Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade
International Nuclear Information System (INIS)
Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.
2008-01-01
Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups
Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W
2015-03-31
Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.
Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.
2013-01-01
The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112
Directory of Open Access Journals (Sweden)
Bin Tang
2018-01-01
Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.
Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1
Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.
1992-01-01
The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-11-01
Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.
Incorporation of phosphate into glycogen by glycogen synthase.
Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J
2016-05-01
The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
myo-Inositol-1-phosphate synthase is required for polar auxin transport and organ development
Chen, Hao
2010-06-01
myo-Inositol-1-phosphate synthase is a conserved enzyme that catalyzes the first committed and rate-limiting step in inositol biosynthesis. Despite its wide occurrence in all eukaryotes, the role of myo-inositol-1-phosphate synthase and de novo inositol biosynthesis in cell signaling and organism development has been unclear. In this study, we isolated loss-of-function mutants in the Arabidopsis MIPS1 gene from different ecotypes. It was found that all mips1 mutants are defective in embryogenesis, cotyledon venation patterning, root growth, and root cap development. The mutant roots are also agravitropic and have reduced basipetal auxin transport. mips1 mutants have significantly reduced levels of major phosphatidylinositols and exhibit much slower rates of endocytosis. Treatment with brefeldin A induces slower PIN2 protein aggregation in mips1, indicating altered PIN2 trafficking. Our results demonstrate that MIPS1 is critical for maintaining phosphatidylinositol levels and affects pattern formation in plants likely through regulation of auxin distribution. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
International Nuclear Information System (INIS)
Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.
2004-01-01
The first crystallographic study of a sucrose phosphate synthase from H. orenii, an organism that is both thermophilic and halophilic, is reported. The protein crystal diffracts X-rays to 3.01 Å. This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure
International Nuclear Information System (INIS)
Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng
2010-01-01
To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.
Energy Technology Data Exchange (ETDEWEB)
Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Yu, Xiyan, E-mail: yuxiyan@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Wang, Xiufeng, E-mail: xfwang@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China)
2010-03-12
To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.
Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang
2017-12-01
Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.
Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe
2014-08-01
Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.
Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S
2008-02-01
This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.
Directory of Open Access Journals (Sweden)
Aarón Barraza
2016-11-01
Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.
Directory of Open Access Journals (Sweden)
Lina Zheng
Full Text Available Validamycin A (Val-A is an effective antifungal agent widely used in Asian countries as crop protectant. Validoxylamine A, the core structure and intermediate of Val-A, consists of two C(7-cyclitol units connected by a rare C-N bond. In the Val-A biosynthetic gene cluster in Streptomyces hygroscopicus 5008, the ORF valL was initially annotated as a validoxylamine A 7'-phosphate(V7P synthase, whose encoded 497-aa protein shows high similarity with trehalose 6-phosphate(T6P synthase. Gene inactivation of valL abolished both validoxylamine A and validamycin A productivity, and complementation with a cloned valL recovered 10% production of the wild-type in the mutant, indicating the involvement of ValL in validoxylamine A biosynthesis. Also we determined the structures of ValL and ValL/trehalose complex. The structural data indicates that ValL adopts the typical fold of GT-B protein family, featuring two Rossmann-fold domains and an active site at domain junction. The residues in the active site are arranged in a manner homologous to that of Escherichia coli (E.coli T6P synthase OtsA. However, a significant discrepancy is found in the active-site loop region. Also noticeable structural variance is found around the active site entrance in the apo ValL structure while the region takes an ordered configuration upon binding of product analog trehalose. Furthermore, the modeling of V7P in the active site of ValL suggests that ValL might have a similar SNi-like mechanism as OtsA.
International Nuclear Information System (INIS)
Salvucci, M.E.; Crafts-Brandner, S.J.
1991-01-01
A method for product analysis that eliminates a problematic step in the radiometric sucrose-phosphate synthase assay is described. The method uses chromatography on a boronate-derivatized high-performance liquid chromatography column to separate the labeled product, [14C]sucrose phosphate, from unreacted uridine 5'-diphosphate-[14C]glucose (UDP-Glc). Direct separation of these compounds eliminates the need for treatment of the reaction mixtures with alkaline phosphatase, thereby avoiding the problem of high background caused by contaminating phosphodiesterase activity in alkaline phosphatase preparations. The method presented in this paper can be applied to many UDP-Glc requiring enzymes; here the authors show its use for determining the activities of sucrose-phosphate synthase, sucrose synthase, and uridine diphosphate-glucose pyrophosphorylase in plant extracts
Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing
2009-05-13
One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.
Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong
2018-07-01
The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
DEFF Research Database (Denmark)
Harthill, Jean E; Meek, Sarah E M; Morrice, Nick
2006-01-01
Trehalose-6-phosphate is a 'sugar signal' that regulates plant metabolism and development. The Arabidopsis genome encodes trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphatase (TPP) enzymes. It also encodes class II proteins (TPS isoforms 5-11) that contain both TPS-like and TPP...
Rodríguez, H; Gonzalez, T; Selman, G
2001-11-30
A genetic construction was carried out using the broad host range vector pKT230 and plasmid pMCG898, which encodes the Erwinia herbicola pyrroloquinoline quinone (PQQ) synthase, a gene involved in mineral phosphate solubilization (mps). The final construction was transformed and expressed in Escherichia coli MC1061, and the recombinant plasmids were transferred to Burkholderia cepacia IS-16 and Pseudomonas sp. PSS recipient cells by conjugation. Clones containing recombinant plasmids produced higher clearing halos in plates with insoluble phosphate as the unique (P) source, in comparison with those of strains without plasmids, demonstrating the heterologous expression of the E. herbicola gene in the recipient strains. This genetic manipulation allowed the increase in mps ability of both strains, enhancing their potentialities as growth promoters of agricultural crops. These results represent the first report on the application of the recombinant DNA methodology for the obtaining of improved phosphate solubilizing ability from rhizobacterial strains for biofertilization purposes.
L-Myo-inositol 1-phosphate synthase in the aquatic fern Azolla filiculoides.
Benaroya, Rony Oren; Zamski, Eli; Tel-Or, Elisha
2004-02-01
L-Myo-inositol 1-phosphate synthase (INPS EC 5.5.1.4) catalyzes the conversion of D-glucose 6-phosphate to L-myo-inositol 1-phosphate. INPS is a key enzyme involved in the biosynthesis of phytate which is a common form of stored phosphates in higher plants. The present study monitored the increase of INPS expression in Azolla filiculoides resulting from exposure to inorganic phosphates, metals and salt stress. The expression of INPS was significantly higher in Azolla plants that were grown in rich mineral growth medium than those maintained on nutritional growth medium. The expression of INPS protein and corresponding mRNA increased in plants cultured in minimal nutritional growth medium when phosphate or Zn2+, Cd2+ and NaCl were added to the growth medium. When employing rich mineral growth medium, INPS protein content increased with the addition of Zn2+, but decreased in the presence of Cd2+ and NaCl. These results indicated that accumulation of phytate in Azolla is a result of the intensified expression of INPS protein and mRNA, and its regulation may be primarily derived by the uptake of inorganic phosphate, and Zn2+, Cd2+ or NaCl.
Directory of Open Access Journals (Sweden)
Khalil Zaynali
2010-06-01
Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh
2014-10-01
Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos
1998-01-01
The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9.
Lin, I Winnie; Sosso, Davide; Chen, Li-Qing; Gase, Klaus; Kim, Sang-Gyu; Kessler, Danny; Klinkenberg, Peter M; Gorder, Molly K; Hou, Bi-Huei; Qu, Xiao-Qing; Carter, Clay J; Baldwin, Ian T; Frommer, Wolf B
2014-04-24
Angiosperms developed floral nectaries that reward pollinating insects. Although nectar function and composition have been characterized, the mechanism of nectar secretion has remained unclear. Here we identify SWEET9 as a nectary-specific sugar transporter in three eudicot species: Arabidopsis thaliana, Brassica rapa (extrastaminal nectaries) and Nicotiana attenuata (gynoecial nectaries). We show that SWEET9 is essential for nectar production and can function as an efflux transporter. We also show that sucrose phosphate synthase genes, encoding key enzymes for sucrose biosynthesis, are highly expressed in nectaries and that their expression is also essential for nectar secretion. Together these data are consistent with a model in which sucrose is synthesized in the nectary parenchyma and subsequently secreted into the extracellular space via SWEET9, where sucrose is hydrolysed by an apoplasmic invertase to produce a mixture of sucrose, glucose and fructose. The recruitment of SWEET9 for sucrose export may have been a key innovation, and could have coincided with the evolution of core eudicots and contributed to the evolution of nectar secretion to reward pollinators.
Directory of Open Access Journals (Sweden)
Gaoyi Cao
Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.
Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.
Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M
2008-07-01
Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.
Directory of Open Access Journals (Sweden)
Huijuan Zhang
2016-08-01
Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.
Roy Choudhury, Swarup; Roy, Sujit; Das, Ranjan; Sengupta, Dibyendu N
2008-12-01
Sucrose phosphate synthase (SPS) (EC 2.3.1.14) is the key regulatory component in sucrose formation in banana (Musa acuminata subgroup Cavendish, cv Giant governor) fruit during ripening. This report illustrates differential transcriptional responses of banana SPS gene following ethylene, auxin, wounding, low temperature and different photoperiods during ripening in banana fruit. Whereas ethylene strongly stimulated SPS transcript accumulation, auxin and cold treatment only marginally increased the abundance of SPS mRNA level, while wounding negatively regulated SPS gene expression. Conversely, SPS transcript level was distinctly increased by constant exposure to white light. Protein level, enzymatic activity of SPS and sucrose synthesis were substantially increased by ethylene and increased exposure to white light conditions as compared to other treatments. To further study the transcriptional regulation of SPS in banana fruit, the promoter region of SPS gene was cloned and some cis-acting regulatory elements such as a reverse GCC-box ERE, two ARE motifs (TGTCTC), one LTRE (CCGAA), a GAGA-box (GAGA...) and a GATA-box LRE (GATAAG) were identified along with the TATA and CAAT-box. DNA-protein interaction studies using these cis-elements indicated a highly specific cis-trans interaction in the banana nuclear extract. Furthermore, we specifically studied the light responsive characteristics of GATA-box containing synthetic as well as native banana SPS promoter. Transient expression assays using banana SPS promoter have also indicated the functional importance of the SPS promoter in regulating gene expression. Together, these results provide insights into the transcriptional regulation of banana SPS gene in response to phytohormones and other environmental factors during fruit ripening.
Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming
2012-01-01
Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Directory of Open Access Journals (Sweden)
Jia Fang
2018-02-01
Full Text Available Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T2 and T3Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium (CP4. For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid content in transgene-present, transgene-absent, empty vector (EV, and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.
Fang, Jia; Nan, Peng; Gu, Zongying; Ge, Xiaochun; Feng, Yu-Qi; Lu, Bao-Rong
2018-01-01
Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T 2 and T 3 Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium ( CP4 ). For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid) content in transgene-present, transgene-absent, empty vector (EV), and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T 2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T 3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1999-01-01
Four cDNAs encoding phosphoribosyl diphosphate (PRPP) synthase were isolated from a spinach (Spinacia oleracea) cDNA library by complementation of an Escherichia coli Δprs mutation. The four gene products produced PRPP in vitro from ATP and ribose-5-phosphate. Two of the enzymes (isozymes 1 and 2...
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella
2011-01-01
Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399
Lamers, W. H.; de Graaf, A.; Mooren, P. G.; Moorman, A. F.; Charles, R.
1982-01-01
A method has been developed to establish the degree of cross-reactivity of an antiserum raised against purified carbamoyl-phosphate synthase (ammonia) from adult rat liver, toward a homologous enzyme from another species without purification of the latter enzyme. For that purpose the ratio between
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
International Nuclear Information System (INIS)
Viana, Renato Marcio Ribeiro; Prado, Maria Auxiliadora Fontes; Alves, Ricardo Jose
2008-01-01
The synthesis of -5-(D-arabino-1,2,3,4-tetrahydroxybutyl)tetrazole and -2-(d-arabino-1,2,3,4-tetra-acetoxybutyl)-5-methyl-1,3,4-oxadiazole from d-arabinose is described. Attempts at removing the protecting groups of the oxadiazole derivative were unsuccessful, leading to products resulting from the opening of the oxadiazole ring. The unprotected tetrazole derivative was selectively phosphorylated at the primary hydroxyl group with diethyl phosphoryl chloride. The resulting 5-[d-arabino-4-(diethylphosphoryloxy)-1,2,3-trihydroxybutyl]tetrazole is a protected form of a potential inhibitor of the enzymes glucose-6-phosphate isomerase and glucosamine synthase. (author)
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Hou, Shasha; Tan, Jian; Yang, Bing; He, Lu; Zhu, Yu
2018-05-01
Thyroid cancer is a common primary tumor in China. Therefore, it is important to investigate the underlying molecular mechanism of thyroid cancer in order to achieve effective individualized treatments. In our previous study, a positive correlation between the expression of alkylglycerone phosphate synthase (AGPS) and the malignant phenotype of thyroid cancer cell lines was identified. The inactivation of AGPS was able to decrease the malignancy of cancer, and inhibit tumor growth and invasion. However, the function of AGPS on thyroid cancer was unclear. In the present study, it was revealed that AGPS was able to regulate the expression of circular RNAs (circRNAs), which may be the mechanism of its anticancer activity. Therefore, the effects of AGPS silencing and knockout on circRNA expression in the thyroid cancer cell line FRO were investigated using circRNAs microarray, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed in order to investigate the underlying molecular mechanism of AGPS for the regulation of thyroid cancer through circRNAs.
Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay
2012-12-01
Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.
Directory of Open Access Journals (Sweden)
Shan Lu
2017-08-01
Full Text Available Phosphate (Pi deficiency is a common nutritional stress of plants in both agricultural and natural ecosystems. Plants respond to Pi starvation in the environment by triggering a suite of biochemical, physiological, and developmental changes that increase survival and growth. The key factors that determine plant sensitivity to Pi starvation, however, are unclear. In this research, we identified an Arabidopsis mutant, dps1, with greatly reduced sensitivity to Pi starvation. The dps1 phenotypes are caused by a mutation in the previously characterized SVR1 (SUPPRESSION OF VARIAGATION 1 gene, which encodes a chloroplast-localized pseudouridine synthase. The mutation of SVR1 results in defects in chloroplast rRNA biogenesis, which subsequently reduces chloroplast translation. Another mutant, rps5, which contains a mutation in the chloroplast ribosomal protein RPS5 and has reduced chloroplast translation, also displayed decreased sensitivity to Pi starvation. Furthermore, wild type plants treated with lincomycin, a chemical inhibitor of chloroplast translation, showed similar growth phenotypes and Pi starvation responses as dps1 and rps5. These results suggest that impaired chloroplast translation desensitizes plants to Pi starvation. Combined with previously published results showing that enhanced leaf photosynthesis augments plant responses to Pi starvation, we propose that the decrease in responses to Pi starvation in dps1, rps5, and lincomycin-treated plants is due to their reduced demand for Pi input from the environment.
Crystal structure of 3,4-dihydroxy-2-butanone 4-phosphate synthase of riboflavin biosynthesis
Energy Technology Data Exchange (ETDEWEB)
Liao, D.-I.; Calabrese, J.C.; Wawrzak, Z.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)
2010-03-05
3,4-Dihydroxy-2-butanone-4-phosphate synthase catalyzes a commitment step in the biosynthesis of riboflavin. On the enzyme, ribulose 5-phosphate is converted to 3,4-dihydroxy-2-butanone 4-phosphate and formate in steps involving enolization, ketonization, dehydration, skeleton rearrangement, and formate elimination. The enzyme is absent in humans and an attractive target for the discovery of antimicrobials for pathogens incapable of acquiring sufficient riboflavin from their hosts. The homodimer of 23 kDa subunits requires Mg{sup 2+} for activity. The first three-dimensional structure of the enzyme was determined at 1.4 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on Escherichia coli protein crystals containing gold. The protein consists of an {alpha} + {beta} fold having a complex linkage of {beta} strands. Intersubunit contacts are mediated by numerous hydrophobic interactions and three hydrogen bond networks. A proposed active site was identified on the basis of amino acid residues that are conserved among the enzyme from 19 species. There are two well-separated active sites per dimer, each of which comprise residues from both subunits. In addition to three arginines and two threonines, which may be used for recognizing the phosphate group of the substrate, the active site consists of three glutamates, two aspartates, two histidines, and a cysteine which may provide the means for general acid and base catalysis and for coordinating the Mg{sup 2+} cofactor within the active site.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Henstrand, John M.; McCue, Kent F.; Brink, Kent; Handa, Avtar K.; Herrmann, Klaus M.; Conn, Eric E.
1992-01-01
Light and fungal elicitor induce mRNA encoding 3-deoxy-d-arabino-heptulosonate 7-phosphate (DAHP) synthase in suspension cultured cells of parsley (Petroselinum crispum L.). The kinetics and dose response of mRNA accumulation were similar for DAHP synthase and phenylalanine ammonia-lyase (PAL). Six micrograms of elicitor from Phytophthora megasperma f. glycinia gave a detectable induction within 1 hour. Induction of DAHP synthase and PAL mRNAs by light was transient, reaching maximal levels at 4 hours and returning to pretreatment levels after 24 hours. Our data suggest that either light or fungal elicitor transcriptionally activate DAHP synthase. A coordinate regulation for key enzymes in the synthesis of primary and secondary metabolites is indicated. ImagesFigure 1 PMID:16668708
Huang, Xinyi; Hernick, Marcy
2015-10-01
Myo-inositol-1-phosphate synthase (MIPS, E.C. 5.5.1.4) catalyzes the first step in inositol production-the conversion of glucose-6-phosphate (Glc-6P) to myo-inositol-1-phosphate. While the three dimensional structure of MIPS from Mycobacterium tuberculosis has been solved, biochemical studies examining the in vitro activity have not been reported to date. Herein we report the in vitro activity of mycobacterial MIPS expressed in E. coli and Mycobacterium smegmatis. Recombinant expression in E. coli yields a soluble protein capable of binding the NAD(+) cofactor; however, it has no significant activity with the Glc-6P substrate. In contrast, recombinant expression in M. smegmatis mc(2)4517 yields a functionally active protein. Examination of structural data suggests that MtMIPS expressed in E. coli adopts a fold that is missing a key helix containing two critical (conserved) Lys side chains, which likely explains the inability of the E. coli expressed protein to bind and turnover the Glc-6P substrate. Recombinant expression in M. smegmatis may yield a protein that adopts a fold in which this key helix is formed enabling proper positioning of important side chains, thereby allowing for Glc-6P substrate binding and turnover. Detailed mechanistic studies may be feasible following optimization of the recombinant MIPS expression protocol in M. smegmatis.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Lamers, W. H.; Vink, C.; Charles, R.
1978-01-01
1. In axolotl liver, the activity of carbamoyl-phosphate synthase (ammonia), expressed per mg liver protein, decreases to a minimum at 5 months of age, then increases to a maximum at 8 months of age which is followed by a decrease again. The initial decrease between 3 and 5 months of age appears to
Nitric oxide synthase gene G298 allele
International Nuclear Information System (INIS)
Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar
2004-01-01
Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant
Directory of Open Access Journals (Sweden)
Ri-He Peng
Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.
It takes two to tango: defining an essential second active site in pyridoxal 5'-phosphate synthase.
Directory of Open Access Journals (Sweden)
Cyril Moccand
Full Text Available The prevalent de novo biosynthetic pathway of vitamin B6 involves only two enzymes (Pdx1 and Pdx2 that form an ornate multisubunit complex functioning as a glutamine amidotransferase. The synthase subunit, Pdx1, utilizes ribose 5-phosphate and glyceraldehyde 3-phosphate, as well as ammonia derived from the glutaminase activity of Pdx2 to directly form the cofactor vitamer, pyridoxal 5'-phosphate. Given the fact that a single enzyme performs the majority of the chemistry behind this reaction, a complicated mechanism is anticipated. Recently, the individual steps along the reaction co-ordinate are beginning to be unraveled. In particular, the binding of the pentose substrate and the first steps of the reaction have been elucidated but it is not known if the latter part of the chemistry, involving the triose sugar, takes place in the same or a disparate site. Here, we demonstrate through the use of enzyme assays, enzyme kinetics, and mutagenesis studies that indeed a second site is involved in binding the triose sugar and moreover, is the location of the final vitamin product, pyridoxal 5'-phosphate. Furthermore, we show that product release is triggered by the presence of a PLP-dependent enzyme. Finally, we provide evidence that a single arginine residue of the C terminus of Pdx1 is responsible for coordinating co-operativity in this elaborate protein machinery.
DEFF Research Database (Denmark)
Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K
2017-01-01
BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
Directory of Open Access Journals (Sweden)
Abir U Igamberdiev
2015-01-01
Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.
Butzin, Nicholas C; Lapierre, Pascal; Green, Anna G; Swithers, Kristen S; Gogarten, J Peter; Noll, Kenneth M
2013-01-01
The bacterial genomes of Thermotoga species show evidence of significant interdomain horizontal gene transfer from the Archaea. Members of this genus acquired many genes from the Thermococcales, which grow at higher temperatures than Thermotoga species. In order to study the functional history of an interdomain horizontally acquired gene we used ancestral sequence reconstruction to examine the thermal characteristics of reconstructed ancestral proteins of the Thermotoga lineage and its archaeal donors. Several ancestral sequence reconstruction methods were used to determine the possible sequences of the ancestral Thermotoga and Archaea myo-inositol-3-phosphate synthase (MIPS). These sequences were predicted to be more thermostable than the extant proteins using an established sequence composition method. We verified these computational predictions by measuring the activities and thermostabilities of purified proteins from the Thermotoga and the Thermococcales species, and eight ancestral reconstructed proteins. We found that the ancestral proteins from both the archaeal donor and the Thermotoga most recent common ancestor recipient were more thermostable than their descendants. We show that there is a correlation between the thermostability of MIPS protein and the optimal growth temperature (OGT) of its host, which suggests that the OGT of the ancestors of these species of Archaea and the Thermotoga grew at higher OGTs than their descendants.
Directory of Open Access Journals (Sweden)
Nicholas C Butzin
Full Text Available The bacterial genomes of Thermotoga species show evidence of significant interdomain horizontal gene transfer from the Archaea. Members of this genus acquired many genes from the Thermococcales, which grow at higher temperatures than Thermotoga species. In order to study the functional history of an interdomain horizontally acquired gene we used ancestral sequence reconstruction to examine the thermal characteristics of reconstructed ancestral proteins of the Thermotoga lineage and its archaeal donors. Several ancestral sequence reconstruction methods were used to determine the possible sequences of the ancestral Thermotoga and Archaea myo-inositol-3-phosphate synthase (MIPS. These sequences were predicted to be more thermostable than the extant proteins using an established sequence composition method. We verified these computational predictions by measuring the activities and thermostabilities of purified proteins from the Thermotoga and the Thermococcales species, and eight ancestral reconstructed proteins. We found that the ancestral proteins from both the archaeal donor and the Thermotoga most recent common ancestor recipient were more thermostable than their descendants. We show that there is a correlation between the thermostability of MIPS protein and the optimal growth temperature (OGT of its host, which suggests that the OGT of the ancestors of these species of Archaea and the Thermotoga grew at higher OGTs than their descendants.
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Gene Cloning of Iranian Leishmania major Mannose-1-Phosphate Guanyltransferase
Directory of Open Access Journals (Sweden)
R Salehi
2009-07-01
Full Text Available "nBackground: Leishmania is an obligatory intracellular protozoan parasite, which infects human beings when infected sand fly vector takes a blood meal. Most efforts are towards designing an effective vaccine to prevent leishmaniasis. In this way, development of candidate antigen for vaccine has special important. In this study, we cloned mannose-1-phosphate guanyltransferase gene of Iranian L .major in pET32a expression vector. "nMethods: Primers based on L. major mannose-1-phosphate guanyltransferase sequence gene was designed and synthesized. DNA of Leishmania promastigotes was extracted and PCR reaction was done. PCR product was cloned into pTZ57R and sub cloned into pET32a expression vector. "nResults: Recombinant plasmid containing 1140 bp as L. major mannose-1-phosphate guanyltransferase gene was extracted and confirmed by restriction analysis. PCR product was sequenced and deposited to GenBank. There were some differences in amino acid sequences between Iranian L. major mannose-1-phosphate guanyltransferase and others previously accepted in GenBank "nConclusion: We amplified and cloned Iranian L. major mannose-1-phosphate guanyltransferase successfully.
Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.
Lather, Amit; Sharma, Sunil; Khatkar, Anurag
2018-01-01
Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Energy Technology Data Exchange (ETDEWEB)
Park, Jaeok [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); Lin, Yih-Shyan [McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); Tsantrizos, Youla S. [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); Berghuis, Albert M., E-mail: albert.berghuis@mcgill.ca [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); McGill University, 3775 Rue University, Montreal, QC H3A 2B4 (Canada)
2014-02-19
A co-crystal structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate, YS0470, and two molecules of inorganic phosphate has been determined. The identity of the phosphate ligands was confirmed by anomalous diffraction data. Human farnesyl pyrophosphate synthase (hFPPS) produces farnesyl pyrophos@@phate, an isoprenoid essential for a variety of cellular processes. The enzyme has been well established as the molecular target of the nitrogen-containing bisphosphonates (N-BPs), which are best known for their antiresorptive effects in bone but are also known for their anticancer properties. Crystal structures of hFPPS in ternary complexes with a novel bisphosphonate, YS0470, and the secondary ligands inorganic phosphate (P{sub i}), inorganic pyrophosphate (PP{sub i}) and isopentenyl pyrophosphate (IPP) have recently been reported. Only the co-binding of the bisphosphonate with either PP{sub i} or IPP resulted in the full closure of the C-@@terminal tail of the enzyme, a conformational change that is required for catalysis and that is also responsible for the potent in vivo efficacy of N-BPs. In the present communication, a co-crystal structure of hFPPS in complex with YS0470 and two molecules of P{sub i} is reported. The unusually close proximity between these ligands, which was confirmed by anomalous diffraction data, suggests that they interact with one another, with their anionic charges neutralized in their bound state. The structure also showed the tail of the enzyme to be fully disordered, indicating that simultaneous binding of two P{sub i} molecules with a bisphosphonate cannot induce the tail-closing conformational change in hFPPS. Examination of homologous FPPSs suggested that this ligand-dependent tail closure is only conserved in the mammalian proteins. The prevalence of P{sub i}-bound hFPPS structures in the PDB raises a question regarding the in vivo relevance of P{sub i} binding to the function of the enzyme.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Madoka eYonekura
2013-03-01
Full Text Available Although sucrose plays a role in sugar sensing and its signaling pathway, little is known about the regulatory mechanisms of the expressions of plant sucrose-related genes. Our previous study on the expression of the sucrose phosphate synthase gene family in rice (OsSPSs suggested the involvement of sucrose sensing and/or circadian rhythm in the transcriptional regulation of OsSPS. To examine whether the promoters of OsSPSs can be controlled by sugars and circadian clock, we produced transgenic rice plants harboring a promoter–luciferase construct for OsSPS1 or OsSPS11 and analyzed the changes in the promoter activities by monitoring bioluminescence from intact transgenic plants in real time. Transgenic plants fed sucrose, glucose, or mannitol under continuous light conditions showed no changes in bioluminescence intensity; meanwhile, the addition of sucrose increased the concentration of sucrose in the plants, and the mRNA levels of OsSPS remained constant. These results suggest that these OsSPS promoters may not be regulated by sucrose levels in the tissues. Next, we investigated the changes in the promoter activities under 12-h light/12-h dark cycles and continuous light conditions. Under the light–dark cycle, both OsSPS1 and OsSPS11 promoter activities were low in the dark and increased rapidly after the beginning of the light period. When the transgenic rice plants were moved to the continuous light condition, both POsSPS1::LUC and POsSPS11::LUC reporter plants exhibited circadian bioluminescence rhythms; bioluminescence peaked during the subjective day with a 27-h period: in the early morning as for OsSPS1 promoter and midday for OsSPS11 promoter. These results indicate that these OsSPS promoters are controlled by both light illumination and circadian clock and that the regulatory mechanism of promoter activity differs between the 2 OsSPS genes.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of ATP synthase CF1 α gene from ...
African Journals Online (AJOL)
ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...
Itagaki, Shiori; Haga, Minami; Oikawa, Yuji; Sakoda, Ayaka; Ohke, Yoshie; Sawada, Hiroshi; Eguchi, Tadashi; Tamegai, Hideyuki
2013-01-01
BtrC2 of the butirosin producer Bacillus circulans is a non-catalytic subunit of 2-deoxy-scyllo-inosose (DOI) synthase that is involved in butirosin biosynthesis, and also a homolog of glutamine amidotransferase subunit (PdxT) of pyridoxal 5'-phosphate (PLP) synthase of Bacillus subtilis. BtrC2 has been found to have functions in B. circulans both in primary and secondary metabolism. In this study, we investigated the properties of PdxT of B. subtilis in order to determine whether the property of enzyme stabilization is universal among PdxT homologs. Complementation with PdxT in the btrC2 disruptant of B. circulans restored the growth and short-term production of antibiotics, but long-term production of antibiotics cannot be restored. Additionally, PdxT did not bind physically with or stabilize BtrC. Our results indicate that the function of BtrC2 in secondary metabolism is specific properties, not universal among PdxT homologs.
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
International Nuclear Information System (INIS)
Rothenberg, M.; Hanson, M.R.
1988-01-01
A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Lin, Po-Cheng; Saha, Rajib; Zhang, Fuzhong; Pakrasi, Himadri B
2017-12-13
Isoprenoids are diverse natural compounds, which have various applications as pharmaceuticals, fragrances, and solvents. The low yield of isoprenoids in plants makes them difficult for cost-effective production, and chemical synthesis of complex isoprenoids is impractical. Microbial production of isoprenoids has been considered as a promising approach to increase the yield. In this study, we engineered the model cyanobacterium Synechocystis sp. PCC 6803 for sustainable production of a commercially valuable isoprenoid, limonene. Limonene synthases from the plants Mentha spicata and Citrus limon were expressed in cyanobacteria for limonene production. Production of limonene was two-fold higher with limonene synthase from M. spicata than that from C. limon. To enhance isoprenoid production, computational strain design was conducted by applying the OptForce strain design algorithm on Synechocystis 6803. Based on the metabolic interventions suggested by this algorithm, genes (ribose 5-phosphate isomerase and ribulose 5-phosphate 3-epimerase) in the pentose phosphate pathway were overexpressed, and a geranyl diphosphate synthase from the plant Abies grandis was expressed to optimize the limonene biosynthetic pathway. The optimized strain produced 6.7 mg/L of limonene, a 2.3-fold improvement in productivity. Thus, this study presents a feasible strategy to engineer cyanobacteria for photosynthetic production of isoprenoids.
Identification of the trehalose-6-phosphate synthase gene family in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.
Almadanim, M. Cecília
2017-01-19
Calcium-dependent protein kinases (CDPKs) are involved in plant tolerance mechanisms to abiotic stresses. Although CDPKs are recognized as key messengers in signal transduction, the specific role of most members of this family remains unknown. Here we test the hypothesis that OsCPK17 plays a role in rice cold stress response by analyzing OsCPK17 knockout, silencing, and overexpressing rice lines under low temperature. Altered OsCPK17 gene expression compromises cold tolerance performance, without affecting the expression of key cold stress-inducible genes. A comparative phosphoproteomic approach led to the identification of six potential in vivo OsCPK17 targets, which are associated with sugar and nitrogen metabolism, and with osmotic regulation. To test direct interaction, in vitro kinase assays were performed, showing that the sucrose phosphate synthase OsSPS4, and the aquaporin OsPIP2;1/OsPIP2;6 are phosphorylated by OsCPK17 in a calcium-dependent manner. Altogether, our data indicates that OsCPK17 is required for a proper cold stress response in rice, likely affecting the activity of membrane channels and sugar metabolism.
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Pei, Laming; Wang, Jiemin; Li, Kunpeng; Li, Yongjun; Li, Bei; Gao, Feng; Yang, Aifang
2012-01-01
Low phosphate availability is a major constraint on plant growth and agricultural productivity. Engineering a crop with enhanced low phosphate tolerance by transgenic technique could be one way of alleviating agricultural losses due to phosphate deficiency. In this study, we reported that transgenic maize plants that overexpressed the Thellungiella halophila vacuolar H+-pyrophosphatase gene (TsVP) were more tolerant to phosphate deficit stress than the wild type. Under phosphate sufficient conditions, transgenic plants showed more vigorous root growth than the wild type. When phosphate deficit stress was imposed, they also developed more robust root systems than the wild type, this advantage facilitated phosphate uptake, which meant that transgenic plants accumulated more phosphorus. So the growth and development in the transgenic maize plants were not damaged as much as in the wild type plants under phosphate limitation. Overexpression of TsVP increased the expression of genes involved in auxin transport, which indicated that the development of larger root systems in transgenic plants might be due in part to enhanced auxin transport which controls developmental events in plants. Moreover, transgenic plants showed less reproductive development retardation and a higher grain yield per plant than the wild type plants when grown in a low phosphate soil. The phenotypes of transgenic maize plants suggested that the overexpression of TsVP led to larger root systems that allowed transgenic maize plants to take up more phosphate, which led to less injury and better performance than the wild type under phosphate deficiency conditions. This study describes a feasible strategy for improving low phosphate tolerance in maize and reducing agricultural losses caused by phosphate deficit stress. PMID:22952696
Nano-sized calcium phosphate (CaP) carriers for non-viral gene deilvery
Energy Technology Data Exchange (ETDEWEB)
Lee, Donghyun, E-mail: dhlee@cau.ac.kr [Department of Biomedical Engineering, Division of Integrative Engineering, Chung-Ang University, 221 Heukseok-Dong, Dongjak-Gu, Seoul 156-756 (Korea, Republic of); Upadhye, Kalpesh [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Mechanical Engineering and Materials Sceince, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Chemical and Petroleum Engineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States)
2012-02-25
Highlights: Black-Right-Pointing-Pointer Nanostructured calcium phosphates (NanoCaPs): comprehensive review. Black-Right-Pointing-Pointer Non viral gene delivery mechanisms: detailed mechanisms are outlined. Black-Right-Pointing-Pointer Barriers to non-viral gene delivery: detailed barriers are discussed. - Abstract: Gene therapy has garnered much interest due to the potential for curing multiple inherited and/or increases in the acquired diseases. As a result, there has been intense activity from multiple research groups for developing effective delivery methods and carriers, which is a critical step in advancing gene delivery technologies. In order for the carriers to effectively deliver the genetic payloads, multiple extracellular and intracellular barriers need to be overcome. Although overcoming these challenges to improve the effectiveness is critical, the development of safe gene delivery agents is even more vital to assure its use in clinical applications. The development of safe and effective strategies has therefore been a major challenge impeding gene therapy progress. In this regard, calcium phosphate (CaP) based nano-particles has been considered as one of the candidate non-viral gene delivery vehicles, but has been plagued by inconsistent and low transfection efficiencies limiting its progress. There has been major research effort to improve the consistency and effectiveness of CaP based vectors. Currently, it is therefore thought that by controlling the various synthesis factors such as Ca/P ratio, mode of mixing, and type of calcium phosphate phase, such variability and inefficiency could be modulated. This review attempts to provide a comprehensive analysis of the current research activity in the development of CaP based ceramic and polymer-ceramic hybrid systems for non-viral gene delivery. Preliminary transfection results of hydroxyapatite (HA or NanoCaPs), amorphous calcium phosphate (ACP) and brushite phases are also compared to assess the
Directory of Open Access Journals (Sweden)
R. Vasudevan
2014-06-01
Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT
Directory of Open Access Journals (Sweden)
Mariateresa eVolpicella
2016-03-01
Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.
[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].
Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V
2014-01-01
Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR
DEFF Research Database (Denmark)
Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Cirera, Susanna
2007-01-01
-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane synthase (HMBS), hypoxanthine phosphoribosyltransferase I (HPRT I), ribosomal protein L4 (RPL4), succinate dehydrogenase complex subunit A (SDHA), TATA box binding protein (TPB) and tyrosine 3-monooxygenase/tryptophan 5......-monooxygenase activation protein zeta polypeptide (YWHAZ). The stability of these reference genes in different pig tissues was investigated using the geNorm application. The range of expression stability in the genes analysed was (from the most stable to the least stable): ACTB/RPL4, TBP, HPRT, HMBS, YWHAZ...
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek
2008-01-01
A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...
DEFF Research Database (Denmark)
Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo
2016-01-01
identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong
2016-02-10
In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Zanglis, A.; Lianos, E.A.
1987-01-01
We studied the ability of rat glomerular mesangial cells and their microsomal fractions to incorporate 1-[ 14 C]hexadecanol to glycerophospholipids via an O-alkyl ether linkage and assessed the presence and activity of the required enzyme: alkyl-dihydroxy acetone phosphate synthase. Suspensions of cultured mesangial cells incorporated 1-[ 14 C]hexadecanol to the phosphatidyl ethanolamine and phosphatidyl choline lipid pools, via a bond resistant to acid and base hydrolysis. When cell homogenates or microsomal fractions were incubated with palmitoyl-DHAP and 1-[ 14 C]hexadecanol, alkyl-DHAP and 1-O-alkyl glycerol were formed (alkyl:hexadecyl). The activity of the enzyme responsible for the O-alkyl product formation was calculated to be 2.5 +/- 0.3 and 544 +/- 50 pmoles/min/mg protein for mesangial cell homogenates and mesangial cell microsomes, respectively. These observations provide evidence that mesangial cells may elaborate either linked lipid precursors de novo for the biosynthesis of O-alkyl glycerophospholipids
Directory of Open Access Journals (Sweden)
Mariela V Catone
Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.
Sinha, A K; Pathre, U V; Sane, P V
1998-11-10
Chemical modification of sucrose-phosphate synthase (EC 2.4.1.14) from Prosopis juliflora by diethyl pyrocarbonate (DEP) and photo-oxidation in the presence of rose bengal (RB) which modify the histidyl residues of the protein resulted in the inactivation of the enzyme activity. This inactivation was dependent on the concentration of the modifying reagent and the time of incubation and followed pseudo-first order kinetics. For both the reagents, the inactivation was maximum at pH 7.5, which is consistent with the involvement and presence of histidine residues at the active site of the enzyme. Substrates, UDPG and F6P protected the enzyme against the inactivation by the modifying reagents suggesting that the histidine residues may be involved in the binding of these substrates and are essential for the catalytic activity. Specificity of DEP was indicated by an increase in absorbance at 240 nm along with concomitant inactivation of the enzyme and reactivation of the modified enzyme by hydroxylamine. These results strongly suggest the presence of histidine residue(s) at or near the active site of the enzyme.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Cloning and expression of pineapple sucrosephosphate synthase ...
African Journals Online (AJOL)
A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2017-08-09
Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.
Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G
2015-04-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
DEFF Research Database (Denmark)
Liepman, Aaron H; Nairn, C Joseph; Willats, William G T
2007-01-01
from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...
Directory of Open Access Journals (Sweden)
Gnanasambandan Ramanathan
2017-01-01
Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.
Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.
2015-01-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
Alkharouf, Nadim W; Klink, Vincent P; Chouikha, Imed B; Beard, Hunter S; MacDonald, Margaret H; Meyer, Susan; Knap, Halina T; Khan, Rana; Matthews, Benjamin F
2006-09-01
Changes in gene expression within roots of Glycine max (soybean), cv. Kent, susceptible to infection by Heterodera glycines (the soybean cyst nematode [SCN]), at 6, 12, and 24 h, and 2, 4, 6, and 8 days post-inoculation were monitored using microarrays containing more than 6,000 cDNA inserts. Replicate, independent biological samples were examined at each time point. Gene expression was analyzed statistically using T-tests, ANOVA, clustering algorithms, and online analytical processing (OLAP). These analyses allow the user to query the data in several ways without importing the data into third-party software. RT-PCR confirmed that WRKY6 transcription factor, trehalose phosphate synthase, EIF4a, Skp1, and CLB1 were differentially induced across most time-points. Other genes induced across most timepoints included lipoxygenase, calmodulin, phospholipase C, metallothionein-like protein, and chalcone reductase. RT-PCR demonstrated enhanced expression during the first 12 h of infection for Kunitz trypsin inhibitor and sucrose synthase. The stress-related gene, SAM-22, phospholipase D and 12-oxophytodienoate reductase were also induced at the early time-points. At 6 and 8 dpi there was an abundance of transcripts expressed that encoded genes involved in transcription and protein synthesis. Some of those genes included ribosomal proteins, and initiation and elongation factors. Several genes involved in carbon metabolism and transport were also more abundant. Those genes included glyceraldehyde 3-phosphate dehydrogenase, fructose-bisphosphate aldolase and sucrose synthase. These results identified specific changes in gene transcript levels triggered by infection of susceptible soybean roots by SCN.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.
2012-01-01
The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...
DEFF Research Database (Denmark)
Costa, M C; Helweg-Larsen, J; Lundgren, Bettina
2003-01-01
The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)
Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru
2018-04-01
Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.
Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.
2014-01-01
Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527
Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin
2017-01-01
RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Directory of Open Access Journals (Sweden)
Meng eWang
2013-05-01
Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
Khurana, Neetika; Chauhan, Harsh; Khurana, Paramjit
2012-01-01
Molecular dissection and a deeper analysis of the heat stress response mechanism in wheat have been poorly understood so far. This study delves into the molecular basis of action of TaMIPS, a heat stress-inducible enzyme that was identified through PCR-select subtraction technology, which is named here as TaMIPS2. MIPS (L-Myo-inositol-phosphate synthase) is important for the normal growth and development in plants. Expression profiling showed that TaMIPS2 is expressed during different developing seed stages upon heat stress. Also, the transcript levels increase in unfertilized ovaries and significant amounts are present during the recovery period providing evidence that MIPS is crucial for its role in heat stress recovery and flower development. Alternatively spliced forms from rice and Arabidopsis were also identified and their expression analysis revealed that apart from heat stress, some of the spliced variants were also inducible by drought, NaCl, Cold, ABA, BR, SA and mannitol. In silico promoter analysis revealed various cis-elements that could contribute for the differential regulation of MIPS in different plant systems. Phylogenetic analysis indicated that MIPS are highly conserved among monocots and dicots and TaMIPS2 grouped specifically with monocots. Comparative analyses was undertaken by different experimental approaches, i.e., semi-quantitative RT-PCR, quantitative RT-PCR, Genevestigator as a reference expression tool and motif analysis to predict the possible function of TaMIPS2 in regulating the different aspects of plant development under abiotic stress in wheat.
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Noar, Roslyn D; Daub, Margaret E
2016-01-01
Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Directory of Open Access Journals (Sweden)
Roslyn D Noar
Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Directory of Open Access Journals (Sweden)
Resnanti Utami Handayani
2014-07-01
Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika
2017-12-01
An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.
Kudoh, Kai; Kawano, Yusuke; Hotta, Shingo; Sekine, Midori; Watanabe, Takafumi; Ihara, Masaki
2014-07-01
Cyanobacteria have recently been receiving considerable attention owing to their potential as photosynthetic producers of biofuels and biomaterials. Here, we focused on the production of isoprenoids by cyanobacteria, and aimed to provide insight into metabolic engineering design. To this end, we examined the over-expression of a key enzyme in 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway, 1-deoxy-d-xylulose 5-phosphate synthase (DXS) in the cyanobacterium Synechocystis sp. PCC6803. In the DXS-over-expression strain (Dxs_ox), the mRNA and protein levels of DXS were 4-times and 1.5-times the levels in the wild-type (WT) strain, respectively. The carotenoid content of the Dxs_ox strain (8.4 mg/g dry cell weight [DCW]) was also up to 1.5-times higher than that in the WT strain (5.6 mg/g DCW), whereas the glycogen content dramatically decreased to an undetectable level. These observations suggested that the carotenoid content in the Dxs_ox strain was increased by consuming glycogen, which is a C-storage compound in cyanobacteria. We also quantified the total sugar (145 and 104 mg/g DCW), total fatty acids (31 and 24 mg/g DCW) and total protein (200 and 240 mg/g DCW) content in the WT and Dxs_ox strains, respectively, which were much higher than the carotenoid content. In particular, approximately 54% of the proteins were phycobiliproteins. This study demonstrated the major destinations of carbon flux in cyanobacteria, and provided important insights into metabolic engineering. Target yield can be improved through optimization of gene expression, the DXS protein stabilization, cell propagation depression and restriction of storage compound synthesis. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
But, Sergey Y; Solntseva, Natalia P; Egorova, Svetlana V; Mustakhimov, Ildar I; Khmelenina, Valentina N; Reshetnikov, Alexander; Trotsenko, Yuri A
2018-05-01
Four enzymes involved in sucrose metabolism: sucrose phosphate synthase (Sps), sucrose phosphate phosphatase (Spp), sucrose synthase (Sus) and fructokinase (FruK), were obtained as his-tagged proteins from the moderately thermophilic methanotroph Methylocaldum szegediense O12. Sps, Spp, FruK and Sus demonstrated biochemical properties similar to those of other bacterial counterparts, but the translated amino acid sequences of Sps and Spp displayed high divergence from the respective microbial enzymes. The Sus of M. szegediense O12 catalyzed the reversible reaction of sucrose cleavage in the presence of ADP or UDP and preferred ADP as a substrate, thus implying a connection between sucrose and glycogen metabolism. Sus-like genes were found only in a few methanotrophs, whereas amylosucrase was generally used in sucrose cleavage in this group of bacteria. Like other microbial fructokinases, FruK of M. szegediense O12 showed a high specificity to fructose.
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
Human-Phosphate-Binding-Protein inhibits HIV-1 gene transcription and replication
Directory of Open Access Journals (Sweden)
Candolfi Ermanno
2011-07-01
Full Text Available Abstract The Human Phosphate-Binding protein (HPBP is a serendipitously discovered lipoprotein that binds phosphate with high affinity. HPBP belongs to the DING protein family, involved in various biological processes like cell cycle regulation. We report that HPBP inhibits HIV-1 gene transcription and replication in T cell line, primary peripherical blood lymphocytes and primary macrophages. We show that HPBP is efficient in naïve and HIV-1 AZT-resistant strains. Our results revealed HPBP as a new and potent anti HIV molecule that inhibits transcription of the virus, which has not yet been targeted by HAART and therefore opens new strategies in the treatment of HIV infection.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
DEFF Research Database (Denmark)
Pacak, Andrzej; Barciszewska-Pacak, Maria; Swida-Barteczka, Aleksandra
2016-01-01
Phosphorus (P) in plants is taken from soil as an inorganic phosphate (Pi) and is one of the most important macroelements in growth and development. Plants actively react to Pi starvation by the induced expression of Pi transporters, MIR399, MIR827, and miR399 molecular sponge - IPS1 genes...... and by the decreased expression of the ubiquitin-conjugating enzyme E2 (PHOSPHATE2 - PHO2) and Pi sensing and transport SPX-MFS genes. The PHO2 protein is involved in the degradation of Pi transporters PHT1;1 (from soil to roots) and PHO1 (from roots to shoots). The decreased expression of PHO2 leads to Pi....... In shoots, the PHO2 mRNA level is decreased, leading to an increased Pi level. We concluded that Pi homeostasis in barley during heat stress is maintained by dynamic changes in Pi-related genes expression....
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
Lane, Courtney E; Benton, Michael G
2015-12-01
A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying
2016-12-28
The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.
Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase
DEFF Research Database (Denmark)
Andersen, Rune W.; Lo Leggio, Leila; Hove-Jensen, Bjarne
2015-01-01
The enzyme 5-phosphoribosyl-1-α-diphosphate (PRPP) synthase (EC 2.7.6.1) catalyses the Mg2+-dependent transfer of a diphosphoryl group from ATP to the C1 hydroxyl group of ribose 5-phosphate resulting in the production of PRPP and AMP. A nucleotide sequence specifying Sulfolobus solfataricus PRPP...
International Nuclear Information System (INIS)
Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.
2006-01-01
The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Stieglitz, Kimberly A; Yang, Hongying; Roberts, Mary F; Stec, Boguslaw
2005-01-11
myo-Inositol-1-phosphate synthase (mIPS) catalyzes the first step in the synthesis of l-myo-inositol-1-phosphate. We have solved and refined the structure of the mIPS from the hyperthermophilic sulfate reducer Archaeoglobus fulgidus at 1.9 A resolution. The enzyme crystallized from poly(ethylene glycol) in the P1 space group with one tetramer in the asymmetric unit and provided a view of the entire biologically active oligomer. Despite significant changes in sequence length and amino acid composition, the general architecture of the archaeal enzyme is similar to that of the eukaryotic mIPS from Saccharomyces cerevisiae and bacterial mIPS from Mycobacterium tuberculosis. The enhanced thermostability of the archaeal enzyme as compared to that from yeast is consistent with deletion of a number of surface loops that results in a significantly smaller protein. In the structure of the A. fulgidus mIPS, the active sites of all four subunits were fully ordered and contained NAD(+) and inorganic phosphate. The structure also contained a single metal ion (identified as K(+)) in two of the four subunits. The analysis of the electrostatic potential maps of the protein suggested the presence of a second metal-ion-binding site in close proximity to the first metal ion and NAD(+). The modeling of the substrate and known inhibitors suggests a critical role for the second metal ion in catalysis and provides insights into the common elements of the catalytic cycle in enzymes from different life kingdoms.
Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh
2008-01-01
of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...
Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei
2013-01-01
Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
DEFF Research Database (Denmark)
Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri
2014-01-01
BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...
Enhancement of vascular targeting by inhibitors of nitric oxide synthase
International Nuclear Information System (INIS)
Davis, Peter D.; Tozer, Gillian M.; Naylor, Matthew A.; Thomson, Peter; Lewis, Gemma; Hill, Sally A.
2002-01-01
Purpose: This study investigates the enhancement of the vascular targeting activity of the tubulin-binding agent combretastatin A4 phosphate (CA4P) by various inhibitors of nitric oxide synthases. Methods and Materials: The syngeneic tumors CaNT and SaS growing in CBA mice were used for this study. Reduction in perfused vascular volume was measured by injection of Hoechst 33342 24 h after drug administration. Necrosis (hematoxylin and eosin stain) was assessed also at 24 h after treatment. Combretastatin A4 phosphate was synthesized by a modification of the published procedure and the nitric oxide synthase inhibitors L-NNA, L-NMMA, L-NIO, L-NIL, S-MTC, S-EIT, AMP, AMT, and L-TC, obtained from commercial sources. Results: A statistically significant augmentation of the reduction in perfused vascular volume by CA4P in the CaNT tumor was observed with L-NNA, AMP, and AMT. An increase in CA4P-induced necrosis in the same tumor achieved significance with L-NNA, L-NMMA, L-NIL, and AMT. CA4P induced little necrosis in the SaS tumor, but combination with the inhibitors L-NNA, L-NMMA, L-NIO, S-EIT, and L-TC was effective. Conclusions: Augmentation of CA4P activity by nitric oxide synthase inhibitors of different structural classes supports a nitric oxide-related mechanism for this effect. L-NNA was the most effective inhibitor studied
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Gebril, Sayed; Seger, Mark; Villanueva, Fabiola Muro; Ortega, Jose Luis; Bagga, Suman; Sengupta-Gopalan, Champa
2015-10-01
Overexpression of SPS in alfalfa is accompanied by early flowering, increased plant growth and an increase in elemental N and protein content when grown under N2-fixing conditions. Sucrose phosphate synthase (SPS; EC 2.3.1.14) is the key enzyme in the synthesis of sucrose in plants. The outcome of overexpression of SPS in different plants using transgenic approaches has been quite varied, but the general consensus is that increased SPS activity is associated with the production of new sinks and increased sink strength. In legumes, the root nodule is a strong C sink and in this study our objective was to see how increasing SPS activity in a legume would affect nodule number and function. Here we have transformed alfalfa (Medicago sativa, cv. Regen SY), with a maize SPS gene driven by the constitutive CaMV35S promoter. Our results showed that overexpression of SPS in alfalfa, is accompanied by an increase in nodule number and mass and an overall increase in nitrogenase activity at the whole plant level. The nodules exhibited an increase in the level of key enzymes contributing to N assimilation including glutamine synthetase and asparagine synthetase. Moreover, the stems of the transformants showed higher level of the transport amino acids, Asx, indicating increased export of N from the nodules. The transformants exhibited a dramatic increase in growth both of the shoots and roots, and earlier flowering time, leading to increased yields. Moreover, the transformants showed an increase in elemental N and protein content. The overall conclusion is that increased SPS activity improves the N status and plant performance, suggesting that the availability of more C in the form of sucrose enhances N acquisition and assimilation in the nodules.
Kalujnaia, Svetlana; Hazon, Neil; Cramb, Gordon
2016-08-01
A single MIPS gene (Isyna1/Ino1) exists in eel and tilapia genomes with a single myo-d-inositol 3-phosphate synthase (MIPS) transcript identified in all eel tissues, although two MIPS spliced variants [termed MIPS(s) and MIPS(l)] are found in all tilapia tissues. The larger tilapia transcript [MIPS(l)] results from the inclusion of the 87-nucleotide intron between exons 5 and 6 in the genomic sequence. In most tilapia tissues, the MIPS(s) transcript exhibits much higher abundance (generally >10-fold) with the exception of white skeletal muscle and oocytes, in which the MIPS(l) transcript predominates. SW acclimation resulted in large (6- to 32-fold) increases in mRNA expression for both MIPS(s) and MIPS(l) in all tilapia tissues tested, whereas in the eel, changes in expression were limited to a more modest 2.5-fold increase and only in the kidney. Western blots identified a number of species- and tissue-specific immunoreactive MIPS proteins ranging from 40 to 67 kDa molecular weight. SW acclimation failed to affect the abundance of any immunoreactive protein in any tissue tested from the eel. However, a major 67-kDa immunoreactive protein (presumed to be MIPS) found in tilapia tissues exhibited 11- and 54-fold increases in expression in gill and fin samples from SW-acclimated fish. Immunohistochemical investigations revealed specific immunoreactivity in the gill, fin, skin, and intestine taken from only SW-acclimated tilapia. Immunofluorescence indicated that MIPS was expressed within gill chondrocytes and epithelial cells of the primary filaments, basal epithelial cell layers of the skin and fin, the cytosol of columnar intestinal epithelial and mucous cells, as well as unknown entero-endocrine-like cells. Copyright © 2016 the American Physiological Society.
Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny
2016-03-09
Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Structural basis for phosphatidylinositol-phosphate biosynthesis
Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo
2015-10-01
Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.
Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert
2017-11-30
Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
International Nuclear Information System (INIS)
Pratt, M.L.; Hsu, P.Y.; DeMoss, J.A.
1986-01-01
Tryptophan synthase (TS), which catalyzes the final step of tryptophan biosynthesis, is a multifunctional protein requiring pyridoxal phosphate (B6P) for two of its three distinct enzyme activities. TS from Neurospora has a blocked N-terminal, is a homodimer of 150 KDa and binds one mole of B6P per mole of subunit. The authors shown the N-terminal residue to be acyl-serine. The B6P-active site of holoenzyme was labelled by reduction of the B6P-Schiff base with [ 3 H]-NaBH 4 , and resulted in a proportionate loss of activity in the two B6P-requiring reactions. SDS-polyacrylamide gel electrophoresis of CNBr-generated peptides showed the labelled, active site peptide to be 6 KDa. The sequence of this peptide, purified to apparent homogeneity by a combination of C-18 reversed phase and TSK gel filtration HPLC is: gly-arg-pro-gly-gln-leu-his-lys-ala-glu-arg-leu-thr-glu-tyr-ala-gly-gly-ala-gln-ile-xxx-leu-lys-arg-glu-asp-leu-asn-his-xxx-gly-xxx-his-/sub ***/-ile-asn-asn-ala-leu. Although four residues (xxx, /sub ***/) are unidentified, this peptide is minimally 78% homologous with the corresponding peptide from yeast TS, in which residue (/sub ***/) is the lysine that binds B6P
Feng, Liguo; Chen, Chen; Li, Tinglin; Wang, Meng; Tao, Jun; Zhao, Daqiu; Sheng, Lixia
2014-02-01
Rosa rugosa is an important ornamental and economical plant. In this paper, four genes encoding 1-deoxy-D-xylulose-5-phosphate synthase (DXS), 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), alcohol acyltransferase (AAT) and linalool synthase (LIS) involved in the monoterpene biosynthesis pathways were isolated from R. rugosa 'Tangzi', and the expression patterns of these genes in different flower development stages and different parts of floral organs were determined by real-time quantitative fluorescence PCR. Furthermore, a comprehensive analysis was carried out into the relationship between expression of four monoterpene synthesis genes and accumulation of main volatile monoterpenes and their acetic acid ester derivatives. The results showed that the genes RrDXS, RrDXR and RrLIS showed consistent expressions during the development process for R. rugosa flower from budding to withering stage, the overall expression levels of gene RrDXS and RrLIS were obviously lower as compared with those of gene RrDXR and RrAAT. Although the gene RrDXS, RrDXR, RrAAT and RrLIS were expressed in all parts of R. rugosa floral organs, the expression levels varied significantly. The variations in the constituent and content of volatile monoterpenes including citronellol, geraniol, nerol, linalool, citronellyl acetate, geranyl acetate and neryl acetate at different development stages and parts of floral organs were significantly different. On this basis, we concluded that the gene RrDXR and RrAAT might play a key role in the biosynthesis of volatile monoterpenes in R. rugosa flowers, and the two genes are important candidate genes for the regulation of secondary metabolism for rose aromatic components. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
Directory of Open Access Journals (Sweden)
Jan Korte
2016-12-01
Full Text Available Trehalose biosynthesis is considered an attractive target for the development of antimicrobials against fungal, helminthic and bacterial pathogens including Mycobacterium tuberculosis. The most common biosynthetic route involves trehalose-6-phosphate (T6P synthase OtsA and T6P phosphatase OtsB that generate trehalose from ADP/UDP-glucose and glucose-6-phosphate. In order to assess the drug target potential of T6P phosphatase, we generated a conditional mutant of M. tuberculosis allowing the regulated gene silencing of the T6P phosphatase gene otsB2. We found that otsB2 is essential for growth of M. tuberculosis in vitro as well as for the acute infection phase in mice following aerosol infection. By contrast, otsB2 is not essential for the chronic infection phase in mice, highlighting the substantial remodelling of trehalose metabolism during infection by M. tuberculosis. Blocking OtsB2 resulted in the accumulation of its substrate T6P, which appears to be toxic, leading to the self-poisoning of cells. Accordingly, blocking T6P production in a ΔotsA mutant abrogated otsB2 essentiality. T6P accumulation elicited a global upregulation of more than 800 genes, which might result from an increase in RNA stability implied by the enhanced neutralization of toxins exhibiting ribonuclease activity. Surprisingly, overlap with the stress response caused by the accumulation of another toxic sugar phosphate molecule, maltose-1-phosphate, was minimal. A genome-wide screen for synthetic lethal interactions with otsA identified numerous genes, revealing additional potential drug targets synergistic with OtsB2 suitable for combination therapies that would minimize the emergence of resistance to OtsB2 inhibitors.
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.
2015-01-01
Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039
International Nuclear Information System (INIS)
Castellino, S.; Leo, G.C.; Sammons, R.D.; Sikorski, J.A.
1989-01-01
The herbicidal dead-end ternary complex (E S3P Glyph ) of glyphosate [N-(phosphonomethyl)glycine] with 5-enolpyruvoylshikimate-3-phosphate synthase (EPSPS) and the substrate shikimate 3-phosphate (S3P) has been characterized by 31 P, 15 N, and 13 C NMR. The NMR spectra of EPSPS-bound glyphosate show unique chemical shifts (δ) for each of the three nuclei. By 31 P NMR, glyphosate in the dead-end complex is a distinct species 3.5 ppm downfield from free glyphosate. The 13 C signal of glyphosate in the dead-end complex is shifted 4 ppm downfield from that of free glyphosate. The 15 N signal for glyphosate (99%) in the dead-end complex is 5 ppm further downfield than that of any free zwitterionic species and 10 ppm downfield from that of the average free species at pH 10.1. The structures of each ionic state of glyphosate are modeled with force field calculations by using MacroModel. A correlation is made for the 31 P δ and the C-P-O bond angle, and the 13 C and 15 N δ values are postulated to be related to C-C-O and C-N-C bond angles, respectively. The downfield 31 P chemical shift perturbation for S3P in the EPSPS binary complex is consistent with ionization of the 3-phosphate of S3P upon binding. Comparison with the S3P 31 P δ vs pH titration curve specifies predominantly the dianion of the 3-phosphate in the E S3P binary complex, while the E S3P Glyph complex indicates net protonation at the 3-phosphate. Chemical shift perturbations of this latter type may be explained by changes in the O-P-O bond angle
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Trehalose-6-Phosphate: connecting plant metabolism and development
Directory of Open Access Journals (Sweden)
Jathish ePonnu
2011-11-01
Full Text Available Beyond their metabolic roles, sugars can also act as messengers in signal transduction. Trehalose, a sugar found in many species of plants and animals, is a non-reducing disaccharide composed of two glucose moieties. Its synthesis in plants is a two-step process, involving the production of trehalose-6-phosphate (T6P catalyzed by TREHALOSE-6-PHOSPHATE SYNTHASE (TPS and its consecutive dephosphorylation to trehalose, catalyzed by TREHALOSE-6-PHOSPHATE PHOSPHATASE (TPP. T6P has recently emerged as an important signaling metabolite, regulating carbon assimilation and sugar status in plants. In addition, T6P has also been demonstrated to play an essential role in plant development. This review recapitulates the recent advances in our understanding the role of T6P in coordinating diverse metabolic and developmental processes.
Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R Douglas; Powles, Stephen B
2015-04-01
Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I+P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. © 2015 American Society of Plant Biologists. All Rights Reserved.
Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....
Sinha, A K; Shirke, P A; Pathre, U; Sane, P V
1997-10-01
Light dependent modulation of sucrose-phosphate synthase activity (SPS; EC 2.4.1.14) was studied in a tree species, namely Prosopis juliflora. In this paper we demonstrate that cycloheximide, an inhibitor of cytoplasmic protein synthesis, when fed to detached leaves of P. juliflora through transpiration stream in the dark or in light completely prevents in vivo light activation of Vlim and Vmax activities of SPS. In case of spinach, however, cycloheximide feeding affects only Vlim activity while Vmax activity remained unchanged. In contrast, chloramphenicol, an inhibitor of protein synthesis in chloroplast has no effect on the light activation of SPS in Prosopis. The treatment with cycloheximide showed slight reduction in the rate of O2 evolution indicating that cycloheximide had very little effect on overall photosynthesis. These results indicate that short term protein turnover of the SPS protein and some other essential component(s) (e.g., a putative protein that modifies SPS activity) is one of the primary steps in a complex and unique regulatory cascade effecting the reversible light activation of SPS.
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J
1999-01-01
Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....
International Nuclear Information System (INIS)
Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano
2014-01-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal
Energy Technology Data Exchange (ETDEWEB)
Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)
2014-07-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Directory of Open Access Journals (Sweden)
Arsa Thammahong
2017-04-01
Full Text Available Trehalose biosynthesis is found in fungi but not humans. Proteins involved in trehalose biosynthesis are essential for fungal pathogen virulence in humans and plants through multiple mechanisms. Loss of canonical trehalose biosynthesis genes in the human pathogen Aspergillus fumigatus significantly alters cell wall structure and integrity, though the mechanistic link between these virulence-associated pathways remains enigmatic. Here we characterize genes, called tslA and tslB, which encode proteins that contain domains similar to those corresponding to trehalose-6-phosphate phosphatase but lack critical catalytic residues for phosphatase activity. Loss of tslA reduces trehalose content in both conidia and mycelia, impairs cell wall integrity, and significantly alters cell wall structure. To gain mechanistic insights into the role that TslA plays in cell wall homeostasis, immunoprecipitation assays coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS were used to reveal a direct interaction between TslA and CsmA, a type V chitin synthase enzyme. TslA regulates not only chitin synthase activity but also CsmA sub-cellular localization. Loss of TslA impacts the immunopathogenesis of murine invasive pulmonary aspergillosis through altering cytokine production and immune cell recruitment. In conclusion, our data provide a novel model whereby proteins in the trehalose pathway play a direct role in fungal cell wall homeostasis and consequently impact fungus-host interactions.
Marani, Mariela M; Costa, Joana; Mafra, Isabel; Oliveira, Maria Beatriz P P; Camperi, Silvia A; Leite, José Roberto de Souza Almeida
2015-03-01
For the prospective immunorecognition of 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) as a biomarker protein expressed by transgenic soybean, an extensive in silico evaluation of the referred protein was performed. The main objective of this study was the selection of a set of peptides that could function as potential immunogens for the production of novel antibodies against CP4-EPSPS protein. For this purpose, the protein was in silico cleaved with trypsin/chymotrypsin and the resultant peptides were extensively analyzed for further selection of the best candidates for antibody production. The analysis enabled the successful proposal of four peptides with potential immunogenicity for their future use as screening biomarkers of genetically modified organisms. To our knowledge, this is the first attempt to select and define potential linear epitopes for the immunization of animals and, subsequently, to generate adequate antibodies for CP4-EPSPS recognition. The present work will be followed by the synthesis of the candidate peptides to be incubated in animals for antibody generation and potential applicability for the development of an immunosensor for CP4-EPSPS detection. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
Baerson, Scott R; Rodriguez, Damian J; Tran, Minhtien; Feng, Yongmei; Biest, Nancy A; Dill, Gerald M
2002-07-01
The spontaneous occurrence of resistance to the herbicide glyphosate in weed species has been an extremely infrequent event, despite over 20 years of extensive use. Recently, a glyphosate-resistant biotype of goosegrass (Eleusine indica) was identified in Malaysia exhibiting an LD(50) value approximately 2- to 4-fold greater than the sensitive biotype collected from the same region. A comparison of the inhibition of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity by glyphosate in extracts prepared from the resistant (R) and sensitive (S) biotypes revealed an approximately 5-fold higher IC(50)(glyphosate) for the (R) biotype. Sequence comparisons of the predicted EPSPS mature protein coding regions from both biotypes revealed four single-nucleotide differences, two of which result in amino acid changes. One of these changes, a proline to serine substitution at position 106 in the (R) biotype, corresponds to a substitution previously identified in a glyphosate-insensitive EPSPS enzyme from Salmonella typhimurium. Kinetic data generated for the recombinant enzymes suggests that the second substitution identified in the (R) EPSPS does not contribute significantly to its reduced glyphosate sensitivity. Escherichia coli aroA- (EPSPS deficient) strains expressing the mature EPSPS enzyme from the (R) biotype exhibited an approximately 3-fold increase in glyphosate tolerance relative to strains expressing the mature EPSPS from the (S) biotype. These results provide the first evidence for an altered EPSPS enzyme as an underlying component of evolved glyphosate resistance in any plant species.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
Directory of Open Access Journals (Sweden)
Lei Gao
Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K
1999-03-01
The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.
Energy Technology Data Exchange (ETDEWEB)
Miao, Yi; Tenor, Jennifer L.; Toffaletti, Dena L.; Maskarinec, Stacey A.; Liu, Jiuyu; Lee, Richard E.; Perfect, John R.; Brennan, Richard G.; Hendrickson, Wayne A.
2017-07-25
The disaccharide trehalose is critical to the survival of pathogenic fungi in their human host. Trehalose-6-phosphate synthase (Tps1) catalyzes the first step of trehalose biosynthesis in fungi. Here, we report the first structures of eukaryotic Tps1s in complex with substrates or substrate analogues. The overall structures of Tps1 from
Energy Technology Data Exchange (ETDEWEB)
Dias, Danielle F.; Alves, Ricardo J., E-mail: ricardodylan@farmacia.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia; Roux, Celine; Durand, Philippe; Iorga, Bogdan; Badet-Denisot, Marie A.; Badet, Bernard [Centre National de la Recherche Scientifique (CNRS), Gif-sur-Yvette (France). Inst. de Chimie des Substances Naturelles
2010-07-01
The aminosugars are very important structural components of bacterial and fungi cell walls. Glucosamine-6-phosphate synthase (GlmS), which catalyses the first step of the aminosugar biosynthetic pathway i.e. the formation of D-glucosamine-6-phosphate from D-fructose-6-phosphate, is therefore an interesting target in the fight against microorganisms. In this work is described the synthesis of aromatic analogs of 2-amino-2-deoxy-D-glucitol-6-phosphate (ADGP) and its epimer 2-amino-2-deoxy-D-manitol-6-phosphate (ADMP), two important inhibitors of GlmS. The aromatic analogs displayed modest inhibitory activity against GlmS, with IC{sub 50} in the mmol L{sup -1} range. (author)
Directory of Open Access Journals (Sweden)
Lin-Hui Gao
2018-01-01
Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.
DEFF Research Database (Denmark)
Ebbesson, Lars O E; Tipsmark, Christian K; Holmqvist, Bo
2005-01-01
We investigated the relationship between nitric oxide (NO) and Na(+),K(+)-ATPase (NKA) in the gill of anadromous Atlantic salmon. Cells containing NO-producing enzymes were revealed by means of nitric oxide synthase (NOS) immunocytochemistry and nicotinamide adenine dinucleotide phosphate diaphor...
Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells
International Nuclear Information System (INIS)
Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.
1986-01-01
Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms
Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.
Kumar, Rahul
2016-01-01
Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.
Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major
Roundup Ready soybean gene concentrations in field soil aggregate size classes.
Levy-Booth, David J; Gulden, Robert H; Campbell, Rachel G; Powell, Jeff R; Klironomos, John N; Pauls, K Peter; Swanton, Clarence J; Trevors, Jack T; Dunfield, Kari E
2009-02-01
Roundup Ready (RR) soybeans containing recombinant Agrobacterium spp. CP4 5-enol-pyruvyl-shikimate-3-phosphate synthase (cp4 epsps) genes tolerant to the herbicide glyphosate are extensively grown worldwide. The concentration of recombinant DNA from RR soybeans in soil aggregates was studied due to the possibility of genetic transformation of soil bacteria. This study used real-time PCR to examine the concentration of cp4 epsps in four field soil aggregate size classes (>2000 microm, 2000-500 microm, 500-250 microm and 2000 mum fraction contained between 66.62% and 99.18% of total gene copies, although it only accounted for about 30.00% of the sampled soil. Aggregate formation may facilitate persistence of recombinant DNA.
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major
Directory of Open Access Journals (Sweden)
Aditya Dev
2013-06-01
Full Text Available The Shikimate pathway is an attractive target for herbicides and antimicrobial agents because it is essential in microbes and plants but absent in animals. The 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS is the first enzyme of this pathway, which is involved in the condensation of phosphoenolpyruvate (PEP and D-erythrose 4-phosphate (E4P to produce 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP. DAHPS enzymes have been divided into two types, class I and class II, based on their primary amino acid sequence and three dimensional structures. The plant DAHPS belongs to class II and is regulated differently than DAHPS from microorganisms. To understand the structural basis of such differences in DAHPS from plants and its catalytic mechanism, we have used sequence analysis, homology modeling and docking approach to generate the three dimensional models of DAHP synthase from Brachypodium distachyon (Bd-DAHPS complexed with substrate PEP for the first time. The three dimensional models of Bd-DAHPS provides a detailed knowledge of the active site and the important secondary structural regions that play significant roles in the regulatory mechanism and further may be helpful for design of specific inhibitors towards herbicide development.
Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling
2016-01-01
Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Phosphate acquisition efficiency and phosphate starvation tolerance ...
Indian Academy of Sciences (India)
3Department of Genetics and Plant Breeding, College of Agriculture, Lembucherra, Tripura 799 ... vated in soil like red and lateritic or acid, with low soluble phosphate content. ..... activation of genes involved in the adaptation of Arabidopsis to.
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
International Nuclear Information System (INIS)
Sheorain, V.S.; Ramakrishna, S.; Benjamin, W.B.; Soderling, T.R.
1985-01-01
A multifunctional protein kinase, purified from rat liver as ATP-citrate lyase kinase, has been identified as a glycogen synthase kinase. This kinase catalyzed incorporation of up to 1.5 mol of and]2number 2 PO 4 /mol of synthase subunit associated with a decrease in the glycogen synthase activity ratio from 0.85 to a value of 0.15. Approximately 65-70% of the 34 PO 4 was incorporated into site 3 and 30-35% into site 2 as determined by reverse phase high performance liquid chromatography. This multifunctional kinase was distinguished from glycogen synthase kinase-3 on the basis of nucleotide and protein substrate specificities. Since the phosphate contents in glycogen synthase of sites 3 and 2 are altered in diabetes and by insulin administration, the possible involvement of the multifunctional kinase was explored. Glycogen synthase purified from diabetic rabbits was phosphorylated in vitro by this multifunctional kinase at only 10% of the rate compared to synthase purified from control rabbits. Treatment of the diabetics with insulin restored the synthase to a form that was readily phosphorylated in vitro
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Duan, Jianfeng; Tian, Hui; Drijber, Rhae A; Gao, Yajun
2015-11-01
Previous studies have reported that the expression of phosphate (Pi) or nitrogen (N) transporter genes in roots of plants could be regulated by arbuscular mycorrhizal (AM) fungi, but little is known whether the regulation is systemic or not. The present study investigated the systemic and local regulation of multiple phosphate and nitrogen transporter genes by four AM fungal species belonging to four genera in the roots of winter wheat. A split-root culture system with AM inoculated (MR) and non-inoculated root compartments (NR) was used to investigate the systemic or local responses of phosphate and nitrogen transporter genes to colonization by four AM fungi in the roots of wheat. The expression of four Pi transporter, five nitrate transporter, and three ammonium transporter genes was quantified using real-time PCR. Of the four AM fungi tested, all locally increased expression of the AM-inducible Pi transporter genes, and most locally decreased expression of a Pi-starvation inducible Pi transporter gene. The addition of N in soil increased the expression of either Pi starvation inducible Pi transporters or AM inducible Pi transporters. Inoculation with AM fungi either had no effect, or could locally or systemically down-regulate expression of nitrogen transporter genes depending on gene type and AM fungal species. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Zaccardi, Margot J; Mannweiler, Olga; Boehr, David D
2012-02-10
Thermophilic enzymes tend to be less catalytically-active at lower temperatures relative to their mesophilic counterparts, despite having very similar crystal structures. An often cited hypothesis for this general observation is that thermostable enzymes have evolved a more rigid tertiary structure in order to cope with their more extreme, natural environment, but they are also less flexible at lower temperatures, leading to their lower catalytic activity under mesophilic conditions. An alternative hypothesis, however, is that complementary thermophilic-mesophilic enzyme pairs simply operate through different evolutionary-optimized catalytic mechanisms. In this communication, we present evidence that while the steps of the catalytic mechanisms for mesophilic and thermophilic indole-3-glycerol phosphate synthase (IGPS) enzymes are fundamentally similar, the identity of the rate-determining step changes as a function of temperature. Our findings indicate that while product release is rate-determining at 25°C for thermophilic IGPS, near its adaptive temperature (75°C), a proton transfer event, involving a general acid, becomes rate-determining. The rate-determining steps for thermophilic and mesophilic IGPS enzymes are also different at their respective, adaptive temperatures with the mesophilic IGPS-catalyzed reaction being rate-limited before irreversible CO2 release, and the thermophilic IGPS-catalyzed reaction being rate limited afterwards. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wenxi Yu
Full Text Available Myo-inositol, the precursor of all inositol compounds, is essential for the viability of eukaryotes. Identifying the factors that regulate inositol homeostasis is of obvious importance to understanding cell function and the pathologies underlying neurological and metabolic resulting from perturbation of inositol metabolism. The current study identifies Mck1, a GSK3 homolog, as a novel positive regulator of inositol de novo synthesis in yeast. Mck1 was required for normal activity of myo-inositol phosphate synthase (MIPS, which catalyzes the rate-limiting step of inositol synthesis. mck1Δ cells exhibited a 50% decrease in MIPS activity and a decreased rate of incorporation of [13C6]glucose into [13C6]-inositol-3-phosphate and [13C6]-inositol compared to WT cells. mck1Δ cells also exhibited decreased growth in the presence of the inositol depleting drug valproate (VPA, which was rescued by supplementation of inositol. However, in contrast to wild type cells, which exhibited more than a 40% decrease in MIPS activity in the presence of VPA, the drug did not significantly decrease MIPS activity in mck1Δ cells. These findings indicate that VPA-induced MIPS inhibition is Mck1-dependent, and suggest a model that unifies two current hypotheses of the mechanism of action of VPA-inositol depletion and GSK3 inhibition.
Yu, Wenxi; Daniel, Joshua; Mehta, Dhara; Maddipati, Krishna Rao; Greenberg, Miriam L
2017-01-01
Myo-inositol, the precursor of all inositol compounds, is essential for the viability of eukaryotes. Identifying the factors that regulate inositol homeostasis is of obvious importance to understanding cell function and the pathologies underlying neurological and metabolic resulting from perturbation of inositol metabolism. The current study identifies Mck1, a GSK3 homolog, as a novel positive regulator of inositol de novo synthesis in yeast. Mck1 was required for normal activity of myo-inositol phosphate synthase (MIPS), which catalyzes the rate-limiting step of inositol synthesis. mck1Δ cells exhibited a 50% decrease in MIPS activity and a decreased rate of incorporation of [13C6]glucose into [13C6]-inositol-3-phosphate and [13C6]-inositol compared to WT cells. mck1Δ cells also exhibited decreased growth in the presence of the inositol depleting drug valproate (VPA), which was rescued by supplementation of inositol. However, in contrast to wild type cells, which exhibited more than a 40% decrease in MIPS activity in the presence of VPA, the drug did not significantly decrease MIPS activity in mck1Δ cells. These findings indicate that VPA-induced MIPS inhibition is Mck1-dependent, and suggest a model that unifies two current hypotheses of the mechanism of action of VPA-inositol depletion and GSK3 inhibition.
Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei
Directory of Open Access Journals (Sweden)
Yue Ming
2009-06-01
Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Directory of Open Access Journals (Sweden)
Juan Ramón Vanegas Sáenz
Full Text Available Nanoparticles represent promising gene delivery systems in biomedicine to facilitate prolonged gene expression with low toxicity compared to viral vectors. Specifically, nanoparticles of calcium phosphate (nCaP, the main inorganic component of human bone, exhibit high biocompatibility and good biodegradability and have been reported to have high affinity for protein or DNA, having thus been used as gene transfer vectors. On the other hand, Octa-arginine (R8, which has a high permeability to cell membrane, has been reported to improve intracellular delivery systems. Here, we present an optimized method for nCaP-mediated gene delivery using an octa-arginine (R8-functionalized nCaP vector containing a marker or functional gene construct. nCaP particle size was between 220-580 nm in diameter and all R8-functionalized nCaPs carried a positive charge. R8 concentration significantly improved nCaP transfection efficiency with high cell compatibility in human mesenchymal stem cells (hMSC and human osteoblasts (hOB in particular, suggesting nCaPs as a good option for non-viral vector gene delivery. Furthermore, pre-treatment with different endocytosis inhibitors identified that the endocytic pathway differed among cell lines and functionalized nanoparticles, with amiloride increasing transfection efficiency of R8-functionalized nCaPs in hMSC and hOB.
Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud
2007-10-01
Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.
Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.
2013-01-01
Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150
James, Antoni W; Nachiappan, Vasanthi
2014-01-01
In the current study, when phosphate transporters pho88 and pho86 were knocked out they resulted in significant accumulation (84% and 43%) of triacylglycerol (TAG) during phosphate starvation. However in the presence of phosphate, TAG accumulation was only around 45% in both pho88 and pho86 mutant cells. These observations were confirmed by radio-labeling, fluorescent microscope and RT-PCR studies. The TAG synthesizing genes encoding for acyltransferases namely LRO1 and DGA1 were up regulated. This is the first report for accumulation of TAG in pho88Δ and pho86Δ cells under phosphate starvation conditions. Copyright © 2013. Published by Elsevier Ltd.
Energy Technology Data Exchange (ETDEWEB)
Shekhar, Sudhanshu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States); McGowan Institute of Regenerative Medicine, University of Pittsburgh, PA 15261 (United States); Roy, Abhijit; Hong, Daeho [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Chemical Engineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Mechanical Engineering and Materials Science, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States); McGowan Institute of Regenerative Medicine, University of Pittsburgh, PA 15261 (United States)
2016-12-01
Nanostructured ceramic particles, particularly, nanoparticles of calcium phosphate (CaP) remain an attractive option among the various types of non-viral gene delivery vectors studied because of their safety, biocompatibility, biodegradability, and ease of handling as well as their adsorptive capacity for DNA. We have accordingly developed an enhanced version of nanostructured calcium phosphates (NanoCaPs), by substituting known amounts of silicate for phosphate in the hydroxyapatite (HA) lattice (NanoSiCaPs). Results indicate that in addition to the excellent transfection levels exhibited by un-substituted NanoCaPs alone in vitro, an additional 20–50% increase in transfection is observed for NanoCaPs containing 8.3–50 mol% silicate aptly called NanoSiCaPs, owing to its rapid dissolution properties enabling nanoparticles escaping the lysosomal degradation. However, high silicate substitution (> 50 mol%) resulted in a drastic decline in transfection as the synthesized NanoCaPs deviated far from the characteristic hydroxyapatite phase formed as evidenced by the materials characterization results. - Highlights: • Successful demonstration of nanostructured NanoSiCaPs formation • Demonstration of superior transfection of NanoSiCaPs contrasted to NanoCaPs • Silicate substitution leads to smaller aggregates of nanoparticle complexes. • Enhanced dissolution of NanoSiCaPs demonstrated • Faster NanoSiCaPs dissolution leads to escape of pDNA from lysosomal degradation.
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
A Phosphate Starvation-Inducible Ribonuclease of Bacillus licheniformis.
Nguyen, Thanh Trung; Nguyen, Minh Hung; Nguyen, Huy Thuan; Nguyen, Hoang Anh; Le, Thi Hoi; Schweder, Thomas; Jürgen, Britta
2016-08-28
The BLi03719 protein of Bacillus licheniformis DSM13 belongs to the most abundant extracellular proteins under phosphate starvation conditions. In this study, the function of this phosphate starvation inducible protein was determined. An amino-acid sequence analysis of the BLi03719-encoding gene showed a high similarity with genes encoding the barnase of Bacillus amyloliquefaciens FZB42 and binase-like RNase of Bacillus pumilus SARF-032. The comparison of the control strain and a BLi03719-deficient strain revealed a strongly reduced extracellular ribonuclease activity of the mutant. Furthermore, this knockout mutant exhibited delayed growth with yeast RNA as an alternative phosphate and carbon source. These results suggest that BLi03719 is an extracellular ribonuclease expressed in B. licheniformis under phosphate starvation conditions. Finally, a BLi03719 mutant showed an advantageous effect on the overexpression of the heterologous amyE gene under phosphate-limited growth conditions.
Heuvel, L.P.W.J. van den; Koul, K. Op de; Knots, E.; Knoers, N.V.A.M.; Monnens, L.A.H.
2001-01-01
BACKGROUND: At present the genetic defect for autosomal recessive and autosomal dominant hypophosphataemic rickets with hypercalciuria (HHRH) is unknown. Type II sodium/phosphate cotransporter (NPT2) gene is a serious candidate for being the causative gene in either or both autosomal recessive and
Analysis of genetic variation of inducible nitric oxide synthase and ...
African Journals Online (AJOL)
The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...
Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.
Jain, Parul; Tar'an, Bunyamin
2014-11-01
Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.
Description of a Riboflavin Biosynthetic Gene Variant Prevalent in the Phylum Proteobacteria
Brutinel, Evan D.; Dean, Antony M.
2013-01-01
Riboflavin (vitamin B2) is the precursor of flavin mononucleotide and flavin adenine dinucleotide, which are cofactors essential for a host of intracellular redox reactions. Microorganisms synthesize flavins de novo to fulfill nutritional requirements, but it is becoming increasingly clear that flavins play a wider role in cellular physiology than was previously appreciated. Flavins mediate diverse processes beyond the cytoplasmic membrane, including iron acquisition, extracellular respiration, and interspecies interactions. While investigating the regulation of flavin electron shuttle biosynthesis in the Gram-negative gammaproteobacterium Shewanella oneidensis, we discovered that a riboflavin biosynthetic gene (ribBA) annotated as encoding a bifunctional 3,4-dihydroxy-2-butanone 4-phosphate (DHBP) synthase/GTP cyclohydrolase II does not possess both functions. The novel gene, renamed ribBX here, encodes an amino-terminal DHBP synthase domain. The carboxy-terminal end of RibBX not only lacks GTP cyclohydrolase II activity but also has evolved a different function altogether in S. oneidensis, regulating the activity of the DHBP synthase domain. Phylogenetic analysis revealed that the misannotation of ribBX as ribBA is rampant throughout the phylum Proteobacteria (40% of 2,173 annotated ribBA genes) and that ribBX emerged early in the evolution of this group of microorganisms. We examined the functionality of representative ribBX genes from Beta-, Gamma-, and Epsilonproteobacteria and found that, consistent with sequence-based predictions, the encoded GTP cyclohydrolase II domains lack catalytic activity. The persistence of ribBX in the genomes of so many phylogenetically divergent bacterial species lends weight to the argument that ribBX has evolved a function which lends a selective advantage to the host. PMID:24097946
Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2
Directory of Open Access Journals (Sweden)
Bhubalan, K.
2010-01-01
Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Burleigh, S H; Harrison, M J
1997-05-01
A cDNA clone (Mt4) was isolated as a result of a differential screen to identify genes showing altered expression during the interaction between Medicago truncatula and the vesicular-arbuscular mycorrhizal (VAM) fungus Glomus versiforme. Mt4 represents a M. truncatula mRNA that contains numerous short open reading frames, the two longest of which are predicted to encode polypeptides of 51 amino acids each. One of these open reading frames shares a short region of identity with a phosphate starvation-inducible gene from tomato. Mt4 gene expression is regulated in response to colonization by mycorrhizal fungi: transcripts were detected in non-colonized roots and levels decreased in both M. truncatula and M. sativa (alfalfa) roots after colonization by G. versiforme. Transcript levels also decreased during the incomplete interaction between G. versiforme and a M. sativa mycorrhizal minus (myc-) line, indicating that the down-regulation of this gene occurs early during the interaction between the fungus and its host plant. Phosphate levels in the nutrient media also affected the expression of the Mt4 gene: transcripts were present in the roots of plants grown under phosphate-deficient conditions, but were undetectable in the roots of plants grown under phosphate sufficient conditions. Furthermore, expression was only observed when plants were grown under nitrogen-sufficient conditions. Northern blot analyses indicate that Mt4 transcripts are present primarily in roots and barely detectable in stems or leaves. Thus, Mt4 represents a M. truncatula gene whose expression is regulated in response to both colonization by mycorrhizal fungi and to the phosphate status of the plant.
Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.
Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu
2013-05-01
The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
GenBank blastx search result: AK058464 [KOME
Lifescience Database Archive (English)
Full Text Available AK058464 001-016-A10 U27202.1 Actinobacillus pleuropneumoniae riboflavin biosynthesis operon, riboflavin...-specific deaminase (ribG), riboflavin synthase alpha subunit (ribB), bifunctional GTP ...cyclohydrase II/3,4-dihydroxy-2-butanone-4-phosphate synthase (ribA), and riboflavin synthase beta subunit (ribH) genes, complete cds.|BCT BCT 1e-105 +2 ...
Toroser, D.; McMichael, R. Jr; Krause, K. P.; Kurreck, J.; Sonnewald, U.; Stitt, M.; Huber, S. C.; Davies, E. (Principal Investigator)
1999-01-01
Site-directed mutagenesis of spinach sucrose-phosphate synthase (SPS) was performed to investigate the role of Ser158 in the modulation of spinach leaf SPS. Tobacco plants expressing the spinach wild-type (WT), S158A, S158T and S157F/S158E SPS transgenes were produced. Expression of transgenes appeared not to reduce expression of the tobacco host SPS. SPS activity in the WT and the S158T SPS transgenics showed light/dark modulation, whereas the S158A and S157F/S158E mutants were not similarly light/dark modulated: the S158A mutant enzyme was not inactivated in the dark, and the S157F/S158E was not activated in the light. The inability to modulate the activity of the S158A mutant enzyme by protein phosphorylation was demonstrated in vitro. The WT spinach enzyme immunopurified from dark transgenic tobacco leaves had a low initial activation state, and could be activated by PP2A and subsequently inactivated by SPS-kinase plus ATP. Rapid purification of the S158A mutant enzyme from dark leaves of transgenic plants using spinach-specific monoclonal antibodies yielded enzyme that had a high initial activation state, and pre-incubation with leaf PP2A or ATP plus SPS-kinase (the PKIII enzyme) caused little modulation of activity. The results demonstrate the regulatory significance of Ser158 as the major site responsible for dark inactivation of spinach SPS in vivo, and indicate that the significance of phosphorylation is the introduction of a negative charge at the Ser158 position.
Fumonisins (FB) are mycotoxins found in corn. FB1 is the most common FB. It is the cause of farm animal diseases and is carcinogenic in rodents. The mode of action is the inhibition of ceramide synthase (CerS). Inhibition of CerS in mice causes a dose-dependent accumulation of sphinganine 1-phosphat...
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Matthews, Bethany A; Launis, Karen L; Bauman, Patricia A; Juba, Nicole C
2017-09-27
MZHG0JG corn will offer growers the flexibility to alternate between herbicides with two different modes of action in their weed-management programs, helping to mitigate and manage the evolution of herbicide resistance in weed populations. The proteins conferring herbicide tolerence in MZHG0JG corn, double-mutated 5-enol pyruvylshikimate-3-phosphate synthase protein (mEPSPS) and phosphinothricin acetyltransferase (PAT), as well as the MZHG0JG corn event, have been assessed by regulatory authorities globally and have been determined to be safe for humans, animals, and the environment. In addition to the safety data available for these proteins, further studies were conducted on MZHG0JG corn to assess levels of mEPSPS as compared to previously registered genetically modified (GM) corn. The results support the conclusion of no impact on toxicological safety or nutritional composition.
Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele
2015-08-01
Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Yang, Ji; Gu, Hongya; Yang, Ziheng
2004-01-01
Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.
Glucose 6-phosphate compartmentation and the control of glycogen synthesis
Meijer, Alfred
2002-01-01
Using adenovirus-mediated gene transfer into FTO-2B cells, a rat hepatoma cell line, we have overexpressed hexokinase I, (HK I), glucokinase (GK), liver glycogen synthase (LGS), muscle glycogen synthase (MGS), and combinations of each of the two glucose phosphorylating enzymes with each one of the
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
International Nuclear Information System (INIS)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-01-01
The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis
Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep
2015-10-01
GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T
2005-04-15
In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Directory of Open Access Journals (Sweden)
Hiroaki Iwasaka
2018-04-01
Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.
Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji
2014-11-01
We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Energy Technology Data Exchange (ETDEWEB)
Light, Samuel H.; Halavaty, Andrei S.; Minasov, George; Shuvalova, Ludmilla; Anderson, Wayne F. (NWU)
2012-06-27
3-Deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS) catalyzes the first step in the biosynthesis of a number of aromatic metabolites. Likely because this reaction is situated at a pivotal biosynthetic gateway, several DAHPS classes distinguished by distinct mechanisms of allosteric regulation have independently evolved. One class of DAHPSs contains a regulatory domain with sequence homology to chorismate mutase - an enzyme further downstream of DAHPS that catalyzes the first committed step in tyrosine/phenylalanine biosynthesis - and is inhibited by chorismate mutase substrate (chorismate) and product (prephenate). Described in this work, structures of the Listeria monocytogenes chorismate/prephenate regulated DAHPS in complex with Mn{sup 2+} and Mn{sup 2+} + phosphoenolpyruvate reveal an unusual quaternary architecture: DAHPS domains assemble as a tetramer, from either side of which chorismate mutase-like (CML) regulatory domains asymmetrically emerge to form a pair of dimers. This domain organization suggests that chorismate/prephenate binding promotes a stable interaction between the discrete regulatory and catalytic domains and supports a mechanism of allosteric inhibition similar to tyrosine/phenylalanine control of a related DAHPS class. We argue that the structural similarity of chorismate mutase enzyme and CML regulatory domain provides a unique opportunity for the design of a multitarget antibacterial.
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yonghai Fan
2017-12-01
Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.
Directory of Open Access Journals (Sweden)
Jianrong Wang
2014-12-01
Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk
2011-07-01
Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Ezawa, Tatsuhiro; Saito, Katsuharu
2018-04-27
Contents Summary I. Introduction II. Foraging for phosphate III. Fine-tuning of phosphate homeostasis IV. The frontiers: phosphate translocation and export V. Conclusions and outlook Acknowledgements References SUMMARY: Arbuscular mycorrhizal fungi form symbiotic associations with most land plants and deliver mineral nutrients, in particular phosphate, to the host. Therefore, understanding the mechanisms of phosphate acquisition and delivery in the fungi is critical for full appreciation of the mutualism in this association. Here, we provide updates on physical, chemical, and biological strategies of the fungi for phosphate acquisition, including interactions with phosphate-solubilizing bacteria, and those on the regulatory mechanisms of phosphate homeostasis based on resurveys of published genome sequences and a transcriptome with reference to the latest findings in a model fungus. For the mechanisms underlying phosphate translocation and export to the host, which are major research frontiers in this field, not only recent advances but also testable hypotheses are proposed. Lastly, we briefly discuss applicability of the latest tools to gene silencing in the fungi, which will be breakthrough techniques for comprehensive understanding of the molecular basis of fungal phosphate metabolism. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.
Wagh, Jitendra; Shah, Sonal; Bhandari, Praveena; Archana, G; Kumar, G Naresh
2014-06-01
Gluconic acid secretion mediated by the direct oxidation of glucose by pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (GDH) is responsible for mineral phosphate solubilization in Gram-negative bacteria. Herbaspirillum seropedicae Z67 (ATCC 35892) genome encodes GDH apoprotein but lacks genes for the biosynthesis of its cofactor PQQ. In this study, pqqE of Erwinia herbicola (in plasmid pJNK1) and pqq gene clusters of Pseudomonas fluorescens B16 (pOK53) and Acinetobacter calcoaceticus (pSS2) were over-expressed in H. seropedicae Z67. Transformants Hs (pSS2) and Hs (pOK53) secreted micromolar levels of PQQ and attained high GDH activity leading to secretion of 33.46 mM gluconic acid when grown on 50 mM glucose while Hs (pJNK1) was ineffective. Hs (pJNK1) failed to solubilize rock phosphate, while Hs (pSS2) and Hs (pOK53) liberated 125.47 μM and 168.07 μM P, respectively, in minimal medium containing 50 mM glucose under aerobic conditions. Moreover, under N-free minimal medium, Hs (pSS2) and Hs (pOK53) not only released significant P but also showed enhanced growth, biofilm formation, and exopolysaccharide (EPS) secretion. However, indole acetic acid (IAA) production was suppressed. Thus, the addition of the pqq gene cluster, but not pqqE alone, is sufficient for engineering phosphate solubilization in H. seropedicae Z67 without compromising growth under nitrogen-fixing conditions.
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Directory of Open Access Journals (Sweden)
Yi Miao
2017-07-01
Full Text Available The disaccharide trehalose is critical to the survival of pathogenic fungi in their human host. Trehalose-6-phosphate synthase (Tps1 catalyzes the first step of trehalose biosynthesis in fungi. Here, we report the first structures of eukaryotic Tps1s in complex with substrates or substrate analogues. The overall structures of Tps1 from Candida albicans and Aspergillus fumigatus are essentially identical and reveal N- and C-terminal Rossmann fold domains that form the glucose-6-phosphate and UDP-glucose substrate binding sites, respectively. These Tps1 structures with substrates or substrate analogues reveal key residues involved in recognition and catalysis. Disruption of these key residues severely impaired Tps1 enzymatic activity. Subsequent cellular analyses also highlight the enzymatic function of Tps1 in thermotolerance, yeast-hypha transition, and biofilm development. These results suggest that Tps1 enzymatic functionality is essential for the fungal stress response and virulence. Furthermore, structures of Tps1 in complex with the nonhydrolyzable inhibitor, validoxylamine A, visualize the transition state and support an internal return-like catalytic mechanism that is generalizable to other GT-B-fold retaining glycosyltransferases. Collectively, our results depict key Tps1-substrate interactions, unveil the enzymatic mechanism of these fungal proteins, and pave the way for high-throughput inhibitor screening buttressed and guided by the current structures and those of high-affinity ligand-Tps1 complexes.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
International Nuclear Information System (INIS)
Ravel, P.; Garel, M.C.; Toullec, D.
1997-01-01
In red blood cells, a modulation of the level of the allosteric effector of hemoglobin, 2,3-diphosphoglycerate (2,3-DPG) would have implications in the treatment of ischemia and sickle cell anemia. Its concentrations is determined by the relative activities of the synthase and phosphatase reactions of the multifunctional bis-phosphoglycerate mutase (BPGM). In this report we develop first a more direct synthase assay which uses glyceraldehyde phosphate to suppress the aldolase and triose phosphate isomerase reactions. Secondly we propose a radioactive phosphatase assay coupled to chromatographic separation and identification of the reaction products by paper electrophoresis. Such identification of these products allows us to show that the multifunctional BPGM expresses its mutase instead of its phosphatase activity in conditions of competition between the 3-phosphoglycerate and the 2-phospho-glycolate activator in the phosphatase reaction. These two more precise procedures could be used to study the effects of substrate and cofactor analogues regarding potential therapeutic approaches and could be used for clinical analyses to detect deficiency of BPGM. (author)
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
Directory of Open Access Journals (Sweden)
Anjali Chauhan
Full Text Available Abstract Aneurinibacillus aneurinilyticus strain CKMV1 was isolated from rhizosphere of Valeriana jatamansi and possessed multiple plant growth promoting traits like production of phosphate solubilization (260 mg/L, nitrogen fixation (202.91 nmol ethylene mL-1 h-1, indole-3-acetic acid (IAA (8.1 µg/mL, siderophores (61.60%, HCN (hydrogen cyanide production and antifungal activity. We investigated the ability of isolate CKMV1 to solubilize insoluble P via mechanism of organic acid production. High-performance liquid chromatography (HPLC study showed that isolate CKMV1 produced mainly gluconic (1.34% and oxalic acids. However, genetic evidences for nitrogen fixation and phosphate solubilization by organic acid production have been reported first time for A. aneurinilyticus strain CKMV1. A unique combination of glucose dehydrogenase (gdh gene and pyrroloquinoline quinone synthase (pqq gene, a cofactor of gdh involved in phosphate solubilization has been elucidated. Nitrogenase (nif H gene for nitrogen fixation was reported from A. aneurinilyticus. It was notable that isolate CKMV1 exhibited highest antifungal against Sclerotium rolfsii (93.58% followed by Fusarium oxysporum (64.3%, Dematophora necatrix (52.71%, Rhizoctonia solani (91.58%, Alternaria sp. (71.08% and Phytophthora sp. (71.37%. Remarkable increase was observed in seed germination (27.07%, shoot length (42.33%, root length (52.6%, shoot dry weight (62.01% and root dry weight (45.7% along with NPK (0.74, 0.36, 1.82% content of tomato under net house condition. Isolate CKMV1 possessed traits related to plant growth promotion, therefore, could be a potential candidate for the development of biofertiliser or biocontrol agent and this is the first study to include the Aneurinibacillus as PGPR.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Balestrini, Raffaella; Gómez-Ariza, Jorge; Lanfranco, Luisa; Bonfante, Paola
2007-09-01
The establishment of a symbiotic interaction between plant roots and arbuscular mycorrhizal (AM) fungi requires both partners to undergo significant morphological and physiological modifications which eventually lead to reciprocal beneficial effects. Extensive changes in gene expression profiles recently have been described in transcriptomic studies that have analyzed the whole mycorrhizal root. However, because root colonization by AM fungi involves different cell types, a cell-specific gene expression pattern is likely to occur. We have applied the laser microdissection (LMD) technology to investigate expression profiles of both plant and fungal genes in Lycopersicon esculentum roots colonized by Glomus mosseae. A protocol to harvest arbuscule-containing cells from paraffin sections of mycorrhizal roots has been developed using a Leica AS LMD system. RNA of satisfactory quantity and quality has been extracted for molecular analysis. Transcripts for plant phosphate transporters (LePTs), selected as molecular markers for a functional symbiosis, have been detected by reverse-transcriptase polymerase chain reaction assays and associated to distinct cell types, leading to novel insights into the distribution of LePT mRNAs. In fact, the transcripts of the five phosphate transporters (PTs) have been detected contemporaneously in the same arbusculated cell population, unlike from the neighboring noncolonized cells. In addition, fungal H(+)ATPase (GmHA5) and phosphate transporter (GmosPT) mRNAs were found exclusively in arbusculated cells. The discovery that five plant and one fungal PT genes are consistently expressed inside the arbusculated cells provides a new scenario for plant-fungus nutrient exchanges.
DEFF Research Database (Denmark)
Willemoës, Martin; Hove-Jensen, Bjarne; Larsen, Sine
2000-01-01
A steady state kinetic investigation of the Pi activation of 5-phospho-D-ribosyl α-1-diphosphate synthase from Escherichia coli suggests that Pi can bind randomly to the enzyme either before or after an ordered addition of free Mg2+ and substrates. Unsaturation with ribose 5-phosphate increased...... the apparent cooperativity of Pi activation. At unsaturating Pi concentrations partial substrate inhibition by ribose 5-phosphate was observed. Together these results suggest that saturation of the enzyme with Pi directs the subsequent ordered binding of Mg2+ and substrates via a fast pathway, whereas...... saturation with ribose 5-phosphate leads to the binding of Mg2+ and substrates via a slow pathway where Pi binds to the enzyme last. The random mechanism for Pi binding was further supported by studies with competitive inhibitors of Mg2+, MgATP, and ribose 5-phosphate that all appeared noncompetitive when...
Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek
2014-01-01
Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.
Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae
2017-11-15
Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd
Directory of Open Access Journals (Sweden)
Mei Lan Jin
2017-11-01
Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
International Nuclear Information System (INIS)
Nabiyouni, Maryam; Ren, Yufu; Bhaduri, Sarit B.
2015-01-01
As biocompatible materials, magnesium phosphates have received a lot of attention for orthopedic applications. During the last decade multiple studies have shown advantages for magnesium phosphate such as lack of cytotoxicity, biocompatibility, strong mechanical properties, and high biodegradability. The present study investigates the role of Mg +2 and Ca +2 ions in the structure of magnesium phosphate and calcium phosphate nanoparticles. To directly compare the effect of Mg +2 and Ca +2 ions on structure of nanoparticles and their biological behavior, three groups of nanoparticles including amorphous magnesium phosphates (AMPs) which release Mg +2 , calcium magnesium phosphates (CMPs) which release Mg +2 and Ca +2 , and hydroxyapatites (HAs) which release Ca +2 were studied. SEM, TEM, XRD, and FTIR were used to evaluate the morphology, crystallinity, and chemical properties of the particles. AMP particles were homogeneous nanospheres, whereas CMPs were combinations of heterogeneous nanorods and nanospheres, and HAs which contained heterogeneous nanosphere particles. Cell compatibility was monitored in all groups to determine the cytotoxicity effect of particles on studied MC3T3-E1 preosteoblasts. AMPs showed significantly higher attachment rate than the HAs after 1 day and both AMPs and CMPs showed significantly higher proliferation rate when compared to HAs after 7 days. Gene expression level of osteoblastic markers ALP, COL I, OCN, OPN, RUNX2 were monitored and they were normalized to GAPDH housekeeping gene. Beta actin expression level was monitored as the second housekeeping gene to confirm the accuracy of results. In general, AMPs and CMPs showed higher expression level of osteoblastic genes after 7 days which can further confirm the stimulating role of Mg + 2 and Ca +2 ions in increasing the proliferation rate, differentiation, and mineralization of MC3T3-E1 preosteoblasts. - Highlights: • Role of Mg 2+ and Ca 2+ ions in proliferation, and differentiation
Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes
Directory of Open Access Journals (Sweden)
Mohammad Bagher Javadi Nobandegani
2015-01-01
Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.
A Mutation in the Dmp1 Gene Alters Phosphate Responsiveness in Mice
Gerard-O'Riley, Rita L.; Acton, Dena; McQueen, Amie K.; Strobel, Isabel E.; Witcher, Phillip C.; Feng, Jian Q.; Econs, Michael J.
2017-01-01
Mutations in the dentin matrix protein 1 (DMP1) gene cause autosomal recessive hypophosphatemic rickets (ARHR). Hypophosphatemia in ARHR results from increased circulating levels of the phosphaturic hormone, fibroblast growth factor 23 (FGF23). Similarly, elevated FGF23, caused by mutations in the PHEX gene, is responsible for the hypophosphatemia in X-linked hypophosphatemic rickets (XLH). Previously, we demonstrated that a Phex mutation in mice creates a lower set point for extracellular phosphate, where an increment in phosphorus further stimulates Fgf23 production to maintain low serum phosphorus levels. To test the presence of the similar set point defect in ARHR, we generated 4- and 12-week-old Dmp1/Galnt3 double knockout mice and controls, including Dmp1 knockout mice (a murine model of ARHR), Galnt3 knockout mice (a murine model of familial tumoral calcinosis), and phenotypically normal double heterozygous mice. Galnt3 knockout mice had increased proteolytic cleavage of Fgf23, leading to low circulating intact Fgf23 levels with consequent hyperphosphatemia. In contrast, Dmp1 knockout mice had little Fgf23 cleavage and increased femoral Fgf23 expression, resulting in hypophosphatemia and low femoral bone mineral density (BMD). However, introduction of the Galnt3 null allele to Dmp1 knockout mice resulted in a significant increase in serum phosphorus and normalization of BMD. This increased serum phosphorus was accompanied by markedly elevated Fgf23 expression and circulating Fgf23 levels, an attempt to reduce serum phosphorus in the face of improving phosphorus levels. These data indicate that a Dmp1 mutation creates a lower set point for extracellular phosphate and maintains it through the regulation of Fgf23 cleavage and expression. PMID:28005411
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Nano-sized calcium phosphate particles for periodontal gene therapy.
Elangovan, Satheesh; Jain, Shardool; Tsai, Pei-Chin; Margolis, Henry C; Amiji, Mansoor
2013-01-01
Growth factors such as platelet-derived growth factor (PDGF) have significantly enhanced periodontal therapy outcomes with a high degree of variability, mostly due to the lack of continual supply for a required period of time. One method to overcome this barrier is gene therapy. The aim of this in vitro study is to evaluate PDGF-B gene delivery in fibroblasts using nano-sized calcium phosphate particles (NCaPP) as vectors. NCaPP incorporating green fluorescent protein (NCaPP-GFP) and PDGF-B (NCaPP-PDGF-B) plasmids were synthesized using an established precipitation system and characterized using transmission electron microscopy and 1.2% agarose gel electrophoresis. Biocompatibility and transfection of the nanoplexes in fibroblasts were evaluated using cytotoxicity assay and florescence microscopy, respectively. Polymerase chain reaction and enzyme-linked immunosorbent assay were performed to evaluate PDGF-B transfection after different time points of treatments, and the functionality of PDGF-B transfection was evaluated using the cell proliferation assay. Synthesized NCaPP nanoplexes incorporating the genes of GFP and PDGF-B were spherical in shape and measured about 30 to 50 nm in diameter. Gel electrophoresis confirmed DNA incorporation and stability within the nanoplexes, and 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagent assay demonstrated their biocompatibility in fibroblasts. In vitro transfection studies revealed a higher and longer lasting transfection after NCaPP-PDGF-B treatment, which lasted up to 96 hours. Significantly enhanced fibroblast proliferation observed in NCaPP-PDGF-B-treated cells confirmed the functionality of these nanoplexes. NCaPP demonstrated higher levels of biocompatibility and efficiently transfected PDGF plasmids into fibroblasts under described in vitro conditions.
Hudek, L; Premachandra, D; Webster, W A J; Bräu, L
2016-11-01
synthesis of active uptake systems. The Pst phosphate transport system is one such system, responsible for the internalization of phosphate when cells are in phosphate-limited environments. Our investigations reveal the presence of multiple Pst phosphate uptake systems that exist across three distinct operons in Nostoc punctiforme and functionally characterize the role of the gene product PstB1 as being crucial for the maintenance of phosphate accumulation. We demonstrate that the genes pstB2, pstB3, and pstB4 show alterations in expression to compensate for the deletion of pstB1 The overall outcomes of this work provide insights as to the complex transport mechanisms that exist in cyanobacteria like N. punctiforme, allowing them to thrive in low-phosphate environments. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Yan eWang
2016-01-01
Full Text Available Heat shock factors (Hsfs are important regulators of stress-response in plants. However, our understanding of Hsf genes and their responses to temperature stresses in two Pooideae cool-season grasses, Festuca arundinacea and Lolium perenne, is limited. Here we conducted comparative transcriptome analyses of plant leaves exposed to heat or cold stress for 10 h. Approximately, 30% and 25% of the genes expressed in the two species showed significant changes under heat and cold stress respectively, including subsets of Hsfs and their target genes. We uncovered 74 Hsfs in F. arundinacea and 52 Hsfs in L. perenne, and categorized these genes into three subfamilies, HsfA, HsfB, and HsfC based on protein sequence homology to known Hsf members in model organisms. The Hsfs showed a strong response to heat and/or cold stress. The expression of HsfAs was elevated under heat stress, especially in class HsfA2, which exhibited the most dramatic responses. HsfBs were upregulated by the both temperature conditions, and HsfCs mainly showed an increase in expression under cold stress. The target genes of Hsfs, such as heat shock protein (HSP, ascorbate peroxidase (APX, inositol-3-phosphate synthase (IPS, and galactinol synthase (GOLS1, showed strong and unique responses to different stressors. We comprehensively detected Hsfs and their target genes in F. arundinacea and L. perenne, providing a foundation for future gene function studies and genetic engineering to improve stress tolerance in grasses and other crops.
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor
2018-04-01
Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan
2018-05-11
Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.
Molecular identification of phosphate solubilizing bacterium ...
African Journals Online (AJOL)
A phosphate solubilizing bacterium was isolated from the rhizosphere soil of upland rice and identified by 16S rRNA gene sequencing. The gene sequence showed 99% homology with Alcaligenes faecalis. Based on the gene sequence homology, it was identified as A. faecalis. Interaction effect of this bacterium on growth ...
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder
2017-11-03
Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.
Directory of Open Access Journals (Sweden)
Linjie Wang
Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; McGuire, James N
2004-01-01
The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...
Gas-Pascual, Elisabet; Simonovik, Biljana; Heintz, Dimitri; Bergdoll, Marc; Schaller, Hubert; Bach, Thomas J
2015-08-01
The effect of an inhibitor of cycloartenol synthase (CAS, EC 5.4.99.8) on the proteome of tobacco BY-2 cells has been examined. CAS catalyzes the first committed step in phytosterol synthesis in plants. BY-2 cells were treated with RO 48-8071, a potent inhibitor of oxidosqualene cyclization. Proteins were separated by two-dimensional electrophoresis and spots, that clearly looked differentially accumulated after visual inspection, were cut, in-gel trypsin digested, and peptides were analyzed by nano-HPLC-MS/MS. Distinct peptides were compared to sequences in the data banks and attributed to corresponding proteins and genes. Inhibition of CAS induced proteins that appear to mitigate the negative effects of the chemical exposure. However, as all enzymes that are directly involved in phytosterol biosynthesis are low-abundant proteins, significant changes in their levels could not be observed. Differences could be seen with enzymes involved in primary metabolism (glycolysis, pentose phosphate pathway etc.), in proteins of the chaperonin family, and those, like actin, that participate in formation and strengthening of the cytoskeleton and have some impact on cell growth and division.
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia
2016-11-01
Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan
2016-01-01
The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
Chauhan, Anjali; Guleria, Shiwani; Balgir, Praveen P; Walia, Abhishek; Mahajan, Rishi; Mehta, Preeti; Shirkot, Chand Karan
Aneurinibacillus aneurinilyticus strain CKMV1 was isolated from rhizosphere of Valeriana jatamansi and possessed multiple plant growth promoting traits like production of phosphate solubilization (260mg/L), nitrogen fixation (202.91nmolethylenemL -1 h -1 ), indole-3-acetic acid (IAA) (8.1μg/mL), siderophores (61.60%), HCN (hydrogen cyanide) production and antifungal activity. We investigated the ability of isolate CKMV1 to solubilize insoluble P via mechanism of organic acid production. High-performance liquid chromatography (HPLC) study showed that isolate CKMV1 produced mainly gluconic (1.34%) and oxalic acids. However, genetic evidences for nitrogen fixation and phosphate solubilization by organic acid production have been reported first time for A. aneurinilyticus strain CKMV1. A unique combination of glucose dehydrogenase (gdh) gene and pyrroloquinoline quinone synthase (pqq) gene, a cofactor of gdh involved in phosphate solubilization has been elucidated. Nitrogenase (nif H) gene for nitrogen fixation was reported from A. aneurinilyticus. It was notable that isolate CKMV1 exhibited highest antifungal against Sclerotium rolfsii (93.58%) followed by Fusarium oxysporum (64.3%), Dematophora necatrix (52.71%), Rhizoctonia solani (91.58%), Alternaria sp. (71.08%) and Phytophthora sp. (71.37%). Remarkable increase was observed in seed germination (27.07%), shoot length (42.33%), root length (52.6%), shoot dry weight (62.01%) and root dry weight (45.7%) along with NPK (0.74, 0.36, 1.82%) content of tomato under net house condition. Isolate CKMV1 possessed traits related to plant growth promotion, therefore, could be a potential candidate for the development of biofertiliser or biocontrol agent and this is the first study to include the Aneurinibacillus as PGPR. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
of endothelial nitric oxide synthase gene and serum level of vascular ...
African Journals Online (AJOL)
uwerhiavwe
Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Kim, Min-Seok; Jeong, Seok Won; Choi, Seong-Jin; Han, Jin-Young; Kim, Sung-Hwan; Yoon, Seokjoo; Oh, Jung-Hwa; Lee, Kyuhong
2017-02-15
The antimicrobial biocide polyhexamethyleneguanidine (PHMG) phosphate is the main ingredient in the commercially available humidifier disinfectant. PHMG phosphate-based humidifier disinfectants can cause pulmonary fibrosis and induce inflammatory and fibrotic responses both in vivo and in vitro. However, toxicological mechanisms including genomic alterations induced by inhalation exposure to PHMG phosphate have not been elucidated. Therefore, this study evaluated the toxicological effects of the PHMG phosphate-containing humidifier disinfectant. We used DNA microarray to identify global gene expression changes in rats treated with PHMG phosphate-containing humidifier disinfectant for 4 weeks and 10 weeks. Functional significance of differentially expressed genes (DEGs) was estimated by gene ontology (GO) analysis. Four weeks post-exposure, 320 and 392 DEGs were identified in female and male rats, respectively (>2-fold, pPHMG phosphate exposure. In addition, 21 genes were upregulated and 4 genes were downregulated in response to PHMG phosphate in a time-dependent manner. Thus, we predict that changes in genomic responses could be a significant molecular mechanism underlying PHMG phosphate toxicity. Further studies are required to determine the detailed mechanism of PHMG phosphate-induced pulmonary toxicity. Copyright © 2016. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D
2001-09-01
The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
Zhang, Fang; Wang, Liu; Wang, Rui; Ying, Yibin; Wu, Jian
2015-02-03
An informative, with simple instrument needed, rapid and easily updated strategy for the identification of insect-resistant genetically modified (GM) rice has been described. Such strategy is based on a parallel series of loop-mediated isothermal amplification (LAMP) reactions targeting the rice endogenous gene sucrose phosphate synthase (Sps), the top two most frequently used genetic elements (Agrobacterium tumefaciens nopaline synthase terminator (Nos) and Cauliflower mosaic virus 35S promoter (CaMV35S)), and an insect-resistant specific gene (Cry1Ac) and detected visually by phosphate ion (Pi)-induced coloration reaction. After a logical judgment of visible readouts has been obtained, three popular insect-resistant GM rice events in China can be successfully identified within 35 min, using either microwell strips or paper bases.
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
Higashi, Tatsuichiro; Iwasaki, Yuko; Ohnishi, Yasuo; Horinouchi, Sueharu
2007-01-01
Grixazone (GX), which is a diffusible yellow pigment containing a phenoxazinone chromophore, is one of the secondary metabolites under the control of A-factor (2-isocapryloyl-3R-hydroxymethyl-γ-butyrolactone) in Streptomyces griseus. GX production is also induced by phosphate starvation. The whole biosynthesis gene cluster for GX was cloned and characterized. The gene cluster consisting of 13 genes contained six transcriptional units, griT, griSR, griR, griAB, griCDEFG, and griJIH. During cul...
DEFF Research Database (Denmark)
Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna
2015-01-01
A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...
Energy Technology Data Exchange (ETDEWEB)
N' Guessan, L.A.; Elifantz, H.; Nevin, K.P.; Mouser, P.J.; Methe, B.; Woodard, T. L.; Manley, K.; Williams, K. H.; Wilkins, M. J.; Larsen, J.T.; Long, P. E.; Lovley, D. R.
2009-09-01
Nutrient limitation is an environmental stress that may reduce the effectiveness of bioremediation strategies, especially when the contaminants are organic compounds or when organic compounds are added to promote microbial activities such as metal reduction. Genes indicative of phosphate-limitation were identified via microarray analysis of chemostat cultures of Geobacter sulfureducens. This analysis revealed that genes in the pst-pho operon, which is associated with a high affinity phosphate uptake system in other microorganisms, had significantly higher transcript abundance under phosphate-limiting conditions, with the genes pstB and phoU the most up-regulated. Quantitative PCR analysis of pstB and phoU transcript levels in G. sulfurreducens grown in chemostats demonstrated that the expression of these genes increased when phosphate was removed from the culture medium. Transcripts of pstB and phoU within the subsurface Geobacter species predominating during an in situ uranium bioremediation field experiment were more abundant than in chemostat cultures of G. sulfurreducens that were not limited for phosphate. Addition of phosphate to incubations of subsurface sediments did not stimulate dissimilatory metal reduction. The added phosphate was rapidly adsorbed onto the sediments. The results demonstrate that Geobacter species can effectively reduce U(VI) even when experiencing suboptimal phosphate concentrations and that increasing phosphate availability with phosphate additions is difficult to achieve due to the high reactivity of this compound. This transcript-based approach developed for diagnosing phosphate limitation should be applicable to assessing the potential need for additional phosphate in other bioremediation processes.
Directory of Open Access Journals (Sweden)
Ming Li
2017-11-01
Full Text Available Chinese fir (Cunninghamia lanceolata (Lamb. Hook. is the most important afforestation tree species in China because of its excellent timber quality and high yield. However, the limited availability of phosphorus in forest soils is widespread and has become an important factor in the declining productivity of Chinese fir plantations. Here we used the Illumina HiSeq™ 2000 DNA sequencing platform to sequence root, stem, and leaf transcriptomes of one-year old Chinese fir clones with phosphorus treatment. Approximately 236,529,278 clean reads were obtained and generated 35.47 G of sequencing data. These reads were assembled into 413,806 unigenes with a mean length of 520 bp. In total, 109,596 unigenes were annotated in the NR (NCBI non-redundant database, 727,287 genes were assigned for GO (Gene Ontology terms, information for 92,001 classified unigenes was assigned to 26 KOG (Karyotic Orthologous Groups categories, and 57,042 unigenes were significantly matched with 132 KEGG (Kyoto Encyclopedia of Genes and Genomes predicted pathways. In total, 49 unigenes were identified as exhibiting inorganic phosphate transporter activity, and 14 positive genes’ expression patterns in different phosphorus deficiency treatments were analyzed by qRT-PCR to explore their putative functions. This study provides a basic foundation for functional genomic studies of the phosphate transporter in Chinese fir, and also presents an extensive annotated sequence resource for molecular research.
International Nuclear Information System (INIS)
Zaccardi, Margot J.; Mannweiler, Olga; Boehr, David D.
2012-01-01
Highlights: ► Catalytic mechanisms of thermophilic–mesophilic enzymes may differ. ► Product release is rate-determining for thermophilic IGPS at low temperatures. ► But at higher temperatures, proton transfer from the general acid is rate-limiting. ► Rate-determining step is different still for mesophilic IGPS. ► Both chemical and physical steps of catalysis are important for temperature adaptation. -- Abstract: Thermophilic enzymes tend to be less catalytically-active at lower temperatures relative to their mesophilic counterparts, despite having very similar crystal structures. An often cited hypothesis for this general observation is that thermostable enzymes have evolved a more rigid tertiary structure in order to cope with their more extreme, natural environment, but they are also less flexible at lower temperatures, leading to their lower catalytic activity under mesophilic conditions. An alternative hypothesis, however, is that complementary thermophilic–mesophilic enzyme pairs simply operate through different evolutionary-optimized catalytic mechanisms. In this communication, we present evidence that while the steps of the catalytic mechanisms for mesophilic and thermophilic indole-3-glycerol phosphate synthase (IGPS) enzymes are fundamentally similar, the identity of the rate-determining step changes as a function of temperature. Our findings indicate that while product release is rate-determining at 25 °C for thermophilic IGPS, near its adaptive temperature (75 °C), a proton transfer event, involving a general acid, becomes rate-determining. The rate-determining steps for thermophilic and mesophilic IGPS enzymes are also different at their respective, adaptive temperatures with the mesophilic IGPS-catalyzed reaction being rate-limited before irreversible CO 2 release, and the thermophilic IGPS-catalyzed reaction being rate limited afterwards.
International Nuclear Information System (INIS)
Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand
2008-01-01
Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses
Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R
1994-01-01
We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...
DEFF Research Database (Denmark)
Schneider, Anja; Häusler, Rainer E; Kolukisaoglu, Uner
2002-01-01
The Arabidopsis thaliana tpt-1 mutant which is defective in the chloroplast triose phosphate/phosphate translocator (TPT) was isolated by reverse genetics. It contains a T-DNA insertion 24 bp upstream of the start ATG of the TPT gene. The mutant lacks TPT transcripts and triose phosphate (TP)-spe...
International Nuclear Information System (INIS)
Sävenstrand, H.; Brosché, M.; Strid, A.
2002-01-01
Suppression subtractive hybridisation was used to isolate genes differentially regulated by low levels (UV-B BE,300 0.13 W m -2 ) of ultraviolet-B radiation (UV-B; 290–320 nm) in Pisum sativum. Six genes were regulated, two of which were novel. The mRNA levels for these two (PsTSDC and PsUOS1) were increased and depressed by UV-B treatment, respectively. Domains in the PsTSDC translation product was similar to TIR (Toll-Interleukin-1 receptor-similar) domains and a NB-ARC domain (nucleotide-binding domain in APAF-1, R gene products and CED-4). The PsUOS1 translation product was similar to an open reading frame in Arabidopsis. Genes encoding embryo-abundant protein (PsEMB) and S-adenosyl-l-methionine synthase (PsSAMS) were induced by UV-B, whereas the transcript levels for genes encoding sucrose transport protein (PsSUT) or ribulose-5-phosphate 3-epimerase (PsR5P3E) were decreased. These regulation patterns are novel, and the PsEMB and PsR5P3E sequences are reported for the first time. The stress-specificity of regulation of these genes were tested by ozone fumigation (100 ppb O 3 ). Qualitatively, the similarity of expression after both UV-B and ozone exposure suggests that, for these genes, similar stress-response pathways are in action. (author)
Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante
2015-11-01
Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
Directory of Open Access Journals (Sweden)
Facincani Agda Paula
2003-01-01
Full Text Available The objective of this work was to assess the functionality of the glycolytic pathways in the bacterium Xylella fastidiosa. To this effect, the enzymes phosphoglucose isomerase, aldolase, glyceraldehyde-3-phosphate dehydrogenase and pyruvate kinase of the glycolytic pathway, and glucose 6-phosphate dehydrogenase of the Entner-Doudoroff pathway were studied, followed by cloning and expression studies of the enolase gene and determination of its activity. These studies showed that X. fastidiosa does not use the glycolytic pathway to metabolize carbohydrates, which explains the increased duplication time of this phytopatogen. Recombinant enolase was expressed as inclusion bodies and solubilized with urea (most efficient extractor, Triton X-100, and TCA. Enolase extracted from X. fastidiosa and from chicken muscle and liver is irreversibly inactivated by urea. The purification of enolase was partial and resulted in a low yield. No enzymatic activity was detected for either recombinant and native enolases, aldolase, and glyceraldehyde-3-phosphate dehydrogenase, suggesting that X. fastidiosa uses the Entner-Doudoroff pathway to produce pyruvate. Evidence is presented supporting the idea that the regulation of genes and the presence of isoforms with regulation patterns might make it difficult to understand the metabolism of carbohydrates in X. fastidiosa.
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx
2007-08-01
To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.
Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.
2006-01-01
Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.
2017-01-01
Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be considered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu
2008-08-01
Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.
Energy Technology Data Exchange (ETDEWEB)
Koutmos, Markos; Kabil, Omer; Smith, Janet L.; Banerjee, Ruma (Michigan-Med)
2011-08-17
The catalytic potential for H{sub 2}S biogenesis and homocysteine clearance converge at the active site of cystathionine {beta}-synthase (CBS), a pyridoxal phosphate-dependent enzyme. CBS catalyzes {beta}-replacement reactions of either serine or cysteine by homocysteine to give cystathionine and water or H{sub 2}S, respectively. In this study, high-resolution structures of the full-length enzyme from Drosophila in which a carbanion (1.70 {angstrom}) and an aminoacrylate intermediate (1.55 {angstrom}) have been captured are reported. Electrostatic stabilization of the zwitterionic carbanion intermediate is afforded by the close positioning of an active site lysine residue that is initially used for Schiff base formation in the internal aldimine and later as a general base. Additional stabilizing interactions between active site residues and the catalytic intermediates are observed. Furthermore, the structure of the regulatory 'energy-sensing' CBS domains, named after this protein, suggests a mechanism for allosteric activation by S-adenosylmethionine.
Directory of Open Access Journals (Sweden)
Tim Soderberg
2005-01-01
Full Text Available A phylogenetic analysis of the genes encoding enzymes in the pentose phosphate pathway (PPP, the ribulose monophosphate (RuMP pathway, and the chorismate pathway of aromatic amino acid biosynthesis, employing data from 13 complete archaeal genomes, provides a potential explanation for the enigmatic phylogenetic patterns of the PPP genes in archaea. Genomic and biochemical evidence suggests that three archaeal species (Methanocaldococcus jannaschii, Thermoplasma acidophilum and Thermoplasma volcanium produce ribose-5-phosphate via the nonoxidative PPP (NOPPP, whereas nine species apparently lack an NOPPP but may employ a reverse RuMP pathway for pentose synthesis. One species (Halobacterium sp. NRC-1 lacks both the NOPPP and the RuMP pathway but may possess a modified oxidative PPP (OPPP, the details of which are not yet known. The presence of transketolase in several archaeal species that are missing the other two NOPPP genes can be explained by the existence of differing requirements for erythrose-4-phosphate (E4P among archaea: six species use transketolase to make E4P as a precursor to aromatic amino acids, six species apparently have an alternate biosynthetic pathway and may not require the ability to make E4P, and one species (Pyrococcus horikoshii probably does not synthesize aromatic amino acids at all.
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Shen, Lan; Wu, Xiao-Qin; Zeng, Qing-Wei; Liu, Hong-Bin
2016-12-01
Phytate-mineralizing rhizobacteria (PMR) play an important role in providing phosphorus for the sustainable plant growth. It is important to investigate the ability of PMR to produce phytase under different phosphate levels for its application. The effects of different concentrations of soluble phosphate on the ability of phytate mineralization of Pseudomonas fluorescens JZ-DZ1, a phytate-mineralizing rhizobacterium, were investigated in both solid and liquid media. The results on solid media showed that halo zone width gradually reduced with concentrations of soluble phosphate increasing from 0.05 to 20 mM, indicating the reduction of the ability of phytate mineralization. The results were consistent with the quantitative detection of phytase activity from the overall trend. An 1866-bp β-propeller phytase (BPP) gene (phyPf) was cloned from the strain, and the deduced amino acid sequence of phyPf shared 98 % of identity with a known BPP from Pseudomonas sp. BS10-3 (AJF36073.1). The results of relative real-time quantitative PCR assay showed that the expression of phyPf was induced by a low concentration (0.1 mM) of soluble phosphate, suggesting that BPP secretion was regulated by gene phyPf. The BPP-harboring bacterium P. fluorescens JZ-DZ1 with low phosphate-inducible ability of phytate mineralization could be potentially applied to promote phosphorus uptake for plants in the future.
Directory of Open Access Journals (Sweden)
Linda Koshy
2008-01-01
Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.
Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-07-01
The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi
2016-12-01
To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.
Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun
2017-09-01
Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.
Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.
Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi
2007-11-01
Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.
Nakano, Kazuhiro; Takeshita, Sen; Kawasaki, Noriko; Miyanaga, Wataru; Okamatsu, Yoriko; Dohi, Mizuki; Nakagawa, Tadakiyo
2017-01-01
Impaired glycogen synthesis and turnover are common in insulin resistance and type 2 diabetes. As glycogen synthase (GS) is a key enzyme involved in the synthetic process, it presents a promising therapeutic target for the treatment of type 2 diabetes. In the present study, we identified a novel, potent and orally available GS activator AJS1669 {sodium 2-[[5-[[4-(4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl]furan-2-carbonyl]-(2-furylmethyl)amino] acetate}. In vitro, we performed a glycogen synthase 1 (GYS1) activation assay for screening GS activators and identified that the activity of AJS1669 was further potentiated in the presence of glucose-6-phosphate (G6P). In vivo, we used ob/ob mice to evaluate the novel anti-diabetic effects of AJS1669 by measuring basal blood glucose levels, glucose tolerance and body fat mass index. Repeated administration of AJS1669 over 4 weeks reduced blood glucose and hemoglobin A1c (HbA1c) levels in ob/ob mice. AJS1669 also improved glucose tolerance in a dose-dependent manner, and decreased body fat mass. The mRNA levels of genes involved in mitochondrial fatty acid oxidation and mitochondrial biogenesis were elevated in skeletal muscle tissue following AJS1669 treatment. Hepatic tissue of treated mice also exhibited elevated expression of genes associated with fatty acid oxidation. In contrast to ob/ob mice, in C57Bl/6 mice AJS1669 administration did not alter body weight or reduce glucose levels. These results demonstrate that pharmacological agents that activate GYS1, the main GS subtype found in skeletal muscle, have potential for use as novel treatments for diabetes that improve glucose metabolism in skeletal muscle. PMID:28290602
Directory of Open Access Journals (Sweden)
G. V. Matyushin
2017-01-01
Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group. In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men, this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the
O.I. Kadykova; P.P. Kravchun
2016-01-01
The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Damveld, R.A.; Arentshorst, M.; Franken, A.; Vankuyk, P.A.; Klis, F.M.; van den Hondel, C.A.; Ram, A.F.
2005-01-01
In Aspergillus niger, the genes coding for glutamine:fructose-6-phosphate amidotransferase (gfaA) and ¿-1,3-glucan synthase (agsA) are induced in response to cell wall stress. In silico analysis of the promoter region of the two genes revealed the presence of putative DNA binding sites for
Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.
Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice
2018-01-06
The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.
International Nuclear Information System (INIS)
Suzuki, Ryuichiro; Kim, Byung-Jun; Shibata, Tsuyoshi; Iwamoto, Yuki; Katayama, Takane; Ashida, Hisashi; Wakagi, Takayoshi; Shoun, Hirofumi; Fushinobu, Shinya; Yamamoto, Kenji
2010-01-01
Xylulose-5-phosphate/fructose-6-phosphate phosphoketolase from B. breve was overexpressed and crystallized. The crystals belonged to the tetragonal space group I422 and diffracted to beyond 1.7 Å resolution. The xylulose-5-phosphate/fructose-6-phosphate phosphoketolase gene from Bifidobacterium breve was cloned and overexpressed in Escherichia coli. The enzyme was purified to homogeneity and crystallized by the sitting-drop vapour-diffusion method. Crystals were obtained at 293 K using 0.05 mM thiamine diphosphate, 0.25 mM MgCl 2 , 24%(w/v) PEG 6000 and 0.1 M Bicine pH 9.0. The crystals belonged to the tetragonal space group I422, with unit-cell parameters a = b = 174.8, c = 163.8 Å, and diffracted to beyond 1.7 Å resolution
The response and recovery of the Arabidopsis thaliana transcriptome to phosphate starvation
Woo, Jongchan
2012-05-03
Background: Over application of phosphate fertilizers in modern agriculture contaminates waterways and disrupts natural ecosystems. Nevertheless, this is a common practice among farmers, especially in developing countries as abundant fertilizers are believed to boost crop yields. The study of plant phosphate metabolism and its underlying genetic pathways is key to discovering methods of efficient fertilizer usage. The work presented here describes a genome-wide resource on the molecular dynamics underpinning the response and recovery in roots and shoots of Arabidopsis thaliana to phosphate-starvation.Results: Genome-wide profiling by micro- and tiling-arrays (accessible from GEO: GSE34004) revealed minimal overlap between root and shoot transcriptomes suggesting two independent phosphate-starvation regulons. Novel gene expression patterns were detected for over 1000 candidates and were classified as either initial, persistent, or latent responders. Comparative analysis to AtGenExpress identified cohorts of genes co-regulated across multiple stimuli. The hormone ABA displayed a dominant role in regulating many phosphate-responsive candidates. Analysis of co-regulation enabled the determination of specific versus generic members of closely related gene families with respect to phosphate-starvation. Thus, among others, we showed that PHR1-regulated members of closely related phosphate-responsive families (PHT1;1, PHT1;7-9, SPX1-3, and PHO1;H1) display greater specificity to phosphate-starvation than their more generic counterparts. Conclusion: Our results uncover much larger, staged responses to phosphate-starvation than previously described. To our knowledge, this work describes the most complete genome-wide data on plant nutrient stress to-date. 2012 Woo et al.; licensee BioMed Central Ltd.
Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan
2009-09-23
Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.
Wang, Junling; Li, Tao; Wu, Xiaogang; Zhao, Zhiwei
2014-01-01
Phosphate transporters (PTs), as entry points for phosphorus (P) in organisms, are involved in a number of P nutrition processes such as phosphate uptake, transport, and transfer. In the study, a PT gene 1632 bp long (named BePT) was cloned, identified, and functionally characterized from Boletus edulis. BePT was expected to encode a polypeptide with 543 amino acid residues. The BePT polypeptide belonged to the major facilitator superfamily and showed a high degree of sequence identity to the Pht1 family. A topology model revealed that BePT exhibited 12 transmembrane helices, divided into two halves, and connected by a large hydrophilic loop in the middle. A yeast mutant complementation analysis suggested that BePT was a functional PT which mediated orthophosphate uptake of yeast at micromolar concentrations. Green fluorescent protein-BePT fusion proteins expressed were extensively restricted to the plasma membrane in BePT transformed yeast, and its activity was dependent on electrochemical membrane potential. In vitro, quantitative PCR confirmed that the expression of BePT was significantly upregulated at lower phosphorus availability, which may enhance phosphate uptake and transport under phosphate starvation. Our results suggest that BePT plays a key role in phosphate acquisition in the ectomycorrhizal fungus B. edulis. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.
Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.
Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.
Directory of Open Access Journals (Sweden)
Imke Schmitt
Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.
Directory of Open Access Journals (Sweden)
Ravid Rivka
2008-05-01
Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.
2013-01-01
Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205
Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg
2013-05-16
The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert
2017-04-01
Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.
Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard
2011-01-01
Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook
2008-01-01
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Ludueña, Liliana M; Anzuay, Maria S; Magallanes-Noguera, Cynthia; Tonelli, Maria L; Ibañez, Fernando J; Angelini, Jorge G; Fabra, Adriana; McIntosh, Matthew; Taurian, Tania
2017-10-01
The mineral phosphate-solubilizing phenotype in bacteria is attributed predominantly to secretion of gluconic acid produced by oxidation of glucose by the glucose dehydrogenase enzyme and its cofactor, pyrroloquinoline quinone. This study analyzes pqqE gene expression and pqq promoter activity in the native phosphate-solubilizing bacterium Serratia sp S119 growing under P-limitation, and in the presence of root exudates obtained from peanut plants, also growing under P-limitation. Results indicated that Serratia sp. S119 contains a pqq operon composed of six genes (pqqA,B,C,D,E,F) and two promoters, one upstream of pqqA and other between pqqA and pqqB. PqqE gene expression and pqq promoter activity increased under P-limiting growth conditions and not under N-deficient conditions. In the plant-bacteria interaction assay, the activity of the bacterial pqq promoter region varied depending on the concentration and type of root exudates and on the bacterial growth phase. Root exudates from peanut plants growing under P-available and P-limiting conditions showed differences in their composition. It is concluded from this study that the response of Serratia sp. S119 to phosphorus limitation involves an increase in expression of pqq genes, and that molecules exuded by peanut roots modify expression of these phosphate-solubilizing bacterial genes during plant-bacteria interactions. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
International Nuclear Information System (INIS)
Roberts, J.K.M.; Aubert, S.; Gout, E.; Bligny, R.; Douce, R.
1997-01-01
Nucleotide metabolism in potato (Solanum tuberosum) mitochondria was studied using 31P-nuclear magnetic resonance spectroscopy and the O2 electrode. Immediately following the addition of ADP, ATP synthesis exceeded the rate of oxidative phosphorylation, fueled by succinate oxidation, due to mitochondrial adenylate kinase (AK) activity two to four times the maximum activity of ATP synthase. Only when the AK reaction approached equilibrium was oxidative phosphorylation the primary mechanism for net ATP synthesis. A pool of sequestered ATP in mitochondria enabled AK and ATP synthase to convert AMP to ATP in the presence of exogenous inorganic phosphate. During this conversion, AK activity can indirectly influence rates of oxidation of both succinate and NADH via changes in mitochondrial ATP. Mitochondrial nucleoside diphosphokinase, in cooperation with ATP synthase, was found to facilitate phosphorylation of nucleoside diphosphates other than ADP at rates similar to the maximum rate of oxidative phosphorylation. These results demonstrate that plant mitochondria contain all of the machinery necessary to rapidly regenerate nucleoside triphosphates from AMP and nucleoside diphosphates made during cellular biosynthesis and that AK activity can affect both the amount of ADP available to ATP synthase and the level of ATP regulating electron transport
Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan
2017-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.
Energy Technology Data Exchange (ETDEWEB)
Richard L. Blanton
2004-02-19
OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.
Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles
2003-01-01
Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032
Saliola, Michele; Scappucci, Gina; De Maria, Ilaria; Lodi, Tiziana; Mancini, Patrizia; Falcone, Claudio
2007-01-01
In Kluyveromyces lactis, the pentose phosphate pathway is an alternative route for the dissimilation of glucose. The first enzyme of the pathway is the glucose-6-phosphate dehydrogenase (G6PDH), encoded by KlZWF1. We isolated this gene and examined its role. Like ZWF1 of Saccharomyces cerevisiae, KlZWF1 was constitutively expressed, and its deletion led to increased sensitivity to hydrogen peroxide on glucose, but unlike the case for S. cerevisiae, the Klzwf1Δ strain had a reduced biomass yield on fermentative carbon sources as well as on lactate and glycerol. In addition, the reduced yield on glucose was associated with low ethanol production and decreased oxygen consumption, indicating that this gene is required for both fermentation and respiration. On ethanol, however, the mutant showed an increased biomass yield. Moreover, on this substrate, wild-type cells showed an additional band of activity that might correspond to a dimeric form of G6PDH. The partial dimerization of the G6PDH tetramer on ethanol suggested the production of an NADPH excess that was negative for biomass yield. PMID:17085636
International Nuclear Information System (INIS)
Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat
2011-01-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate
Energy Technology Data Exchange (ETDEWEB)
Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)
2011-12-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk
Molecular cloning of allelopathy related genes and their relation to HHO in Eupatorium adenophorum.
Guo, Huiming; Pei, Xixiang; Wan, Fanghao; Cheng, Hongmei
2011-10-01
In this study, conserved sequence regions of HMGR, DXR, and CHS (encoding 3-hydroxy-3-methylglutaryl-CoA reductase, 1-deoxyxylulose-5-phosphate reductoisomerase and chalcone synthase, respectively) were amplified by reverse transcriptase (RT)-PCR from Eupatorium adenophorum. Quantitative real-time PCR showed that the expression of CHS was related to the level of HHO, an allelochemical isolated from E. adenophorum. Semi-quantitative RT-PCR showed that there was no significant difference in expression of genes among three different tissues, except for CHS. Southern blotting indicated that at least three CHS genes are present in the E. adenophorum genome. A full-length cDNA from CHS genes (named EaCHS1, GenBank ID: FJ913888) was cloned. The 1,455 bp cDNA contained an open reading frame (1,206 bp) encoding a protein of 401 amino acids. Preliminary bioinformatics analysis of EaCHS1 revealed that EaCHS1 was a member of CHS family, the subcellular localization predicted that EaCHS1 was a cytoplasmic protein. To the best of our knowledge, this is the first report of conserved sequences of these genes and of a full-length EaCHS1 gene in E. adenophorum. The results indicated that CHS gene is related to allelopathy of E. adenophorum.
Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid
2017-04-01
Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.
miRNA778 and SUVH6 are involved in phosphate homeostasis in Arabidopsis.
Wang, Lei; ZengJ, Hou Qing; Song, Jun; Feng, Sheng Jun; Yang, Zhi Min
2015-09-01
microRNAs (miRNAs) play an important role in plant adaptation to phosphate (Pi) starvation. Histone methylation can remodel chromatin structure and mediate gene expression. This study identified Arabidopsis miR778, a Pi-responsive miRNA, and its target gene Su(var) 3-9 homologs 6 (SUVH6) encoding a histone H3 lysine 9 (H3K9) methyltransferase. Overexpression of miR778 moderately enhanced primary and lateral root growth, free phosphate accumulation in shoots, and accumulation of anthocyanin under Pi deficient conditions. miR778 overexpression relieved the arrest of columella cell development under Pi starvation. Conversely, transgenic plants overexpressing a miR778-target mimic (35S::MIM778), that act as a sponge and sequesters miR778, showed opposite phenotypes of 35S::miR778 plants under Pi deficiency. Expression of several Pi deficiency-responsive genes such as miR399, Phosphate Transporter (PHT1;4), Low Phosphate-Resistant1 (LPR1) and Production of Anthocyanin Pigment 1 (PAP1) were elevated in the miR778 overexpressing plants, suggesting that both miR778 and SUVH6 are involved in phosphate homeostasis in plants. This study has provided a basis for further investigation on how SUVH6 regulates its downstream genes through chromatin remodeling and DNA methylation in plants stressed by Pi deficiency. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Sudar Milovanovic, E; Jovanovic, A; Misirkic-Marjanovic, M; Vucicevic, Lj; Janjetovic, K; Isenovic, E R
2015-11-01
The aim of this study was to examine the effects of ghrelin on regulation of cardiac inducible nitric oxide synthase (iNOS) activity/expression in high fat (HF), obese rats.For this study, male Wistar rats fed with HF diet (30% fat) for 4 weeks were injected every 24 h for 5 days intracerebroventricularly (ICV) with ghrelin (0.3 nmol/5 µl) or with an equal volume of phosphate buffered saline (PBS). Control rats were ICV injected with an equal volume of PBS. Glucose, insulin and nitric oxide (NO) concentrations were measured in serum, while arginase activity and citrulline concentrations were measured in heart lysate. Protein iNOS and regulatory subunit of nuclear factor-κB (NFκB-p65), phosphorylation of enzymes protein kinase B (Akt) at Ser(473), and extracellular signal-regulated kinases 1/2 (ERK1/2) at Tyr(202)/Tyr(204) were determined in heart lysate by Western blot. For gene expression of iNOS qRT-PCR was used.Results show significantly (parginase activity (pactivity of cardiac iNOS via Akt phosphorylation followed by NFκB activation in HF rats. © Georg Thieme Verlag KG Stuttgart · New York.
Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby
2013-09-06
Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
Directory of Open Access Journals (Sweden)
Zenghui Hu
2017-08-01
Full Text Available Lilium is a world famous fragrant bulb flower with high ornamental and economic values, and significant differences in fragrance are found among different Lilium genotypes. In order to explore the mechanism underlying the different fragrances, the floral scents of Lilium ‘Sibeia’, with a strong fragrance, and Lilium ‘Novano’, with a very faint fragrance, were collected in vivo using a dynamic headspace technique. These scents were identified using automated thermal desorption—gas chromatography/mass spectrometry (ATD-GC/MS at different flowering stages. We used RNA-Seq technique to determine the petal transcriptome at the full-bloom stage and analyzed differentially expressed genes (DEGs to investigate the molecular mechanism of floral scent biosynthesis. The results showed that a significantly higher amount of Lilium ‘Siberia’ floral scent was released compared with Lilium ‘Novano’. Moreover, monoterpenes played a dominant role in the floral scent of Lilium ‘Siberia’; therefore, it is believed that the different emissions of monoterpenes mainly contributed to the difference in the floral scent between the two Lilium genotypes. Transcriptome sequencing analysis indicated that ~29.24 Gb of raw data were generated and assembled into 124,233 unigenes, of which 35,749 unigenes were annotated. Through a comparison of gene expression between these two Lilium genotypes, 6,496 DEGs were identified. The genes in the terpenoid backbone biosynthesis pathway showed significantly different expression levels. The gene expressions of 1-deoxy-D-xylulose 5-phosphate synthase (DXS, 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR, 4-hydroxy-3-methylbut-2-enyl diphosphate synthase (HDS, 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR, isopentenyl diphosphate isomerase (IDI, and geranyl diphosphate synthase (GPS/GGPS, were upregulated in Lilium ‘Siberia’ compared to Lilium ‘Novano’, and two monoterpene synthase genes
Directory of Open Access Journals (Sweden)
Mu eLi
2016-02-01
Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene
Lunkenbein, S.; Coiner, H.; Vos, de C.H.; Schaart, J.G.; Boone, M.J.; Krens, F.A.; Schwab, W.; Salentijn, E.M.J.
2006-01-01
An octaploid (Fragaria × ananassa cv. Calypso) genotype of strawberry was transformed with an antisense chalcone synthase (CHS) gene construct using a ripening related CHS cDNA from Fragaria × ananassa cv. Elsanta under the control of the constitutive CaMV 35S promoter via Agrobacterium tumefaciens.
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Diez-Fernandez, Carmen; Häberle, Johannes
2017-04-01
Carbamoyl phosphate synthetase 1 (CPS1) deficiency (CPS1D) is a rare autosomal recessive urea cycle disorder (UCD), which can lead to life-threatening hyperammonemia. Unless promptly treated, it can result in encephalopathy, coma and death, or intellectual disability in surviving patients. Over recent decades, therapies for CPS1D have barely improved leaving the management of these patients largely unchanged. Additionally, in many cases, current management (protein-restriction and supplementation with citrulline and/or arginine and ammonia scavengers) is insufficient for achieving metabolic stability, highlighting the importance of developing alternative therapeutic approaches. Areas covered: After describing UCDs and CPS1D, we give an overview of the structure- function of CPS1. We then describe current management and potential novel treatments including N-carbamoyl-L-glutamate (NCG), pharmacological chaperones, and gene therapy to treat hyperammonemia. Expert opinion: Probably, the first novel CPS1D therapies to reach the clinics will be the already commercial substance NCG, which is the standard treatment for N-acetylglutamate synthase deficiency and has been proven to rescue specific CPS1D mutations. Pharmacological chaperones and gene therapy are under development too, but these two technologies still have key challenges to be overcome. In addition, current experimental therapies will hopefully add further treatment options.
Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei
2015-04-01
Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Directory of Open Access Journals (Sweden)
Deqiang Tai
Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.
Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja
2017-07-01
The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.
Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C
2015-07-28
Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.
International Nuclear Information System (INIS)
Christie, J.M.; Jenkins, G.I.
1996-01-01
UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species
Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi
2016-07-01
Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.
18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells
Directory of Open Access Journals (Sweden)
Kuchipudi Suresh V
2012-10-01
Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and
Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru
2012-11-01
5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...
Directory of Open Access Journals (Sweden)
Raúl González
2015-08-01
Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.
Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase
International Nuclear Information System (INIS)
Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.
1990-01-01
The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6
Energy Technology Data Exchange (ETDEWEB)
Pejcha, Robert; Ludwig, Martha L. (Michigan)
2010-03-08
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
International Nuclear Information System (INIS)
Pejcha, Robert; Ludwig, Martha L.
2005-01-01
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Directory of Open Access Journals (Sweden)
Robert Pejchal
2005-02-01
Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Van Moerkercke, Alex; Galván-Ampudia, Carlos S; Verdonk, Julian C; Haring, Michel A; Schuurink, Robert C
2012-05-01
In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds occurs in these cells. However, whether the entire pathway is active in these cells and whether it is exclusively active in these cells remains to be proven. Cell-specific transcription factors activating these genes will determine in which cells they are expressed. In petunia, the transcription factor EMISSION OF BENZENOIDS II (EOBII) activates the ODORANT1 (ODO1) promoter and the promoter of the biosynthetic gene isoeugenol synthase (IGS). The regulator ODO1 in turn activates the promoter of the shikimate gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Here the identification of a new target gene of ODO1, encoding an ABC transporter localized on the plasma membrane, PhABCG1, which is co-expressed with ODO1, is described. PhABCG1 expression is up-regulated in petals overexpressing ODO1 through activation of the PhABCG1 promoter. Interestingly, the ODO1, PhABCG1, and IGS promoters were active in petunia protoplasts originating from both epidermal and mesophyll cell layers of the petal, suggesting that the volatile phenylpropanoid/benzenoid pathway in petunia is active in these different cell types. Since volatile release occurs from epidermal cells, trafficking of (volatile) compounds between cell layers must be involved, but the exact function of PhABCG1 remains to be resolved.
Directory of Open Access Journals (Sweden)
Maryam Parhamfar
2014-04-01
Full Text Available Introduction: Biofertilizers are the microorganisms that can convert useless nutrient to usable compounds. Unlike fertilizer, cost of biofertilizer production is low and doesn’t produce ecosystem pollution. Phosphate fertilizers can be replaced by phosphate biofertilizer to produce improvement. So, it is necessary to screen the climate-compatible phosphate solubilizing bacteria. Materials and methods: In this project samples were picked up from Loriya hot spring, which are located in Jiroft. Samples were incubated in PKV medium for 3 days. Screening of phosphate solubilizing bacteria was performed on the specific media, based on clear area diameter. The best bacterium was identified based on 16s rDNA gene. Phosphate solubilizing activity of this strain was considered in different carbon, nitrogen, phosphate and pH sources. Results: Sequence alignment and phylogenetic tree results show that B. sp. LOR033 is closely related to Bacillus licheniformis, with 97% homology. In addition, results show that maximum enzyme production was performed after 2 days that incubation pH was decreased simultaneously when the time was increased. Carbon sources investigation show that glucose is the most appropriate in enzyme production and phosphate releasing. Furthermore, results show that the optimum initial pH for phytase production was pH5.0. Different phosphate sources show that tricalcium phosphate has the suitable effect on enzyme activity in three days of incubation. Discussion and conclusion: Phosphatase enzyme production capacity, growth in acidic pH and phosphate solubilizing potential in different salt and phosphate sources show that this strain has considerable importance as biofertilizers.
Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan
2018-06-01
Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.
Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F
2014-10-01
A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.
DEFF Research Database (Denmark)
Sørensen, Kim I.; Hove-Jensen, Bjarne
1996-01-01
. The rpiB gene resided on a 4.6-kbp HindIII-EcoRV DNA fragment from phage lambda 10H5 (642) of the Kohara gene library and mapped at 92.85 min. Consistent with this map position, the cloned DNA fragment contained two divergent open reading frames of 149 and 296 codons, encoding ribose phosphate isomerase B...
Namitha, Kanakapura Krishnamurthy; Archana, Surya Narayana; Negi, Pradeep Singh
2011-04-01
To study the expression pattern of carotenoid biosynthetic pathway genes, changes in their expression at different stages of maturity in tomato fruit (cv. Arka Ahuti) were investigated. The genes regulating carotenoid production were quantified by a dot blot method using a DIG (dioxigenin) labelling and detection kit. The results revealed that there was an increase in the levels of upstream genes of the carotenoid biosynthetic pathway such as 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), 4-hydroxy-3-methyl-but-2-enyl diphosphate reductase (Lyt B), phytoene synthase (PSY), phytoene desaturase (PDS) and ζ-carotene desaturase (ZDS) by 2-4 fold at the breaker stage as compared to leaf. The lycopene and β-carotene content was analyzed by HPLC at different stages of maturity. The lycopene (15.33 ± 0.24 mg per 100 g) and β-carotene (10.37 ± 0.46 mg per 100 g) content were found to be highest at 5 days post-breaker and 10 days post-breaker stage, respectively. The lycopene accumulation pattern also coincided with the color values at different stages of maturity. These studies may provide insight into devising gene-based strategies for enhancing carotenoid accumulation in tomato fruits.
DEFF Research Database (Denmark)
Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong
2017-01-01
Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.
Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng
2017-03-01
Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
Komonyi, Orban; Schauer, Tamas; Papai, Gabor; Deak, Peter; Boros, Imre M
2009-03-15
Although telomere formation occurs through a different mechanism in Drosophila compared with other organisms, telomere associations result from mutations in homologous genes, indicating the involvement of similar pathways in chromosome end protection. We report here that mutations of the Drosophila melanogaster gene CG31241 lead to high frequency chromosome end fusions. CG31241 is a bicistronic gene that encodes trimethylguanosine synthase (TGS1), which forms the m3G caps of noncoding small RNAs, and a novel protein, DTL. We show that although TGS1 has no role in telomere protection, DTL is localized at specific sites, including the ends of polytene chromosomes, and its loss results in telomere associations. Mutations of ATM- and Rad3-related (ATR) kinase suppress telomere fusions in the absence of DTL. Thus, genetic interactions place DTL in an ATR-related pathway in telomere protection. In contrast to ATR kinase, mutations of ATM (ataxia telangiectasia mutated) kinase, which acts in a partially overlapping pathway of telomere protection, do not suppress formation of telomere associations in the absence of DTL. Thus, uncovering the role of DTL will help to dissect the evolutionary conserved pathway(s) controlling ATM-ATR-related telomere protection.
DEFF Research Database (Denmark)
Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.
2005-01-01
A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
DEFF Research Database (Denmark)
Yang, Shu-Yi; Grønlund, Mette; Jakobsen, Iver
2012-01-01
Pi acquisition of crops via arbuscular mycorrhizal (AM) symbiosis is becoming increasingly important due to limited highgrade rock Pi reserves and a demand for environmentally sustainable agriculture. Here, we show that 70% of the overall Pi acquired by rice (Oryza sativa) is delivered via...... or PT13 affected the development of the symbiosis, demonstrating that both genes are important for AM symbiosis. For symbiotic Pi uptake, however, only PT11 is necessary and sufficient. Consequently, our results demonstrate that mycorrhizal rice depends on the AM symbiosis to satisfy its Pi demands...... the symbiotic route. To better understand this pathway, we combined genetic, molecular, and physiological approaches to determine the specific functions of two symbiosis-specific members of the PHOSPHATE TRANSPORTER1 (PHT1) gene family from rice, ORYsa;PHT1;11 (PT11) and ORYsa;PHT1;13 (PT13). The PT11 lineage...
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper
2007-01-01
Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...
Cao, Tian-Shu; Chi, Zhe; Liu, Guang-Lei; Chi, Zhen-Ming
2014-01-01
It has been reported that trehalose plays an important role in stress tolerance in yeasts. Therefore, in order to construct a stably recombinant Saccharomyces sp. W0 with higher ethanol tolerance, the TPS1 gene encoding 6-phosphate-trehalose synthase cloned from Saccharomycopsis fibuligera A11 was ligated into the 18S rDNA integration vector pMIRSC11 and integrated into chromosomal DNA of Saccharomyces sp. W0. The transformant Z8 obtained had the content of 6.23 g of trehalose/100 g of cell dry weight, while Saccharomyces sp. W0 only contained 4.05 g of trehalose/100 g of cell dry weight. The transformant Z8 also had higher ethanol tolerance (cell survival was 25.1 % at 18 ml of ethanol/100 ml of solution) and trehalose-6-phosphate synthase (Tps1) activity (1.3 U/mg) and produced more ethanol (16.4 ml of ethanol/100 ml of medium) than Saccharomyces sp. W0 (cell survival was 12.1 % at 18 ml of ethanol/100 ml of solution, Tps1 activity was 0.8 U/mg and the produced ethanol concentration was 14.2 ml of ethanol/100 ml of medium) under the same conditions. The results show that trehalose indeed can play an important role in ethanol tolerance and ethanol production by Saccharomyces sp. W0.
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Evaluation of pink-pigmented facultative methylotrophic bacteria for phosphate solubilization.
Jayashree, Shanmugam; Vadivukkarasi, Ponnusamy; Anand, Kirupanithi; Kato, Yuko; Seshadri, Sundaram
2011-08-01
Thirteen pink-pigmented facultative methylotrophic (PPFM) strains isolated from Adyar and Cooum rivers in Chennai and forest soil samples in Tamil Nadu, India, along with Methylobacterium extorquens, M. organophilum, M. gregans, and M. komagatae were screened for phosphate solubilization in plates. P-solubilization index of the PPFMs grown on NBRIP-BPB plates for 7 days ranged from 1.1 to 2.7. The growth of PPFMs in tricalcium phosphate amended media was found directly proportional to the glucose concentration. Higher phosphate solubilization was observed in four strains MSF 32 (415 mg l(-l)), MDW 80 (301 mg l(-l)), M. komagatae (279 mg l(-l)), and MSF 34 (202 mg l(-l)), after 7 days of incubation. A drop in the media pH from 6.6 to 3.4 was associated with an increase in titratable acidity. Acid phosphatase activity was more pronounced in the culture filtrate than alkaline phosphatase activity. Adherence of phosphate to densely grown bacterial surface was observed under scanning electron microscope after 7-day-old cultures. Biochemical characterization and screening for methanol dehydrogenase gene (mxaF) confirmed the strains as methylotrophs. The mxaF gene sequence from MSF 32 clustered towards M. lusitanum sp. with 99% similarity. This study forms the first detailed report on phosphate solubilization by the PPFMs.
Chalcone synthase genes from milk thistle (Silybum marianum)
Indian Academy of Sciences (India)
... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...
Directory of Open Access Journals (Sweden)
Michelle F. Valentine
2017-05-01
Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.
Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.
2017-01-01
Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
International Nuclear Information System (INIS)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He; Su, Xiao-Dong
2006-01-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni 2+ -chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2 1 , with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°
Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish
2011-01-01
Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032
Directory of Open Access Journals (Sweden)
Ginsburg Hagai
2005-03-01
Full Text Available Abstract The general paradigm that emerges from the analysis of the transcriptome of the malaria parasite Plasmodium falciparum is that the expression clusters of genes that code for enzymes engaged in the same cellular function is coordinated. Here the consistency of this perception is examined by analysing specific pathways that metabolically-linked. The pentose phosphate pathway (PPP is a fundamental element of cell biochemistry since it is the major pathway for the recycling of NADP+ to NADPH and for the production of ribose-5-phosphate that is needed for the synthesis of nucleotides. The function of PPP depends on the synthesis of NADP+ and thiamine pyrophosphate, a co-enzyme of the PPP enzyme transketolase. In this essay, the transcription of gene coding for enzymes involved in the PPP, thiamine and NAD(P+ syntheses are analysed. The genes coding for two essential enzymes in these pathways, transaldolase and NAD+ kinase could not be found in the genome of P. falciparum. It is found that the transcription of the genes of each pathway is not always coordinated and there is usually a gene whose transcription sets the latest time for the full deployment of the pathway's activity. The activity of PPP seems to involve only the oxidative arm of PPP that is geared for maximal NADP+ reduction and ribose-5-phosphate production during the early stages of parasite development. The synthesis of thiamine diphosphate is predicted to occur much later than the expression of transketolase. Later in the parasite cycle, the non-oxidative arm of PPP that can use fructose-6-phosphate and glyceraldehyde-3-phosphate supplied by glycolysis, becomes fully deployed allowing to maximize the production of ribose-5-phosphate. These discrepancies require direct biochemical investigations to test the activities of the various enzymes in the developing parasite. Notably, several transcripts of PPP enzyme-coding genes display biphasic pattern of transcription unlike most
DEFF Research Database (Denmark)
Fedosov, Sergey
1994-01-01
In order to characterize ADP-ATP and creatine-creatine phosphate (Cr-CrP) shuttles a minimal mathematical model with two compartments and cyclic turnover of matter was designed. The 'mitochondrial' compartment contained 'ATP-synthase' and 'mitochondrial ereatine kinase' (mitCK). The 'cytoplasmic......' compartment consisted of 'ATPase', 'cytoplasmic creatine kinase' (cytCK) and an 'ADP-binding structure'. The exchange of metabolites between these compartments was limited. Different levels of cytCK and mitCK expression as welt as different exchange rate constants between the compartments were assigned...
International Nuclear Information System (INIS)
Haussühl, K.; Rohde, W.; Weissenböck, G.
1996-01-01
Four chalcone synthase (CHS; EC 2.3.1.74) clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation
TransDetect Identifies a New Regulatory Module Controlling Phosphate Accumulation.
Pal, Sikander; Kisko, Mushtak; Dubos, Christian; Lacombe, Benoit; Berthomieu, Pierre; Krouk, Gabriel; Rouached, Hatem
2017-10-01
Identifying transcription factor (TFs) cooperation controlling target gene expression is still an arduous challenge. The accuracy of current methods at genome scale significantly drops with the increase in number of genes, which limits their applicability to more complex genomes, like animals and plants. Here, we developed an algorithm, TransDetect, able to predict TF combinations controlling the expression level of a given gene. TransDetect was used to identify novel TF modules regulating the expression of Arabidopsis ( Arabidopsis thaliana ) phosphate transporter PHO1;H3 comprising MYB15, MYB84, bHLH35, and ICE1. These TFs were confirmed to interact between themselves and with the PHO1;H3 promoter. Phenotypic and genetic analyses of TF mutants enable the organization of these four TFs and PHO1;H3 in a new gene regulatory network controlling phosphate accumulation in zinc-dependent manner. This demonstrates the potential of TransDetect to extract directionality in nondynamic transcriptomes and to provide a blueprint to identify gene regulatory network involved in a given biological process. © 2017 American Society of Plant Biologists. All Rights Reserved.
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.
Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E
2016-11-01
Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.
Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong
2016-09-01
Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.
Díaz-Sánchez, Violeta; Avalos, Javier; Limón, M Carmen
2012-10-01
Fusarins are a class of mycotoxins of the polyketide family produced by different Fusarium species, including the gibberellin-producing fungus Fusarium fujikuroi. Based on sequence comparisons between polyketide synthase (PKS) enzymes for fusarin production in other Fusarium strains, we have identified the F. fujikuroi orthologue, called fusA. The participation of fusA in fusarin biosynthesis was demonstrated by targeted mutagenesis. Fusarin production is transiently stimulated by nitrogen availability in this fungus, a regulation paralleled by the fusA mRNA levels in the cell. Illumination of the cultures results in a reduction of the fusarin content, an effect partially explained by a high sensitivity of these compounds to light. Mutants of the fusA gene exhibit no external phenotypic alterations, including morphology and conidiation, except for a lack of the characteristic yellow and/or orange pigmentation of fusarins. Moreover, the fusA mutants are less efficient than the wild type at degrading cellophane on agar cultures, a trait associated with pathogenesis functions in Fusarium oxysporum. The fusA mutants, however, are not affected in their capacities to grow on plant tissues.
Habenicht, A; Quesada, A; Cerff, R
1997-10-01
A cDNA-library has been constructed from Nicotiana plumbaginifolia seedlings, and the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GapN, EC 1.2.1.9) was isolated by plaque hybridization using the cDNA from pea as a heterologous probe. The cDNA comprises the entire GapN coding region. A putative polyadenylation signal is identified. Phylogenetic analysis based on the deduced amino acid sequences revealed that the GapN gene family represents a separate ancient branch within the aldehyde dehydrogenase superfamily. It can be shown that the GapN gene family and other distinct branches of the superfamily have its phylogenetic origin before the separation of primary life-forms. This further demonstrates that already very early in evolution, a broad diversification of the aldehyde dehydrogenases led to the formation of the superfamily.
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.
Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N
2014-09-01
Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...
Directory of Open Access Journals (Sweden)
Vannozzi Alessandro
2012-08-01
Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be
Bifunctional effects of fucoidan on the expression of inducible nitric oxide synthase
International Nuclear Information System (INIS)
Yang, Jin Won; Yoon, Se Young; Oh, Soo Jin; Kim, Sang Kyum; Kang, Keon Wook
2006-01-01
Algal fucoidan is a marine sulfated polysaccharide with a wide variety of biological activities including anti-thrombotic and anti-inflammatory effects. This study evaluated the effect of fucoidan on the expression of inducible nitric oxide synthase (iNOS) in a macrophage cell line, RAW264.7. Low concentration range of fucoidan (10 μg/ml) increased the basal expression level of iNOS in quiescent macrophages. However, we found for the first time that fucoidan inhibited the release of nitric oxide (NO) in RAW264.7 cells stimulated with lipopolysaccharide (LPS). Western blot analysis revealed that fucoidan suppressed the LPS-induced expression of the inducible nitric oxide synthase (iNOS) gene. Moreover, the activation of both nuclear factor-κB (NF-κB) and activator protein 1 (AP-1) are key steps in the transcriptional activation of the iNOS gene. Here, it was revealed that fucoidan selectively suppressed AP-1 activation, and that the activation of AP-1 appears to be essential for the induction of iNOS in activated macrophages. This inhibitory effect on AP-1 activation by fucoidan might be associated with its NO blocking and anti-inflammatory effects
Houde, Mario; Diallo, Amadou Oury
2008-08-27
Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.
DEFF Research Database (Denmark)
Zhang, Chuanhui; Jiang, Dong; Liu, Fulai
2010-01-01
with the temporally change patterns of starch synthase activities and relative gene expression levels. For instance, activities of soluble and granule-bound starch synthases (designated SSS and GBSS) peaked at 20 and 24 DAF. Genes encoding isoforms of starch synthases expressed at different grain filling periods...
Energy Technology Data Exchange (ETDEWEB)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He, E-mail: liangyh@pku.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, Peking University, Beijing 100871 (China); Department of Biochemistry and Molecular Biology, College of Life Sciences, Peking University, Beijing 100871 (China)
2006-10-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.
Lane, Alexander; Boecklemann, Astrid; Woronuk, Grant N; Sarker, Lukman; Mahmoud, Soheil S
2010-03-01
We are developing Lavandula angustifolia (lavender) as a model system for investigating molecular regulation of essential oil (a mixture of mono- and sesquiterpenes) production in plants. As an initial step toward building the necessary 'genomics toolbox' for this species, we constructed two cDNA libraries from lavender leaves and flowers, and obtained sequence information for 14,213 high-quality expressed sequence tags (ESTs). Based on homology to sequences present in GenBank, our EST collection contains orthologs for genes involved in the 1-deoxy-D: -xylulose-5-phosphate (DXP) and the mevalonic acid (MVA) pathways of terpenoid biosynthesis, and for known terpene synthases and prenyl transferases. To gain insight into the regulation of terpene metabolism in lavender flowers, we evaluated the transcriptional activity of the genes encoding for 1-deoxy-D: -xylulose-5-phosphate synthase (DXS) and HMG-CoA reductase (HMGR), which represent regulatory steps of the DXP and MVA pathways, respectively, in glandular trichomes (oil glands) by real-time PCR. While HMGR transcripts were barely detectable, DXS was heavily expressed in this tissue, indicating that essential oil constituents are predominantly produced through the DXP pathway in lavender glandular trichomes. As anticipated, the linalool synthase (LinS)-the gene responsible for the production of linalool, a major constituent of lavender essential oil-was also strongly expressed in glands. Surprisingly, the most abundant transcript in floral glandular trichomes corresponded to a sesquiterpene synthase (cadinene synthase, CadS), although sesquiterpenes are minor constituents of lavender essential oils. This result, coupled to the weak activity of the MVA pathway (the main route for sesquiterpene production) in trichomes, indicates that precursor supply may represent a bottleneck in the biosynthesis of sesquiterpenes in lavender flowers.
Pudake, Ramesh Namdeo; Mehta, Chandra Mohan; Mohanta, Tapan Kumar; Sharma, Suvigya; Varma, Ajit; Sharma, Anil Kumar
2017-05-01
Phosphorus (P) is a vital nutrient for plant growth and development, and is absorbed in cells with the help of membrane-spanning inorganic phosphate transporter (Pht) protein. Symbiosis with arbuscular mycorrhiza (AM) also helps in transporting P from the soil to plant and Pht proteins play an important role in it. To understand this phenomenon in Finger Mille plant, we have cloned four Pht genes from Finger millet, which shares the homology with Pht1 protein family of cereals. Expression pattern analysis during the AM infection indicated that EcPT4 gene was AM specific, and its expression was higher in roots where AM colonization percentage was high. The expression level of EcPT1-4 gene under the phosphorous (Pi) stress in seedlings was found to be consistent with its role in acquisition of phosphorus. Homology study of the EcPt proteins with Pht proteins of cereals shows close relationship. The findings of the study indicate that Pht1 family genes from finger millet can serve to be an important resource for the better understanding of phosphorus use efficiency.
Moghadam, Ali Asghar; Ebrahimie, Eemaeil; Taghavi, Seyed Mohsen; Niazi, Ali; Babgohari, Mahbobeh Zamani; Deihimi, Tahereh; Djavaheri, Mohammad; Ramezani, Amin
2013-07-01
A small number of stress-responsive genes, such as those of the mitochondrial F1F0-ATP synthase complex, are encoded by both the nucleus and mitochondria. The regulatory mechanism of these joint products is mysterious. The expression of 6-kDa subunit (MtATP6), a relatively uncharacterized nucleus-encoded subunit of F0 part, was measured during salinity stress in salt-tolerant and salt-sensitive cultivated wheat genotypes, as well as in the wild wheat genotypes, Triticum and Aegilops using qRT-PCR. The MtATP6 expression was suddenly induced 3 h after NaCl treatment in all genotypes, indicating an early inducible stress-responsive behavior. Promoter analysis showed that the MtATP6 promoter includes cis-acting elements such as ABRE, MYC, MYB, GTLs, and W-boxes, suggesting a role for this gene in abscisic acid-mediated signaling, energy metabolism, and stress response. It seems that 6-kDa subunit, as an early response gene and nuclear regulatory factor, translocates to mitochondria and completes the F1F0-ATP synthase complex to enhance ATP production and maintain ion homeostasis under stress conditions. These communications between nucleus and mitochondria are required for inducing mitochondrial responses to stress pathways. Dual targeting of 6-kDa subunit may comprise as a mean of inter-organelle communication and save energy for the cell. Interestingly, MtATP6 showed higher and longer expression in the salt-tolerant wheat and the wild genotypes compared to the salt-sensitive genotype. Apparently, salt-sensitive genotypes have lower ATP production efficiency and weaker energy management than wild genotypes; a stress tolerance mechanism that has not been transferred to cultivated genotypes.
DEFF Research Database (Denmark)
Vionnet, Christine; Roubaty, Carole; Ejsing, Christer S.
2010-01-01
In yeast, the inositolphosphorylceramides mostly contain C26:0 fatty acids. Inositolphosphorylceramides were considered to be important for viability, since the inositolphosphorylceramide synthase AUR1 is essential. Yet, lcb1 cells, unable to make sphingoid bases and inositolphosphorylceramides......, are viable if they harbor SLC1-1, a gain of function mutation in the 1-acyl-glycerol-3-phosphate acyltransferase SLC1. SLC1-1 allows to incorporate C26:0 fatty acids into phosphatidylinositol (PI), thus generating PIii, an abnormal, C26-containing PI, presumably acting as surrogate...
Identification and phylogenetic analysis of a novel starch synthase in maize
Directory of Open Access Journals (Sweden)
Hanmei eLiu
2015-11-01
Full Text Available Starch is an important reserve of carbon and energy in plants, providing the majority of calories in the human diet and animal feed. Its synthesis is orchestrated by several key enzymes, and the amount and structure of starch, affecting crop yield and quality, are determined mainly by starch synthase (SS activity. To date, five SS isoforms, including SSI-IV and Granule Bound Starch Synthase (GBSS have been identified and their physiological functions have been well characterized. Here, we report the identification of a new SS isoform in maize, designated SSV. By searching sequenced genomes, SSV has been found in all green plants with conserved sequences and gene structures. Our phylogenetic analysis based on 780 base pairs has suggested that SSIV and SSV resulted from a gene duplication event, which may have occurred before the algae formation. An expression profile analysis of SSV in maize has indicated that ZmSSV is mainly transcribed in the kernel and ear leaf during the grain filling stage, which is partly similar to other SS isoforms. Therefore, it is likely that SSV may play an important role in starch biosynthesis. Subsequent analysis of SSV function may facilitate understanding the mechanism of starch granules formation, number and structure.
CTP limitation increases expression of CTP synthase in Lactococcus lactis
DEFF Research Database (Denmark)
Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan
2003-01-01
CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...
Genetics Home Reference: carbamoyl phosphate synthetase I deficiency
... belongs to a class of genetic diseases called urea cycle disorders. In this condition, the carbamoyl phosphate synthetase I ... Management Resources (4 links) Baby's First Test GeneReview: Urea Cycle Disorders Overview MedlinePlus Encyclopedia: Hereditary Urea Cycle Abnormality National ...
Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr
International Nuclear Information System (INIS)
Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.
2016-01-01
Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)
Directory of Open Access Journals (Sweden)
Fei eZhou
2015-04-01
Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V
2017-01-01
Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.
Yang, X.; Walboomers, X.F.; Dolder, J. van den; Yang, F.; Bian, Z.; Fan, M.; Jansen, J.A.
2008-01-01
Calcium phosphate nanoparticles have shown potential as non-viral vectors for gene delivery. The aim of this study was to induce bone morphogenetic protein (Bmp)2 transfection in rat dental pulp stem cells using calcium phosphate nanoparticles as a gene vector and then to evaluate the efficiency and
Directory of Open Access Journals (Sweden)
Broglie Karen E
2008-09-01
Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each
Engineering Potato Starch with a Higher Phosphate Content.
Directory of Open Access Journals (Sweden)
Xuan Xu
Full Text Available Phosphate esters are responsible for valuable and unique functionalities of starch for industrial applications. Also in the cell phosphate esters play a role in starch metabolism, which so far has not been well characterized in storage starch. Laforin, a human enzyme composed of a carbohydrate-binding module and a dual-specificity phosphatase domain, is involved in the dephosphorylation of glycogen. To modify phosphate content and better understand starch (dephosphorylation in storage starch, laforin was engineered and introduced into potato (cultivar Kardal. Interestingly, expression of an (engineered laforin in potato resulted in significantly higher phosphate content of starch, and this result was confirmed in amylose-free potato genetic background (amf. Modified starches exhibited altered granule morphology and size compared to the control. About 20-30% of the transgenic lines of each series showed red-staining granules upon incubation with iodine, and contained higher phosphate content than the blue-stained starch granules. Moreover, low amylose content and altered gelatinization properties were observed in these red-stained starches. Principle component and correlation analysis disclosed a complex correlation between starch composition and starch physico-chemical properties. Ultimately, the expression level of endogenous genes involved in starch metabolism was analysed, revealing a compensatory response to the decrease of phosphate content in potato starch. This study provides a new perspective for engineering starch phosphate content in planta by making use of the compensatory mechanism in the plant itself.
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae
2014-03-01
Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.