorphs at the cell surface by influencing the structure of the peptide-binding cleft and the diversity of peptides bound by the HLA-C molecules. Together with a phylogenetic analysis, these results highlight the diversity and long-term balancing selection of regulatory factors...

  15. Mutualistic interactions drive ecological niche convergence in a diverse butterfly community.

    Science.gov (United States)

    Elias, Marianne; Gompert, Zachariah; Jiggins, Chris; Willmott, Keith

    2008-12-02

    Ecological communities are structured in part by evolutionary interactions among their members. A number of recent studies incorporating phylogenetics into community ecology have upheld the paradigm that competition drives ecological divergence among species of the same guild. However, the role of other interspecific interactions, in particular positive interactions such as mutualism, remains poorly explored. We characterized the ecological niche and inferred phylogenetic relationships among members of a diverse community of neotropical Müllerian mimetic butterflies. Müllerian mimicry is one of the best studied examples of mutualism, in which unpalatable species converge in wing pattern locally to advertize their toxicity to predators. We provide evidence that mutualistic interactions can drive convergence along multiple ecological axes, outweighing both phylogeny and competition in shaping community structure. Our findings imply that ecological communities are adaptively assembled to a much greater degree than commonly suspected. In addition, our results show that phenotype and ecology are strongly linked and support the idea that mimicry can cause ecological speciation through multiple cascading effects on species' biology.

  16. Mutualistic interactions drive ecological niche convergence in a diverse butterfly community.

    Directory of Open Access Journals (Sweden)

    Marianne Elias

    2008-12-01

    Full Text Available Ecological communities are structured in part by evolutionary interactions among their members. A number of recent studies incorporating phylogenetics into community ecology have upheld the paradigm that competition drives ecological divergence among species of the same guild. However, the role of other interspecific interactions, in particular positive interactions such as mutualism, remains poorly explored. We characterized the ecological niche and inferred phylogenetic relationships among members of a diverse community of neotropical Müllerian mimetic butterflies. Müllerian mimicry is one of the best studied examples of mutualism, in which unpalatable species converge in wing pattern locally to advertize their toxicity to predators. We provide evidence that mutualistic interactions can drive convergence along multiple ecological axes, outweighing both phylogeny and competition in shaping community structure. Our findings imply that ecological communities are adaptively assembled to a much greater degree than commonly suspected. In addition, our results show that phenotype and ecology are strongly linked and support the idea that mimicry can cause ecological speciation through multiple cascading effects on species' biology.

  17. Human and ecological determinants of the spatial structure of local breed diversity.

    Science.gov (United States)

    Colino-Rabanal, Victor J; Rodríguez-Díaz, Roberto; Blanco-Villegas, María José; Peris, Salvador J; Lizana, Miguel

    2018-04-24

    Since domestication, a large number of livestock breeds adapted to local conditions have been created by natural and artificial selection, representing one of the most powerful ways in which human groups have constructed niches to meet their need. Although many authors have described local breeds as the result of culturally and environmentally mediated processes, this study, located in mainland Spain, is the first aimed at identifying and quantifying the environmental and human contributions to the spatial structure of local breed diversity, which we refer to as livestock niche. We found that the more similar two provinces were in terms of human population, ecological characteristics, historical ties, and geographic distance, the more similar the composition of local breeds in their territories. Isolation by human population distance showed the strongest effect, followed by isolation by the environment, thus supporting the view of livestock niche as a socio-cultural product adapted to the local environment, in whose construction humans make good use of their ecological and cultural inheritances. These findings provide a useful framework to understand and to envisage the effects of climate change and globalization on local breeds and their livestock niches.

  18. Aquatic insect ecophysiological traits reveal phylogenetically based differences in dissolved cadmium susceptibility.

    Science.gov (United States)

    Buchwalter, David B; Cain, Daniel J; Martin, Caitrin A; Xie, Lingtian; Luoma, Samuel N; Garland, Theodore

    2008-06-17

    We used a phylogenetically based comparative approach to evaluate the potential for physiological studies to reveal patterns of diversity in traits related to susceptibility to an environmental stressor, the trace metal cadmium (Cd). Physiological traits related to Cd bioaccumulation, compartmentalization, and ultimately susceptibility were measured in 21 aquatic insect species representing the orders Ephemeroptera, Plecoptera, and Trichoptera. We mapped these experimentally derived physiological traits onto a phylogeny and quantified the tendency for related species to be similar (phylogenetic signal). All traits related to Cd bioaccumulation and susceptibility exhibited statistically significant phylogenetic signal, although the signal strength varied among traits. Conventional and phylogenetically based regression models were compared, revealing great variability within orders but consistent, strong differences among insect families. Uptake and elimination rate constants were positively correlated among species, but only when effects of body size and phylogeny were incorporated in the analysis. Together, uptake and elimination rates predicted dramatic Cd bioaccumulation differences among species that agreed with field-based measurements. We discovered a potential tradeoff between the ability to eliminate Cd and the ability to detoxify it across species, particularly mayflies. The best-fit regression models were driven by phylogenetic parameters (especially differences among families) rather than functional traits, suggesting that it may eventually be possible to predict a taxon's physiological performance based on its phylogenetic position, provided adequate physiological information is available for close relatives. There appears to be great potential for evolutionary physiological approaches to augment our understanding of insect responses to environmental stressors in nature.

  19. Phylogenetic reconstruction and shell evolution of the Diplommatinidae (Gastropoda: Caenogastropoda).

    Science.gov (United States)

    Webster, Nicole B; Van Dooren, Tom J M; Schilthuizen, Menno

    2012-06-01

    The fascinating and often unlikely shell shapes in the terrestrial micromollusc family Diplommatinidae (Gastropoda: Caenogastropoda) provide a particularly attractive set of multiple morphological traits to investigate evolutionary patterns of shape variation. Here, a molecular phylogenetic reconstruction, based on five genes and 2700 bp, was undertaken for this family, integrated with ancestral state reconstruction and phylogenetic PCA of discrete and quantitative traits, respectively. We found strong support for the Diplommatininae as a monophyletic group, separating the Cochlostomatidae into a separate family. Five main clades appear within the Diplommatininae, corresponding with both coiling direction and biogeographic patterns. A Belau clade (A) with highly diverse (but always sinistral) morphology comprised Hungerfordia, Palaina, and some Diplommatina. Arinia (dextral) and Opisthostoma (sinistroid) are sister groups in clade B. Clade C and D solely contain sinistral Diplommatina that are robust and little ornamented (clade C) or slender and sculptured (clade D). Clade E is dextral but biogeographically diverse with species from all sampled regions save the Caroline Islands. Adelopoma, Diplommatina, Palaina, and Hungerfordia require revision to allow taxonomy to reflect phylogeny, whereas Opisthostoma is clearly monophyletic. Ancestral state reconstruction suggests a sinistral origin for the Diplommatinidae, with three reversals to dextrality. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Phylogenetic congruence and ecological coherence in terrestrial Thaumarchaeota.

    Science.gov (United States)

    Oton, Eduard Vico; Quince, Christopher; Nicol, Graeme W; Prosser, James I; Gubry-Rangin, Cécile

    2016-01-01

    Thaumarchaeota form a ubiquitously distributed archaeal phylum, comprising both the ammonia-oxidising archaea (AOA) and other archaeal groups in which ammonia oxidation has not been demonstrated (including Group 1.1c and Group 1.3). The ecology of AOA in terrestrial environments has been extensively studied using either a functional gene, encoding ammonia monooxygenase subunit A (amoA) or 16S ribosomal RNA (rRNA) genes, which show phylogenetic coherence with respect to soil pH. To test phylogenetic congruence between these two markers and to determine ecological coherence in all Thaumarchaeota, we performed high-throughput sequencing of 16S rRNA and amoA genes in 46 UK soils presenting 29 available contextual soil characteristics. Adaptation to pH and organic matter content reflected strong ecological coherence at various levels of taxonomic resolution for Thaumarchaeota (AOA and non-AOA), whereas nitrogen, total mineralisable nitrogen and zinc concentration were also important factors associated with AOA thaumarchaeotal community distribution. Other significant associations with environmental factors were also detected for amoA and 16S rRNA genes, reflecting different diversity characteristics between these two markers. Nonetheless, there was significant statistical congruence between the markers at fine phylogenetic resolution, supporting the hypothesis of low horizontal gene transfer between Thaumarchaeota. Group 1.1c Thaumarchaeota were also widely distributed, with two clusters predominating, particularly in environments with higher moisture content and organic matter, whereas a similar ecological pattern was observed for Group 1.3 Thaumarchaeota. The ecological and phylogenetic congruence identified is fundamental to understand better the life strategies, evolutionary history and ecosystem function of the Thaumarchaeota.

  1. Alien plants invade more phylogenetically clustered community types and cause even stronger clustering

    Czech Academy of Sciences Publication Activity Database

    Lososová, Z.; de Bello, Francesco; Chytrý, M.; Kühn, I.; Pyšek, Petr; Sádlo, Jiří; Winter, M.; Zelený, D.

    2015-01-01

    Roč. 24, č. 7 (2015), s. 786-794 ISSN 1466-822X R&D Projects: GA ČR GAP505/12/1296; GA ČR GB14-36079G Institutional support: RVO:67985939 Keywords : biological invasions * phylogenetic diversity * vegetation type Subject RIV: EH - Ecology, Behaviour Impact factor: 5.840, year: 2015

  2. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  3. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource

    Directory of Open Access Journals (Sweden)

    Sharpton Thomas J

    2012-10-01

    Full Text Available Abstract Background New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. Results We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as “Sifting Families,” or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology–based analyses. Conclusions We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/.

  4. Native fauna on exotic trees: phylogenetic conservatism and geographic contingency in two lineages of phytophages on two lineages of trees.

    Science.gov (United States)

    Gossner, Martin M; Chao, Anne; Bailey, Richard I; Prinzing, Andreas

    2009-05-01

    The relative roles of evolutionary history and geographical and ecological contingency for community assembly remain unknown. Plant species, for instance, share more phytophages with closer relatives (phylogenetic conservatism), but for exotic plants introduced to another continent, this may be overlaid by geographically contingent evolution or immigration from locally abundant plant species (mass effects). We assessed within local forests to what extent exotic trees (Douglas-fir, red oak) recruit phytophages (Coleoptera, Heteroptera) from more closely or more distantly related native plants. We found that exotics shared more phytophages with natives from the same major plant lineage (angiosperms vs. gymnosperms) than with natives from the other lineage. This was particularly true for Heteroptera, and it emphasizes the role of host specialization in phylogenetic conservatism of host use. However, for Coleoptera on Douglas-fir, mass effects were important: immigration from beech increased with increasing beech abundance. Within a plant phylum, phylogenetic proximity of exotics and natives increased phytophage similarity, primarily in younger Coleoptera clades on angiosperms, emphasizing a role of past codiversification of hosts and phytophages. Overall, phylogenetic conservatism can shape the assembly of local phytophage communities on exotic trees. Whether it outweighs geographic contingency and mass effects depends on the interplay of phylogenetic scale, local abundance of native tree species, and the biology and evolutionary history of the phytophage taxon.

  5. Phylogenetic and recombination analysis of tomato spotted wilt virus.

    Directory of Open Access Journals (Sweden)

    Sen Lian

    Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.

  6. Phylogenetic climatic niche conservatism and evolution of climatic suitability in Neotropical Angraecinae (Vandeae, Orchidaceae) and their closest African relatives

    Czech Academy of Sciences Publication Activity Database

    Kolanowska, Marta; Grochocka, E.; Konowalik, K.

    2017-01-01

    Roč. 5, may (2017), č. článku e3328. ISSN 2167-8359 R&D Projects: GA ČR GB14-36098G Institutional support: RVO:86652079 Keywords : campylocentrum orchidaceae * molecular phylogenetics * environmental niches * costa-rica * diversity * models * speciation * ecology * pollination * divergence * Angraecinae * Ecological niche modeling * Orchidaceae * Phylogenetic niche conservatism * Angraecum * Campylocentrum * Dendrophylax Subject RIV: EH - Ecology, Behaviour OBOR OECD: Biodiversity conservation Impact factor: 2.177, year: 2016

  7. Extensive diversity and evolution of hepadnaviruses in bats in China.

    Science.gov (United States)

    Nie, Fang-Yuan; Lin, Xian-Dan; Hao, Zong-Yu; Chen, Xiao-Nan; Wang, Zhao-Xiao; Wang, Miao-Ruo; Wu, Jun; Wang, Hong-Wei; Zhao, Guoqiang; Ma, Runlin Z; Holmes, Edward C; Zhang, Yong-Zhen

    2018-01-15

    To better understand the evolution of hepadnaviruses, we sampled bats from Guizhou, Henan and Zhejiang provinces, China, and rodents from Zhejiang province. Genetically diverse hepadnaviruses were identified in a broad range of bat species, with an overall prevalence of 13.3%. In contrast, no rodent hepadnaviruses were identified. The newly discovered bat hepadnaviruses fell into two distinct phylogenetic groups. The viruses within the first group exhibited high diversity, with some closely related to viruses previously identified in Yunnan province. Strikingly, the newly discovered viruses sampled from Jiyuan city in the second phylogenetic group were most closely related to those found in bats from West Africa, suggestive of a long-term association between bats and hepadnaviruses. A co-phylogenetic analysis revealed frequent cross-species transmission among bats from different species, genera, and families. Overall, these data suggest that there are likely few barriers to the cross-species transmission of bat hepadnaviruses. Copyright © 2017. Published by Elsevier Inc.

  8. Cyanobacterial diversity and halotolerance in a variable hypersaline environment.

    Science.gov (United States)

    Kirkwood, Andrea E; Buchheim, Julie A; Buchheim, Mark A; Henley, William J

    2008-04-01

    The Great Salt Plains (GSP) in north-central Oklahoma, USA is an expansive salt flat (approximately 65 km(2)) that is part of the federally protected Salt Plains National Wildlife Refuge. The GSP serves as an ideal environment to study the microbial diversity of a terrestrial, hypersaline system that experiences wide fluctuations in freshwater influx and diel temperature. Our study assessed cyanobacterial diversity at the GSP by focusing on the taxonomic and physiological diversity of GSP isolates, and the 16S rRNA phylogenetic diversity of isolates and environmental clones from three sites (north, central, and south). Taxonomic diversity of isolates was limited to a few genera (mostly Phormidium and Geitlerinema), but physiological diversity based on halotolerance ranges was strikingly more diverse, even between strains of the same phylotype. The phylogenetic tree revealed diversity that spanned a number of cyanobacterial lineages, although diversity at each site was dominated by only a few phylotypes. Unlike other hypersaline systems, a number of environmental clones from the GSP were members of the heterocystous lineage. Although a number of cyanobacterial isolates were close matches with prevalent environmental clones, it is not certain if these clones reflect the same halotolerance ranges of their matching isolates. This caveat is based on the notable disparities we found between strains of the same phylotype and their inherent halotolerance. Our findings support the hypothesis that variable or poikilotrophic environments promote diversification, and in particular, select for variation in ecotype more than phylotype.

  9. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  10. Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Douglas B. Young

    2015-03-01

    Full Text Available Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms with predicted impact on protein function and transcriptional regulation. Differences in the B12 synthesis pathway, methionine biosynthesis, fatty acid catabolism, and DNA repair and replication are consistent with adaptations to different environmental niches and pathogenic lifestyles. While there is no evidence of further gene acquisition during expansion of the M. tuberculosis complex, the emergence of other forms of genetic diversity provides insights into continuing host-pathogen co-evolution and has the potential to identify novel targets for disease intervention.

  11. Metagenomic-based study of the phylogenetic and functional gene diversity in Galápagos land and marine iguanas.

    Science.gov (United States)

    Hong, Pei-Ying; Mao, Yuejian; Ortiz-Kofoed, Shannon; Shah, Rushabh; Cann, Isaac; Mackie, Roderick I

    2015-02-01

    In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.

  12. Metagenomic-Based Study of the Phylogenetic and Functional Gene Diversity in Galápagos Land and Marine Iguanas

    KAUST Repository

    Hong, Pei-Ying

    2014-12-19

    In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.

  13. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  14. Convergent phylogenetic and functional responses to altered fire regimes in mesic savanna grasslands of North America and South Africa.

    Science.gov (United States)

    Forrestel, Elisabeth J; Donoghue, Michael J; Smith, Melinda D

    2014-08-01

    The importance of fire in the creation and maintenance of mesic grassland communities is well recognized. Improved understanding of how grasses--the dominant clade in these important ecosystems--will respond to alterations in fire regimes is needed in the face of anthropogenically driven climate and land-use change. Here, we examined how grass communities shift in response to experimentally manipulated fire regimes at multiple levels of community diversity--taxonomic, phylogenetic and functional--in C4-dominanted mesic savanna grassland sites with similar structure and physiognomy, yet disparate biogeographic histories. We found that the grass communities were similar in their phylogenetic response and aspects of their functional response to high fire frequency. Both sites exhibited phylogenetic clustering of highly abundant species in annually burned plots, driven by species of the Andropogoneae, and a narrow range of functional strategies associated with rapid post-fire regeneration in a high-light, nitrogen-limited environment. By examining multiple facets of diversity in a comparative context, we identified convergent phylogenetic and functional responses to altered fire regimes in two mesic savanna grasslands. Our results highlight the importance of a common filtering process associated with fire that is consistent across grasslands of disparate biogeographic histories and taxonomic representation. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  15. Opposing assembly mechanisms in a neotropical dry forest: implications for phylogenetic and functional community ecology.

    Science.gov (United States)

    Swenson, Nathan G; Enquist, Brian J

    2009-08-01

    Species diversity is promoted and maintained by ecological and evolutionary processes operating on species attributes through space and time. The degree to which variability in species function regulates distribution and promotes coexistence of species has been debated. Previous work has attempted to quantify the relative importance of species function by using phylogenetic relatedness as a proxy for functional similarity. The key assumption of this approach is that function is phylogenetically conserved. If this assumption is supported, then the phylogenetic dispersion in a community should mirror the functional dispersion. Here we quantify functional trait dispersion along several key axes of tree life-history variation and on multiple spatial scales in a Neotropical dry-forest community. We next compare these results to previously reported patterns of phylogenetic dispersion in this same forest. We find that, at small spatial scales, coexisting species are typically more functionally clustered than expected, but traits related to adult and regeneration niches are overdispersed. This outcome was repeated when the analyses were stratified by size class. Some of the trait dispersion results stand in contrast to the previously reported phylogenetic dispersion results. In order to address this inconsistency we examined the strength of phylogenetic signal in traits at different depths in the phylogeny. We argue that: (1) while phylogenetic relatedness may be a good general multivariate proxy for ecological similarity, it may have a reduced capacity to depict the functional mechanisms behind species coexistence when coexisting species simultaneously converge and diverge in function; and (2) the previously used metric of phylogenetic signal provided erroneous inferences about trait dispersion when married with patterns of phylogenetic dispersion.

  16. Phylogenetic analysis of fungal ABC transporters.

    Science.gov (United States)

    Kovalchuk, Andriy; Driessen, Arnold J M

    2010-03-16

    The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.

  17. Application of the major capsid protein as a marker of the phylogenetic diversity of Emiliania huxleyi viruses.

    Science.gov (United States)

    Rowe, Janet M; Fabre, Marie-Françoise; Gobena, Daniel; Wilson, William H; Wilhelm, Steven W

    2011-05-01

    Studies of the Phycodnaviridae have traditionally relied on the DNA polymerase (pol) gene as a biomarker. However, recent investigations have suggested that the major capsid protein (MCP) gene may be a reliable phylogenetic biomarker. We used MCP gene amplicons gathered across the North Atlantic to assess the diversity of Emiliania huxleyi-infecting Phycodnaviridae. Nucleotide sequences were examined across >6000 km of open ocean, with comparisons between concentrates of the virus-size fraction of seawater and of lysates generated by exposing host strains to these same virus concentrates. Analyses revealed that many sequences were only sampled once, while several were over-represented. Analyses also revealed nucleotide sequences distinct from previous coastal isolates. Examination of lysed cultures revealed a new richness in phylogeny, as MCP sequences previously unrepresented within the existing collection of E. huxleyi viruses (EhV) were associated with viruses lysing cultures. Sequences were compared with previously described EhV MCP sequences from the North Sea and a Norwegian Fjord, as well as from the Gulf of Maine. Principal component analysis indicates that location-specific distinctions exist despite the presence of sequences common across these environments. Overall, this investigation provides new sequence data and an assessment on the use of the MCP gene. © 2011 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved.

  18. Combining phylogenetic and demographic inferences to assess the origin of the genetic diversity in an isolated wolf population.

    Directory of Open Access Journals (Sweden)

    Luca Montana

    Full Text Available The survival of isolated small populations is threatened by both demographic and genetic factors. Large carnivores declined for centuries in most of Europe due to habitat changes, overhunting of their natural prey and direct persecution. However, the current rewilding trends are driving many carnivore populations to expand again, possibly reverting the erosion of their genetic diversity. In this study we reassessed the extent and origin of the genetic variation of the Italian wolf population, which is expanding after centuries of decline and isolation. We genotyped wolves from Italy and other nine populations at four mtDNA regions (control-region, ATP6, COIII and ND4 and 39 autosomal microsatellites. Results of phylogenetic analyses and assignment procedures confirmed in the Italian wolves a second private mtDNA haplotype, which belongs to a haplogroup distributed mostly in southern Europe. Coalescent analyses showed that the unique mtDNA haplotypes in the Italian wolves likely originated during the late Pleistocene. ABC simulations concordantly showed that the extant wolf populations in Italy and in south-western Europe started to be isolated and declined right after the last glacial maximum. Thus, the standing genetic variation in the Italian wolves principally results from the historical isolation south of the Alps.

  19. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  20. galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M

    2004-06-12

    The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se

  1. Phylogenetic assemblage structure of North American trees is more strongly shaped by glacial-interglacial climate variability in gymnosperms than in angiosperms.

    Science.gov (United States)

    Ma, Ziyu; Sandel, Brody; Svenning, Jens-Christian

    2016-05-01

    How fast does biodiversity respond to climate change? The relationship of past and current climate with phylogenetic assemblage structure helps us to understand this question. Studies of angiosperm tree diversity in North America have already suggested effects of current water-energy balance and tropical niche conservatism. However, the role of glacial-interglacial climate variability remains to be determined, and little is known about any of these relationships for gymnosperms. Moreover, phylogenetic endemism, the concentration of unique lineages in restricted ranges, may also be related to glacial-interglacial climate variability and needs more attention. We used a refined phylogeny of both angiosperms and gymnosperms to map phylogenetic diversity, clustering and endemism of North American trees in 100-km grid cells, and climate change velocity since Last Glacial Maximum together with postglacial accessibility to recolonization to quantify glacial-interglacial climate variability. We found: (1) Current climate is the dominant factor explaining the overall patterns, with more clustered angiosperm assemblages toward lower temperature, consistent with tropical niche conservatism. (2) Long-term climate stability is associated with higher angiosperm endemism, while higher postglacial accessibility is linked to to more phylogenetic clustering and endemism in gymnosperms. (3) Factors linked to glacial-interglacial climate change have stronger effects on gymnosperms than on angiosperms. These results suggest that paleoclimate legacies supplement current climate in shaping phylogenetic patterns in North American trees, and especially so for gymnosperms.

  2. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).

    Science.gov (United States)

    Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J

    2010-12-01

    Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical

  4. Provider diversity in the English NHS: a study of recent developments in four local health economies.

    Science.gov (United States)

    Allen, Pauline; Turner, Simon; Bartlett, Will; Perotin, Virginie; Matchaya, Greenwell; Zamora, Bernarda

    2012-01-01

    To assess the impact of provider diversity on quality and innovation in the English NHS by mapping the extent of diverse provider activity and identifying the differences in performance between Third Sector Organisations (TSOs), for-profit private enterprises, and incumbent organizations within the NHS, and the factors that affect the entry and growth of new providers. Case studies of four local health economies. Data included: semi-structured interviews with 48 managerial and clinical staff from NHS organizations and providers from the private and third sector; some documentary evidence; a focus group with service users; and routine data from the Care Quality Commission and Companies House. Data collection was mainly between November 2008 and November 2009. Involvement of diverse providers in the NHS is limited. Commissioners' local strategies influence degrees of diversity. Barriers to entry for TSOs include lack of economies of scale in the bidding process. Private providers have greater concern to improve patient pathways and patient experience, whereas TSOs deliver quality improvements by using a more holistic approach and a greater degree of community involvement. Entry of new providers drives NHS trusts to respond by making improvements. Information sharing diminishes as competition intensifies. There is scope to increase the participation of diverse providers in the NHS but care must be taken not to damage public accountability, overall productivity, equity and NHS providers (especially acute hospitals, which are likely to remain in the NHS) in the process.

  5. Competition and habitat filtering jointly explain phylogenetic structure of soil bacterial communities across elevational gradients.

    Science.gov (United States)

    Zhang, Qian; Goberna, Marta; Liu, Yuguo; Cui, Ming; Yang, Haishui; Sun, Qixiang; Insam, Heribert; Zhou, Jinxing

    2018-04-24

    The importance of assembly processes in shaping biological communities is poorly understood, especially for microbes. Here we report on the forces that structure soil bacterial communities along a 2000 m elevational gradient. We characterized the relative importance of habitat filtering and competition on phylogenetic structure and turnover in bacterial communities. Bacterial communities exhibited a phylogenetically clustered pattern and were more clustered with increasing elevation. Biotic factors (i.e. relative abundance of dominant bacterial lineages) appeared to be most important to the degree of clustering, evidencing the role of the competitive ability of entire clades in shaping the communities. Phylogenetic turnover showed the greatest correlation to elevation. After controlling for elevation, biotic factors showed greater correlation to phylogenetic turnover than all the habitat variables (i.e. climate, soil and vegetation). Structural equation modelling also identified that elevation and soil organic matter exerted indirect effects on phylogenetic diversity and turnover by determining the dominance of microbial competitors. Our results suggest that competition among bacterial taxa induced by soil carbon contributes to the phylogenetic pattern across elevational gradient in the Tibetan Plateau. This highlights the importance of considering not only abiotic filtering but also biotic interactions in soil bacterial communities across stressful elevational gradients. This article is protected by copyright. All rights reserved. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Phylogenetic patterns of extinction risk in the eastern arc ecosystems, an African biodiversity hotspot.

    Science.gov (United States)

    Yessoufou, Kowiyou; Daru, Barnabas H; Davies, T Jonathan

    2012-01-01

    There is an urgent need to reduce drastically the rate at which biodiversity is declining worldwide. Phylogenetic methods are increasingly being recognised as providing a useful framework for predicting future losses, and guiding efforts for pre-emptive conservation actions. In this study, we used a reconstructed phylogenetic tree of angiosperm species of the Eastern Arc Mountains - an important African biodiversity hotspot - and described the distribution of extinction risk across taxonomic ranks and phylogeny. We provide evidence for both taxonomic and phylogenetic selectivity in extinction risk. However, we found that selectivity varies with IUCN extinction risk category. Vulnerable species are more closely related than expected by chance, whereas endangered and critically endangered species are not significantly clustered on the phylogeny. We suggest that the general observation for taxonomic and phylogenetic selectivity (i.e. phylogenetic signal, the tendency of closely related species to share similar traits) in extinction risks is therefore largely driven by vulnerable species, and not necessarily the most highly threatened. We also used information on altitudinal distribution and climate to generate a predictive model of at-risk species richness, and found that greater threatened species richness is found at higher altitude, allowing for more informed conservation decision making. Our results indicate that evolutionary history can help predict plant susceptibility to extinction threats in the hyper-diverse but woefully-understudied Eastern Arc Mountains, and illustrate the contribution of phylogenetic approaches in conserving African floristic biodiversity where detailed ecological and evolutionary data are often lacking.

  7. Phylogenetic patterns of extinction risk in the eastern arc ecosystems, an African biodiversity hotspot.

    Directory of Open Access Journals (Sweden)

    Kowiyou Yessoufou

    Full Text Available There is an urgent need to reduce drastically the rate at which biodiversity is declining worldwide. Phylogenetic methods are increasingly being recognised as providing a useful framework for predicting future losses, and guiding efforts for pre-emptive conservation actions. In this study, we used a reconstructed phylogenetic tree of angiosperm species of the Eastern Arc Mountains - an important African biodiversity hotspot - and described the distribution of extinction risk across taxonomic ranks and phylogeny. We provide evidence for both taxonomic and phylogenetic selectivity in extinction risk. However, we found that selectivity varies with IUCN extinction risk category. Vulnerable species are more closely related than expected by chance, whereas endangered and critically endangered species are not significantly clustered on the phylogeny. We suggest that the general observation for taxonomic and phylogenetic selectivity (i.e. phylogenetic signal, the tendency of closely related species to share similar traits in extinction risks is therefore largely driven by vulnerable species, and not necessarily the most highly threatened. We also used information on altitudinal distribution and climate to generate a predictive model of at-risk species richness, and found that greater threatened species richness is found at higher altitude, allowing for more informed conservation decision making. Our results indicate that evolutionary history can help predict plant susceptibility to extinction threats in the hyper-diverse but woefully-understudied Eastern Arc Mountains, and illustrate the contribution of phylogenetic approaches in conserving African floristic biodiversity where detailed ecological and evolutionary data are often lacking.

  8. Diversity and phylogenetic analyses of bacteria from a shallow-water hydrothermal vent in Milos island (Greece).

    Science.gov (United States)

    Giovannelli, Donato; d'Errico, Giuseppe; Manini, Elena; Yakimov, Michail; Vetriani, Costantino

    2013-01-01

    Studies of shallow-water hydrothermal vents have been lagging behind their deep-sea counterparts. Hence, the importance of these systems and their contribution to the local and regional diversity and biogeochemistry is unclear. This study analyzes the bacterial community along a transect at the shallow-water hydrothermal vent system of Milos island, Greece. The abundance and biomass of the prokaryotic community is comparable to areas not affected by hydrothermal activity and was, on average, 1.34 × 10(8) cells g(-1). The abundance, biomass and diversity of the prokaryotic community increased with the distance from the center of the vent and appeared to be controlled by the temperature gradient rather than the trophic conditions. The retrieved 16S rRNA gene fragments matched sequences from a variety of geothermal environments, although the average similarity was low (94%), revealing previously undiscovered taxa. Epsilonproteobacteria constituted the majority of the population along the transect, with an average contribution to the total diversity of 60%. The larger cluster of 16S rRNA gene sequences was related to chemolithoautotrophic Sulfurovum spp., an Epsilonproteobacterium so far detected only at deep-sea hydrothermal vents. The presence of previously unknown lineages of Epsilonproteobacteria could be related to the abundance of organic matter in these systems, which may support alternative metabolic strategies to chemolithoautotrophy. The relative contribution of Gammaproteobacteria to the Milos microbial community increased along the transect as the distance from the center of the vent increased. Further attempts to isolate key species from these ecosystems will be critical to shed light on their evolution and ecology.

  9. Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species.

    Science.gov (United States)

    Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf

    2014-01-01

    The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

  10. Feeding ecology and phylogenetic structure of a complex neotropical termite assemblage, revealed by nitrogen stable isotope ratios

    Czech Academy of Sciences Publication Activity Database

    Bourguignon, T.; Šobotník, Jan; Lepoint, G.; Martin, J. M.; Hardy, O. J.; Dejean, A.; Roisin, Y.

    2011-01-01

    Roč. 36, č. 2 (2011), s. 261-269 ISSN 0307-6946 Institutional research plan: CEZ:AV0Z40550506 Keywords : diet diversity * feeding groups * Isoptera * phylogenetic autocorrelation Subject RIV: CC - Organic Chemistry Impact factor: 1.995, year: 2011

  11. Molecular phylogenetic reconstruction and localization of the (TTAGG)n telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863) suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera).

    Science.gov (United States)

    Pereira, Tássia Tatiane Pontes; Dos Reis, Ana Caroline Coelho Corrêa; Cardoso, Danon Clemes; Cristiano, Maykon Passos

    2018-01-01

    Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG) 6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus . Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  12. Ecological and phylogenetic variability in the spinalis muscle of snakes.

    Science.gov (United States)

    Tingle, J L; Gartner, G E A; Jayne, B C; Garland, T

    2017-11-01

    Understanding the origin and maintenance of functionally important subordinate traits is a major goal of evolutionary physiologists and ecomorphologists. Within the confines of a limbless body plan, snakes are diverse in terms of body size and ecology, but we know little about the functional traits that underlie this diversity. We used a phylogenetically diverse group of 131 snake species to examine associations between habitat use, sidewinding locomotion and constriction behaviour with the number of body vertebrae spanned by a single segment of the spinalis muscle, with total numbers of body vertebrae used as a covariate in statistical analyses. We compared models with combinations of these predictors to determine which best fit the data among all species and for the advanced snakes only (N = 114). We used both ordinary least-squares models and phylogenetic models in which the residuals were modelled as evolving by the Ornstein-Uhlenbeck process. Snakes with greater numbers of vertebrae tended to have spinalis muscles that spanned more vertebrae. Habitat effects dominated models for analyses of all species and advanced snakes only, with the spinalis length spanning more vertebrae in arboreal species and fewer vertebrae in aquatic and burrowing species. Sidewinding specialists had shorter muscle lengths than nonspecialists. The relationship between prey constriction and spinalis length was less clear. Differences among clades were also strong when considering all species, but not for advanced snakes alone. Overall, these results suggest that muscle morphology may have played a key role in the adaptive radiation of snakes. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

  13. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  14. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    OpenAIRE

    Skaljac, Marisa; Kanakala, Surapathrudu; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts dete...

  15. Mining environmental high-throughput sequence data sets to identify divergent amplicon clusters for phylogenetic reconstruction and morphotype visualization.

    Science.gov (United States)

    Gimmler, Anna; Stoeck, Thorsten

    2015-08-01

    Environmental high-throughput sequencing (envHTS) is a very powerful tool, which in protistan ecology is predominantly used for the exploration of diversity and its geographic and local patterns. We here used a pyrosequenced V4-SSU rDNA data set from a solar saltern pond as test case to exploit such massive protistan amplicon data sets beyond this descriptive purpose. Therefore, we combined a Swarm-based blastn network including 11 579 ciliate V4 amplicons to identify divergent amplicon clusters with targeted polymerase chain reaction (PCR) primer design for full-length small subunit of the ribosomal DNA retrieval and probe design for fluorescence in situ hybridization (FISH). This powerful strategy allows to benefit from envHTS data sets to (i) reveal the phylogenetic position of the taxon behind divergent amplicons; (ii) improve phylogenetic resolution and evolutionary history of specific taxon groups; (iii) solidly assess an amplicons (species') degree of similarity to its closest described relative; (iv) visualize the morphotype behind a divergent amplicons cluster; (v) rapidly FISH screen many environmental samples for geographic/habitat distribution and abundances of the respective organism and (vi) to monitor the success of enrichment strategies in live samples for cultivation and isolation of the respective organisms. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Multifaceted diversity-area relationships reveal global hotspots of mammalian species, trait and lineage diversity.

    Science.gov (United States)

    Mazel, Florent; Guilhaumon, François; Mouquet, Nicolas; Devictor, Vincent; Gravel, Dominique; Renaud, Julien; Cianciaruso, Marcus Vinicius; Loyola, Rafael Dias; Diniz-Filho, José Alexandre Felizola; Mouillot, David; Thuiller, Wilfried

    2014-08-01

    To define biome-scale hotspots of phylogenetic and functional mammalian biodiversity (PD and FD, respectively) and compare them to 'classical' hotspots based on species richness (SR) only. Global. SR, PD & FD were computed for 782 terrestrial ecoregions using distribution ranges of 4616 mammalian species. We used a set of comprehensive diversity indices unified by a recent framework that incorporates the species relative coverage in each ecoregion. We build large-scale multifaceted diversity-area relationships to rank ecoregions according to their levels of biodiversity while accounting for the effect of area on each diversity facet. Finally we defined hotspots as the top-ranked ecoregions. While ignoring species relative coverage led to a relative good congruence between biome top ranked SR, PD and FD hotspots, ecoregions harboring a rich and abundantly represented evolutionary history and functional diversity did not match with top ranked ecoregions defined by species richness. More importantly PD and FD hotspots showed important spatial mismatches. We also found that FD and PD generally reached their maximum values faster than species richness as a function of area. The fact that PD/FD reach faster their maximal value than SR may suggest that the two former facets might be less vulnerable to habitat loss than the latter. While this point is expected, it is the first time that it is quantified at global scale and should have important consequences in conservation. Incorporating species relative coverage into the delineation of multifaceted hotspots of diversity lead to weak congruence between SR, PD and FD hotspots. This means that maximizing species number may fail at preserving those nodes (in the phylogenetic or functional tree) that are relatively abundant in the ecoregion. As a consequence it may be of prime importance to adopt a multifaceted biodiversity perspective to inform conservation strategies at global scale.

  17. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Microsatellite based genetic diversity and relationships among ten Creole and commercial cattle breeds raised in Brazil

    Directory of Open Access Journals (Sweden)

    Almeida Leonardo D

    2007-12-01

    Full Text Available Abstract Background Brazil holds the largest commercial cattle populations worldwide. Local cattle breeds can be classified according to their origin, as exotic or Creole. Exotic breeds imported in the last 100 years, both zebuine and taurine, currently make up the bulk of the intensively managed populations. Locally adapted Creole breeds, originated from cattle introduced by the European conquerors derive from natural selection and events of breed admixture. While historical knowledge exists on the Brazilian Creole breeds very little is known on their genetic composition. The objective of this study was to assess the levels of genetic diversity, phylogenetic relationships and patterns of taurine/zebuine admixture among ten cattle breeds raised in Brazil. Results Significant reduction of heterozygosity exists due both to within-population inbreeding and to breed differentiation in both subspecies (taurine and zebuine. For taurine breeds the number of markers that contribute to breed differentiation is larger than for zebuine. A consistently similar number of alleles was seen in both subspecies for all microsatellites. Four Creole breeds were the most genetically diverse followed by the zebuine breeds, the two specialized taurine breeds and the Creole Caracu. Pairwise genetic differentiation were all significant indicating that all breeds can be considered as genetically independent entities. A STRUCTURE based diagram indicated introgression of indicine genes in the local Creole breeds and suggested that occasional Creole introgression can be detected in some Zebuine animals. Conclusion This study reports on a comprehensive study of the genetic structure and diversity of cattle breeds in Brazil. A significant amount of genetic variation is maintained in the local cattle populations. The genetic data show that Brazilian Creole breeds constitute an important and diverse reservoir of genetic diversity for bovine breeding and conservation. The

  19. Molecular phylogenetic reconstruction and localization of the (TTAGGn telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863 suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera

    Directory of Open Access Journals (Sweden)

    Tássia Tatiane Pontes Pereira

    2018-01-01

    Full Text Available Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known. The main exception is Acromyrmex striatus (Roger, 1863, which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH with telomeric probes with (TTAGG6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  20. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  1. Diversity of Phylogenetic Information According to the Locus and the Taxonomic Level: An Example from a Parasitic Mesostigmatid Mite Genus

    Directory of Open Access Journals (Sweden)

    Lise Roy

    2010-04-01

    Full Text Available Molecular markers for cladistic analyses may perform differently according to the taxonomic group considered and the historical level under investigation. Here we evaluate the phylogenetic potential of five different markers for resolving evolutionary relationships within the ectoparasitic genus Dermanyssus at the species level, and their ability to address questions about the evolution of specialization. COI provided 9–18% divergence between species (up to 9% within species, 16S rRNA 10–16% (up to 4% within species, ITS1 and 2 2–9% (up to 1% within species and Tropomyosin intron n 8–20% (up to 6% within species. EF-1a revealed different non-orthologous copies withinindividuals of Dermanyssus and Ornithonyssus. Tropomyosin intron n was shown containing consistent phylogenetic signal at the specific level within Dermanyssus and represents a promising marker for future prospects in phylogenetics of Acari. Phylogenetic analyses revealed that the generalist condition is apomorphic and D. gallinae mightrepresent a complex of hybridized lineages. The split into hirsutus-group and gallinae-group in Dermanyssus does not seem to be appropriate based upon these results and D. longipes appears to be composed of two different entities.

  2. Phylogeny, Traits, and Biodiversity of a Neotropical Bat Assemblage: Close Relatives Show Similar Responses to Local Deforestation.

    Science.gov (United States)

    Frank, Hannah K; Frishkoff, Luke O; Mendenhall, Chase D; Daily, Gretchen C; Hadly, Elizabeth A

    2017-08-01

    If species' evolutionary pasts predetermine their responses to evolutionarily novel stressors, then phylogeny could predict species survival in an increasingly human-dominated world. To understand the role of phylogenetic relatedness in structuring responses to rapid environmental change, we focused on assemblages of Neotropical bats, an ecologically diverse and functionally important group. We examined how taxonomic and phylogenetic diversity shift between tropical forest and farmland. We then explored the importance of evolutionary history by ascertaining whether close relatives share similar responses to environmental change and which species traits might mediate these trends. We analyzed a 5-year data set (5,011 captures) from 18 sites in a countryside landscape in southern Costa Rica using statistical models that account and correct for imperfect detection of species across sites, spatial autocorrelation, and consideration of spatial scale. Taxonomic and phylogenetic diversity decreased with deforestation, and assemblages became more phylogenetically clustered. Species' responses to deforestation were strongly phylogenetically correlated. Body mass and absolute wing loading explained a substantial portion of species variation in species' habitat preferences, likely related to these traits' influence on maneuverability in cluttered forest environments. Our findings highlight the role that evolutionary history plays in determining which species will survive human impacts and the need to consider diversity metrics, evolutionary history, and traits together when making predictions about species persistence for conservation or ecosystem functioning.

  3. XplorSeq: a software environment for integrated management and phylogenetic analysis of metagenomic sequence data.

    Science.gov (United States)

    Frank, Daniel N

    2008-10-07

    Advances in automated DNA sequencing technology have accelerated the generation of metagenomic DNA sequences, especially environmental ribosomal RNA gene (rDNA) sequences. As the scale of rDNA-based studies of microbial ecology has expanded, need has arisen for software that is capable of managing, annotating, and analyzing the plethora of diverse data accumulated in these projects. XplorSeq is a software package that facilitates the compilation, management and phylogenetic analysis of DNA sequences. XplorSeq was developed for, but is not limited to, high-throughput analysis of environmental rRNA gene sequences. XplorSeq integrates and extends several commonly used UNIX-based analysis tools by use of a Macintosh OS-X-based graphical user interface (GUI). Through this GUI, users may perform basic sequence import and assembly steps (base-calling, vector/primer trimming, contig assembly), perform BLAST (Basic Local Alignment and Search Tool; 123) searches of NCBI and local databases, create multiple sequence alignments, build phylogenetic trees, assemble Operational Taxonomic Units, estimate biodiversity indices, and summarize data in a variety of formats. Furthermore, sequences may be annotated with user-specified meta-data, which then can be used to sort data and organize analyses and reports. A document-based architecture permits parallel analysis of sequence data from multiple clones or amplicons, with sequences and other data stored in a single file. XplorSeq should benefit researchers who are engaged in analyses of environmental sequence data, especially those with little experience using bioinformatics software. Although XplorSeq was developed for management of rDNA sequence data, it can be applied to most any sequencing project. The application is available free of charge for non-commercial use at http://vent.colorado.edu/phyloware.

  4. Tasting soil fungal diversity with earth tongues: phylogenetic test of SATe alignments for environmental ITS data.

    Directory of Open Access Journals (Sweden)

    Zheng Wang

    Full Text Available An abundance of novel fungal lineages have been indicated by DNA sequencing of the nuclear ribosomal ITS region from environmental samples such as soil and wood. Although phylogenetic analysis of these novel lineages is a key component of unveiling the structure and diversity of complex communities, such analyses are rare for environmental ITS data due to the difficulties of aligning this locus across significantly divergent taxa. One potential approach to this issue is simultaneous alignment and tree estimation. We targeted divergent ITS sequences of the earth tongue fungi (Geoglossomycetes, a basal class in the Ascomycota, to assess the performance of SATé, recent software that combines progressive alignment and tree building. We found that SATé performed well in generating high-quality alignments and in accurately estimating the phylogeny of earth tongue fungi. Drawing from a data set of 300 sequences of earth tongues and progressively more distant fungal lineages, 30 insufficiently identified ITS sequences from the public sequence databases were assigned to the Geoglossomycetes. The association between earth tongues and plants has been hypothesized for a long time, but hard evidence is yet to be collected. The ITS phylogeny showed that four ectomycorrhizal isolates shared a clade with Geoglossum but not with Trichoglossum earth tongues, pointing to the significant potential inherent to ecological data mining of environmental samples. Environmental sampling holds the key to many focal questions in mycology, and simultaneous alignment and tree estimation, as performed by SATé, can be a highly efficient companion in that pursuit.

  5. Genome Size Diversity in Lilium (Liliaceae Is Correlated with Karyotype and Environmental Traits

    Directory of Open Access Journals (Sweden)

    Yun-peng Du

    2017-07-01

    Full Text Available Genome size (GS diversity is of fundamental biological importance. The occurrence of giant genomes in angiosperms is restricted to just a few lineages in the analyzed genome size of plant species so far. It is still an open question whether GS diversity is shaped by neutral or natural selection. The genus Lilium, with giant genomes, is phylogenetically and horticulturally important and is distributed throughout the northern hemisphere. GS diversity in Lilium and the underlying evolutionary mechanisms are poorly understood. We performed a comprehensive study involving phylogenetically independent analysis on 71 species to explore the diversity and evolution of GS and its correlation with karyological and environmental traits within Lilium (including Nomocharis. The strong phylogenetic signal detected for GS in the genus provides evidence consistent with that the repetitive DNA may be the primary contributors to the GS diversity, while the significant positive relationships detected between GS and the haploid chromosome length (HCL provide insights into patterns of genome evolution. The relationships between GS and karyotypes indicate that ancestral karyotypes of Lilium are likely to have exhibited small genomes, low diversity in centromeric index (CVCI values and relatively high relative variation in chromosome length (CVCL values. Significant relationships identified between GS and annual temperature and between GS and annual precipitation suggest that adaptation to habitat strongly influences GS diversity. We conclude that GS in Lilium is shaped by both neutral (genetic drift and adaptive evolution. These findings will have important consequences for understanding the evolution of giant plant genomes, and exploring the role of repetitive DNA fraction and chromosome changes in a plant group with large genomes and conservation of chromosome number.

  6. Genetic Diversity and Population Structure of Cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Xiong, Haizheng; Shi, Ainong; Mou, Beiquan; Qin, Jun; Motes, Dennis; Lu, Weiguo; Ma, Jianbing; Weng, Yuejin; Yang, Wei; Wu, Dianxing

    2016-01-01

    The genetic diversity of cowpea was analyzed, and the population structure was estimated in a diverse set of 768 cultivated cowpea genotypes from the USDA GRIN cowpea collection, originally collected from 56 countries. Genotyping by sequencing was used to discover single nucleotide polymorphism (SNP) in cowpea and the identified SNP alleles were used to estimate the level of genetic diversity, population structure, and phylogenetic relationships. The aim of this study was to detect the gene pool structure of cowpea and to determine its relationship between different regions and countries. Based on the model-based ancestry analysis, the phylogenetic tree, and the principal component analysis, three well-differentiated genetic populations were postulated from 768 worldwide cowpea genotypes. According to the phylogenetic analyses between each individual, region, and country, we may trace the accession from off-original, back to the two candidate original areas (West and East of Africa) to predict the migration and domestication history during the cowpea dispersal and development. To our knowledge, this is the first report of the analysis of the genetic variation and relationship between globally cultivated cowpea genotypes. The results will help curators, researchers, and breeders to understand, utilize, conserve, and manage the collection for more efficient contribution to international cowpea research.

  7. Integrative taxonomy of ciliates: Assessment of molecular phylogenetic content and morphological homology testing.

    Science.gov (United States)

    Vďačný, Peter

    2017-10-01

    The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.

  8. Phylogenetic diversification of Early Cretaceous seed plants: The compound seed cone of Doylea tetrahedrasperma.

    Science.gov (United States)

    Rothwell, Gar W; Stockey, Ruth A

    2016-05-01

    Discovery of cupulate ovules of Doylea tetrahedrasperma within a compact, compound seed cone highlights the rich diversity of fructification morphologies, pollination biologies, postpollination enclosure of seeds, and systematic diversity of Early Cretaceous gymnosperms. Specimens were studied using the cellulose acetate peel technique, three-dimensional reconstructions (in AVIZO), and morphological phylogenetic analyses (in TNT). Doylea tetrahedrasperma has bract/fertile short shoot complexes helically arranged within a compact, compound seed cone. Complexes diverge from the axis as a single unit and separate distally into a free bract tip and two sporophylls. Each sporophyll bears a single, abaxial seed, recurved toward the cone axis, that is enveloped after pollinaton by sporophyll tissue, forming a closed cupule. Ovules are pollinated by bisaccate grains captured by micropylar pollination horns. The unique combination of characters shown by D. tetrahedrasperma includes the presence of cupulate seeds borne in conifer-like compound seed cones, an ovuliferous scale analogue structurally equivalent to the ovulate stalk of Ginkgo biloba, gymnospermous pollination, and nearly complete enclosure of mature seeds. These features characterize the Doyleales ord. nov., clearly distinguish it from the seed fern order Corystospermales, and allow for recognition of another recently described Early Cretaceous seed plant as a second species in genus Doylea. A morphological phylogenetic analysis highlights systematic relationships of the Doyleales ord. nov. and emphasizes the explosive phylogenetic diversification of gymnosperms that was underway at the time when flowering plants may have originated and/or first began to radiate. © 2016 Botanical Society of America.

  9. Constructing level-2 phylogenetic networks from triplets

    OpenAIRE

    Iersel, Leo; Keijsper, J.C.M.; Kelk, Steven; Stougie, Leen; Hagen, F.; Boekhout, T.; Vingron, M.; Wong, L.

    2009-01-01

    htmlabstractJansson and Sung showed that, given a dense set of input triplets T (representing hypotheses about the local evolutionary relationships of triplets of taxa), it is possible to determine in polynomial time whether there exists a level-1 network consistent with T, and if so to construct such a network (Inferring a Level-1 Phylogenetic Network from a Dense Set of Rooted Triplets, Theoretical Computer Science, 363, pp. 60-68 (2006)). Here we extend this work by showing that this probl...

  10. Distinct genetic diversity of Oncomelania hupensis, intermediate host of Schistosoma japonicum in mainland China as revealed by ITS sequences.

    Directory of Open Access Journals (Sweden)

    Qin Ping Zhao

    Full Text Available BACKGROUND: Oncomelania hupensis is the unique intermediate host of Schistosoma japonicum, which causes schistosomiasis endemic in the Far East, and especially in mainland China. O. hupensis largely determines the parasite's geographical range. How O. hupensis's genetic diversity is distributed geographically in mainland China has never been well examined with DNA sequence data. METHODOLOGY/PRINCIPAL FINDINGS: In this study we investigate the genetic variation among O. hupensis from different geographical origins using the combined complete internal transcribed spacer 1 (ITS1 and ITS2 regions of nuclear ribosomal DNA. 165 O. hupensis isolates were obtained in 29 localities from 7 provinces across mainland China: lake/marshland and hill regions in Anhui, Hubei, Hunan, Jiangxi and Jiangsu provinces, located along the middle and lower reaches of Yangtze River, and mountainous regions in Sichuan and Yunnan provinces. Phylogenetic and haplotype network analyses showed distinct genetic diversity and no shared haplotypes between populations from lake/marshland regions of the middle and lower reaches of the Yangtze River and populations from mountainous regions of Sichuan and Yunnan provinces. The genetic distance between these two groups is up to 0.81 based on Fst, and branch time was estimated as 2-6 Ma. As revealed in the phylogenetic tree, snails from Sichuan and Yunnan provinces were also clustered separately. Geographical separation appears to be an important factor accounting for the diversification of the two groups of O. hupensis in mainland China, and probably for the separate clades between snails from Sichuan and Yunnan provinces. In lake/marshland and hill regions along the middle and lower reaches of the Yangtze River, three clades were identified in the phylogenetic tree, but without any obvious clustering of snails from different provinces. CONCLUSIONS: O. hupensis in mainland China may have considerable genetic diversity, and a more

  11. Global Taxonomic Diversity of Living Reptiles

    Science.gov (United States)

    Pincheira-Donoso, Daniel; Bauer, Aaron M.; Meiri, Shai; Uetz, Peter

    2013-01-01

    Reptiles are one of the most ecologically and evolutionarily remarkable groups of living organisms, having successfully colonized most of the planet, including the oceans and some of the harshest and more environmentally unstable ecosystems on earth. Here, based on a complete dataset of all the world’s diversity of living reptiles, we analyse lineage taxonomic richness both within and among clades, at different levels of the phylogenetic hierarchy. We also analyse the historical tendencies in the descriptions of new reptile species from Linnaeus to March 2012. Although (non-avian) reptiles are the second most species-rich group of amniotes after birds, most of their diversity (96.3%) is concentrated in squamates (59% lizards, 35% snakes, and 2% amphisbaenians). In strong contrast, turtles (3.4%), crocodilians (0.3%), and tuataras (0.01%) are far less diverse. In terms of species discoveries, most turtles and crocodilians were described early, while descriptions of lizards, snakes and amphisbaenians are multimodal with respect to time. Lizard descriptions, in particular, have reached unprecedented levels during the last decade. Finally, despite such remarkably asymmetric distributions of reptile taxonomic diversity among groups, we found that the distributions of lineage richness are consistently right-skewed, with most clades (monophyletic families and genera) containing few lineages (monophyletic genera and species, respectively), while only a few have radiated greatly (notably the families Colubridae and Scincidae, and the lizard genera Anolis and Liolaemus). Therefore, such consistency in the frequency distribution of richness among clades and among phylogenetic levels suggests that the nature of reptile biodiversity is fundamentally fractal (i.e., it is scale invariant). We then compared current reptile diversity with the global reptile diversity and taxonomy known in 1980. Despite substantial differences in the taxonomies (relative to 2012), the patterns of

  12. Global taxonomic diversity of living reptiles.

    Science.gov (United States)

    Pincheira-Donoso, Daniel; Bauer, Aaron M; Meiri, Shai; Uetz, Peter

    2013-01-01

    Reptiles are one of the most ecologically and evolutionarily remarkable groups of living organisms, having successfully colonized most of the planet, including the oceans and some of the harshest and more environmentally unstable ecosystems on earth. Here, based on a complete dataset of all the world's diversity of living reptiles, we analyse lineage taxonomic richness both within and among clades, at different levels of the phylogenetic hierarchy. We also analyse the historical tendencies in the descriptions of new reptile species from Linnaeus to March 2012. Although (non-avian) reptiles are the second most species-rich group of amniotes after birds, most of their diversity (96.3%) is concentrated in squamates (59% lizards, 35% snakes, and 2% amphisbaenians). In strong contrast, turtles (3.4%), crocodilians (0.3%), and tuataras (0.01%) are far less diverse. In terms of species discoveries, most turtles and crocodilians were described early, while descriptions of lizards, snakes and amphisbaenians are multimodal with respect to time. Lizard descriptions, in particular, have reached unprecedented levels during the last decade. Finally, despite such remarkably asymmetric distributions of reptile taxonomic diversity among groups, we found that the distributions of lineage richness are consistently right-skewed, with most clades (monophyletic families and genera) containing few lineages (monophyletic genera and species, respectively), while only a few have radiated greatly (notably the families Colubridae and Scincidae, and the lizard genera Anolis and Liolaemus). Therefore, such consistency in the frequency distribution of richness among clades and among phylogenetic levels suggests that the nature of reptile biodiversity is fundamentally fractal (i.e., it is scale invariant). We then compared current reptile diversity with the global reptile diversity and taxonomy known in 1980. Despite substantial differences in the taxonomies (relative to 2012), the patterns of

  13. Global taxonomic diversity of living reptiles.

    Directory of Open Access Journals (Sweden)

    Daniel Pincheira-Donoso

    Full Text Available Reptiles are one of the most ecologically and evolutionarily remarkable groups of living organisms, having successfully colonized most of the planet, including the oceans and some of the harshest and more environmentally unstable ecosystems on earth. Here, based on a complete dataset of all the world's diversity of living reptiles, we analyse lineage taxonomic richness both within and among clades, at different levels of the phylogenetic hierarchy. We also analyse the historical tendencies in the descriptions of new reptile species from Linnaeus to March 2012. Although (non-avian reptiles are the second most species-rich group of amniotes after birds, most of their diversity (96.3% is concentrated in squamates (59% lizards, 35% snakes, and 2% amphisbaenians. In strong contrast, turtles (3.4%, crocodilians (0.3%, and tuataras (0.01% are far less diverse. In terms of species discoveries, most turtles and crocodilians were described early, while descriptions of lizards, snakes and amphisbaenians are multimodal with respect to time. Lizard descriptions, in particular, have reached unprecedented levels during the last decade. Finally, despite such remarkably asymmetric distributions of reptile taxonomic diversity among groups, we found that the distributions of lineage richness are consistently right-skewed, with most clades (monophyletic families and genera containing few lineages (monophyletic genera and species, respectively, while only a few have radiated greatly (notably the families Colubridae and Scincidae, and the lizard genera Anolis and Liolaemus. Therefore, such consistency in the frequency distribution of richness among clades and among phylogenetic levels suggests that the nature of reptile biodiversity is fundamentally fractal (i.e., it is scale invariant. We then compared current reptile diversity with the global reptile diversity and taxonomy known in 1980. Despite substantial differences in the taxonomies (relative to 2012, the

  14. A revised root for the human Y chromosomal phylogenetic tree: the origin of patrilineal diversity in Africa.

    Science.gov (United States)

    Cruciani, Fulvio; Trombetta, Beniamino; Massaia, Andrea; Destro-Bisol, Giovanni; Sellitto, Daniele; Scozzari, Rosaria

    2011-06-10

    To shed light on the structure of the basal backbone of the human Y chromosome phylogeny, we sequenced about 200 kb of the male-specific region of the human Y chromosome (MSY) from each of seven Y chromosomes belonging to clades A1, A2, A3, and BT. We detected 146 biallelic variant sites through this analysis. We used these variants to construct a patrilineal tree, without taking into account any previously reported information regarding the phylogenetic relationships among the seven Y chromosomes here analyzed. There are several key changes at the basal nodes as compared with the most recent reference Y chromosome tree. A different position of the root was determined, with important implications for the origin of human Y chromosome diversity. An estimate of 142 KY was obtained for the coalescence time of the revised MSY tree, which is earlier than that obtained in previous studies and easier to reconcile with plausible scenarios of modern human origin. The number of deep branchings leading to African-specific clades has doubled, further strengthening the MSY-based evidence for a modern human origin in the African continent. An analysis of 2204 African DNA samples showed that the deepest clades of the revised MSY phylogeny are currently found in central and northwest Africa, opening new perspectives on early human presence in the continent. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  15. Unique Phylogenetic Lineage Found in the Fusarium-like Clade after Re-examining BCCM/IHEM Fungal Culture Collection Material.

    Science.gov (United States)

    Triest, David; De Cremer, Koen; Piérard, Denis; Hendrickx, Marijke

    2016-09-01

    Recently, the Fusarium genus has been narrowed based upon phylogenetic analyses and a Fusarium -like clade was adopted. The few species of the Fusarium -like clade were moved to new, re-installed or existing genera or provisionally retained as " Fusarium ." Only a limited number of reference strains and DNA marker sequences are available for this clade and not much is known about its actual species diversity. Here, we report six strains, preserved by the Belgian fungal culture collection BCCM/IHEM as a Fusarium species, that belong to the Fusarium -like clade. They showed a slow growth and produced pionnotes, typical morphological characteristics of many Fusarium -like species. Multilocus sequencing with comparative sequence analyses in GenBank and phylogenetic analyses, using reference sequences of type material, confirmed that they were indeed member of the Fusarium -like clade. One strain was identified as "Fusarium" ciliatum whereas another strain was identified as Fusicolla merismoides . The four remaining strains were shown to represent a unique phylogenetic lineage in the Fusarium -like clade and were also found morphologically distinct from other members of the Fusarium -like clade. Based upon phylogenetic considerations, a new genus, Pseudofusicolla gen. nov., and a new species, Pseudofusicolla belgica sp. nov., were installed for this lineage. A formal description is provided in this study. Additional sampling will be required to gather isolates other than the historical strains presented in the present study as well as to further reveal the actual species diversity in the Fusarium -like clade.

  16. Environmental Noise Could Promote Stochastic Local Stability of Behavioral Diversity Evolution

    Science.gov (United States)

    Zheng, Xiu-Deng; Li, Cong; Lessard, Sabin; Tao, Yi

    2018-05-01

    In this Letter, we investigate stochastic stability in a two-phenotype evolutionary game model for an infinite, well-mixed population undergoing discrete, nonoverlapping generations. We assume that the fitness of a phenotype is an exponential function of its expected payoff following random pairwise interactions whose outcomes randomly fluctuate with time. We show that the stochastic local stability of a constant interior equilibrium can be promoted by the random environmental noise even if the system may display a complicated nonlinear dynamics. This result provides a new perspective for a better understanding of how environmental fluctuations may contribute to the evolution of behavioral diversity.

  17. Diversity and paleogeographic distribution of Early Jurassic plesiosaurs

    Science.gov (United States)

    Vincent, Peggy; Suan, Guillaume

    2010-05-01

    Early Jurassic plesiosaurs, a group of extinct marine reptiles, were one of the first groups to be described in the history of vertebrate paleontology. Nevertheless, the paleogeographic distribution and the taxonomic diversity of these forms are still unclear, particularly because most descriptions and taxonomic attributions were realized during the mid 19th to early 20th century. Here we investigate the paleodiversity and paleogeographic distribution of Early Jurassic plesiosaurs using an extensive taxonomic and anatomical revision of most known Early Jurassic specimens. We also present an examination of the biostratigraphic and sedimentological framework of deposits in which these specimens were discovered, in order to decipher whether their fossil record reflects primary paleobiological trends or taphonomic/discovery biases. Early Jurassic Plesiosaur diversity appears to reach its maximum during the Toarcian (falciferum-bifrons ammonite zones). Nevertheless, the inclusion of ghost lineages into the diversity curves indicates that this pattern likely reflects discovery and taphonomical biases rather than primary biodiversity trends. Indeed, most strata where numerous plesiosaurs species were discovered correspond to sediments that were deposited under poorly-oxygenated conditions and exploited at least in a semi-industrial way during the 1800's-1950's. The Lower Jurassic fossiliferous localities that yielded identifiable plesiosaur species are only found in Western Europe (England, Germany, and France). In Europe, the Toarcian stage is the only interval where more than one fossiliferous locality is known (the Hettangian, Sinemurian and Pliensbachian stages being each represented by only one locality where specimens are identifiable at the species level). The different Toarcian fossiliferous sites of Europe do not bear any single common taxon, suggesting a high degree of endemism in Early Jurassic plesiosaurs. Nevertheless, these sites are fundamentally

  18. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  19. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  20. Genetic diversity analysis of the oriental river prawn (Macrobrachium nipponense) in Huaihe River.

    Science.gov (United States)

    Cui, Feng; Yu, Yanyan; Bao, Fangyin; Wang, Song; Xiao, Ming Song

    2018-04-19

    The oriental river prawn (Macrobrachium nipponense) is an economically and nutritionally important species of decapod crustaceans in China. Genetic structure and demographic history of Macrobrachium nipponense were examined using sequence data from portions of the mitochondrial DNA cytochrome oxidase subunit I (COI) gene. Samples of 191 individuals were collected from 10 localities in the upper to middle reaches of the Huaihe River. Variability was detected at a total of 42 nucleotide sites along 684 bp length of homologous sequence (6.14%), and base substitutions occurred mostly at the second codon position. Haplotype diversity (h) and nucleotide diversity (π) of all populations were 0.9136 ± 0.0116 and 0.0078 ± 0.0042, respectively. Phylogenetic tree constructed using the maximum-likelihood (ML) method showed that the 44 haplotypes were assigned to two obvious clades associated with geographic regions. Moreover, the median-joining network was similar to the topology of the phylogenetic tree with 44 haplotypes. The pairwise F ST values between the populations varied from -0.0298 to 0.2994. Generally, moderate genetic differentiation (F ST  = 0.1598, p = .0000) among different geographic populations was detected, with the significant differentiation between the Huaibin (HB) and other Macrobrachium nipponense populations. Both mismatch distribution analyses and neutrality tests suggested the early stage of Late Pleistocene population expansion 85,500 years before present for the species, which was consistent with the palaeoclimatic condition of the Huaihe River Basin.

  1. Teaching Geoscience in Place for Local Diversity and Sustainability

    Science.gov (United States)

    Semken, S.

    2008-12-01

    Globalization, careerism, media, thoughtless consumption, standardized education and assessment, and even well-meaning advocacy for far-flung environments and people all divert our attention from meaningful interaction with our own surroundings. Meanwhile, many young Americans prefer virtual realities over personal intimacy with nature. Many have lost sight of the pedagogical power of places: localities imbued with meaning by human experience. To lack a sense of local places is to be oblivious to their environmental, cultural, and aesthetic importance, and to risk acceding to their degradation. The geosciences, born and rooted in exploration of environments, have much to lose from this trend but can be pivotal in helping to reverse it. Place-based teaching is situated in local physical and cultural environments and blends experiential learning, transdisciplinary and multicultural content, and service to the community. It is advocated for its relevance and potential to engage diverse students. Authentically place-based education is informed not only by scientific knowledge of places but also by the humanistic meanings and attachments affixed to them. Leveraging and enriching the senses of place of students, teachers, and the community is a defining and desirable learning outcome. We have researched and piloted several place-based approaches to geoscience teaching at various places in the Southwest USA: at a rural Tribal College, a large urban university, and a teacher in-service program at an underserved, minority-majority rural school district. Curricula are situated in complexly evolved, ruggedly beautiful desert-mountain physical landscapes coincident with multicultural, deeply historic, but rapidly changing cultural landscapes. The organizing theme is a cyclical path of inquiry through Earth and Sky, derived from Indigenous ethnogeology; syllabi integrate geology, hydrology, climate, environmental quality, and cultural geography and are situated in real places

  2. Body size diversity and frequency distributions of Neotropical cichlid fishes (Cichliformes: Cichlidae: Cichlinae.

    Directory of Open Access Journals (Sweden)

    Sarah E Steele

    Full Text Available Body size is an important correlate of life history, ecology and distribution of species. Despite this, very little is known about body size evolution in fishes, particularly freshwater fishes of the Neotropics where species and body size diversity are relatively high. Phylogenetic history and body size data were used to explore body size frequency distributions in Neotropical cichlids, a broadly distributed and ecologically diverse group of fishes that is highly representative of body size diversity in Neotropical freshwater fishes. We test for divergence, phylogenetic autocorrelation and among-clade partitioning of body size space. Neotropical cichlids show low phylogenetic autocorrelation and divergence within and among taxonomic levels. Three distinct regions of body size space were identified from body size frequency distributions at various taxonomic levels corresponding to subclades of the most diverse tribe, Geophagini. These regions suggest that lineages may be evolving towards particular size optima that may be tied to specific ecological roles. The diversification of Geophagini appears to constrain the evolution of body size among other Neotropical cichlid lineages; non-Geophagini clades show lower species-richness in body size regions shared with Geophagini. Neotropical cichlid genera show less divergence and extreme body size than expected within and among tribes. Body size divergence among species may instead be present or linked to ecology at the community assembly scale.

  3. A phylogenetic perspective on the evolution of Mediterranean teleost fishes.

    Directory of Open Access Journals (Sweden)

    Christine N Meynard

    Full Text Available The Mediterranean Sea is a highly diverse, highly studied, and highly impacted biogeographic region, yet no phylogenetic reconstruction of fish diversity in this area has been published to date. Here, we infer the timing and geographic origins of Mediterranean teleost species diversity using nucleotide sequences collected from GenBank. We assembled a DNA supermatrix composed of four mitochondrial genes (12S ribosomal DNA, 16S ribosomal DNA, cytochrome c oxidase subunit I and cytochrome b and two nuclear genes (rhodopsin and recombination activating gene I, including 62% of Mediterranean teleost species plus 9 outgroups. Maximum likelihood and Bayesian phylogenetic and dating analyses were calibrated using 20 fossil constraints. An additional 124 species were grafted onto the chronogram according to their taxonomic affinity, checking for the effects of taxonomic coverage in subsequent diversification analyses. We then interpreted the time-line of teleost diversification in light of Mediterranean historical biogeography, distinguishing non-endemic natives, endemics and exotic species. Results show that the major Mediterranean orders are of Cretaceous origin, specifically ~100-80 Mya, and most Perciformes families originated 80-50 Mya. Two important clade origin events were detected. The first at 100-80 Mya, affected native and exotic species, and reflects a global diversification period at a time when the Mediterranean Sea did not yet exist. The second occurred during the last 50 Mya, and is noticeable among endemic and native species, but not among exotic species. This period corresponds to isolation of the Mediterranean from Indo-Pacific waters before the Messinian salinity crisis. The Mediterranean fish fauna illustrates well the assembly of regional faunas through origination and immigration, where dispersal and isolation have shaped the emergence of a biodiversity hotspot.

  4. Evolution of specialization: a phylogenetic study of host range in the red milkweed beetle (Tetraopes tetraophthalmus).

    Science.gov (United States)

    Rasmann, Sergio; Agrawal, Anurag A

    2011-06-01

    Specialization is common in most lineages of insect herbivores, one of the most diverse groups of organisms on earth. To address how and why specialization is maintained over evolutionary time, we hypothesized that plant defense and other ecological attributes of potential host plants would predict the performance of a specialist root-feeding herbivore (the red milkweed beetle, Tetraopes tetraophthalmus). Using a comparative phylogenetic and functional trait approach, we assessed the determinants of insect host range across 18 species of Asclepias. Larval survivorship decreased with increasing phylogenetic distance from the true host, Asclepias syriaca, suggesting that adaptation to plant traits drives specialization. Among several root traits measured, only cardenolides (toxic defense chemicals) correlated with larval survival, and cardenolides also explained the phylogenetic distance effect in phylogenetically controlled multiple regression analyses. Additionally, milkweed species having a known association with other Tetraopes beetles were better hosts than species lacking Tetraopes herbivores, and milkweeds with specific leaf area values (a trait related to leaf function and habitat affiliation) similar to those of A. syriaca were better hosts than species having divergent values. We thus conclude that phylogenetic distance is an integrated measure of phenotypic and ecological attributes of Asclepias species, especially defensive cardenolides, which can be used to explain specialization and constraints on host shifts over evolutionary time.

  5. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. RAPD analysis for genetic diversity of two populations of Mystus ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-01

    Sep 1, 2009 ... and other aquatic ecosystem and the ecological complexes. ... is a property at the population level while the functional diversity concept ... warm water fish species, which are distributed all over the world. ..... Phylogenetic.

  7. [Phylogenetic diversity and cold-adaptive hydrolytic enzymes of culturable psychrophilic bacteria associated with sea ice from high latitude ocean, Artic].

    Science.gov (United States)

    Yu, Yong; Li, Hui-Rong; Chen, Bo; Zeng, Yin-Xin; He, Jian-Feng

    2006-04-01

    The phylogenetic diversity of culturable psychrophilic bacteria associated with sea ice from high latitude sea (77 degrees 30'N - 81 degrees 12'N), Canadian Basin and Greenland sea Arctic, was investigated. A total of 37 psychrophilic strains were isolated using three different methods of ( i ) spread plate method: 100 microL of each dilution ice-melt sample was spreaded onto the surface of Marine 2216 agar (DIFCO laboratories, Detroit, MI) and incubated for 2 to 6 weeks at 4 degrees C; ( ii ) bath culture and spread plate method: 1 mL of sample was added to 9mL of NSW (unamended natural seawater, 0.2 microm prefiltered and autoclaved) and incubated for 1 months at - 1 degrees C, then spread plate method was used to isolate bacterial strains from the pre-cultured samples; ( iii ) cold shock, bath culture and spread plate method: samples were exposed to - 20 degrees C for 24h, then bacterial strains isolated by bath culture and spread plate method under aerobic conditions. Nearly half of psychrophilic strains are isolated by using method iii . 16S rDNA nearly full-length sequence analysis reveal that psychrophilic strains fall in two phylogenetic divisions, gamma-proteobacteria (in the genera Colwellia, Marinobacter, Shewanella, Thalassomonas, Glaciecola, Marinomonas and Pseudoalteromonas) and Cytophaga-Flexibacter-Bacteroides (in the genera Flavobacterium and Psychroflexus). Nine of bacterial isolates (BSi20007, BSi20497, BSi20517, BSi20537, BSi20170, BSi20001, BSi20002, BSi20675 and BSi20101) quite likely represent novel species (16S rDNA sequence similarity below 97%). One of strains (BSi20002) from Canadian Basin shows 100% sequence similarity to the Antarctic Weddell sea ice isolate Marinobacter sp. ANT8277, suggesting bacteria may have a bipolar distribution at the species level. AF283859 sequences were submitted to the BLAST search program of the National Center for Biotechnology Information website (NCBI, http://www. ncbi. nlm.nih. gov). Twenty sequences

  8. Phylogenetic structure of plant species pools reflects habitat age on the geological time scale

    Czech Academy of Sciences Publication Activity Database

    Lososová, Z.; Šmarda, P.; Chytrý, M.; Purschke, O.; Pyšek, Petr; Sádlo, Jiří; Tichý, L.; Winter, M.

    2015-01-01

    Roč. 26, č. 6 (2015), s. 1080-1089 ISSN 1100-9233 R&D Projects: GA ČR GB14-36079G Grant - others:AV ČR(CZ) AP1002 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:67985939 Keywords : plant communities * phylogenetic diversity * species pool Subject RIV: EH - Ecology, Behaviour Impact factor: 3.151, year: 2015

  9. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  10. Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs.

    Science.gov (United States)

    Amarouche-Yala, Samia; Benouadah, Ali; El Ouahab Bentabet, Abd; López-García, Purificación

    2014-11-01

    Geothermal springs in Algeria have been known since the Roman Empire. They mainly locate in Eastern Algeria and are inhabited by thermophilic organisms, which include cyanobacteria forming mats and concretions. In this work, we have investigated the cyanobacterial diversity of these springs. Cyanobacteria were collected from water, concretions and mats in nine hot springs with water temperatures ranging from 39 to 93 °C. Samples were collected for isolation in culture, microscopic morphological examination, and molecular diversity analysis based on 16S rRNA gene sequences. Nineteen different cyanobacterial morphotypes were identified, the most abundant of which were three species of Leptolyngbya, accompanied by members of the genera Gloeocapsa, Gloeocapsopsis, Stigonema, Fischerella, Synechocystis, Microcoleus, Cyanobacterium, Chroococcus and Geitlerinema. Molecular diversity analyses were in good general agreement with classical identification and allowed the detection of additional species in three springs with temperatures higher than 50 °C. They corresponded to a Synechococcus clade and to relatives of the intracellularly calcifying Candidatus Gloeomargarita lithophora. The hottest springs were dominated by members of Leptolyngbya, Synechococcus-like cyanobacteria and Gloeomargarita, whereas Oscillatoriales other than Leptolyngbya, Chroococcales and Stigonematales dominated lower temperature springs. The isolation of some of these strains sets the ground for future studies on the biology of thermophilic cyanobacteria.

  11. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  12. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D

    2015-05-13

    Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).

  13. Phylogenetic distribution of large-scale genome patchiness

    Directory of Open Access Journals (Sweden)

    Hackenberg Michael

    2008-04-01

    Full Text Available Abstract Background The phylogenetic distribution of large-scale genome structure (i.e. mosaic compositional patchiness has been explored mainly by analytical ultracentrifugation of bulk DNA. However, with the availability of large, good-quality chromosome sequences, and the recently developed computational methods to directly analyze patchiness on the genome sequence, an evolutionary comparative analysis can be carried out at the sequence level. Results The local variations in the scaling exponent of the Detrended Fluctuation Analysis are used here to analyze large-scale genome structure and directly uncover the characteristic scales present in genome sequences. Furthermore, through shuffling experiments of selected genome regions, computationally-identified, isochore-like regions were identified as the biological source for the uncovered large-scale genome structure. The phylogenetic distribution of short- and large-scale patchiness was determined in the best-sequenced genome assemblies from eleven eukaryotic genomes: mammals (Homo sapiens, Pan troglodytes, Mus musculus, Rattus norvegicus, and Canis familiaris, birds (Gallus gallus, fishes (Danio rerio, invertebrates (Drosophila melanogaster and Caenorhabditis elegans, plants (Arabidopsis thaliana and yeasts (Saccharomyces cerevisiae. We found large-scale patchiness of genome structure, associated with in silico determined, isochore-like regions, throughout this wide phylogenetic range. Conclusion Large-scale genome structure is detected by directly analyzing DNA sequences in a wide range of eukaryotic chromosome sequences, from human to yeast. In all these genomes, large-scale patchiness can be associated with the isochore-like regions, as directly detected in silico at the sequence level.

  14. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Species Diversity of Shallow Water Zoanthids (Cnidaria: Anthozoa: Hexacorallia in Florida

    Directory of Open Access Journals (Sweden)

    James Davis Reimer

    2012-01-01

    Full Text Available Shallow water zooxanthellate zoanthids are a common component of the coral reef ecosystems of the Caribbean. Despite this, their species diversity remains poorly understood. In this study, collected Palythoa, Zoanthus, Isaurus, and Terrazoanthus specimens from the waters of Florida were phylogenetically examined to obtain a better understanding of zoanthid species diversity in the Caribbean. Surprisingly, the results from analyses utilizing three DNA markers (mitochondrial 16S ribosomal DNA, cytochrome oxidase subunit I, and the internal transcribed spacer of ribosomal DNA showed the presence of at least eleven species, of which up to four appear undescribed. Additionally, the presence of the genus Terrazoanthus in the Caribbean was confirmed for the first time. Attempts to match phylogenetic species or clades with original literature were hampered by vague and short original descriptions, and it is clear that for Atlantic Palythoa and Zoanthus species an in-depth and multidisciplinary investigation is needed to reconcile recent phylogenetic results such as in this study with traditional taxonomy. Furthermore, most shallow water zoanthid species from Florida were observed to have close, sister-species relationships with previously investigated species in the Pacific Ocean. These results indicate that many brachycnemic zoanthid species likely had a Caribbean-Pacific distribution until the formation of the Isthmus of Panama. However, due to inadvertent redescriptions, overall species diversity in these two common genera is likely much lower than literature indicates.

  16. MHC class II DQB diversity in the Japanese black bear, Ursus thibetanus japonicus

    Science.gov (United States)

    2012-01-01

    Background The major histocompatibility complex (MHC) genes are one of the most important genetic systems in the vertebrate immune response. The diversity of MHC genes may directly influence the survival of individuals against infectious disease. However, there has been no investigation of MHC diversity in the Asiatic black bear (Ursus thibetanus). Here, we analyzed 270-bp nucleotide sequences of the entire exon 2 region of the MHC DQB gene by using 188 samples from the Japanese black bear (Ursus thibetanus japonicus) from 12 local populations. Results Among 185 of 188 samples, we identified 44 MHC variants that encoded 31 different amino acid sequences (allotypes) and one putative pseudogene. The phylogenetic analysis suggests that MHC variants detected from the Japanese black bear are derived from the DQB locus. One of the 31 DQB allotypes, Urth-DQB*01, was found to be common to all local populations. Moreover, this allotype was shared between the black bear on the Asian continent and the Japanese black bear, suggesting that Urth-DQB*01 might have been maintained in the ancestral black bear population for at least 300,000 years. Our findings, from calculating the ratio of non-synonymous to synonymous substitutions, indicate that balancing selection has maintained genetic variation of peptide-binding residues at the DQB locus of the Japanese black bear. From examination of genotype frequencies among local populations, we observed a considerably lower level of observed heterozygosity than expected. Conclusions The low level of observed heterozygosity suggests that genetic drift reduced DQB diversity in the Japanese black bear due to a bottleneck event at the population or species level. The decline of DQB diversity might have been accelerated by the loss of rare variants that have been maintained by negative frequency-dependent selection. Nevertheless, DQB diversity of the black bear appears to be relatively high compared with some other endangered mammalian

  17. MHC class II DQB diversity in the Japanese black bear, Ursus thibetanus japonicus

    Directory of Open Access Journals (Sweden)

    Yasukochi Yoshiki

    2012-11-01

    Full Text Available Abstract Background The major histocompatibility complex (MHC genes are one of the most important genetic systems in the vertebrate immune response. The diversity of MHC genes may directly influence the survival of individuals against infectious disease. However, there has been no investigation of MHC diversity in the Asiatic black bear (Ursus thibetanus. Here, we analyzed 270-bp nucleotide sequences of the entire exon 2 region of the MHC DQB gene by using 188 samples from the Japanese black bear (Ursus thibetanus japonicus from 12 local populations. Results Among 185 of 188 samples, we identified 44 MHC variants that encoded 31 different amino acid sequences (allotypes and one putative pseudogene. The phylogenetic analysis suggests that MHC variants detected from the Japanese black bear are derived from the DQB locus. One of the 31 DQB allotypes, Urth-DQB*01, was found to be common to all local populations. Moreover, this allotype was shared between the black bear on the Asian continent and the Japanese black bear, suggesting that Urth-DQB*01 might have been maintained in the ancestral black bear population for at least 300,000 years. Our findings, from calculating the ratio of non-synonymous to synonymous substitutions, indicate that balancing selection has maintained genetic variation of peptide-binding residues at the DQB locus of the Japanese black bear. From examination of genotype frequencies among local populations, we observed a considerably lower level of observed heterozygosity than expected. Conclusions The low level of observed heterozygosity suggests that genetic drift reduced DQB diversity in the Japanese black bear due to a bottleneck event at the population or species level. The decline of DQB diversity might have been accelerated by the loss of rare variants that have been maintained by negative frequency-dependent selection. Nevertheless, DQB diversity of the black bear appears to be relatively high compared with some other

  18. MHC class II DQB diversity in the Japanese black bear, Ursus thibetanus japonicus.

    Science.gov (United States)

    Yasukochi, Yoshiki; Kurosaki, Toshifumi; Yoneda, Masaaki; Koike, Hiroko; Satta, Yoko

    2012-11-29

    The major histocompatibility complex (MHC) genes are one of the most important genetic systems in the vertebrate immune response. The diversity of MHC genes may directly influence the survival of individuals against infectious disease. However, there has been no investigation of MHC diversity in the Asiatic black bear (Ursus thibetanus). Here, we analyzed 270-bp nucleotide sequences of the entire exon 2 region of the MHC DQB gene by using 188 samples from the Japanese black bear (Ursus thibetanus japonicus) from 12 local populations. Among 185 of 188 samples, we identified 44 MHC variants that encoded 31 different amino acid sequences (allotypes) and one putative pseudogene. The phylogenetic analysis suggests that MHC variants detected from the Japanese black bear are derived from the DQB locus. One of the 31 DQB allotypes, Urth-DQB*01, was found to be common to all local populations. Moreover, this allotype was shared between the black bear on the Asian continent and the Japanese black bear, suggesting that Urth-DQB*01 might have been maintained in the ancestral black bear population for at least 300,000 years. Our findings, from calculating the ratio of non-synonymous to synonymous substitutions, indicate that balancing selection has maintained genetic variation of peptide-binding residues at the DQB locus of the Japanese black bear. From examination of genotype frequencies among local populations, we observed a considerably lower level of observed heterozygosity than expected. The low level of observed heterozygosity suggests that genetic drift reduced DQB diversity in the Japanese black bear due to a bottleneck event at the population or species level. The decline of DQB diversity might have been accelerated by the loss of rare variants that have been maintained by negative frequency-dependent selection. Nevertheless, DQB diversity of the black bear appears to be relatively high compared with some other endangered mammalian species. This result suggests that

  19. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  20. Bird diversity and dissimilarity show contrasting patterns along heavy metal pollution gradients in the Urals, Russia.

    Science.gov (United States)

    Belskii, Eugen A; Mikryukov, Vladimir S

    2018-05-07

    The effects of industrial pollution on bird diversity have been widely studied using traditional diversity measures, which assume all species to be equivalent. We compared species richness and Shannon index with distance-based measures of taxonomic, functional, and phylogenetic diversity (the abundance-weighted mean nearest taxon distances), which describe within-community dissimilarity at terminal branches. Analysis of dissimilarity can shed light on the processes underlying community assembly, i.e., environmental filtering decreases dissimilarity whereas competitive exclusion increases it. In the 2-year study near Karabash and Revda copper smelters in Russia, point counts of nesting birds and habitat descriptions were taken at 10 sites (40 plots) along each pollution gradient. The abundance and diversity of birds showed good repeatability in both regions. The total density of birds, number of species per plot, and Shannon diversity decreased at high toxic load in both regions. The taxonomic, functional, and phylogenetic nearest taxon distances showed the same pattern within regions. Species dissimilarity within communities increased with pollution in Karabash (due to loss of functionally similar species), but did not change in Revda (due to mass replacement of forest species by species of open habitats). Pollution-induced changes in bird communities near Karabash were greater due to the stronger deterioration of the forest ecosystems and less favorable natural conditions (more arid climate, lower diversity and vitality of the tree stand and understorey) compared to Revda. This study emphasizes the need for a multi-level approach to the analysis of bird communities using traditional indices of diversity, functional, taxonomic, or phylogenetic distances between species and environmental variables.

  1. Genome-level comparisons provide insight into the phylogeny and metabolic diversity of species within the genus Lactococcus.

    Science.gov (United States)

    Yu, Jie; Song, Yuqin; Ren, Yan; Qing, Yanting; Liu, Wenjun; Sun, Zhihong

    2017-11-03

    The genomic diversity of different species within the genus Lactococcus and the relationships between genomic differentiation and environmental factors remain unclear. In this study, type isolates of ten Lactococcus species/subspecies were sequenced to assess their genomic characteristics, metabolic diversity, and phylogenetic relationships. The total genome sizes varied between 1.99 (Lactococcus plantarum) and 2.46 megabases (Mb; L. lactis subsp. lactis), and the G + C content ranged from 34.81 (L. lactis subsp. hordniae) to 39.67% (L. raffinolactis) with an average value of 37.02%. Analysis of genome dynamics indicated that the genus Lactococcus has an open pan-genome, while the core genome size decreased with sequential addition at the genus and species group levels. A phylogenetic dendrogram based on the concatenated amino acid sequences of 643 core genes was largely consistent with the phylogenetic tree obtained by 16S ribosomal RNA (rRNA) genes, but it provided a more robust phylogenetic resolution than the 16S rRNA gene-based analysis. Comparative genomics indicated that species in the genus Lactococcus had high degrees of diversity in genome size, gene content, and carbohydrate metabolism. This may be important for the specific adaptations that allow different Lactococcus species to survive in different environments. These results provide a quantitative basis for understanding the genomic and metabolic diversity within the genus Lactococcus, laying the foundation for future studies on taxonomy and functional genomics.

  2. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  3. The Development of Three Long Universal Nuclear Protein-Coding Locus Markers and Their Application to Osteichthyan Phylogenetics with Nested PCR

    Science.gov (United States)

    Zhang, Peng

    2012-01-01

    Background Universal nuclear protein-coding locus (NPCL) markers that are applicable across diverse taxa and show good phylogenetic discrimination have broad applications in molecular phylogenetic studies. For example, RAG1, a representative NPCL marker, has been successfully used to make phylogenetic inferences within all major osteichthyan groups. However, such markers with broad working range and high phylogenetic performance are still scarce. It is necessary to develop more universal NPCL markers comparable to RAG1 for osteichthyan phylogenetics. Methodology/Principal Findings We developed three long universal NPCL markers (>1.6 kb each) based on single-copy nuclear genes (KIAA1239, SACS and TTN) that possess large exons and exhibit the appropriate evolutionary rates. We then compared their phylogenetic utilities with that of the reference marker RAG1 in 47 jawed vertebrate species. In comparison with RAG1, each of the three long universal markers yielded similar topologies and branch supports, all in congruence with the currently accepted osteichthyan phylogeny. To compare their phylogenetic performance visually, we also estimated the phylogenetic informativeness (PI) profile for each of the four long universal NPCL markers. The PI curves indicated that SACS performed best over the whole timescale, while RAG1, KIAA1239 and TTN exhibited similar phylogenetic performances. In addition, we compared the success of nested PCR and standard PCR when amplifying NPCL marker fragments. The amplification success rate and efficiency of the nested PCR were overwhelmingly higher than those of standard PCR. Conclusions/Significance Our work clearly demonstrates the superiority of nested PCR over the conventional PCR in phylogenetic studies and develops three long universal NPCL markers (KIAA1239, SACS and TTN) with the nested PCR strategy. The three markers exhibit high phylogenetic utilities in osteichthyan phylogenetics and can be widely used as pilot genes for

  4. Phylogenetic and Physiological Diversity of Subseafloor Microbial Communities at Axial Seamount, Juan de Fuca Ridge: Summary of Results From the New Millenium Observatory (NeMO), 1998-2004

    Science.gov (United States)

    Baross, J. A.; Huber, J. A.; Mehta, M. P.; Opatkiewicz, A.; Bolton, S. A.; Butterfield, D. A.; Sogin, M. L.; Embley, R. W.

    2005-12-01

    Axial Seamount (45 ° 58' N; 130 ° 00' W) is an active submarine volcano located on the Juan de Fuca Ridge, approximately 300 miles off the coast of Oregon. Lying at the intersection of a seamount chain and a spreading axis, Axial is a unique study site from both the geological and biological perspective. In January of 1998, Axial experienced a week-long series of earthquakes, and subsequent water column and seafloor observations on the southeast portion of the caldera found temperature and chemical anomalies, extensive new seafloor lava flows, large "snow blower" type vents, and other characteristics commonly associated with diking-eruptive events. Due to its high activity and close proximity to shore, Axial was chosen as a site for a multi-year observatory (New Millenium Observatory, NeMO) to document changes and interactions between geology, chemistry, and biology on the mid-ocean ridge system. From 1998 through 2004, we extensively sampled diffuse vents at Axial Seamount to determine the physiological and phylogenetic diversity of subseafloor microbial communities and their relationship to the geochemical environment. Here we present a summary of those studies, including molecular-based phylogenetic surveys of bacteria, archaea, and potential nitrogen-fixing organisms, culturing results of thermophiles and hyperthermophiles from over 20 sites, and the distribution of one particular group of hyperthermophiles at diffuse vents throughout the caldera and how that distribution may be linked to the geochemical habitat. Results indicate that Axial supports a diverse subseafloor microbial community, including hydrogen and sulfur oxidizers, hyperthermophilic methane producers and heterotrophs, and many organisms with the potential to fix nitrogen. In addition, we find that the species composition of the microbial community changes in response to changes in the physical and chemical conditions at each vent site. The extent of seawater mixing with hydrothermal fluids

  5. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  6. Identification and phylogenetic inferences on stocks of sharks affected by the fishing industry off the Northern coast of Brazil

    Directory of Open Access Journals (Sweden)

    Luis Fernando da Silva Rodrigues-Filho

    2009-01-01

    Full Text Available The ongoing decline in abundance and diversity of shark stocks, primarily due to uncontrolled fishery exploitation, is a worldwide problem. An additional problem for the development of conservation and management programmes is the identification of species diversity within a given area, given the morphological similarities among shark species, and the typical disembarkation of processed carcasses which are almost impossible to differentiate. The main aim of the present study was to identify those shark species being exploited off northern Brazil, by using the 12S-16S molecular marker. For this, DNA sequences were obtained from 122 specimens collected on the docks and the fish market in Bragança, in the Brazilian state of Pará. We identified at least 11 species. Three-quarters of the specimens collected were either Carcharhinus porosus or Rhizoprionodon sp, while a notable absence was the daggernose shark, Isogomphodon oxyrhyncus, previously one of the most common species in local catches. The study emphasises the value of molecular techniques for the identification of cryptic shark species, and the potential of the 12S-16S marker as a tool for phylogenetic inferences in a study of elasmobranchs.

  7. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  8. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  9. Competitive interactions between forest trees are driven by species' trait hierarchy, not phylogenetic or functional similarity: implications for forest community assembly.

    Science.gov (United States)

    Kunstler, Georges; Lavergne, Sébastien; Courbaud, Benoît; Thuiller, Wilfried; Vieilledent, Ghislain; Zimmermann, Niklaus E; Kattge, Jens; Coomes, David A

    2012-08-01

    The relative importance of competition vs. environmental filtering in the assembly of communities is commonly inferred from their functional and phylogenetic structure, on the grounds that similar species compete most strongly for resources and are therefore less likely to coexist locally. This approach ignores the possibility that competitive effects can be determined by relative positions of species on a hierarchy of competitive ability. Using growth data, we estimated 275 interaction coefficients between tree species in the French mountains. We show that interaction strengths are mainly driven by trait hierarchy and not by functional or phylogenetic similarity. On the basis of this result, we thus propose that functional and phylogenetic convergence in local tree community might be due to competition-sorting species with different competitive abilities and not only environmental filtering as commonly assumed. We then show a functional and phylogenetic convergence of forest structure with increasing plot age, which supports this view. © 2012 Blackwell Publishing Ltd/CNRS.

  10. Unique Phylogenetic Lineage Found in the Fusarium-like Clade after Re-examining BCCM/IHEM Fungal Culture Collection Material

    Science.gov (United States)

    De Cremer, Koen; Piérard, Denis; Hendrickx, Marijke

    2016-01-01

    Recently, the Fusarium genus has been narrowed based upon phylogenetic analyses and a Fusarium-like clade was adopted. The few species of the Fusarium-like clade were moved to new, re-installed or existing genera or provisionally retained as "Fusarium." Only a limited number of reference strains and DNA marker sequences are available for this clade and not much is known about its actual species diversity. Here, we report six strains, preserved by the Belgian fungal culture collection BCCM/IHEM as a Fusarium species, that belong to the Fusarium-like clade. They showed a slow growth and produced pionnotes, typical morphological characteristics of many Fusarium-like species. Multilocus sequencing with comparative sequence analyses in GenBank and phylogenetic analyses, using reference sequences of type material, confirmed that they were indeed member of the Fusarium-like clade. One strain was identified as "Fusarium" ciliatum whereas another strain was identified as Fusicolla merismoides. The four remaining strains were shown to represent a unique phylogenetic lineage in the Fusarium-like clade and were also found morphologically distinct from other members of the Fusarium-like clade. Based upon phylogenetic considerations, a new genus, Pseudofusicolla gen. nov., and a new species, Pseudofusicolla belgica sp. nov., were installed for this lineage. A formal description is provided in this study. Additional sampling will be required to gather isolates other than the historical strains presented in the present study as well as to further reveal the actual species diversity in the Fusarium-like clade. PMID:27790062

  11. Phylogenetic classification of the world's tropical forests

    DEFF Research Database (Denmark)

    Slik, J. W. Ferry; Franklin, Janet; Arroyo-Rodriguez, Victor

    2018-01-01

    -Pacific counterparts. We also find indications for the existence of a global dry forest region, with representatives in America, Africa, Madagascar, and India. Additionally, a northern-hemisphere Subtropical forest region was identified with representatives in Asia and America, providing support for a link between......Knowledge about the biogeographic affinities of the world's tropical forests helps to better understand regional differences in forest structure, diversity, composition, and dynamics. Such understanding will enable anticipation of region-specific responses to global environmental change. Modern...... phylogenies, in combination with broad coverage of species inventory data, now allow for global biogeographic analyses that take species evolutionary distance into account. Here we present a classification of the world's tropical forests based on their phylogenetic similarity. We identify five principal...

  12. pplacer: linear time maximum-likelihood and Bayesian phylogenetic placement of sequences onto a fixed reference tree

    Directory of Open Access Journals (Sweden)

    Kodner Robin B

    2010-10-01

    Full Text Available Abstract Background Likelihood-based phylogenetic inference is generally considered to be the most reliable classification method for unknown sequences. However, traditional likelihood-based phylogenetic methods cannot be applied to large volumes of short reads from next-generation sequencing due to computational complexity issues and lack of phylogenetic signal. "Phylogenetic placement," where a reference tree is fixed and the unknown query sequences are placed onto the tree via a reference alignment, is a way to bring the inferential power offered by likelihood-based approaches to large data sets. Results This paper introduces pplacer, a software package for phylogenetic placement and subsequent visualization. The algorithm can place twenty thousand short reads on a reference tree of one thousand taxa per hour per processor, has essentially linear time and memory complexity in the number of reference taxa, and is easy to run in parallel. Pplacer features calculation of the posterior probability of a placement on an edge, which is a statistically rigorous way of quantifying uncertainty on an edge-by-edge basis. It also can inform the user of the positional uncertainty for query sequences by calculating expected distance between placement locations, which is crucial in the estimation of uncertainty with a well-sampled reference tree. The software provides visualizations using branch thickness and color to represent number of placements and their uncertainty. A simulation study using reads generated from 631 COG alignments shows a high level of accuracy for phylogenetic placement over a wide range of alignment diversity, and the power of edge uncertainty estimates to measure placement confidence. Conclusions Pplacer enables efficient phylogenetic placement and subsequent visualization, making likelihood-based phylogenetics methodology practical for large collections of reads; it is freely available as source code, binaries, and a web service.

  13. Evolution of Anolis lizard dewlap diversity.

    Directory of Open Access Journals (Sweden)

    Kirsten E Nicholson

    Full Text Available BACKGROUND: The dewlaps of Anolis lizards provide a classic example of a complex signaling system whose function and evolution is poorly understood. Dewlaps are flaps of skin beneath the chin that are extended and combined with head and body movements for visual signals and displays. They exhibit extensive morphological variation and are one of two cladistic features uniting anoles, yet little is known regarding their function and evolution. We quantified the diversity of anole dewlaps, investigated whether dewlap morphology was informative regarding phylogenetic relationships, and tested two separate hypotheses: (A similar Anolis habitat specialists possess similar dewlap configurations (Ecomorph Convergence hypothesis, and (B sympatric species differ in their dewlap morphologies to a greater extent than expected by chance (Species Recognition hypothesis. METHODOLOGY/PRINCIPAL FINDINGS: We found that dewlap configurations (sizes, patterns and colors exhibit substantial diversity, but that most are easily categorized into six patterns that incorporate one to three of 13 recognizable colors. Dewlap morphology is not phylogenetically informative and, like other features of anoles, exhibits convergence in configurations. We found no support for the Ecomorph Convergence hypothesis; species using the same structural habitat were no more similar in dewlap configuration than expected by chance. With one exception, all sympatric species in four communities differ in dewlap configuration. However, this provides only weak support for the Species Recognition hypothesis because, due to the great diversity in dewlap configurations observed across each island, few cases of sympatric species with identical dewlaps would be expected to co-occur by chance alone. CONCLUSIONS/SIGNIFICANCE: Despite previous thought, most dewlaps exhibit easily characterizable patterns and colorations. Nevertheless, dewlap variation is extensive and explanations for the origin and

  14. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  15. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  16. Microtheories for Spatial Data Infrastructures - Accounting for Diversity of Local Conceptualizations at a Global Level

    Science.gov (United States)

    Duce, Stephanie; Janowicz, Krzysztof

    The categorization of our environment into feature types is an essential prerequisite for cartography, geographic information retrieval, routing applications, spatial decision support systems, and data sharing in general. However, there is no a priori conceptualization of the world and the creation of features and types is an act of cognition. Humans conceptualize their environment based on multiple criteria such as their cultural background, knowledge, motivation, and particularly by space and time. Sharing and making these conceptualizations explicit in a formal, unambiguous way is at the core of semantic interoperability. One way to cope with semantic heterogeneities is by standardization, i.e., by agreeing on a shared conceptualization. This bears the danger of losing local diversity. In contrast, this work proposes the use of microtheories for Spatial Data Infrastructures, such as INSPIRE, to account for the diversity of local conceptualizations while maintaining their semantic interoperability at a global level. We introduce a novel methodology to structure ontologies by spatial and temporal aspects, in our case administrative boundaries, which reflect variations in feature conceptualization. A local, bottom-up approach, based on non-standard inference, is used to compute global feature definitions which are neither too broad nor too specific. Using different conceptualizations of rivers and other geographic feature types, we demonstrate how the present approach can improve the INSPIRE data model and ease its adoption by European member states.

  17. Diversity and wiring variability of visual local neurons in the Drosophila medulla M6 stratum.

    Science.gov (United States)

    Chin, An-Lun; Lin, Chih-Yung; Fu, Tsai-Feng; Dickson, Barry J; Chiang, Ann-Shyn

    2014-12-01

    Local neurons in the vertebrate retina are instrumental in transforming visual inputs to extract contrast, motion, and color information and in shaping bipolar-to-ganglion cell transmission to the brain. In Drosophila, UV vision is represented by R7 inner photoreceptor neurons that project to the medulla M6 stratum, with relatively little known of this downstream substrate. Here, using R7 terminals as references, we generated a 3D volume model of the M6 stratum, which revealed a retinotopic map for UV representations. Using this volume model as a common 3D framework, we compiled and analyzed the spatial distributions of more than 200 single M6-specific local neurons (M6-LNs). Based on the segregation of putative dendrites and axons, these local neurons were classified into two families, directional and nondirectional. Neurotransmitter immunostaining suggested a signal routing model in which some visual information is relayed by directional M6-LNs from the anterior to the posterior M6 and all visual information is inhibited by a diverse population of nondirectional M6-LNs covering the entire M6 stratum. Our findings suggest that the Drosophila medulla M6 stratum contains diverse LNs that form repeating functional modules similar to those found in the vertebrate inner plexiform layer. © 2014 Wiley Periodicals, Inc.

  18. Limited Influence of Oxygen on the Evolution of Chemical Diversity in Metabolic Networks

    Directory of Open Access Journals (Sweden)

    Kazuhiro Takemoto

    2013-10-01

    Full Text Available Oxygen is thought to promote species and biomolecule diversity. Previous studies have suggested that oxygen expands metabolic networks by acquiring metabolites with different chemical properties (higher hydrophobicity, for example. However, such conclusions are typically based on biased evaluation, and are therefore non-conclusive. Thus, we re-investigated the effect of oxygen on metabolic evolution using a phylogenetic comparative method and metadata analysis to reduce the bias as much as possible. Notably, we found no difference in metabolic network expansion between aerobes and anaerobes when evaluating phylogenetic relationships. Furthermore, we showed that previous studies have overestimated or underestimated the degrees of differences in the chemical properties (e.g., hydrophobicity between oxic and anoxic metabolites in metabolic networks of unicellular organisms; however, such overestimation was not observed when considering the metabolic networks of multicellular organisms. These findings indicate that the contribution of oxygen to increased chemical diversity in metabolic networks is lower than previously thought; rather, phylogenetic signals and cell-cell communication result in increased chemical diversity. However, this conclusion does not contradict the effect of oxygen on metabolic evolution; instead, it provides a deeper understanding of how oxygen contributes to metabolic evolution despite several limitations in data analysis methods.

  19. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  20. Relating appendicular skeletal variation of sigmodontine rodents to locomotion modes in a phylogenetic context.

    Science.gov (United States)

    Carvalho Coutinho, Ludmilla; Alves de Oliveira, João

    2017-10-01

    Sigmodontinae rodents constitute the second-largest subfamily among mammals. Alongside the taxonomic diversity, they are also ecologically diverse, exhibiting a wide array of locomotion modes, with semifossorial, terrestrial, semiaquatic, scansorial, arboreal, and saltatorial forms. To understand the ecomorphologic aspects that allow these rodents to display such locomotion diversity, we analyzed 35 qualitative characters of the appendicular skeleton (humerus, ulna, radius, scapula, femur, tibia, ilium, ischium and pubis) in 795 specimens belonging to 64 species, 34 genera and 10 tribes, representing all locomotion modes assigned to this subfamily. We performed a statistical analysis based upon the coefficient of trait differentiation to test the congruence of character states and the different locomotion modes. We also mapped characters states in a molecular phylogeny in order to reconstruct ancestral states and to evaluate how appendicular characters evolved within main lineages of Sigmodontinae radiation under a phylogenetic framework. The statistical analyses revealed six characters related to specific locomotion modes, except terrestrial. The mapping and parsimony ancestral states reconstruction identified two characters with phylogenetical signal and eight characters that are exclusively or more frequently recorded in certain modes of locomotion, four of them also detected by the statistical analysis. Notwithstanding the documented morphological variation, few changes characterize the transition to each of the locomotion modes, at least regarding the appendicular skeleton. This finding corroborates previous results that showed that sigmodontines exhibit an all-purpose appendicular morphology that allows them to use and explore a great variety of habitats. © 2017 Anatomical Society.

  1. Antarctic glossopterid diversity on a local scale: the presence of multiple megasporophyll genera, Upper Permian, Mt. Achernar, Transantarctic Mountains, Antarctica.

    Science.gov (United States)

    Ryberg, Patricia E; Taylor, Edith L; Taylor, Thomas N

    2012-09-01

    The glossopterids are a group of plants that thrived during a time of global warming similar to what is happening on the Earth today as well as the transition from archaic plant groups to the ancestors of modern groups. The diversity of the glossopterid clade is based on the megasporangiate structures assigned to the group, because the vegetative and pollen-bearing structures vary little. The presence of numerous reproductive genera from a single Upper Permian locality in the central Transantarctic Mountains provides important data on local glossopterid diversity in Antarctica. Impression/compression fossils were imaged with a Leica 5000C digital camera on a dissecting microscope or a Fujifilm FinePix S1pro digital camera. Two megasporangiate taxa are described: Scutum leiophyllum, which represents the first confirmed record of the genus in Antarctica, and Lidgettoniopsis ramulus, a new morphology consisting of a pinnate structure with oppositely attached megasporophylls. Plumsteadia ovata specimens indicate that this genus can be larger than previously recorded and illustrate the vegetative surface with a distinct midrib. The presence of a laminar, multiovulate structure and a pinnate structure at the same site indicates that local-level glossopterid diversity in Antarctica is greater than previously hypothesized. The discovery of a new megasporophyll morphology in Antarctica (confirming the presence of three distinctive morphologies on the continent) shows that Antarctic glossopterid heterogeneity is on a par with other Gondwanan continents. The diversity of the Antarctic landscape reveals that high polar latitudes can sustain a diverse ecosystem during times of global warming.

  2. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  3. Phylogenetic analysis of HIV-1 pol gene: first subgenomic evidence of CRF29-BF among Iranian HIV-1 patients

    Directory of Open Access Journals (Sweden)

    Kazem Baesi

    2014-09-01

    Full Text Available Objective: To identify the dominant subtype among the HIV-1 strains circulation in Iran. Methods: In this cross sectional study 100 HIV positive patients participated. HIV-1 RNA was extracted from plasma. RT nested-PCR was performed and the final products were sequenced and phylogenetically analyzed; reference sequences were downloaded from Los Alamos, aligned with Iranian pol sequences in the study and analyzed by neighbor-joining method. Results: The results of the phylogenetic analysis showed that HIV-1 subtype CRF-35AD was the dominant subtype among HIV-1 infected patients in Iran; this analysis also suggested a new circulating recombinant form that had not previously been identified in Iran: CRF-29BF. Conclusions: The impact of HIV diversity on pathogenesis, transmission and clinical management have been discussed in different studies; therefore, analyses of HIV genetic diversity is required to design effective antiretroviral strategies for different HIV subtypes.

  4. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  5. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  6. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  7. Assessing genetic diversity and phylogeographic structure of duck ...

    African Journals Online (AJOL)

    In this study, the maternal genetic diversity and phylogenetic relationship of Nigerian duck populations were assessed. A total of 591 base pair fragment of the mitochondrial DNA (mtDNA) D-loop region of 87 indigenous ducks from two populations in Nigeria were analyzed. Seven haplotypes and 70 polymorphic sites were ...

  8. Diversity of total and functional microbiome of anammox reactors fed with complex and synthetic nitrogen-rich wastewaters

    DEFF Research Database (Denmark)

    Gülay, Arda; Pellicer i Nàcher, Carles; Mutlu, Ayten Gizem

    diversity than the bioreactors treating synthetic wastewaters inferred from observed OTUs0.03, Chao1, Shannon index and Phylogenetic distance calculations. Differences in total microbial diversity agreed with the ecological theory concerning the positive correlation between substrate complexity...

  9. Potential link between plant and fungal distributions in a dipterocarp rainforest: community and phylogenetic structure of tropical ectomycorrhizal fungi across a plant and soil ecotone.

    Science.gov (United States)

    Peay, Kabir G; Kennedy, Peter G; Davies, Stuart J; Tan, Sylvester; Bruns, Thomas D

    2010-01-01

    *Relatively little is known about diversity or structure of tropical ectomycorrhizal communities or their roles in tropical ecosystem dynamics. In this study, we present one of the largest molecular studies to date of an ectomycorrhizal community in lowland dipterocarp rainforest. *We sampled roots from two 0.4 ha sites located across an ecotone within a 52 ha forest dynamics plot. Our plots contained > 500 tree species and > 40 species of ectomycorrhizal host plants. Fungi were identified by sequencing ribosomal RNA genes. *The community was dominated by the Russulales (30 species), Boletales (17), Agaricales (18), Thelephorales (13) and Cantharellales (12). Total species richness appeared comparable to molecular studies of temperate forests. Community structure changed across the ecotone, although it was not possible to separate the role of environmental factors vs host plant preferences. Phylogenetic analyses were consistent with a model of community assembly where habitat associations are influenced by evolutionary conservatism of functional traits within ectomycorrhizal lineages. *Because changes in the ectomycorrhizal fungal community parallel those of the tree community at this site, this study demonstrates the potential link between the distribution of tropical tree diversity and the distribution of tropical ectomycorrhizal diversity in relation to local-scale edaphic variation.

  10. Microbial communities of the Lemon Creek Glacier show subtle structural variation yet stable phylogenetic composition over space and time

    Directory of Open Access Journals (Sweden)

    Cody Springer Sheik

    2015-05-01

    Full Text Available Glaciers are geologically important yet transient ecosystems that support diverse, biogeochemically significant microbial communities. During the melt season glaciers undergo dramatic physical, geochemical and biological changes that exert great influence on downstream biogeochemical cycles. Thus, we sought to understand the temporal melt-season dynamics of microbial communities and associated geochemistry at the terminus of Lemon Creek Glacier (LCG in coastal southern Alaska. Due to late season snowfall, sampling of LCG occurred in three interconnected areas: proglacial Lake Thomas, the lower glacial outflow stream and the glacier’s terminus. LCG associated microbial communities were phylogenetically diverse and varied by sampling location. However, Betaproteobacteria, Alphaproteobacteria and Bacteroidetes dominated communities at all sampling locations. Strict anaerobic groups such as methanogens, SR1, and OP11 were also recovered from glacier outflows, indicating anoxic conditions in at least some portions of the LCG subglacial environment. Microbial community structure was significantly correlated with sampling location and sodium concentrations. Microbial communities sampled from terminus outflow waters exhibited day-to-day fluctuation in taxonomy and phylogenetic similarity. However, these communities were not significantly different from randomly constructed communities from all three sites. These results indicate that glacial outflows share a large proportion of phylogenetic overlap with downstream environments and that the observed significant shifts in community structure are driven by changes in relative abundance of different taxa, and not complete restructuring of communities. We conclude that LCG glacial discharge hosts a diverse and relatively stable microbiome that shifts at fine taxonomic scales in response to geochemistry and likely water residence time.

  11. The Hidden Diversity of Zanclea Associated with Scleractinians Revealed by Molecular Data

    KAUST Repository

    Montano, Simone; Maggioni, Davide; Arrigoni, Roberto; Seveso, Davide; Puce, Stefania; Galli, Paolo

    2015-01-01

    focus on the genetic diversity among Zanclea specimens associated with 13 scleractinian genera. The monophyly of Zanclea associated with scleractinians was strongly supported in all nuclear and mitochondrial phylogenetic reconstructions. Furthermore, a

  12. Characterization of bud emergence 46 (BEM46) protein: Sequence, structural, phylogenetic and subcellular localization analyses

    International Nuclear Information System (INIS)

    Kumar, Abhishek; Kollath-Leiß, Krisztina; Kempken, Frank

    2013-01-01

    Highlights: •All eukaryotes have at least a single copy of a bem46 ortholog. •The catalytic triad of BEM46 is illustrated using sequence and structural analysis. •We identified indels in the conserved domain of BEM46 protein. •Localization studies of BEM46 protein were carried out using GFP-fusion tagging. -- Abstract: The bud emergence 46 (BEM46) protein from Neurospora crassa belongs to the α/β-hydrolase superfamily. Recently, we have reported that the BEM46 protein is localized in the perinuclear ER and also forms spots close by the plasma membrane. The protein appears to be required for cell type-specific polarity formation in N. crassa. Furthermore, initial studies suggested that the BEM46 amino acid sequence is conserved in eukaryotes and is considered to be one of the widespread conserved “known unknown” eukaryotic genes. This warrants for a comprehensive phylogenetic analysis of this superfamily to unravel origin and molecular evolution of these genes in different eukaryotes. Herein, we observe that all eukaryotes have at least a single copy of a bem46 ortholog. Upon scanning of these proteins in various genomes, we find that there are expansions leading into several paralogs in vertebrates. Usingcomparative genomic analyses, we identified insertion/deletions (indels) in the conserved domain of BEM46 protein, which allow to differentiate fungal classes such as ascomycetes from basidiomycetes. We also find that exonic indels are able to differentiate BEM46 homologs of different eukaryotic lineage. Furthermore, we unravel that BEM46 protein from N. crassa possess a novel endoplasmic-retention signal (PEKK) using GFP-fusion tagging experiments. We propose that three residues namely a serine 188S, a histidine 292H and an aspartic acid 262D are most critical residues, forming a catalytic triad in BEM46 protein from N. crassa. We carried out a comprehensive study on bem46 genes from a molecular evolution perspective with combination of functional

  13. Characterization of bud emergence 46 (BEM46) protein: Sequence, structural, phylogenetic and subcellular localization analyses

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Abhishek; Kollath-Leiß, Krisztina; Kempken, Frank, E-mail: fkempken@bot.uni-kiel.de

    2013-08-30

    Highlights: •All eukaryotes have at least a single copy of a bem46 ortholog. •The catalytic triad of BEM46 is illustrated using sequence and structural analysis. •We identified indels in the conserved domain of BEM46 protein. •Localization studies of BEM46 protein were carried out using GFP-fusion tagging. -- Abstract: The bud emergence 46 (BEM46) protein from Neurospora crassa belongs to the α/β-hydrolase superfamily. Recently, we have reported that the BEM46 protein is localized in the perinuclear ER and also forms spots close by the plasma membrane. The protein appears to be required for cell type-specific polarity formation in N. crassa. Furthermore, initial studies suggested that the BEM46 amino acid sequence is conserved in eukaryotes and is considered to be one of the widespread conserved “known unknown” eukaryotic genes. This warrants for a comprehensive phylogenetic analysis of this superfamily to unravel origin and molecular evolution of these genes in different eukaryotes. Herein, we observe that all eukaryotes have at least a single copy of a bem46 ortholog. Upon scanning of these proteins in various genomes, we find that there are expansions leading into several paralogs in vertebrates. Usingcomparative genomic analyses, we identified insertion/deletions (indels) in the conserved domain of BEM46 protein, which allow to differentiate fungal classes such as ascomycetes from basidiomycetes. We also find that exonic indels are able to differentiate BEM46 homologs of different eukaryotic lineage. Furthermore, we unravel that BEM46 protein from N. crassa possess a novel endoplasmic-retention signal (PEKK) using GFP-fusion tagging experiments. We propose that three residues namely a serine 188S, a histidine 292H and an aspartic acid 262D are most critical residues, forming a catalytic triad in BEM46 protein from N. crassa. We carried out a comprehensive study on bem46 genes from a molecular evolution perspective with combination of functional

  14. Phylogeny and palm diversity across scales

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Svenning, J.-C.; Baker, William J.

    spatial scales. Among others, we ask the following questions: To what extent can niche conservatism explain large-scale distribution patterns? Which assembly mechanisms are responsible for palm community composition on different spatial scales? What is the role of phylogenetic history for spatial patterns...... clustering. On a continental scale in the New World, we inferred from phylogenetic turnover that palms diversified mainly within seven biogeographic regions. This pattern of in situ diversification is strongly driven by a combination of phylogenetic niche conservatism, environmental filtering and dispersal...... limitation. Niche conservatism with respect to temperature seasonality and extremes emerges as an important determinant of palm species and clade distributions and thus there is concern that palms might be considerably vulnerable to climate change. On a regional to local scale in the Western Amazon...

  15. Phylogeny and phylogenetic classification of the antbirds, ovenbirds, woodcreepers, and allies (Aves: Passeriformes: Infraorder Furnariides)

    Science.gov (United States)

    Moyle, R.G.; Chesser, R.T.; Brumfield, R.T.; Tello, J.G.; Marchese, D.J.; Cracraft, J.

    2009-01-01

    The infraorder Furnariides is a diverse group of suboscine passerine birds comprising a substantial component of the Neotropical avifauna. The included species encompass a broad array of morphologies and behaviours, making them appealing for evolutionary studies, but the size of the group (ca. 600 species) has limited well-sampled higher-level phylogenetic studies. Using DNA sequence data from the nuclear RAG-1 and RAG-2 exons, we undertook a phylogenetic analysis of the Furnariides sampling 124 (more than 88%) of the genera. Basal relationships among family-level taxa differed depending on phylogenetic method, but all topologies had little nodal support, mirroring the results from earlier studies in which discerning relationships at the base of the radiation was also difficult. In contrast, branch support for family-rank taxa and for many relationships within those clades was generally high. Our results support the Melanopareidae and Grallariidae as distinct from the Rhinocryptidae and Formicariidae, respectively. Within the Furnariides our data contradict some recent phylogenetic hypotheses and suggest that further study is needed to resolve these discrepancies. Of the few genera represented by multiple species, several were not monophyletic, indicating that additional systematic work remains within furnariine families and must include dense taxon sampling. We use this study as a basis for proposing a new phylogenetic classification for the group and in the process erect new family-group names for clades having high branch support across methods. ?? 2009 The Willi Hennig Society.

  16. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  17. "Time Flies in California": Multiliteracies Bridging Local Diversity and Global Connectedness through a "Reggio"-Inspired Approach

    Science.gov (United States)

    Hesterman, Sandra

    2017-01-01

    A pedagogy of multiliteracies is based on the theoretical perspective that in order to find our way around our mass media, multimedia and electronic hypermedia communication environments and accommodate the realities of increasing local diversity and global connectedness, a broadened definition of literacy is required. New ways of making sense of…

  18. Tree-Based Unrooted Phylogenetic Networks.

    Science.gov (United States)

    Francis, A; Huber, K T; Moulton, V

    2018-02-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.

  19. Evolution of feeding specialization in Tanganyikan scale-eating cichlids: a molecular phylogenetic approach

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-10-01

    Full Text Available Abstract Background Cichlid fishes in Lake Tanganyika exhibit remarkable diversity in their feeding habits. Among them, seven species in the genus Perissodus are known for their unique feeding habit of scale eating with specialized feeding morphology and behaviour. Although the origin of the scale-eating habit has long been questioned, its evolutionary process is still unknown. In the present study, we conducted interspecific phylogenetic analyses for all nine known species in the tribe Perissodini (seven Perissodus and two Haplotaxodon species using amplified fragment length polymorphism (AFLP analyses of the nuclear DNA. On the basis of the resultant phylogenetic frameworks, the evolution of their feeding habits was traced using data from analyses of stomach contents, habitat depths, and observations of oral jaw tooth morphology. Results AFLP analyses resolved the phylogenetic relationships of the Perissodini, strongly supporting monophyly for each species. The character reconstruction of feeding ecology based on the AFLP tree suggested that scale eating evolved from general carnivorous feeding to highly specialized scale eating. Furthermore, scale eating is suggested to have evolved in deepwater habitats in the lake. Oral jaw tooth shape was also estimated to have diverged in step with specialization for scale eating. Conclusion The present evolutionary analyses of feeding ecology and morphology based on the obtained phylogenetic tree demonstrate for the first time the evolutionary process leading from generalised to highly specialized scale eating, with diversification in feeding morphology and behaviour among species.

  20. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago.

    Science.gov (United States)

    Vasconcelos, Raquel; Montero-Mendieta, Santiago; Simó-Riudalbas, Marc; Sindaco, Roberto; Santos, Xavier; Fasola, Mauro; Llorente, Gustavo; Razzetti, Edoardo; Carranza, Salvador

    2016-01-01

    Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot) and the conservation interest of its reptile fauna (94% endemics), we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra's most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8-54.4%. This has implications in the species' ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs), cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework.

  1. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago.

    Directory of Open Access Journals (Sweden)

    Raquel Vasconcelos

    Full Text Available Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot and the conservation interest of its reptile fauna (94% endemics, we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra's most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8-54.4%. This has implications in the species' ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs, cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework.

  2. Phylogenetic Diversity in Core Region of Hepatitis C Virus Genotype 1a as a Factor Associated with Fibrosis Severity in HIV-1-Coinfected Patients

    Directory of Open Access Journals (Sweden)

    Micaela Parra

    2017-01-01

    Full Text Available High hepatitis C virus (HCV genetic diversity impacts infectivity/pathogenicity, influencing chronic liver disease progression associated with fibrosis degrees and hepatocellular carcinoma. HCV core protein is crucial in cell-growth regulation and host-gene expression. Liver fibrosis is accelerated by unknown mechanisms in human immunodeficiency virus-1- (HIV-1- coinfected individuals. We aimed to study whether well-defined HCV-1a core polymorphisms and genetic heterogeneity are related to fibrosis in a highly homogeneous group of interferon-treated HIV-HCV-coinfected patients. Genetic heterogeneity was weighed by Faith’s phylogenetic diversity (PD, which has been little studied in HCV. Eighteen HCV/HIV-coinfected patients presenting different liver fibrosis stages before anti-HCV treatment-initiation were recruited. Sampling at baseline and during and after treatment was performed up to 72 weeks. At inter/intrahost level, HCV-1a populations were studied using molecular cloning and Sanger sequencing. Over 400 complete HCV-1a core sequences encompassing 573 positions of C were obtained. Amino acid substitutions found previously at positions 70 and 91 of HCV-1b core region were not observed. However, HCV genetic heterogeneity was higher in mild than in severe fibrosis cases. These results suggest a potential utility of PD as a virus-related factor associated with chronic hepatitis C progression. These observations should be reassessed in larger cohorts to corroborate our findings and assess other potential covariates.

  3. Photobiont diversity in lichens from metal-rich substrata based on ITS rDNA sequences.

    Science.gov (United States)

    Backor, Martin; Peksa, Ondrej; Skaloud, Pavel; Backorová, Miriam

    2010-05-01

    The photobiont is considered as the more sensitive partner of lichen symbiosis in metal pollution. For this reason the presence of a metal tolerant photobiont in lichens may be a key factor of ecological success of lichens growing on metal polluted substrata. The photobiont inventory was examined for terricolous lichen community growing in Cu mine-spoil heaps derived by historical mining. Sequences of internal transcribed spacer (ITS) were phylogenetically analyzed using maximum likelihood analyses. A total of 50 ITS algal sequences were obtained from 22 selected lichen taxa collected at three Cu mine-spoil heaps and two control localities. Algae associated with Cladonia and Stereocaulon were identified as members of several Asterochloris lineages, photobionts of cetrarioid lichens clustered with Trebouxia hypogymniae ined. We did not find close relationship between heavy metal content (in localities as well as lichen thalli) and photobiont diversity. Presence of multiple algal genotypes in single lichen thallus has been confirmed. Copyright 2009 Elsevier Inc. All rights reserved.

  4. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  5. The local knowledge of medicinal plants trader and diversity of medicinal plants in the Kabanjahe traditional market, North Sumatra, Indonesia.

    Science.gov (United States)

    Silalahi, Marina; Nisyawati; Walujo, Eko Baroto; Supriatna, Jatna; Mangunwardoyo, Wibowo

    2015-12-04

    Market is the main place for transactions of medicinal plants and traditional ingredients by local community in the Karo regency, North Sumatra, Indonesia. This is the first study to document the local knowledge of traders on and the diversity of the medicinal plants. The investigation was carried out in the Kabanjahe traditional market, in the Karo regency. The research goal was to reveal the local knowledge, diversity and utilization of medicinal plants, which have been traded in the Kabanjahe traditional market, as a basis for conservation efforts. The study was conducted through ethnobotanical approach using market surveys. All traders of medicinal plants were surveyed applying in-depth interviews and participative observations. Data were analyzed qualitatively using descriptive statistics. The diversity of medicinal plants was expressed in term of the Shannon-Wiener diversity index (H'), whereas the similarity among traders was indicated by Jaccard index (Ji). Traders of medicinal plants stored the simplicia of medicinal plants in chest of drawers, plastic baskets, plastic bags, and in the air by suspending them from the the stall ceilings. We recorded 344 species, 217 genera and 90 families of medicinal plants. Those that were sold mostly belong to Zingeberaceae (20 species), Poaceae (19 species), and Asclepiadaceae (17 species), and the species received high consumers demand, mostly belong to Zingiberaceae, Rutaceae, and Asclepidiaceae. Asclepidiaceae was used to treat diseases like cancer and heart problems. The Shannon-Wiener diversity index of medicinal plants at the Kabanjahe traditional market was high (H'= 5.637). The high Jaccard similarity index (Ji>0.56) suggested that the traders were trading similar species of medicinal plants. Kabanjahe traditional market is the center for the sale of of medicinal plants as traditional ingredients. Several species are well known for their pharmacological properties but others, [such as: Dischidia imbricata (Blume

  6. Environmental constraints on the compositional and phylogenetic beta-diversity of tropical forest snake assemblages.

    Science.gov (United States)

    Moura, Mario R; Costa, Henrique C; Argôlo, Antônio J S; Jetz, Walter

    2017-09-01

    The ongoing biodiversity crisis increases the importance and urgency of studies addressing the role of environmental variation on the composition and evolutionary history of species assemblages, but especially the tropics and ectotherms remain understudied. In regions with rainy summers, coexistence of tropical ectothermic species may be determined by the partitioning of the climatic niche, as ectotherms can rely on water availability and thermoregulatory behaviour to buffer constraints along their climatic niche. Conversely, tropical ectotherms facing dry summers would have fewer opportunities to climatic niche partitioning and other processes rather than environmental filtering would mediate species coexistence. We used 218 snake assemblages to quantify the compositional (CBD) and phylogenetic (PBD) beta-diversity of snakes in the Atlantic Forest (AF) hotspot, South America. We identify two AF regions with distinct climatological regimes: dry summers in the northern-AF and rainy summers in the southern-AF. While accounting for the influence of multiscale spatial processes, we disentangle the relative contribution of thermal, water-related and topographic conditions in structuring the CBD and PBD of snake assemblages, and determine the extent in which snake assemblages under distinct climatological regimes are affected by environmental filtering. Thermal conditions best explain CBD and PBD of snakes for the whole AF, whereas water-related factors best explain the structure of snake assemblages within a same climatological regime. CBD and PBD patterns are similarly explained by spatial factors but snake assemblages facing dry summers are more affected by spatial processes operating at fine to intermediate spatial scale, whereas those assemblages in regions with rainy summers have a stronger signature of coarse-scale processes. As expected, environmental filtering plays a stronger role in southern-AF than northern-AF, and the synergism between thermal and water

  7. Ant-Based Phylogenetic Reconstruction (ABPR: A new distance algorithm for phylogenetic estimation based on ant colony optimization

    Directory of Open Access Journals (Sweden)

    Karla Vittori

    2008-12-01

    Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.

  8. Species Diversity of Shallow Water Zoanthids (Cnidaria: Anthozoa: Hexacorallia) in Florida

    OpenAIRE

    Reimer, James Davis; Foord, Colin; Irei, Yuka

    2012-01-01

    Shallow water zooxanthellate zoanthids are a common component of the coral reef ecosystems of the Caribbean. Despite this, their species diversity remains poorly understood. In this study, collected Palythoa, Zoanthus, Isaurus, and Terrazoanthus specimens from the waters of Florida were phylogenetically examined to obtain a better understanding of zoanthid species diversity in the Caribbean. Surprisingly, the results from analyses utilizing three DNA markers (mitochondrial 16S ribosomal DNA, ...

  9. Highly structured genetic diversity of the Mycobacterium tuberculosis population in Djibouti.

    Science.gov (United States)

    Godreuil, S; Renaud, F; Choisy, M; Depina, J J; Garnotel, E; Morillon, M; Van de Perre, P; Bañuls, A L

    2010-07-01

    Djibouti is an East African country with a high tuberculosis incidence. This study was conducted over a 2-month period in Djibouti, during which 62 consecutive patients with pulmonary tuberculosis (TB) were included. Genetic characterization of Mycobacterium tuberculosis, using mycobacterial interspersed repetitive-unit variable-number tandem-repeat typing and spoligotyping, was performed. The genetic and phylogenetic analysis revealed only three major families (Central Asian, East African Indian and T). The high diversity and linkage disequilibrium within each family suggest a long period of clonal evolution. A Bayesian approach shows that the phylogenetic structure observed in our sample of 62 isolates is very likely to be representative of the phylogenetic structure of the M. tuberculosis population in the total number of TB cases.

  10. The effect of soil habitat connectivity on microbial interactions, community structure and diversity: a microcosm-based approach

    NARCIS (Netherlands)

    Wolf, A.B.

    2014-01-01

    Soils contain tremendous microbial phylogenetic and functional diversity. Recent advances in the application of molecular methods into microbial ecology have provided a new appreciation of the extent of soil-borne microbial diversity, but our understanding of the forces that shape and maintain this

  11. Genetic diversity and temporal variation of the marine Synechococcus community in the subtropical coastal waters of Hong Kong.

    Science.gov (United States)

    Jing, Hongmei; Zhang, Rui; Pointing, Stephen B; Liu, Hongbin; Qian, Peiyuan

    2009-03-01

    The phylogenetic diversity of the marine Synechococcus community in the subtropical coastal waters of Hong Kong, China, was examined through intergenic transcribed spacer clone libraries. All the sequences obtained fell within both marine cluster A (MC-A) and B (MC-B), with MC-A phylotypes dominating throughout the year. Distinct phylogenetic lineages specific to Hong Kong waters were detected from both MC-A and MC-B. The highest Synechococcus community diversity occurred in December, but the highest Synechococcus abundance occurred in August. On the other hand, both the abundance and diversity of Synechococcus showed a minimum in February. The remarkable seasonal variations of Synechococcus diversity observed were likely the result of the changes of hydrographic condition modulated by monsoons. Principal component analysis revealed that the in situ abiotic water characteristics, especially salinity and water turbidity, explained much of the variability of the marine Synechococcus population diversity in Hong Kong coastal waters. In addition, the temporal changes of Synechococcus abundance were largely driven by water temperature.

  12. Phylogenetic analysis and antifouling potentials of culturable fungi in mangrove sediments from Techeng Isle, China.

    Science.gov (United States)

    Zhang, Xiao-Yong; Fu, Wen; Chen, Xiao; Yan, Mu-Ting; Huang, Xian-De; Bao, Jie

    2018-06-09

    To search for more microbial resources for screening environment-friendly antifoulants, we investigated the phylogenetic diversity and antifouling potentials of culturable fungi in mangrove sediments from Techeng Isle, China. A total of 176 isolates belonging to 57 fungal taxa were recovered and identified. The high levels of diversity and abundance of mangrove fungi from Techeng Isle were in accordance with previous studies on fungi from other mangrove ecosystems. Fifteen of the 176 isolates demonstrated high divergence (87-93%) from the known fungal taxa in GenBank. Moreover, 26 isolates recorded in mangrove ecosystems for the first time. These results suggested that mangrove sediments from Techeng Isle harbored some new fungal communities compared with other mangrove ecosystems. The antifouling activity of 57 representative isolates (belonging to 57 different fungal taxa) was tested against three marine bacteria (Loktanella hongkongensis, Micrococcus luteus and Pseudoalteromonas piscida) and two marine macrofoulers (bryozoan Bugula neritina and barnacle Balanus amphitrite). Approximately 40% of the tested isolates displayed distinct antifouling activity. Furthermore, 17 fungal isolates were found to display strong or a wide spectrum of antifouling activity in this study, suggesting that these isolates deserve further study as potential sources of novel antifouling metabolites. To our knowledge, this is the first report on the investigation of the phylogenetic diversity and antifouling potential of culturable fungi in mangrove sediments from Techeng Isle, China. These results contribute to our knowledge of mangrove fungi and further increases the pool of fungi available for natural bioactive product screening.

  13. Genetic characterization and phylogenetic analysis of porcine circovirus type 2 (PCV2) in Serbia.

    Science.gov (United States)

    Savic, Bozidar; Milicevic, Vesna; Jakic-Dimic, Dobrila; Bojkovski, Jovan; Prodanovic, Radisa; Kureljusic, Branislav; Potkonjak, Aleksandar; Savic, Borivoje

    2012-01-01

    Porcine circovirus type 2 (PCV2) is the main causative agent of postweaning multisystemic wasting syndrome (PMWS). To characterize and determine the genetic diversity of PCV2 in the porcine population of Serbia, nucleotide and deduced amino acid sequences of the open reading frame 2 (ORF2) of PCV2 collected from the tissues of pigs that either had died as a result of PMWS or did not exhibit disease symptoms were analyzed. Sequencing and phylogenetic analysis showed considerable diversity among PCV2 ORF2 sequences and the existence of two main PCV2 genotypes, PCV2b and PCV2a, with at least three clusters, 1A/B, 1C and 2D. In order to provide further proof that the 1C strain is circulating in the porcine population, the whole viral genome of one PCV2 isolate was sequenced. Genotyping and phylogenetic analysis using the entire viral genome sequences confirmed that there was a PMWS-associated 1C strain emerging in Serbia. Our analysis also showed that PCV2b is dominant in the porcine population, and that it is exclusively associated with PMWS occurrences in the country. These data constitute a useful basis for further epidemiological studies regarding the heterogeneity of PCV2 strains on the European continent.

  14. Genetic diversity and structure of elite cotton germplasm (Gossypium hirsutum L.) using genome-wide SNP data.

    Science.gov (United States)

    Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing

    2017-10-01

    Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.

  15. Epidemic disease decimates amphibian abundance, species diversity, and evolutionary history in the highlands of central Panama.

    Science.gov (United States)

    Crawford, Andrew J; Lips, Karen R; Bermingham, Eldredge

    2010-08-03

    Amphibian populations around the world are experiencing unprecedented declines attributed to a chytrid fungal pathogen, Batrachochytrium dendrobatidis. Despite the severity of the crisis, quantitative analyses of the effects of the epidemic on amphibian abundance and diversity have been unavailable as a result of the lack of equivalent data collected before and following disease outbreak. We present a community-level assessment combining long-term field surveys and DNA barcode data describing changes in abundance and evolutionary diversity within the amphibian community of El Copé, Panama, following a disease epidemic and mass-mortality event. The epidemic reduced taxonomic, lineage, and phylogenetic diversity similarly. We discovered that 30 species were lost, including five undescribed species, representing 41% of total amphibian lineage diversity in El Copé. These extirpations represented 33% of the evolutionary history of amphibians within the community, and variation in the degree of population loss and decline among species was random with respect to the community phylogeny. Our approach provides a fast, economical, and informative analysis of loss in a community whether measured by species or phylogenetic diversity.

  16. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  17. Polyphasic characterization of Trichocoleus desertorum sp. nov. (Pseudanabaenales, Cyanobacteria) from desert soils and phylogenetic placement of the genus Trichocoleus

    Science.gov (United States)

    Radka Muhlsteinova; Jeffrey R. Johansen; Nicole Pietrasiak; Michael P. Martin; Karina Osorio-Santos; Steven D. Warren

    2014-01-01

    Little is known about the taxonomic diversity of cyanobacteria in deserts, despite their important ecological roles in these ecosystems. In this study, cyanobacterial strains from the Atacama, Colorado, and Mojave Deserts were isolated and characterized using molecular, morphological, and ecological information. Phylogenetic placement of these strains was revealed...

  18. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  19. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  20. Assessing the diversity, host-specificity and infection patterns of apicomplexan parasites in reptiles from Oman, Arabia.

    Science.gov (United States)

    Maia, João P; Harris, D James; Carranza, Salvador; Goméz-Díaz, Elena

    2016-11-01

    Understanding the processes that shape parasite diversification, their distribution and abundance provides valuable information on the dynamics and evolution of disease. In this study, we assessed the diversity, distribution, host-specificity and infection patterns of apicomplexan parasites in amphibians and reptiles from Oman, Arabia. Using a quantitative PCR approach we detected three apicomplexan parasites (haemogregarines, lankesterellids and sarcocystids). A total of 13 haemogregarine haplotypes were identified, which fell into four main clades in a phylogenetic framework. Phylogenetic analysis of six new lankesterellid haplotypes revealed that these parasites were distinct from, but phylogenetically related to, known Lankesterella species and might represent new taxa. The percentage of infected hosts (prevalence) and the number of haemogregarines in the blood (parasitaemia) varied significantly between gecko species. We also found significant differences in parasitaemia between haemogregarine parasite lineages (defined by phylogenetic clustering of haplotypes), suggesting differences in host-parasite compatibility between these lineages. For Pristurus rupestris, we found significant differences in haemogregarine prevalence between geographical areas. Our results suggest that host ecology and host relatedness may influence haemogregarine distributions and, more generally, highlight the importance of screening wild hosts from remote regions to provide new insights into parasite diversity.

  1. Genomic Diversity and Evolution of the Lyssaviruses

    Science.gov (United States)

    Delmas, Olivier; Holmes, Edward C.; Talbi, Chiraz; Larrous, Florence; Dacheux, Laurent; Bouchier, Christiane; Bourhy, Hervé

    2008-01-01

    Lyssaviruses are RNA viruses with single-strand, negative-sense genomes responsible for rabies-like diseases in mammals. To date, genomic and evolutionary studies have most often utilized partial genome sequences, particularly of the nucleoprotein and glycoprotein genes, with little consideration of genome-scale evolution. Herein, we report the first genomic and evolutionary analysis using complete genome sequences of all recognised lyssavirus genotypes, including 14 new complete genomes of field isolates from 6 genotypes and one genotype that is completely sequenced for the first time. In doing so we significantly increase the extent of genome sequence data available for these important viruses. Our analysis of these genome sequence data reveals that all lyssaviruses have the same genomic organization. A phylogenetic analysis reveals strong geographical structuring, with the greatest genetic diversity in Africa, and an independent origin for the two known genotypes that infect European bats. We also suggest that multiple genotypes may exist within the diversity of viruses currently classified as ‘Lagos Bat’. In sum, we show that rigorous phylogenetic techniques based on full length genome sequence provide the best discriminatory power for genotype classification within the lyssaviruses. PMID:18446239

  2. Genomic diversity and evolution of the lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Olivier Delmas

    2008-04-01

    Full Text Available Lyssaviruses are RNA viruses with single-strand, negative-sense genomes responsible for rabies-like diseases in mammals. To date, genomic and evolutionary studies have most often utilized partial genome sequences, particularly of the nucleoprotein and glycoprotein genes, with little consideration of genome-scale evolution. Herein, we report the first genomic and evolutionary analysis using complete genome sequences of all recognised lyssavirus genotypes, including 14 new complete genomes of field isolates from 6 genotypes and one genotype that is completely sequenced for the first time. In doing so we significantly increase the extent of genome sequence data available for these important viruses. Our analysis of these genome sequence data reveals that all lyssaviruses have the same genomic organization. A phylogenetic analysis reveals strong geographical structuring, with the greatest genetic diversity in Africa, and an independent origin for the two known genotypes that infect European bats. We also suggest that multiple genotypes may exist within the diversity of viruses currently classified as 'Lagos Bat'. In sum, we show that rigorous phylogenetic techniques based on full length genome sequence provide the best discriminatory power for genotype classification within the lyssaviruses.

  3. Herbarium collection-based phylogenetics of the ragweeds (Ambrosia, Asteraceae).

    Science.gov (United States)

    Martin, Michael D; Quiroz-Claros, Elva; Brush, Grace S; Zimmer, Elizabeth A

    2018-03-01

    Ambrosia (Asteraceae) is a taxonomically difficult genus of weedy, wind-pollinated plants with an apparent center of diversity in the Sonoran Desert of North America. Determining Ambrosia's evolutionary relationships has been the subject of much interest, with numerous studies using morphological characters, cytology, comparative phytochemistry, and chloroplast restriction site variation to produce conflicting accounts the relationships between Ambrosia species, as well as the classification of their close relatives in Franseria and Hymenoclea. To resolve undetermined intra-generic relationships within Ambrosia, we used DNA extracted from tissues obtained from seed banks and herbarium collections to generate multi-locus genetic data representing nearly all putative species, including four from South America. We performed Bayesian and Maximum-Likelihood phylogenetic analyses of six chloroplast-genome and two nuclear-genome markers, enabling us to infer monophyly for the genus, resolve major infra-generic species clusters, as well as to resolve open questions about the evolutionary relationships of several Ambrosia species and former members of Franseria. We also provide molecular data supporting the hypothesis that A. sandersonii formed through the hybridization of A. eriocentra and A. salsola. The topology of our chloroplast DNA phylogeny is almost entirely congruent with the most recent molecular work based on chloroplast restriction site variation of a much more limited sampling of 14 North American species of Ambrosia, although our improved sampling of global Ambrosia diversity enables us to draw additional conclusions. As our study is the first direct DNA sequence-based phylogenetic analyses of Ambrosia, we analyze the data in relation to previous taxonomic studies and discuss several instances of chloroplast/nuclear incongruence that leave the precise geographic center of origin of Ambrosia in question. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Phylogenetic heritability of geographic range size in haematophagous ectoparasites: time of divergence and variation among continents.

    Science.gov (United States)

    Krasnov, Boris R; Shenbrot, Georgy I; van der Mescht, Luther; Warburton, Elizabeth M; Khokhlova, Irina S

    2018-04-12

    To understand existence, patterns and mechanisms behind phylogenetic heritability in the geographic range size (GRS) of parasites, we measured phylogenetic signal (PS) in the sizes of both regional (within a region) and continental (within a continent) geographic ranges of fleas in five regions. We asked whether (a) GRS is phylogenetically heritable and (b) the manifestation of PS varies between regions. We also asked whether geographic variation in PS reflects the effects of the environment's spatiotemporal stability (e.g. glaciation disrupting geographic ranges) or is associated with time since divergence (accumulation differences among species over time). Support for the former hypothesis would be indicated by stronger PS in southern than in northern regions, whereas support for the latter hypothesis would be shown by stronger PS in regions with a large proportion of species belonging to the derived lineages than in regions with a large proportion of species belonging to the basal lineages. We detected significant PS in both regional and continental GRSs of fleas from Canada and in continental GRS of fleas from Mongolia. No PS was found in the GRS of fleas from Australia and Southern Africa. Venezuelan fleas demonstrated significant PS in regional GRS only. Local Indicators of Phylogenetic Association detected significant local positive autocorrelations of GRS in some clades even in regions in which PS has not been detected across the entire phylogeny. This was mainly characteristic of younger taxa.

  5. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  6. Study of fecal bacterial diversity in Yunnan snub-nosed monkey ...

    African Journals Online (AJOL)

    Yomi

    The bacterial diversity in fecal samples from Yunnan snub-nosed monkey ... Based on the phylogenetic analysis, the fecal bacteria of R. bieti distributed ... and conservation genetics, but research on fecal bacterial ... The large number of microorganisms in the intestine of .... There was high evolutional relativity between.

  7. Symbioses with nitrogen-fixing bacteria: nodulation and phylogenetic data across legume genera.

    Science.gov (United States)

    Afkhami, Michelle E; Luke Mahler, D; Burns, Jean H; Weber, Marjorie G; Wojciechowski, Martin F; Sprent, Janet; Strauss, Sharon Y

    2018-02-01

    How species interactions shape global biodiversity and influence diversification is a central - but also data-hungry - question in evolutionary ecology. Microbially based mutualisms are widespread and could cause diversification by ameliorating stress and thus allowing organisms to colonize and adapt to otherwise unsuitable habitats. Yet the role of these interactions in generating species diversity has received limited attention, especially across large taxonomic groups. In the massive angiosperm family Leguminosae, plants often associate with root-nodulating bacteria that ameliorate nutrient stress by fixing atmospheric nitrogen. These symbioses are ecologically-important interactions, influencing community assembly, diversity, and succession, contributing ~100-290 million tons of N annually to natural ecosystems, and enhancing growth of agronomically-important forage and crop plants worldwide. In recent work attempting to determine whether mutualism with N-fixing bacteria led to increased diversification across legumes, we were unable to definitively resolve the relationship between diversification and nodulation. We did, however, succeed in compiling a very large searchable, analysis-ready database of nodulation data for 749 legume genera (98% of Leguminosae genera; LPWG 2017), which, along with associated phylogenetic information, will provide a valuable resource for future work addressing this question and others. For each legume genus, we provide information about the species richness, frequency of nodulation, subfamily association, and topological correspondence with an additional data set of 100 phylogenetic trees curated for database compatibility. We found 386 legume genera were confirmed nodulators (i.e., all species examined for nodulation nodulated), 116 were non-nodulating, four were variable (i.e., containing both confirmed nodulators and confirmed non-nodulators), and 243 had not been examined for nodulation in published studies. Interestingly

  8. Identification of putative orthologous genes for the phylogenetic reconstruction of temperate woody bamboos (Poaceae: Bambusoideae).

    Science.gov (United States)

    Zhang, Li-Na; Zhang, Xian-Zhi; Zhang, Yu-Xiao; Zeng, Chun-Xia; Ma, Peng-Fei; Zhao, Lei; Guo, Zhen-Hua; Li, De-Zhu

    2014-09-01

    The temperate woody bamboos (Arundinarieae) are highly diverse in morphology but lack a substantial amount of genetic variation. The taxonomy of this lineage is intractable, and the relationships within the tribe have not been well resolved. Recent studies indicated that this tribe could have a complex evolutionary history. Although phylogenetic studies of the tribe have been carried out, most of these phylogenetic reconstructions were based on plastid data, which provide lower phylogenetic resolution compared with nuclear data. In this study, we intended to identify a set of desirable nuclear genes for resolving the phylogeny of the temperate woody bamboos. Using two different methodologies, we identified 209 and 916 genes, respectively, as putative single copy orthologous genes. A total of 112 genes was successfully amplified and sequenced by next-generation sequencing technologies in five species sampled from the tribe. As most of the genes exhibited intra-individual allele heterozygotes, we investigated phylogenetic utility by reconstructing the phylogeny based on individual genes. Discordance among gene trees was observed and, to resolve the conflict, we performed a range of analyses using BUCKy and HybTree. While caution should be taken when inferring a phylogeny from multiple conflicting genes, our analysis indicated that 74 of the 112 investigated genes are potential markers for resolving the phylogeny of the temperate woody bamboos. © 2014 John Wiley & Sons Ltd.

  9. Toward a phylogenetic chronology of ancient Gaulish, Celtic, and Indo-European.

    Science.gov (United States)

    Forster, Peter; Toth, Alfred

    2003-07-22

    Indo-European is the largest and best-documented language family in the world, yet the reconstruction of the Indo-European tree, first proposed in 1863, has remained controversial. Complications may include ascertainment bias when choosing the linguistic data, and disregard for the wave model of 1872 when attempting to reconstruct the tree. Essentially analogous problems were solved in evolutionary genetics by DNA sequencing and phylogenetic network methods, respectively. We now adapt these tools to linguistics, and analyze Indo-European language data, focusing on Celtic and in particular on the ancient Celtic language of Gaul (modern France), by using bilingual Gaulish-Latin inscriptions. Our phylogenetic network reveals an early split of Celtic within Indo-European. Interestingly, the next branching event separates Gaulish (Continental Celtic) from the British (Insular Celtic) languages, with Insular Celtic subsequently splitting into Brythonic (Welsh, Breton) and Goidelic (Irish and Scottish Gaelic). Taken together, the network thus suggests that the Celtic language arrived in the British Isles as a single wave (and then differentiated locally), rather than in the traditional two-wave scenario ("P-Celtic" to Britain and "Q-Celtic" to Ireland). The phylogenetic network furthermore permits the estimation of time in analogy to genetics, and we obtain tentative dates for Indo-European at 8100 BC +/- 1,900 years, and for the arrival of Celtic in Britain at 3200 BC +/- 1,500 years. The phylogenetic method is easily executed by hand and promises to be an informative approach for many problems in historical linguistics.

  10. Phylogenetic analysis of feline immunodeficiency virus strains from naturally infected cats in Belgium and The Netherlands.

    Science.gov (United States)

    Roukaerts, Inge D M; Theuns, Sebastiaan; Taffin, Elien R L; Daminet, Sylvie; Nauwynck, Hans J

    2015-01-22

    Feline immunodeficiency virus (FIV) is a major pathogen in feline populations worldwide, with seroprevalences up to 26%. Virus strains circulating in domestic cats are subdivided into different phylogenetic clades (A-E), based on the genetic diversity of the V3-V4 region of the env gene. In this report, a phylogenetic analysis of the V3-V4 env region, and a variable region in the gag gene was made for 36 FIV strains isolated in Belgium and The Netherlands. All newly generated gag sequences clustered together with previously known clade A FIV viruses, confirming the dominance of clade A viruses in Northern Europe. The same was true for the obtained env sequences, with only one sample of an unknown env subtype. Overall, the genetic diversity of FIV strains sequenced in this report was low. This indicates a relatively recent introduction of FIV in Belgium and The Netherlands. However, the sample with an unknown env subtype indicates that new introductions of FIV from unknown origin do occur and this will likely increase genetic variability in time. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Characterization of the genome of a phylogenetically distinct tospovirus and its interactions with the local lesion-induced host Chenopodium quinoa by whole-transcriptome analyses.

    Science.gov (United States)

    Chou, Wan-Chen; Lin, Shih-Shun; Yeh, Shyi-Dong; Li, Siang-Ling; Peng, Ying-Che; Fan, Ya-Hsu; Chen, Tsung-Chi

    2017-01-01

    Chenopodium quinoa is a natural local lesion host of numerous plant viruses, including tospoviruses (family Bunyaviridae). Groundnut chlorotic fan-spot tospovirus (GCFSV) has been shown to consistently induce local lesions on the leaves of C. quinoa 4 days post-inoculation (dpi). To reveal the whole genome of GCFSV and its interactions with C. quinoa, RNA-seq was performed to determine the transcriptome profiles of C. quinoa leaves. The high-throughput reads from infected C. quinoa leaves were used to identify the whole genome sequence of GCFSV and its single nucleotide polymorphisms. Our results indicated that GCFSV is a phylogenetically distinct tospovirus. Moreover, 27,170 coding and 29,563 non-coding sequences of C. quinoa were identified through de novo assembly, mixing reads from mock and infected samples. Several key genes involved in the modulation of hypersensitive response (HR) were identified. The expression levels of 4,893 deduced complete genes annotated using the Arabidopsis genome indicated that several HR-related orthologues of pathogenesis-related proteins, transcription factors, mitogen-activated protein kinases, and defense proteins were significantly expressed in leaves that formed local lesions. Here, we also provide new insights into the replication progression of a tospovirus and the molecular regulation of the C. quinoa response to virus infection.

  12. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  13. Assessment of Genetic Diversity, Relationships and Structure among Korean Native Cattle Breeds Using Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Sangwon Suh

    2014-11-01

    Full Text Available Four Korean native cattle (KNC breeds—Hanwoo, Chikso, Heugu, and Jeju black—are entered in the Domestic Animal Diversity Information System of the United Nations Food and Agriculture Organization (FAO. The objective of this study was to assess the genetic diversity, phylogenetic relationships and population structure of these KNC breeds (n = 120 and exotic breeds (Holstein and Charolais, n = 56. Thirty microsatellite loci recommended by the International Society for Animal Genetics/FAO were genotyped. These genotypes were used to determine the allele frequencies, allelic richness, heterozygosity and polymorphism information content per locus and breed. Genetic diversity was lower in Heugu and Jeju black breeds. Phylogenetic analysis, Factorial Correspondence Analysis and genetic clustering grouped each breed in its own cluster, which supported the genetic uniqueness of the KNC breeds. These results will be useful for conservation and management of KNC breeds as animal genetic resources.

  14. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  15. Short-Term Local Adaptation of Historical Common Bean (Phaseolus vulgaris L. Varieties and Implications for In Situ Management of Bean Diversity

    Directory of Open Access Journals (Sweden)

    Stephanie M. Klaedtke

    2017-02-01

    Full Text Available Recognizing both the stakes of traditional European common bean diversity and the role farmers’ and gardeners’ networks play in maintaining this diversity, the present study examines the role that local adaptation plays for the management of common bean diversity in situ. To the purpose, four historical bean varieties and one modern control were multiplied on two organic farms for three growing seasons. The fifteen resulting populations, the initial ones and two populations of each variety obtained after the three years of multiplication, were then grown in a common garden. Twenty-two Simple Sequence Repeat (SSR markers and 13 phenotypic traits were assessed. In total, 68.2% of tested markers were polymorphic and a total of 66 different alleles were identified. FST analysis showed that the genetic composition of two varieties multiplied in different environments changed. At the phenotypic level, differences were observed in flowering date and leaf length. Results indicate that three years of multiplication suffice for local adaptation to occur. The spatial dynamics of genetic and phenotypic bean diversity imply that the maintenance of diversity should be considered at the scale of the network, rather than individual farms and gardens. The microevolution of bean populations within networks of gardens and farms emerges as a research perspective.

  16. The morphology of neoptile feathers: ancestral state reconstruction and its phylogenetic implications.

    Science.gov (United States)

    Foth, Christian

    2011-04-01

    Avian neoptile feathers are defined as the first feather generation, which covers the chick after hatching, and usually described as simple structures consisting of numerous downy barbs which are radially symmetrically arranged and come together in a short calamus. In contrast, in some birds (e.g., Anas platyrhynchos, Dromaius novaehollandiae) the neoptile feathers have a prominent rhachis, and therefore display clear bilateral symmetry. Because the symmetrical variety found in neoptile feathers is poorly understood, their morphology was studied in a more comprehensive and phylogenetic approach. Neoptile body feathers from over 22 bird species were investigated using light microscopy, SEM, and MicroCT. Characters such as an anterior-posterior axis, a central rhachis, medullary cells, and structure of the calamus wall were defined and mapped onto recent phylogenetic hypotheses for extant birds. It can be shown that bilaterally symmetric neoptile feathers (with a solid calamus wall) were already present in the stem lineage of crown-group birds (Neornithes). In contrast, simple radially symmetric neoptile feathers (with a fragile calamus wall) are an apomorphic character complex for the clade Neoaves. The simple morphology of this feather type may be the result of a reduced period of development during embryogenesis. To date, embryogenesis of neoptile feathers from only a few bird species was used as a model to reconstruct feather evolution. Because this study shows that the morphology of neoptile feathers is more diverse and even shows a clear phylogenetic signal, it is necessary to expand the spectrum of "model organisms" to species with bilaterally symmetric neoptile feathers and compare differences in the frequency of feather development from a phylogenetic point of view. Copyright © 2011 Wiley-Liss, Inc.

  17. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  18. Genetic diversity and phylogenetic analysis of Aleutian mink disease virus isolates in north-east China.

    Science.gov (United States)

    Leng, Xue; Liu, Dongxu; Li, Jianming; Shi, Kun; Zeng, Fanli; Zong, Ying; Liu, Yi; Sun, Zhibo; Zhang, Shanshan; Liu, Yadong; Du, Rui

    2018-05-01

    Aleutian mink disease is the most important disease in the mink-farming industry worldwide. So far, few large-scale molecular epidemiological studies of AMDV, based on the NS1 and VP2 genes, have been conducted in China. Here, eight new Chinese isolates of AMDV from three provinces in north-east China were analyzed to clarify the molecular epidemiology of AMDV. The seroprevalence of AMDV in north-east China was 41.8% according to counterimmuno-electrophoresis. Genetic variation analysis of the eight isolates showed significant non-synonymous substitutions in the NS1 and VP2 genes, especially in the NS1 gene. All eight isolates included the caspase-recognition sequence NS1:285 (DQTD↓S), but not the caspase recognition sequence NS1:227 (INTD↓S). The LN1 and LN2 strains had a new 10-amino-acid deletion in-between amino acids 28-37, while the JL3 strain had a one-amino-acid deletion at position 28 in the VP2 protein, compared with the AMDV-G strain. Phylogenetic analysis based on most of NS1 (1755 bp) and complete VP2 showed that the AMDV genotypes did not cluster according to their pathogenicity or geographic origin. Local and imported ADMV species are all prevalent in mink-farming populations in the north-east of China. This is the first study to report the molecular epidemiology of AMDV in north-east China based on most of NS1 and the complete VP2, and further provides information about polyG deletions and new variations in the amino acid sequences of NS1 and VP2 proteins. This report is a good foundation for further study of AMDV in China.

  19. Phylogenetic Framework and Molecular Signatures for the Main Clades of the Phylum Actinobacteria

    Science.gov (United States)

    Gao, Beile

    2012-01-01

    Summary: The phylum Actinobacteria harbors many important human pathogens and also provides one of the richest sources of natural products, including numerous antibiotics and other compounds of biotechnological interest. Thus, a reliable phylogeny of this large phylum and the means to accurately identify its different constituent groups are of much interest. Detailed phylogenetic and comparative analyses of >150 actinobacterial genomes reported here form the basis for achieving these objectives. In phylogenetic trees based upon 35 conserved proteins, most of the main groups of Actinobacteria as well as a number of their superageneric clades are resolved. We also describe large numbers of molecular markers consisting of conserved signature indels in protein sequences and whole proteins that are specific for either all Actinobacteria or their different clades (viz., orders, families, genera, and subgenera) at various taxonomic levels. These signatures independently support the existence of different phylogenetic clades, and based upon them, it is now possible to delimit the phylum Actinobacteria (excluding Coriobacteriia) and most of its major groups in clear molecular terms. The species distribution patterns of these markers also provide important information regarding the interrelationships among different main orders of Actinobacteria. The identified molecular markers, in addition to enabling the development of a stable and reliable phylogenetic framework for this phylum, also provide novel and powerful means for the identification of different groups of Actinobacteria in diverse environments. Genetic and biochemical studies on these Actinobacteria-specific markers should lead to the discovery of novel biochemical and/or other properties that are unique to different groups of Actinobacteria. PMID:22390973

  20. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.