Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

International Nuclear Information System (INIS)

Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.

2009-01-01

This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

Parametric study of the fractional-order Chen-Lee system

International Nuclear Information System (INIS)

Tam, L.M.; Tou, W.M.S.

2008-01-01

The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

Parametric study of the fractional-order Chen-Lee system

Energy Technology Data Exchange (ETDEWEB)

Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)

2008-08-15

The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

Dynamics of fractional-ordered Chen system with delay

Indian Academy of Sciences (India)

Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review.

Science.gov (United States)

Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju

2016-07-21

Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016

Comparing numerical methods for the solutions of the Chen system

International Nuclear Information System (INIS)

Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.

2007-01-01

In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

Impulsive synchronization of Chen's hyperchaotic system

International Nuclear Information System (INIS)

Haeri, Mohammad; Dehghani, Mahsa

2006-01-01

In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

Science.gov (United States)

Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

2018-03-01

This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

Directory of Open Access Journals (Sweden)

Ana Maria Candela

2015-08-01

Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

A numeric-analytic method for approximating the chaotic Chen system

International Nuclear Information System (INIS)

Mossa Al-sawalha, M.; Noorani, M.S.M.

2009-01-01

The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

Science.gov (United States)

Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

2015-12-11

Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)

Science.gov (United States)

Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.

2017-01-01

In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe

OpenAIRE

Spinner, Kaspar H.

2014-01-01

Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

Science.gov (United States)

Fan, Ka-Wai

2018-01-01

This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

Chaos control of Chen chaotic dynamical system

International Nuclear Information System (INIS)

Yassen, M.T.

2003-01-01

This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET

Directory of Open Access Journals (Sweden)

Denis Dolinar

2015-12-01

Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

Chaos synchronization between Chen system and Genesio system

International Nuclear Information System (INIS)

Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao

2007-01-01

This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

Directory of Open Access Journals (Sweden)

Yee Hooi Min

2016-01-01

Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle.

Science.gov (United States)

Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C

2016-07-01

Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

An equilibrium point stabilization strategy for the Chen system

International Nuclear Information System (INIS)

Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo

2004-01-01

The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

Generalized projective synchronization between Lorenz system and Chen's system

International Nuclear Information System (INIS)

Li Guohui

2007-01-01

On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

Cyberaddictions: toward a psychosocial perspective.

Science.gov (United States)

Suissa, Amnon Jacob

2014-12-01

The concept of cyberaddiction is far from being unanimously accepted by scientists (Ko, Yen, Yen, Chen, & Chen, 2012; Pezoa-Jares, Espinoza-Luna & Vasquez-Medina, 2012; Nadeau & et al. 2011; Perraton, Fusaro & Bonenfant, 2011. The same is true of addiction to videogames (Hellman, Schoenmakers, Nordstrom, & Van Holst 2013); Coulombe (2010); or to Facebook (Andreassen et al. 2012; Levard & Soulas, 2010). While certain researchers wished to see this condition included in the DSM-5, others question the operational and practical basis for the diagnostic criteria (Block, 2008). Through a review of litterature and results from research findings; the aim of this article is to propose a psychosocial perspective for the cyberaddiction phenomenon. By a psychosocial perspective, we mean the inclusion of social determinants (weak social ties, social exclusion, hyper individualism, poverty, unemployment, etc) and not only the individual characteristics associated with the disease model in the addiction field. To what extent social conditions and cyberaddiction behaviors constitute a potential pathology ? Can we include a psychosocial approach to gain a more general picture of this contemporary issue? In response to these questions, a contextualization and an attempt to define cyberaddiction will be followed by an analysis of some major issues in the development of this type of addiction. As a conclusion, a demonstration of the cycle of addiction on how people develop addictions, including cyberaddictions, will be done within a psychosocial perspective in order to seize the multifactorial aspects of this addiction. Copyright © 2014 Elsevier Ltd. All rights reserved.

From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium

Science.gov (United States)

Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz

2017-06-01

Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].

Science.gov (United States)

Quan, Xiaohong; Li, Shuqian; Li, Ying

2017-03-12

Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

Directory of Open Access Journals (Sweden)

Richard K. Payne

2016-03-01

Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.

Theoretical and experimental study of Chen chaotic system with notch filter feedback control

International Nuclear Information System (INIS)

Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen

2010-01-01

Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)

His Excellency Professor Jiaer Chen President, National Natural Science Foundation, People's Republic of China

CERN Multimedia

Maximilien Brice

2002-01-01

L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.

Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen

OpenAIRE

Thoma, Axel Michael

2017-01-01

Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.

Time budgets of Snow Geese Chen caerulescens and Ross's Geese Chen rossii in mixed flocks: Implications of body size, ambient temperature and family associations

Science.gov (United States)

Jonsson, J.E.; Afton, A.D.

2009-01-01

Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.

[Academic thoughts on Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China].

Science.gov (United States)

Huang, Weiping; Li, Naiqi

2015-03-01

Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.

Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

OpenAIRE

Richard K. Payne

2016-01-01

Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...

Le jeu de la création : Le mangeur (2005 de Ying Chen

Directory of Open Access Journals (Sweden)

Nicole Dunham

2013-11-01

Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.

Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

International Nuclear Information System (INIS)

Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou

2008-01-01

A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study

Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

Energy Technology Data Exchange (ETDEWEB)

Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)

2008-11-15

A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.

76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer

Science.gov (United States)

2011-11-16

... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

Cyber addictions: toward a psychosocial perspective.

Science.gov (United States)

Suissa, Amnon Jacob

2015-04-01

The concept of cyberaddiction is far from being unanimously accepted by scientists (Ko, Yen, Yen, Chen, & Chen 2012; Pezoa-Jares, Espinoza-Luna & Vasquez-Medina 2012; Nadeau et al., 2011; Perraton, Fusaro & Bonenfant 2011). The same is true of addiction to videogames (Hellman, Schoenmakers, Nordstrom, & Van Holst 2013; Coulombe 2010); or to Facebook (Andreassen et al., 2012; Levard & Soulas, 2010). While certain researchers wished to see this condition included in the DSM-5 (Block, 2008), others question the operational and practical bases for the diagnostic criteria. Some see cyberaddiction as a problem linked more to time management, to brain deficits, to an impulse-control disorder or to psychosocial conditions while others consider it to be a pre-existing comorbidity. Considering that most addiction problems are generally understood more as individual and pathological problems rather than the result of psychosocial conditions (poverty, unemployment, weak social ties, social exclusion, hyper individualism, etc), the aim of this article is to propose a psychosocial perspective for this emerging trend in cyberaddictions. To what extent social conditions and cyberaddiction behaviors constitute a potential pathology? Can we include a psychosocial approach to gain a more general picture of this contemporary issue? In response to these questions, a contextualization and an attempt to define cyberaddiction will be followed by an analysis of some major issues in the development of this type of addiction. A demonstration of the cycle of addiction on how people develop addictions, including cyberaddictions, will be done within a psychosocial perspective in order to seize the multifactorial aspects of this addiction. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

Security problems for a pseudorandom sequence generator based on the Chen chaotic system

Science.gov (United States)

Özkaynak, Fatih; Yavuz, Sırma

2013-09-01

Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.

Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state

OpenAIRE

Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro

2014-01-01

We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...

Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra

International Nuclear Information System (INIS)

Moreno M, A.; Moreno B, A.

2000-01-01

In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra; Energia de activacion y factor de frecuencia de R. Chen en la ecuacion original de Randall y Wilkins para cinetica de segundo orden. Curva de emision simulada en algebra de Microsoft Excel

Energy Technology Data Exchange (ETDEWEB)

Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A

2000-07-01

In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass

Science.gov (United States)

Liu, Jian-Liang; Yu, Chengjie

2017-10-01

In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.

Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau

Science.gov (United States)

Ju, J.

2013-12-01

Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of

[Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

Science.gov (United States)

Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

2014-01-01

Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

Le jeu de la création : Le mangeur (2005) de Ying Chen

OpenAIRE

Nicole Dunham

2013-01-01

Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...

Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system

International Nuclear Information System (INIS)

Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun

2012-01-01

In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)

Wormholes supported by phantom energy from Shan-Chen cosmological fluids

Energy Technology Data Exchange (ETDEWEB)

Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)

2016-03-15

In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)

Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

OpenAIRE

Giafferri, Xiaomin

2008-01-01

Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...

The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed

Science.gov (United States)

Chen, Chi-ju

2017-04-01

Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop

New contributions to the knowledge of Chinese flea beetle fauna (III): Revision of Meishania Chen & Wang with description of five new species (Coleoptera: Chrysomelidae: Galerucinae)

Science.gov (United States)

The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...

X-ray attenuation coefficients and photoelectric cross sections of Cu, Fe and Sn for the energy range 3-29 KeV

International Nuclear Information System (INIS)

Wang Dachun; Yang Hua; Luo Pingan; Ding Xunliang; Wang Xinfu; Zhou Hongyu; Shen Xinyin; Zhu Guanghua

1991-08-01

The document contains the following two papers: X-ray attenuation coefficient and photoelectric cross sections of Sn for the Energy Range 3.3 KeV to 29.1 KeV - by Wang Dachun, Yang Hua and Luo Pingan. X-ray attenuation coefficients and photoelectric cross sections of Cu and Fe for the range 3 KeV to 29 KeV - by Wang Dachun, Ding Xunliang, Wang Xinfu, Yang Hua, Zhou Hongyu, Shen Xinyin and Zhu Guanghua. A separate abstract was prepared for each of these papers. Refs, figs and tabs

21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

CERN Multimedia

CERN Photo Service

2008-01-01

21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

Directory of Open Access Journals (Sweden)

Xiaomin Giafferri

2008-12-01

Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

CERN Multimedia

Maximilien Brice

2007-01-01

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

Psychometric properties of the Revised Chen Internet Addiction Scale (CIAS-R) in Chinese adolescents.

Science.gov (United States)

Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M

2014-10-01

The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.

Screening for Internet Addiction: An Empirical Study on Cut-off Points for the Chen Internet Addiction Scale

Directory of Open Access Journals (Sweden)

Chih-Hung Ko

2005-12-01

Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.

Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling

Science.gov (United States)

Sepehrinia, Reza; Chalangari, Fartash

2018-03-01

The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.

Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n

Directory of Open Access Journals (Sweden)

Péter Bíró

2011-01-01

Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.

Plasma biochemistry values in emperor geese (Chen canagica) in Alaska: comparisons among age, sex, incubation, and molt.

Science.gov (United States)

Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.

2009-01-01

Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.

Body mass of prefledging Emperor Geese Chen canagica: Large-scale effects of interspecific densities and food availability

Science.gov (United States)

Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.

2008-01-01

We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.

Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan

Directory of Open Access Journals (Sweden)

M.-L. Lin

2005-01-01

Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.

[Reiner Nürnberg, Ekkehard Höxtermann, Martina Voigt. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts] / Monika von Hirschheydt

Index Scriptorium Estoniae

Hirschheydt, Monika von

2015-01-01

Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014

6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

CERN Multimedia

Maximilien Brice

2012-01-01

6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan

Science.gov (United States)

Zhang, Wen-Yan; Lin, Chao-Yuan

2017-04-01

The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

Serum Metabolomic Characterization of Liver Fibrosis in Rats and Anti-Fibrotic Effects of Yin-Chen-Hao-Tang

Directory of Open Access Journals (Sweden)

Hongyang Zhang

2016-01-01

Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.

Social Entrepreneurial Intention among Business Undergraduates: An Emerging Economy Perspective

Directory of Open Access Journals (Sweden)

Noorseha Ayob

2014-09-01

Full Text Available Social entrepreneurs are viewed as having the abilities to combat social and economic problems in which government, businesses, and non-profits may not be able to solve the problems alone. Consequently, with the collaboration among these sectors, more social enterprises can be established to create social values and development in a nation, specifically among the emerging economies. Therefore, it is timely to investigate what motivates undergraduates to develop social entrepreneurial intention. Drawing from the entrepreneurial models of Shapero and Sokol (1982 and Kruger and Brazeal (1994, this study aims to examine the social entrepreneurial intention among undergraduates from the perspective of an emerging economy. The proposed conceptual model differs from the existing entrepreneurial intention studies by adding the concepts of empathy and social entrepreneurship exposure as the antecedents to perceived desirability and perceived feasibility of social enterprising start-up, which in turn link to social entrepreneurial intention. Using the quota sampling technique, data were collected from 257 business and economics undergraduates from both public and private higher education institutions in Malaysia. The survey instrument was adapted from prior related studies, for instance, Davis (1983 for empathy; Shapero and Sokol (1982 for social entrepreneurship exposure; Krueger (1993 for perceived desirability and perceived feasibility; and Chen et al. (1998 for social entrepreneurial intention. Partial least squares path modelling was used to analyze the hypothesized relationships in the proposed conceptual framework. It is hoped that the findings of this study will shed light on the existing literature of social entrepreneurship, specifically the social entrepreneurial intention studies from the emerging economies perspective.

Social Entrepreneurial Intention among Business Undergraduates: An Emerging Economy Perspective

Directory of Open Access Journals (Sweden)

Ayob Noorseha

2013-12-01

Full Text Available Social entrepreneurs are viewed as having the abilities to combat social and economic problems in which government, businesses, and non-profits may not be able to solve the problems alone. Consequently, with the collaboration among these sectors, more social enterprises can be established to create social values and development in a nation, specifically among the emerging economies. Therefore, it is timely to investigate what motivates undergraduates to develop social entrepreneurial intention. Drawing from the entrepreneurial models of Shapero and Sokol (1982 and Kruger and Brazeal (1994, this study aims to examine the social entrepreneurial intention among undergraduates from the perspective of an emerging economy. The proposed conceptual model differs from the existing entrepreneurial intention studies by adding the concepts of empathy and social entrepreneurship exposure as the antecedents to perceived desirability and perceived feasibility of social enterprising start-up, which in turn link to social entrepreneurial intention. Using the quota sampling technique, data were collected from 257 business and economics undergraduates from both public and private higher education institutions in Malaysia. The survey instrument was adapted from prior related studies, for instance, Davis (1983 for empathy; Shapero and Sokol (1982 for social entrepreneurship exposure; Krueger (1993 for perceived desirability and perceived feasibility; and Chen et al. (1998 for social entrepreneurial intention. Partial least squares path modelling was used to analyze the hypothesized relationships in the proposed conceptual framework. It is hoped that the findings of this study will shed light on the existing literature of social entrepreneurship, specifically the social entrepreneurial intention studies from the emerging economies perspective.

Two phases of droplet evaporation during plasma arc spraying: reply to Chen's comment about the 'rocket' effect under conditions of thermal plasma spraying

Energy Technology Data Exchange (ETDEWEB)

Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)

2007-07-07

The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)

A variational numerical method based on finite elements for the nonlinear solution characteristics of the periodically forced Chen system

Science.gov (United States)

Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.

2017-09-01

Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

CERN Multimedia

Maximilien Brice

2007-01-01

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

The prevalence and pathogenicity of gizzard nematodes of the genera Amidostomum and Epomidiostomum (Trichostrongylidae) in the lesser snow goose (Chen caerulescens caerulescens)

Science.gov (United States)

Tuggle, B.N.; Crites, John L.

1984-01-01

Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.

Chlorpromazine-induced perturbations of bile acids and free fatty acids in cholestatic liver injury prevented by the Chinese herbal compound Yin-Chen-Hao-Tang.

Science.gov (United States)

Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li

2015-04-16

Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of

Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'

Directory of Open Access Journals (Sweden)

Kay Schaffer

2006-09-01

Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.

Redescription of the Indo-West Pacific scorpionfish (Scorpaenidae), Neomerinthe erostris (Alcock 1896), a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002.

Science.gov (United States)

Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar

2015-09-29

The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.

New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae

Directory of Open Access Journals (Sweden)

Hua-yan Chen

2017-01-01

Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n

Metrics for Uncertainty in Organizational Decision-Making

Science.gov (United States)

2006-06-01

measurement and computational agents. Computational Economics : A Perspective from Computational Intelligence book. S.- H. Chen, Jain, Lakhmi, & Tai...change and development." Annual Review of Psychology 50: 361-386. Von Neumann, J., and Morgenstern, O. (1953). Theory of games and economic ...2006 Interviews versus Field data MI MPU Hanford/HAB (CR: cooperation) Savannah River Site/SAB (MR: competition) ER ER about 7.1% in 2002 ER

"Is political behavior a viable coping strategy to perceived organizational politics? Unveiling the underlying resource dynamics": Correction to Sun and Chen (2017).

Science.gov (United States)

2017-10-01

Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Sociological Perspectives.

Science.gov (United States)

Townley, Charles; Middleton, Mike

This monograph examines sociological perspectives and their applications. It is intended to help the college student coming to sociology for the first time to recognize that there are several perspectives within sociology and to disentangle the mass of terms associated with each. The first distinctive sociological perspective came from the work of…

Variation in foraging behavior and body mass in broods of Emperor Geese (Chen canagica): Evidence for interspecific density dependence

Science.gov (United States)

Schmutz, J.A.; Laing, K.K.

2002-01-01

Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling

A Biophysico-Computational Perspective of Breast Cancer Pathogenesis and Treatment Response

Science.gov (United States)

2007-03-01

E C T E D P R O O F Tan, J. L., Tien, J., Pirone, D.M., Gray, D. S., Bhadriraju, K., andChen, C. S. (2003). Cells lying on a bed of microneedles : An...provided by P. Khavari, Stanford Medical Center) were used directly. Adenovirus Tet, V12Rac, V12Rac H40, PID, Pak1 WT, and HA-tagged β2-Chimerin have...polarized acini were then isolated in PBS/10mM EDTA, infected with adenovirus (15 minutes; 37°C) and transgene expression was confirmed by immunofluoresence

MENTAL HEALTH: ISLAMIC PERSPECTIVE

OpenAIRE

Muzdalifah M. Rahman

2015-01-01

The purpose of this paper was to explain the concept of mental health perspective Contemporary Psychology, describes the mental health of an Islamic perspective and describes how mental health recovery. The theory used is the concept of mental health perspective Contemporary Psychology, and the concept of mental health perspective Islamic Psychology Writing is writing method using qualitative research methods. Mental health is avoiding an Islamic perspective of all symptoms, complaints and...

Ten perspectives on Nordic energy

Energy Technology Data Exchange (ETDEWEB)

Tennbakk, Berit

2006-10-15

Summary: Perspective no. 1: Costly early learning from the EU ETS - Unforeseen price levels hit industries hard; Perspective no. 2: Market based support schemes - Do they work as intended? Perspective no. 3: New decade in the Nordic energy markets. Perspective no. 4: Reduced CO{sub 2} emissions and more renewables - Are we getting there or not? Perspective no. 5: Interpretation of financial requirements - An impediment to sound investments? Perspective no. 6: Who should invest in infrastructure - Public or private investors? Perspective no. 7: Re regulation is not the answer - Need for coordination calls for a visible hand? Perspective no. 8: Increased infrastructure investments - Due to EU ETS and support schemes for RES. Perspective no. 9: Energy, welfare and industry - Complex links make policy making difficult. Perspective no. 10 'Fuel' for an energy policy discussion - A Nordic energy policy agenda? (AG)

The perspective awareness model - Eliciting multiple perspectives to formulate high quality decisions

International Nuclear Information System (INIS)

Boucher, Laurel

2013-01-01

A great deal of attention is given to the importance of communication in environmental remediation and radioactive waste management. However, very little attention is given to eliciting multiple perspectives so as to formulate high quality decisions. Plans that are based on a limited number of perspectives tend to be narrowly focused whereas those that are based on a wide variety of perspectives tend to be comprehensive, higher quality, and more apt to be put into application. In addition, existing methods of dialogue have built-in limitations in that they typically draw from the predominant thinking patterns which focus in some areas but ignore others. This can result in clarity but a lack of comprehensiveness. This paper presents a Perspective Awareness Model which helps groups such as partnering teams, interagency teams, steering committees, and working groups elicit a wide net of perspectives and viewpoints. The paper begins by describing five factors that makes cooperation among such groups challenging. Next, a Perspective Awareness Model that makes it possible to manage these five factors is presented. The two primary components of this model --- the eight 'Thinking Directions' and the 'Shared Documentation' --- are described in detail. Several examples are given to illustrate how the Perspective Awareness Model can be used to elicit multiple perspectives to formulate high quality decisions in the area of environmental remediation and radioactive waste management. (authors)

Revision of the subfamily Opiinae (Hymenoptera, Braconidae from Hunan (China, including thirty-six new species and two new genera

Directory of Open Access Journals (Sweden)

Li Xi-Ying

2013-02-01

postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n

Perspective-takers behave more stereotypically.

Science.gov (United States)

Galinsky, Adam D; Wang, Cynthia S; Ku, Gillian

2008-08-01

Nine studies demonstrated that perspective-takers are particularly likely to adopt a target's positive and negative stereotypical traits and behaviors. Perspective-takers rated both positive and negative stereotypic traits of targets as more self-descriptive. As a result, taking the perspective of a professor led to improved performance on an analytic task, whereas taking the perspective of a cheerleader led to decreased performance, in line with the respective stereotypes of professors and cheerleaders. Similarly, perspective-takers of an elderly target competed less compared to perspective-takers of an African American target. Including the stereotype in the self (but not liking of the target) mediated the effects of perspective-taking on behavior, suggesting that cognitive and not affective processes drove the behavioral effects. These effects occurred using a measure and multiple manipulations of perspective-taking, as well as a panoply of stereotypes, establishing the robustness of the link between perspective-taking and stereotypical behavior. The findings support theorizing (A. D. Galinsky, G. Ku, & C. S. Wang, 2005) that perspective-takers utilize information, including stereotypes, to coordinate their behavior with others and provide key theoretical insights into the processes of both perspective-taking and behavioral priming. (c) 2008 APA, all rights reserved

Religious architecture: anthropological perspectives

NARCIS (Netherlands)

Verkaaik, O.

2013-01-01

Religious Architecture: Anthropological Perspectives develops an anthropological perspective on modern religious architecture, including mosques, churches and synagogues. Borrowing from a range of theoretical perspectives on space-making and material religion, this volume looks at how religious

The Hierarchical Perspective

Directory of Open Access Journals (Sweden)

Daniel Sofron

2015-05-01

Full Text Available This paper is focused on the hierarchical perspective, one of the methods for representing space that was used before the discovery of the Renaissance linear perspective. The hierarchical perspective has a more or less pronounced scientific character and its study offers us a clear image of the way the representatives of the cultures that developed it used to perceive the sensitive reality. This type of perspective is an original method of representing three-dimensional space on a flat surface, which characterises the art of Ancient Egypt and much of the art of the Middle Ages, being identified in the Eastern European Byzantine art, as well as in the Western European Pre-Romanesque and Romanesque art. At the same time, the hierarchical perspective is also present in naive painting and infantile drawing. Reminiscences of this method can be recognised also in the works of some precursors of the Italian Renaissance. The hierarchical perspective can be viewed as a subjective ranking criterion, according to which the elements are visually represented by taking into account their relevance within the image while perception is ignored. This paper aims to show how the main objective of the artists of those times was not to faithfully represent the objective reality, but rather to emphasize the essence of the world and its perennial aspects. This may represent a possible explanation for the refusal of perspective in the Egyptian, Romanesque and Byzantine painting, characterised by a marked two-dimensionality.

Four EIS Perspectives: A literature review

DEFF Research Database (Denmark)

Pries-Heje, Jan; Svejvig, Per

A literature review of the Enterprise Information Systems literature reveals a number of recurring issues. We identify and detail four different perspectives that together categorizes the topics found. The first being a technical-rational perspective. The second being a social perspective....... The third being a more political and emergent perspective. Fourth, we identify a design-oriented perspective. We categorize the literature on EIS using these four perspectives, and for each perspective we identify core issues. Finally we discuss how the four perspectives complement each other....

A Comparison of the Social-Adaptive Perspective and Functionalist Perspective on Guilt and Shame

Directory of Open Access Journals (Sweden)

Heidi L. Dempsey

2017-12-01

Full Text Available Within the field of guilt and shame two competing perspectives have been advanced. The first, the social-adaptive perspective, proposes that guilt is an inherently adaptive emotion and shame is an inherently maladaptive emotion. Thus, those interested in moral character development and psychopathology should work to increase an individual’s guilt-proneness and decrease an individual’s shame-proneness. The functionalist perspective, in contrast, argues that both guilt and shame can serve a person adaptively or maladaptively—depending on the situational appropriateness, duration, intensity, and so forth. This paper reviews the research conducted supporting both positions; critiques some issues with the most widely used guilt- and shame-proneness measure in the social-adaptive research (the TOSCA and discusses the differences in results found when assessing guilt and shame at the state versus trait level. The conclusion drawn is that although there is broad support for the functionalist perspective across a wide variety of state and trait guilt/shame studies, the functionalist perspective does not yet have the wealth of data supporting it that has been generated by the social-adaptive perspective using the TOSCA. Thus, before a dominant perspective can be identified, researchers need to (1 do more research assessing how the social-adaptive perspective compares to the functionalist perspective at the state level and (2 do more trait research within the functionalist perspective to compare functionalist guilt- and shame-proneness measures with the TOSCA.

A Comparison of the Social-Adaptive Perspective and Functionalist Perspective on Guilt and Shame

Science.gov (United States)

2017-01-01

Within the field of guilt and shame two competing perspectives have been advanced. The first, the social-adaptive perspective, proposes that guilt is an inherently adaptive emotion and shame is an inherently maladaptive emotion. Thus, those interested in moral character development and psychopathology should work to increase an individual’s guilt-proneness and decrease an individual’s shame-proneness. The functionalist perspective, in contrast, argues that both guilt and shame can serve a person adaptively or maladaptively—depending on the situational appropriateness, duration, intensity, and so forth. This paper reviews the research conducted supporting both positions; critiques some issues with the most widely used guilt- and shame-proneness measure in the social-adaptive research (the TOSCA) and discusses the differences in results found when assessing guilt and shame at the state versus trait level. The conclusion drawn is that although there is broad support for the functionalist perspective across a wide variety of state and trait guilt/shame studies, the functionalist perspective does not yet have the wealth of data supporting it that has been generated by the social-adaptive perspective using the TOSCA. Thus, before a dominant perspective can be identified, researchers need to (1) do more research assessing how the social-adaptive perspective compares to the functionalist perspective at the state level and (2) do more trait research within the functionalist perspective to compare functionalist guilt- and shame-proneness measures with the TOSCA. PMID:29232888

Accidents in perspective

International Nuclear Information System (INIS)

Gittus, J.H.

1989-01-01

The nuclear industry perspective and the public perspective on big nuclear accidents and leukaemia near nuclear sites are discussed. The industry perspective is that big accidents are so unlikely as to be virtually impossible and that leukaemia is not specifically associated with nuclear installations. Clusters of cancer with statistical significance occur in major cities. The public perspective is coloured by a prejudice and myth: the fear of radiation. The big nuclear accident is seen therefore as much more unacceptable than any other big accident. Risks associated with Sizewell-B nuclear station and the liquid gas depot at Canvey Island are discussed. The facts and figures are presented as tables and graphs. Given conflicting interpretations of the leukaemia problem the public inclines towards the more pessimistic view. (author)

Ma Ying-jeou’s Presidential Discourse

Directory of Open Access Journals (Sweden)

Jonathan Sullivan

2012-01-01

Full Text Available Despite the substantial advances made in cross-Strait relations during Ma Ying-jeou’s (Ma Yingjiu first term, the ROC president’s rhetoric varied considerably as he grappled with the difficult reality of implementing campaign and inauguration pledges to establish better relations with China while striving to maintain national respect and sovereignty. In this article, we put forward a framework for measuring, analysing and explaining this variation in President Ma’s first-term discourse. Analysing a very large number of Ma’s speeches, addresses, etc., we provide empirical assessments of how the content of Ma’s public pronouncements has developed over time, how his rhetoric varies according to the strategic context and timing of a speech, and how his discourse compares to that of his predecessor, Chen Shui-bian (Chen Shuibian. In addressing these questions, the article contributes a quantitative perspective to existing work on political discourse in Taiwan and to the growing methodological and applied literature on how to systematically analyse Chinese political text.

China Report, Political, Sociological and Military Affairs, No. 445.

Science.gov (United States)

1983-08-11

2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics

Science.gov (United States)

1998-07-01

Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62

Life support and euthanasia, a perspective on Shaw's new perspective.

Science.gov (United States)

Busch, Jacob; Rodogno, Raffaele

2011-02-01

It has recently been suggested by Shaw (2007) that the distinction between voluntary active euthanasia, such as giving a patient a lethal overdose with the intention of ending that patient's life, and voluntary passive euthanasia, such as removing a patient from a ventilator, is much less obvious than is commonly acknowledged in the literature. This is argued by suggesting a new perspective that more accurately reflects the moral features of end-of-life situations. The argument is simply that if we consider the body of a mentally competent patient who wants to die, a kind of 'unwarranted' life support, then the distinction collapses. We argue that all Shaw has provided is a perspective that makes the conclusion that there is little distinction between voluntary active euthanasia and voluntary passive euthanasia only seemingly more palatable. In doing so he has yet to convince us that this perspective is superior to other perspectives and thus more accurately reflects the moral features of the situations pertaining to this issue.

A Matter of Perspective

Science.gov (United States)

2012-04-21

can differ depending on whether a person is influenced by either an individualistic or collectivistic environment. Although perspective-taking...need for a deeper understanding and appreciation of others’ perspectives and cultures is relevant in a wide range of missions, and especially so in...perspective-taking a critical component in achieving cultural awareness and understanding, but it also is necessary for development of interpersonal

古今中西之間--陳垣與20世紀中國史學%Between the Ancient and the Present and between China and the West：Prof. Chen Yuan and Chinese Historiography in the 20 th Century

Institute of Scientific and Technical Information of China (English)

陳智超

2010-01-01

Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.

Revision of the subfamily Opiinae (Hymenoptera, Braconidae) from Hunan (China), including thirty-six new species and two new genera

Science.gov (United States)

Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai

2013-01-01

van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis

Inferring Perspective Versus Getting Perspective: Underestimating the Value of Being in Another Person's Shoes.

Science.gov (United States)

Zhou, Haotian; Majka, Elizabeth A; Epley, Nicholas

2017-04-01

People use at least two strategies to solve the challenge of understanding another person's mind: inferring that person's perspective by reading his or her behavior (theorization) and getting that person's perspective by experiencing his or her situation (simulation). The five experiments reported here demonstrate a strong tendency for people to underestimate the value of simulation. Predictors estimated a stranger's emotional reactions toward 50 pictures. They could either infer the stranger's perspective by reading his or her facial expressions or simulate the stranger's perspective by watching the pictures he or she viewed. Predictors were substantially more accurate when they got perspective through simulation, but overestimated the accuracy they had achieved by inferring perspective. Predictors' miscalibrated confidence stemmed from overestimating the information revealed through facial expressions and underestimating the similarity in people's reactions to a given situation. People seem to underappreciate a useful strategy for understanding the minds of others, even after they gain firsthand experience with both strategies.

Reference: 291 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen

The Multi-perspective Process Explorer

NARCIS (Netherlands)

Mannhardt, Felix; De Leoni, Massimiliano; Reijers, Hajo A.

2015-01-01

Organizations use process mining techniques to analyze event data recorded by their information systems. Multi-perspective process mining techniques make use of data attributes attached to events to analyze processes from multiple perspectives. Applying those multi-perspective process mining

International critical perspectives

NARCIS (Netherlands)

Sambrook, S.A.; Poell, R.F.

2014-01-01

The Problem Critical perspectives on human resource development (HRD) have emerged, across Europe and America, hailed as the future of the field. However, we note the paucity of critical perspectives globally, the problematic dominance of critical HRD activities in Western sites of theory and

Nomenclatural corrections to the taxonomic revision of The Old World species of Boehmeria (Urticaceae, tribus Boehmeriae) by Wilmot-Dear and Friis (2013)

DEFF Research Database (Denmark)

Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.

2014-01-01

(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...

Religious Architecture : Anthropological Perspectives

OpenAIRE

2013-01-01

Religious Architecture: Anthropological Perspectives develops an anthropological perspective on modern religious architecture, including mosques, churches and synagogues. Borrowing from a range of theoretical perspectives on space-making and material religion, this volume looks at how religious buildings take their place in opposition to the secular surroundings, how they, as evocations of the sublime, help believers to move beyond the boundaries of modern subjectivity, and how they, in their...

MARGA_Chen et al_2016

Data.gov (United States)

U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...

THREE PERSPECTIVES ON MANAGING FRONT END INNOVATION

DEFF Research Database (Denmark)

Jensen, Anna Rose Vagn; Clausen, Christian; Gish, Liv

2018-01-01

as a complementary perspective. The paper combines a literature review with an empirical examination of the application of these multiple perspectives across three cases of front end of innovation (FEI) management in mature product developing companies. While the process models represent the dominant, albeit rather...... to represent an emergent approach in managing FEI where process models, knowledge strategies and objects become integrated elements in more advanced navigational strategies for key players.......This paper presents three complementary perspectives on the management of front end innovation: A process model perspective, a knowledge perspective and a translational perspective. While the first two perspectives are well established in literature, we offer the translation perspective...

Perspective switching using theories and interpretations

Energy Technology Data Exchange (ETDEWEB)

Farmer, W.M. [Mitre Corp., Bedford, MA (United States)

1996-12-31

An important aspect of intelligence is the ability to switch perspectives. In the course of reasoning about a particular subject matter, it can be convenient to change from one perspective of the subject matter to another perspective, which is often at a different level of abstraction. For example, in some situations it may be advantageous to view a building as a collection of floors and in other situations as a collection of wings. If the arrangement of the rooms is not important for the task at hand, the building might be viewed as simply an unstructured collection of rooms. These are three perspectives on how a building can be decomposed. Utilizing multiple perspectives and freeing moving from one to another is a powerful method for both managing complexity and organizing knowledge. The key idea behind this method is to always employ the {open_quotes}right{close_quotes} perspective for each reasoning task. This talk will address the following two questions: (1) What logical machinery is needed to formalize perspective switching? (2) How can knowledge associated with one perspective be retrieved for use with another perspective?

The Cultural Boundaries of Perspective-Taking: When and Why Perspective-Taking Reduces Stereotyping.

Science.gov (United States)

Wang, Cynthia S; Lee, Margaret; Ku, Gillian; Leung, Angela K-Y

2018-06-01

Research conducted in Western cultures indicates that perspective-taking is an effective social strategy for reducing stereotyping. The current article explores whether and why the effects of perspective-taking on stereotyping differ across cultures. Studies 1 and 2 established that perspective-taking reduces stereotyping in Western but not in East Asian cultures. Using a socioecological framework, Studies 2 and 3 found that relational mobility, that is, the extent to which individuals' social environments provide them opportunities to choose new relationships and terminate old ones, explained our effect: Perspective-taking was negatively associated with stereotyping in relationally mobile (Western) but not in relationally stable (East Asian) environments. Finally, Study 4 examined the proximal psychological mechanism underlying the socioecological effect: Individuals in relationally mobile environments are more motivated to develop new relationships than those in relationally stable environments. Subsequently, when this motivation is high, perspective-taking increases self-target group overlap, which then decreases stereotyping.

MENTAL HEALTH: ISLAMIC PERSPECTIVE

Directory of Open Access Journals (Sweden)

Muzdalifah M. Rahman

2015-02-01

of mental health, especially mental health needs to be developed with an Islamic perspective various studies and research, especially the development of mental health recovery means Islamic perspective.

Placing Motivation and Future Time Perspective Theory in a Temporal Perspective

Science.gov (United States)

Simons, Joke; Vansteenkiste, Maarten; Lens, Willy; Lacante, Marlies

2004-01-01

An overview of the conceptual development of future time perspective theory [Nuttin, J. R. (1984). "Motivation, Planning and Action: A Relational Theory of Behavior," Erlbaum, Hillsdale, NJ; Nuttin, J., and Lens, W. (1985). "Future Time Perspective and Motivation: Theory and Research Method," Leuven University Press and Erlbaum, Leuven, Belgium…

Meteorological data fields 'in perspective'

Science.gov (United States)

Hasler, A. F.; Pierce, H.; Morris, K. R.; Dodge, J.

1985-01-01

Perspective display techniques can be applied to meteorological data sets to aid in their interpretation. Examples of a perspective display procedure applied to satellite and aircraft visible and infrared image pairs and to stereo cloud-top height analyses are presented. The procedure uses a sophisticated shading algorithm that produces perspective images with greatly improved comprehensibility when compared with the wire-frame perspective displays that have been used in the past. By changing the 'eye-point' and 'view-point' inputs to the program in a systematic way, movie loops that give the impression of flying over or through the data field have been made. This paper gives examples that show how several kinds of meteorological data fields are more effectively illustrated using the perspective technique.

Forest health from different perspectives

Science.gov (United States)

T. E. Kolb; M. R. Wagner; W. W. Covington

1995-01-01

Forest health is an increasingly important concept in natural resource management. However, definition of forest health is difficult and dependent on human perspective. From a utilitarian perspective, forest health has been defined by the production of forest conditions which directly satisfy human needs. From an ecosystem-centered perspective, forest health has been...

Relational Perspectives on Leading

DEFF Research Database (Denmark)

Relational Perspectives on Leading discusses leadership from a relational and social constructionism perspective as practiced on an everyday basis between people. The book pursues a fast growing, practice-based approach - particularly within the Anglo-Saxon parts of the world - to organization...

Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China

Science.gov (United States)

Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min

2018-01-01

Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422

Observer perspective imagery with stuttering.

Science.gov (United States)

Lowe, Robyn; Menzies, Ross; Packman, Ann; O'Brian, Sue; Onslow, Mark

2015-01-01

Adults who stutter are at risk of developing a range of psychological conditions. Social anxiety disorder is the most common anxiety disorder associated with stuttering. Observer perspective imagery is one cognitive process involved in the maintenance of some anxiety disorders. This involves viewing images as if looking at the self from the perspective of another. In contrast, the field perspective involves looking out from the self at the surrounding environment. The purpose of this study was to assess the presence of observer perspective imagery with stuttering. The authors administered the Hackmann, Surawy and Clark (1998) semi-structured interview to 30 adults who stutter and 30 controls. Group images and impressions were compared for frequency, perspective recalled and emotional valence. The stuttering group was significantly more likely than controls to recall images and impressions from an observer rather than a field perspective for anxious situations. It is possible the present results could reflect the same attentional processing bias that occurs with anxiety disorders in the non-stuttering population. These preliminary results provide an explanation for the persistence of conditions such as social anxiety disorder with stuttering. Clinical implications are discussed.

Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae

Directory of Open Access Journals (Sweden)

Mingqiang Wang

2017-12-01

Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.

Turning the Kaleidoscope: Five Perspectives on Procurement

DEFF Research Database (Denmark)

Munkgaard Møller, Morten; Vammen, Søren

Purpose of this paper The purpose of the paper is to provide a conceptual foundation to enhance the body of knowledge related to procurement and sourcing through a framework consisting of five perspectives. The perspectives are: (1) Strategic, (2) Organizational, (3) Capability, (4) Supplier......, and a (5) Customer Perspectives. The aim is to develop a holistic perspective of procurement by applying these five essential, but very different perspectives in order to achieve a holistic picture of the function. Design/methodology/approach The foundation is derived from various well-established theories...... within the five perspectives. Specifically, procurement was viewed from the perspective of organizational theory, network theory, resource/knowledge based views of the firm, transaction cost theory and various theories within the strategic field of research Findings By viewing procurement through...

Perspectives on the future of nuclear power

International Nuclear Information System (INIS)

Chernoff, H.; Friedman, D.

1990-01-01

The US outlook on the future of nuclear power can be divided into three perspectives, here termed the macroeconomic perspective, the technological perspective, and the utility perspective (including independent power producers, or IPPs). A brief review of the macroeconomic and technological perspectives shows how differently the public, the media, politicians, and many nonutility advocates of nuclear power view the future of nuclear power (and, especially, the requirements for new orders) compared with the utilities and prospective IPPs

Exploring Multiple Usability Perspectives

DEFF Research Database (Denmark)

Uldall-Espersen, Tobias

2007-01-01

Industrial usability work often fails to produce the expected impact on software products even though significant resources have been used on uncovering problems and suggesting improvements. So, it seems that feedback from industrial usability work lacks persuasiveness, i.e. it fails to convince...... the key stakeholders that actions need to be taken. This study reports from interviews with 26 stakeholders in software development projects. Our data suggests that the interviewees address usability using different perspectives and based on our observations we describe five such perspectives. Further, we...... discuss how applying different usability perspectives might inform the persuasiveness of usability work....

Perspectives used for gaining approval of budgets.

Science.gov (United States)

Franks-Joiner, G L

1990-01-01

Nurse executives think about problems using a certain perspective which may influence decisions on budgetary matters. The nurse executives' perspective used in decision-making may influence which budget proposals are developed and approved. A study was performed to determine the perspective used by nurse executives in decision-making on supplementary budget item proposals and whether perspective use influenced approval. Findings showed that use of the system view or dual-domain perspective in a proposal may enhance nurse executives' changes of gaining approval.

Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)

African Journals Online (AJOL)

Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.

Construction of full-length cDNA library of white flower Salvia ...

African Journals Online (AJOL)

STORAGESEVER

2009-05-18

May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

The Process Perspective on Trust in Organizations

DEFF Research Database (Denmark)

Jagd, Søren

Several trust researchers have pointed to the relevance of the process perspective for understanding trust in organizations. In this paper I review the attempts to apply the process perspective in trust research distinguishing between a soft and a strong process perspective. It appears that nearly......’s history? A few examples of studies applying a strong process perspective to trust in organizations is discussed.  Summarising, I argue that the process perspective, in general, may contribute furthering the understanding of the complexities of the development of trust over time and that the strong process...

The effect of culture on perspective taking.

Science.gov (United States)

Wu, Shali; Keysar, Boaz

2007-07-01

People consider the mental states of other people to understand their actions. We evaluated whether such perspective taking is culture dependent. People in collectivistic cultures (e.g., China) are said to have interdependent selves, whereas people in individualistic cultures (e.g., the United States) are said to have independent selves. To evaluate the effect of culture, we asked Chinese and American pairs to play a communication game that required perspective taking. Eye-gaze measures demonstrated that the Chinese participants were more tuned into their partner's perspective than were the American participants. Moreover, Americans often completely failed to take the perspective of their partner, whereas Chinese almost never did. We conclude that cultural patterns of interdependence focus attention on the other, causing Chinese to be better perspective takers than Americans. Although members of both cultures are able to distinguish between their perspective and another person's perspective, cultural patterns afford Chinese the effective use of this ability to interpret other people's actions.

Housing in a sustainable consumption perspective

DEFF Research Database (Denmark)

Gram-Hanssen, Kirsten

2015-01-01

In a global perspective, sustainability includes a social, an economic and an environmental perspective (United Nations 1987). In this chapter I focus on the environmental perspective from a North-Western point of view, and in this context sustainable consumption is mainly about reducing the use ......-third of all energy consumed (Danish Energy Authority 2010). Thus irrespective of whether one approaches the topic from above or from below, housing is important when dealing with sustainable consumption.......In a global perspective, sustainability includes a social, an economic and an environmental perspective (United Nations 1987). In this chapter I focus on the environmental perspective from a North-Western point of view, and in this context sustainable consumption is mainly about reducing the use...... of non-renewable resources as well as avoiding environmental pollution and waste. Resource consumption, emissions and waste related to housing can be assessed either from ‘above’ or from ‘below’. When counting from below, from the point of the individual consumer, three main consumption areas are usually...

Wise Ways of Seeing: Wisdom and Perspectives

Directory of Open Access Journals (Sweden)

Roger Walsh

2015-03-01

Full Text Available The capacity for perspective taking is thought to be linked to psychological development and to wisdom. This article draws from psychological, contemplative, cross-cultural, and philosophical disciplines to create an inventory of perspectival skills and their possible relationships to wisdom. The nature of perspectives is explored, as are the characteristics of healthy perspectives, and the factors—such as developmental stage, assumptions, and state of mind—that determine the number and kinds of available perspectives. The article then examines rare postconventional perspectival capacities such as the ability to integrate multiple perspectives, to adopt higher order metaperspectives, and to experience transperspectival “pure awareness.” Fifteen kinds of wise perspectives and perspectival skills are suggested. Finally, the article reviews psychological, relational, contemplative, philosophical, and educational methods thought to foster perspectival skills and wisdom.

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.

Abstract processing and observer vantage perspective in dysphoria.

Science.gov (United States)

Hart-Smith, Ly; Moulds, Michelle L

2018-05-07

processing and observer vantage perspective have been associated with negative consequences in depression. We investigated the relationship between mode of processing and vantage perspective bidirectionally in high and low dysphoric individuals, using abstract and concrete descriptions of experimenter-provided everyday actions. When vantage perspective was manipulated and processing mode was measured (Study 1a), participants who adopted a field perspective did not differ from those who adopted an observer perspective in their preference for abstract descriptions, irrespective of dysphoria status. When processing mode was manipulated and vantage perspective was measured (Study 1b), participants provided with abstract descriptions had a greater tendency to adopt an observer perspective than those provided with concrete descriptions, irrespective of dysphoria status. These results were replicated in larger online samples (Studies 2a and 2b). Together, they indicate a unidirectional causal relationship, whereby processing mode causally influences vantage perspective, in contrast to the bidirectional relationship previously reported in an unselected sample (Libby, Shaeffer, & Eibach, 2009). Further, these findings demonstrate that abstract processing increases the likelihood of adopting an observer perspective, and support targeting abstract processing in the treatment of depression to address the negative consequences associated with both abstract processing and recalling/imagining events from an observer perspective. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

The String Landscape: A Personal Perspective

Science.gov (United States)

Dienes, Keith R.

2015-02-01

In keeping with the "Perspectives" theme of this volume, this Chapter provides a personal perspective on the string landscape. Along the way, the perspectives of many other physicists are discussed as well. No attempt is made to provide a thorough and balanced review of the field, and indeed there is a slight emphasis on my own contributions to this field, as these contributions have been critical to forming my perspective. This Chapter is adapted from a Colloquium which I have delivered at a number of institutions worldwide, and I have attempted to retain the informal and non-technical spirit and style of this Colloquium presentation as much as possible.

Ecological Perspectives in HCI

DEFF Research Database (Denmark)

Blevis, Eli; Bødker, Susanne; Flach, John

The aim of the workshop is to provide a forum for researchers and practitioners to discuss the present and future of ecological perspectives in HCI. The participants will reflect on the current uses and interpretations of “ecology” and related concepts in the field. The workshop will assess the p...... the potential of ecological perspectives in HCI for supporting rich and meaningful analysis, as well as innovative design, of interactive technologies in real-life contexts......The aim of the workshop is to provide a forum for researchers and practitioners to discuss the present and future of ecological perspectives in HCI. The participants will reflect on the current uses and interpretations of “ecology” and related concepts in the field. The workshop will assess...

Browse Title Index

African Journals Online (AJOL)

Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...

Development of quantum perspectives in modern physics

Directory of Open Access Journals (Sweden)

Charles Baily

2009-03-01

Full Text Available Introductory undergraduate courses in classical physics stress a perspective that can be characterized as realist; from this perspective, all physical properties of a classical system can be simultaneously specified and thus determined at all future times. Such a perspective can be problematic for introductory quantum physics students, who must develop new perspectives in order to properly interpret what it means to have knowledge of quantum systems. We document this evolution in student thinking in part through pre- and post-instruction evaluations using the Colorado Learning Attitudes about Science Survey. We further characterize variations in student epistemic and ontological commitments by examining responses to two essay questions, coupled with responses to supplemental quantum attitude statements. We find that, after instruction in modern physics, many students are still exhibiting a realist perspective in contexts where a quantum-mechanical perspective is needed. We further find that this effect can be significantly influenced by instruction, where we observe variations for courses with differing learning goals. We also note that students generally do not employ either a realist or a quantum perspective in a consistent manner.

The “Axial” (“Vanishing Axis” Perspective

Directory of Open Access Journals (Sweden)

Daniel Sofron

2015-11-01

Full Text Available The present paper approaches the axial perspective, a method of spatial representation that precedes the invention of the Renaissance geometrical perspective. Despite being typical to ancient Greek and Roman art, the axial perspective can also be identified during the Middle Ages and the early Renaissance period and it represents the first form of systematic convergence of parallel lines. At the same time, the paper presents Erwin Panofsky's theories on this spatial suggestion method. Trying to offer it a scientific foundation, the researcher builds a system that he calls "the vanishing axis perspective" and puts forward a series of arguments in favour of the existence of such a perspective. Although the axial perspectival constructions imply awkward superimpositions of planes that might seem geometrically inaccurate, this method of spatial structuring of the image constitutes an important stage in the process of identifying solutions for the faithful reproduction of concrete reality and an essential stepin the development process of thevanishing point perspective.

Age-related perspectives and emotion processing.

Science.gov (United States)

Lynchard, Nicholas A; Radvansky, Gabriel A

2012-12-01

Emotion is processed differently in younger and older adults. Older adults show a positivity effect, whereas younger adults show a negativity effect. Socioemotional selectivity theory suggests that these effects can be elicited in any age group when age-related perspectives are manipulated. To examine this, younger and older adults were oriented to actual and age-contrasting possible selves. Emotion activations were assessed using lexical decision. In line with socioemotional selectivity theory, shifts in emotion orientation varied according to perspective, with both younger and older adults showing a negativity effect when a younger adult perspective was taken and a positivity effect when an older adult perspective was taken. 2013 APA, all rights reserved

Action Research in European perspective

DEFF Research Database (Denmark)

Rasmussen, Lauge Baungaard

2004-01-01

The article gives an overview of how different Italian and Danish contributions to action research can be viewed in an European perspective.......The article gives an overview of how different Italian and Danish contributions to action research can be viewed in an European perspective....

Shifting visual perspective during retrieval shapes autobiographical memories.

Science.gov (United States)

St Jacques, Peggy L; Szpunar, Karl K; Schacter, Daniel L

2017-03-01

The dynamic and flexible nature of memories is evident in our ability to adopt multiple visual perspectives. Although autobiographical memories are typically encoded from the visual perspective of our own eyes they can be retrieved from the perspective of an observer looking at our self. Here, we examined the neural mechanisms of shifting visual perspective during long-term memory retrieval and its influence on online and subsequent memories using functional magnetic resonance imaging (fMRI). Participants generated specific autobiographical memories from the last five years and rated their visual perspective. In a separate fMRI session, they were asked to retrieve the memories across three repetitions while maintaining the same visual perspective as their initial rating or by shifting to an alternative perspective. Visual perspective shifting during autobiographical memory retrieval was supported by a linear decrease in neural recruitment across repetitions in the posterior parietal cortices. Additional analyses revealed that the precuneus, in particular, contributed to both online and subsequent changes in the phenomenology of memories. Our findings show that flexibly shifting egocentric perspective during autobiographical memory retrieval is supported by the precuneus, and suggest that this manipulation of mental imagery during retrieval has consequences for how memories are retrieved and later remembered. Copyright © 2017 Elsevier Inc. All rights reserved.

Perspective taking in older age revisited: a motivational perspective.

Science.gov (United States)

Zhang, Xin; Fung, Helene H; Stanley, Jennifer T; Isaacowitz, Derek M; Ho, Man Yee

2013-10-01

How perspective-taking ability changes with age (i.e., whether older adults are better at understanding others' behaviors and intentions and show greater empathy to others or not) is not clear, with prior empirical findings on this phenomenon yielding mixed results. In a series of experiments, we investigated the phenomenon from a motivational perspective. Perceived closeness between participants and the experimenter (Study 1) or the target in an emotion recognition task (Study 2) was manipulated to examine whether the closeness could influence participants' performance in faux pas recognition (Study 1) and emotion recognition (Study 2). It was found that the well-documented negative age effect (i.e., older adults performed worse than younger adults in faux pas and emotion recognition tasks) was only replicated in the control condition for both tasks. When closeness was experimentally increased, older adults enhanced their performance, and they now performed at a comparable level as younger adults. Findings from the 2 experiments suggest that the reported poorer performance of older adults in perspective-taking tasks might be attributable to a lack of motivation instead of ability to perform in laboratory settings. With the presence of strong motivation, older adults have the ability to perform equally well as younger adults.

Evolution of Theoretical Perspectives in My Research

Science.gov (United States)

Otero, Valerie K.

2009-11-01

Over the past 10 years I have been using socio-cultural theoretical perspectives to understand how people learn physics in a highly interactive, inquiry-based physics course such as Physics and Everyday Thinking [1]. As a result of using various perspectives (e.g. Distributed Cognition and Vygotsky's Theory of Concept Formation), my understanding of how these perspectives can be useful for investigating students' learning processes has changed. In this paper, I illustrate changes in my thinking about the role of socio-cultural perspectives in understanding physics learning and describe elements of my thinking that have remained fairly stable. Finally, I will discuss pitfalls in the use of certain perspectives and discuss areas that need attention in theoretical development for PER.

Three new species of the genus Gnamptogenys (Hymenoptera, Formicidae from southern China with a key to the known Chinese species

Directory of Open Access Journals (Sweden)

Zhilin Chen

2017-02-01

Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.

Reference: 418 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua

European Cyber Security Perspectives 2015

NARCIS (Netherlands)

Baloo, J.; Geveke, H.G.; Paulissen, W.; Vries, H. de

2015-01-01

Following the success of last year’s publication, we are proud to present the second edition of our European Cyber Security Perspectives report. Through this collection of articles, we aim to share our different perspectives and insights, the latest developments and achievements in the field of

Human flesh search: a supplemental review.

Science.gov (United States)

Chao, Chian-Hsueng; Tao, Yu-Hui

2012-07-01

Human flesh search (HFS), a phenomenon that has recently emerged over the Internet, represents the interaction between the virtual and real worlds. The term "HFS" is equivalent to "cyber manhunt" in the West, although there were more large-scale HFS events reported in the East recently. While the majority of academic articles on HFS have focused on the Chinese context, the phenomenon has also been reported in many countries and involves diverse issues such as the controversy between privacy violation and public opinion. Based on 16 HFS references, a review paper by Chen and Sharma summarizes core issues on growth, incidents, distinctive attributes, key benefits and drawbacks, findings, and research gaps and opportunities. Echoing their call for a global HFS context, the current article provides a Taiwanese HFS context based on 32 reported incidents in Taiwan. To conduct an incremental HFS review, this study expands the reference base to 33 carefully selected academic articles from China and Taiwan. The review findings range from 6 derived HFS perspectives supplementing each article, 12 frequently mentioned HFS concepts, and 4 additional research directions. The resulting comprehensive knowledge of HFS, along with that contributed by Chen and Sharma, can be considered a useful reference framework for future HFS studies and policy making.

The Development of Teacher Perspectives: Final Report.

Science.gov (United States)

Tabachnick, B. Robert; Zeichner, Kenneth M.

This longitudinal study of the development of perspectives toward teaching consists of three major phases: (1) an examination of the impact of the student teaching experience on the development of teacher perspectives; (2) an examination of the continuing development of teacher perspectives during the first year of teaching; and (3) further…

Physics perspectives for a Future Circular Collider: FCC-hh/eh - Physics-Perspectives

CERN Multimedia

CERN. Geneva

2017-01-01

The lectures will briefly discuss the parameters of a Future Circular Collider, before addressing in detail the physics perspectives and the challenges for the experiments and detector systems. The main focus will be on ee and pp collisions, but opportunities for e—p physics will also be covered. The FCC physics perspectives will be presented with reference to the ongoing LHC programme, including the physics potential from future upgrades to the LHC in luminosity and possibly energy.

Efficient Transfer of Graphene-Physical and Electrical Performance Perspective

KAUST Repository

Ghoneim, Mohamed T.

2012-11-01

Efficient Transfer of Graphene –Physical and Electrical Performance Perspective Graphene has become one of the most widely used atomic crystal structure materials since its first experimental proof by Geim-Novoselov in 2004 [1]. This is attributed to its reported incredible carrier mobility, mechanical strength and thermal conductivity [2] [3] [4]. These properties suggest interesting applications of Graphene ranging from electronics to energy storage and conversion [5]. In 2008, Chen et al reported a 40,000 cm2V-1s-1 mobility for a Single Layer Graphene (SLG) on SiO2 compared to 285 cm2V-1s-1 for silicon channel devices [6]. Chemical vapor deposition (CVD) is a common method for growing graphene on a metal surface as a catalyst for graphene nucleation. This adds a necessary transfer step to the target substrate ultimately desired for graphene devices fabrication. Interfacing with graphene is a critical challenge in preserving its promising high mobility. This initiated the motivation for studying the effect of intermediate interfaces imposed by transfer processes. In this work, few layers graphene (FLG) was grown on copper foils inside a high temperature furnace. Then Raman spectroscopy was performed on grown graphene sample to confirm few (in between 3-10) layers. Afterwards the sample was cut into three pieces and transferred to 300 nm SiO2 on Si substrates using three techniques, namely: (i) pickup transfer with top side of Graphene brought in contact with SiO2 [7], (ii) Ploy (methyl methacrylate) (PMMA) transfer with Graphene and a PMMA support layer on top scooped from bottom side [8], and (iii) a modified direct transfer which is similar to PMMA transfer without the support layer [9]. Comparisons were done using Raman spectroscopy to determine the relative defectivity, Scanning Electron Microscopy (SEM) to observe discontinuities and Atomic Force Microscopy (AFM) to measure surface roughness. Then we conclude with electrical data based on the contact

Project Management – Multi-perspective Leadership

DEFF Research Database (Denmark)

Riis, Eva

2014-01-01

”Project Management – Multi-perspective Leadership” af Hans Mikkelsen og Jens Ove Riis - anmeldelse......”Project Management – Multi-perspective Leadership” af Hans Mikkelsen og Jens Ove Riis - anmeldelse...

Symbolic interactionism and critical perspective: divergent or synergistic?

Science.gov (United States)

Burbank, Patricia M; Martins, Diane C

2010-01-01

Throughout their history, symbolic interactionism and critical perspective have been viewed as divergent theoretical perspectives with different philosophical underpinnings. A review of their historical and philosophical origins reveals both points of divergence and areas of convergence. Their underlying philosophies of science and views of human freedom are different as is their level of focus with symbolic interactionism having a micro perspective and critical perspective using a macro perspective. This micro/macro difference is reflected in the divergence of their major concepts, goals and basic tenets. While their underlying philosophies are different, however, they are not necessarily contradictory and areas of convergence may include the concepts of reference groups and looking glass self within symbolic interactionism and ideological hegemony within critical perspective. By using a pragmatic approach and combining symbolic interactionism and critical perspectives, both micro and macro levels come into focus and strategies for change across individual and societal levels can be developed and applied. Application of both symbolic interactionism and critical perspective to nursing research and scholarship offers exciting new opportunities for theory development and research methodologies. In nursing education, these two perspectives can give students added insight into patients' and families' problems at the micro level while, at the same time, giving them a lens to see and tools to apply to problems at the macro level in health care. In nursing practice, a combined symbolic interactionism/critical perspective approach assists nurses to give high-quality care at the individual level while also working at the macro level to address the manufacturers of illness. New research questions emerge from this combination of perspectives with new possibilities for theory development, a transformation in nursing education, and the potential for new practice strategies that

Gas assessment and perspectives

International Nuclear Information System (INIS)

Ferrier, Jerome; Bouchard, Georges; Al-Saffar, Ali; ); Bros, Thierry; Khayat, Armand; Leger, Sebastien; Nyouki, Evariste; Jamme, Dominique; Remont, Sophie; Delamare, Monique; Hureau, Geoffroy; Poillion, Christophe; Noilhan, Fabrice; Lafon, Madeleine; Lagumina, Sandra

2015-01-01

This document reports the content of contributions and debates of the 'Gas assessment and perspectives' convention organised by the AFG (the French Gas Association) in March 2015. After an introduction speech, a contributor proposed a comment of the 'World energy outlook 2014' (discussion of factors related to demand and to supply, pressures related to climate change). A round table discussed the context and overview of the gas market, and more precisely addressed the evolution of the gas European market on the short term (demand, storage, production, imports, LNG market), the gas demand for electricity production (the electricity European market, impact on gas, European perspectives, the gas market, three scenarios of evolution of gas demand, World perspectives), the European gas demand on the medium term (the control of gas price in Europe, the final decline of gas, the assessment of the European energy policy, the divorce between Russia and Europe), the recent trends and perspectives for the LNG market (price evolution, a still comfortable market, LNG back in Europe, demand and supply, LNG in the global energy mix), and an assessment of the French gas market by the CRE (the French Commission on Energy Regulation). A second round table addressed the security of gas supply: status and perspectives for the European gas supply, stress tests and measures on the short term to improve supply security, role of the State in the security of gas supply, storage as a key tool for the security of supply, development of new policy for security of supplies. The last speech stated the point of view of a GrDF manager

Perspectives on Energy Security

International Nuclear Information System (INIS)

Carlsson-Kanyama, Annika; Holmgren, Aake J.; Joensson, Thomas; Larsson, Robert L.

2007-05-01

A common notion of 'Energy Security' is that it includes access to energy resources without risking the the survival of the state. 'Security of supply' is most often the concept emphasized in the political discourse on energy security and it includes both production as well as secure and safe delivery of energy to the end consumers. Another aspect of energy security is the need for reducing energy consumption by improving energy efficiency. In this report, eight chapters covering these and other perspectives on energy security are presented. Six of the chapters deal with the supply perspective. Included topics cover power politics and geopolitical perspectives regarding large infrastructure projects and the ambitions of the EU in this regard. Further, methods and approaches for conducting risk analyses of electricity supply systems as well as for improving the security of digital control systems are discussed. As climate change will affect the supply and distribution of energy, one chapter presents an overview of this topic. The consumption perspective is discussed against the backdrop of research about household consumption practices and the role of climate change for future consumption levels. Finally, the role of armed forces as a large energy users is touched upon, as well as how so-called 'future studies' have dealt with energy as a topic

Perspectives of employability skills

OpenAIRE

ANNE LOUISE NEWTON

2017-01-01

The study investigated the different perspectives held by young people, employers and policy makers around Employability Skills and it examined how young people learnt these skills. This study draws young peoples’ perspectives into the research around Employability Skills and highlights the way in which social and cultural capital mediate their development. The research points to a model to re-vision employability skills which recognises the many ways in which they are learnt, over time a...

Perspectives on Applied Ethics

OpenAIRE

2007-01-01

Applied ethics is a growing, interdisciplinary field dealing with ethical problems in different areas of society. It includes for instance social and political ethics, computer ethics, medical ethics, bioethics, envi-ronmental ethics, business ethics, and it also relates to different forms of professional ethics. From the perspective of ethics, applied ethics is a specialisation in one area of ethics. From the perspective of social practice applying eth-ics is to focus on ethical aspects and ...

Untitled

Indian Academy of Sciences (India)

Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...

Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...

African Journals Online (AJOL)

Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.

Visual perspective in remembering and episodic future thought.

Science.gov (United States)

McDermott, Kathleen B; Wooldridge, Cynthia L; Rice, Heather J; Berg, Jeffrey J; Szpunar, Karl K

2016-01-01

According to the constructive episodic simulation hypothesis, remembering and episodic future thinking are supported by a common set of constructive processes. In the present study, we directly addressed this assertion in the context of third-person perspectives that arise during remembering and episodic future thought. Specifically, we examined the frequency with which participants remembered past events or imagined future events from third-person perspectives. We also examined the different viewpoints from which third-person perspective events were remembered or imagined. Although future events were somewhat more likely to be imagined from a third-person perspective, the spatial viewpoint distributions of third-person perspectives characterizing remembered and imagined events were highly similar. These results suggest that a similar constructive mechanism may be at work when people remember events from a perspective that could not have been experienced in the past and when they imagine events from a perspective that could not be experienced in the future. The findings are discussed in terms of their consistency with--and as extensions of--the constructive episodic simulation hypothesis.

George Herbert Mead, La Philosophie du temps en perspective(s)

OpenAIRE

Leclerc, Natalia

2013-01-01

L’ouvrage intitulé La Philosophie du temps en perspective(s) comporte plusieurs textes de G. H. Mead, précédés d’une importante introduction de Michèle Leclerc-Olive, qui présente « Les figures du temps dans la philosophie de George Herbert Mead ». Son caractère pédagogique est très appréciable : elle permet en effet d’entrer progressivement dans la pensée, ou plutôt dans les différentes facettes et étapes de la réflexion de Mead. Il est extrêmement dense, et le présent compte rendu n’a pas d...

Perspective and Spatiality in the Modern Age

Directory of Open Access Journals (Sweden)

Fausto Fraisopi

2016-05-01

Full Text Available the domain of Art critique and becoming a philosophical argument. How can we think of Perspective as symbolic Form? Is Perspective really a symbolic form? Why is Perspective so important? Because at the beginning of the Modern Age, Perspective as spiritual figure grounds many symbolic or even many scientific constructions. We could we say that perspective open the foundation of modern science as such. The “Geometrization” of Vision, beginning with perspective, will be for us the interpretative key in order to understand the Modern Age as a whole.  This understanding will allow us to understand the anthropologic dimension arising from the Modern Age, called „Perspectivism“. Assuming that perspective was neither only an invention of painting nor of geometry nor of philosophy, taken as singular fields of human inquiry, we will try to sketch the genesis of “perspective” from an interdisciplinary point of view. By doing so, we will also try to fix its deep significance for the anthropology of the Modern Age. Living and feeling in a perspectival world is the real invention of the Modern Age, one that overcame the closed Cosmos of the Middle Ages in order to reveal to mankind its own potential. Our interdisciplinary approach will proceed from many points of view (history of art, science, theology, anthropology and converge on the idea of a new kind of human experience. Such an interdisciplinary approach will open new questions about our present time. Are we justified in thinking of our experience today as perspectival? What does it mean today to think from perspectives in the manifold dimensions of our living and to face to the complexity of our times?

The Perspective Structure of Visual Space

Science.gov (United States)

2015-01-01

Luneburg’s model has been the reference for experimental studies of visual space for almost seventy years. His claim for a curved visual space has been a source of inspiration for visual scientists as well as philosophers. The conclusion of many experimental studies has been that Luneburg’s model does not describe visual space in various tasks and conditions. Remarkably, no alternative model has been suggested. The current study explores perspective transformations of Euclidean space as a model for visual space. Computations show that the geometry of perspective spaces is considerably different from that of Euclidean space. Collinearity but not parallelism is preserved in perspective space and angles are not invariant under translation and rotation. Similar relationships have shown to be properties of visual space. Alley experiments performed early in the nineteenth century have been instrumental in hypothesizing curved visual spaces. Alleys were computed in perspective space and compared with reconstructed alleys of Blumenfeld. Parallel alleys were accurately described by perspective geometry. Accurate distance alleys were derived from parallel alleys by adjusting the interstimulus distances according to the size-distance invariance hypothesis. Agreement between computed and experimental alleys and accommodation of experimental results that rejected Luneburg’s model show that perspective space is an appropriate model for how we perceive orientations and angles. The model is also appropriate for perceived distance ratios between stimuli but fails to predict perceived distances. PMID:27648222

The effects of Present Hedonistic Time Perspective and Past Negative Time Perspective on substance use consequences.

Science.gov (United States)

Chavarria, Jesus; Allan, Nicholas P; Moltisanti, Allison; Taylor, Jeanette

2015-07-01

The overuse of substances can lead to economic, physical, and social consequences. Previous research has demonstrated associations between time perspective and frequency of substance use, but no studies have investigated time perspective's effect on substance use consequences. This study aimed to fill this gap in the literature. Using an MTurk sample (N=531), latent factor models tested the hypothesis that both Present Hedonistic Time Perspective (PrHTP) and Past Negative Time Perspective PaNTP positively predict alcohol and illicit drug use consequences. Bootstrap analyses were then used to test the hypothesis that PrHTP indirectly affected the relationship between PaNTP and alcohol and illicit drug use consequences. PrHTP significantly predicted alcohol and illicit drug use consequences. PaNTP also significantly predicted alcohol and illicit drug use consequences. PrHTP was found to indirectly affect the relationship between PaNTP and substance use consequences for both alcohol and illicit drugs. The findings are consistent with previous research and introduce time perspective as an individual differences risk factor for substance use consequences. The partial and full indirect effects are consistent with the idea that individuals with a PaNTP may develop a PrHTP, placing them at risk for substance use consequences. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The Third Perspective on Shifting Cultivation

Directory of Open Access Journals (Sweden)

Sukanya Sharma

2017-11-01

Full Text Available ABSTRACT There are two perspectives in which the understanding of food sustainability in the world is entangled. The first perspective which believes that food sustainability can be achieved by technology presents shifting cultivation as a reflection of a lower state of cultural evolution in comparison with more sophisticated societies (O’Brien 2002.The second perspective which believes in culture, in the ‘way of life’ paradigm valorise shifting cultivation as a form of indigenous genius, representing the indigenous people as perhaps the original environmentalist (Bandy et al.1993; Conklin 1957; Grandstaff 1981; Hong 1987. The biasness of both the perspectives is well visible. The task now is to document and evaluate indigenous strategies of shifting cultivation through a process of research and development. This process involves identification of promising indigenous practices, characterization of the practices, validation of the utility of the practice for other communities, extrapolation to other locations, verification with key farmers, and wide-scale extension. This can be treated as the third perspective available to the policy makers. By this, the detrimental effects of shifting cultivation can be mitigated and productivity increased (Mali 2003.

Perspective-taking increases willingness to engage in intergroup contact.

Science.gov (United States)

Wang, Cynthia S; Kenneth, Tai; Ku, Gillian; Galinsky, Adam D

2014-01-01

The current research explored whether perspective-taking increases willingness to engage in contact with stereotyped outgroup members. Across three studies, we find that perspective-taking increases willingness to engage in contact with negatively-stereotyped targets. In Study 1, perspective-takers sat closer to, whereas stereotype suppressors sat further from, a hooligan compared to control participants. In Study 2, individual differences in perspective-taking tendencies predicted individuals' willingness to engage in contact with a hooligan, having effects above and beyond those of empathic concern. Finally, Study 3 demonstrated that perspective-taking's effects on intergroup contact extend to the target's group (i.e., another homeless man), but not to other outgroups (i.e., a man of African descent). Consistent with other perspective-taking research, our findings show that perspective-taking facilitates the creation of social bonds by increasing contact with stereotyped outgroup members.

Perspective-Taking Increases Willingness to Engage in Intergroup Contact

Science.gov (United States)

Wang, Cynthia S.; Kenneth, Tai; Ku, Gillian; Galinsky, Adam D.

2014-01-01

The current research explored whether perspective-taking increases willingness to engage in contact with stereotyped outgroup members. Across three studies, we find that perspective-taking increases willingness to engage in contact with negatively-stereotyped targets. In Study 1, perspective-takers sat closer to, whereas stereotype suppressors sat further from, a hooligan compared to control participants. In Study 2, individual differences in perspective-taking tendencies predicted individuals' willingness to engage in contact with a hooligan, having effects above and beyond those of empathic concern. Finally, Study 3 demonstrated that perspective-taking's effects on intergroup contact extend to the target's group (i.e., another homeless man), but not to other outgroups (i.e., a man of African descent). Consistent with other perspective-taking research, our findings show that perspective-taking facilitates the creation of social bonds by increasing contact with stereotyped outgroup members. PMID:24465648

Untitled

Indian Academy of Sciences (India)

Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.

Safety regulations: Implications of the new risk perspectives

International Nuclear Information System (INIS)

Aven, T.; Ylönen, M.

2016-01-01

The current safety regulations for industrial activities are to a large extent functionally oriented and risk-based (informed), expressing what to achieve rather than the means and solutions needed. They are founded on a probability-based perspective on risk, with the use of risk assessment, risk acceptance criteria and tolerability limits. In recent years several risk researchers have argued for the adoption of some new types of risk perspectives which highlight uncertainties rather than probabilities in the way risk is defined, the point being to better reflect the knowledge, and lack of knowledge, dimension of risk. The Norwegian Petroleum Safety Authority has recently implemented such a perspective. The new ISO standard 31000 is based on a similar thinking. In this paper we discuss the implications of these perspectives on safety regulation, using the oil & gas and nuclear industries as illustrations. Several suggestions for how to develop the current safety regulations in line with the ideas of the new risk perspectives are outlined, including some related to the use of risk acceptance criteria (tolerability limits). We also point to potential obstacles and incentives that the larger societal and institutional setting may impose on industry as regards the adoption of the new risk perspectives. - Highlights: • Some new types of risk perspectives have been promoted. • They have been implemented for example by the Norwegian Petroleum Safety Authority. • The paper studies the implication of these perspectives on the risk regulation. • Suggestions for how to develop the regulations are provided • Obstacles and incentives for the implementation of the perspectives are pointed to.

A Temporal Perspective on Organizational Identity

DEFF Research Database (Denmark)

Schultz, Majken; Hernes, Tor

2013-01-01

time perspective in the use of memory enabled a longer time perspective in formulating claims for future identity, (2) a broader scope of articulated identity claims for the future was related to the combination of a broader range of memory forms, and (3) the depth of claims for future identity...... was related to the way in which memory forms were combined. At a more general level, our paper illustrates how viewing identity construction from the perspective of an ongoing present adds a new dimension to understanding the temporal dynamics of organizational identity....

Perspective-taking increases willingness to engage in intergroup contact.

Directory of Open Access Journals (Sweden)

Cynthia S Wang

Full Text Available The current research explored whether perspective-taking increases willingness to engage in contact with stereotyped outgroup members. Across three studies, we find that perspective-taking increases willingness to engage in contact with negatively-stereotyped targets. In Study 1, perspective-takers sat closer to, whereas stereotype suppressors sat further from, a hooligan compared to control participants. In Study 2, individual differences in perspective-taking tendencies predicted individuals' willingness to engage in contact with a hooligan, having effects above and beyond those of empathic concern. Finally, Study 3 demonstrated that perspective-taking's effects on intergroup contact extend to the target's group (i.e., another homeless man, but not to other outgroups (i.e., a man of African descent. Consistent with other perspective-taking research, our findings show that perspective-taking facilitates the creation of social bonds by increasing contact with stereotyped outgroup members.

Does narrative perspective influence readers’ perspective-taking? An empirical study on free indirect discourse, psycho-narration and first-person narration

Directory of Open Access Journals (Sweden)

Susanna Salem

2017-06-01

Full Text Available It is often assumed that narrating a story from the protagonist’s perspective increases the readers’ inclination to take over this perspective. In a questionnaire study, we examined to which degree different textual modes of narration (a increase the degree to which the reader can generally relate to the protagonist (what we will call 'relatedness', (b make the reader prone to imagine the scene from the 'spatial point-of-view 'of the protagonist, and (c enhance the psychological perspective-taking of the reader, measured as 'identification 'with the protagonist. We employed two different types of texts—one literary and one non-literary—and tested them in four different modes of narration: free indirect discourse, psycho-narration, first-person narration and external focalization. In terms of the 'relatedness 'between the reader and protagonist and 'spatial perspective-taking 'the largest differences (descriptively occurred between external focalization and psycho-narration ('p'& .05 for 'relatedness', 'p'& .05 for 'spatial perspective-taking' and between external focalization and first-person narration ('p'& .05 for 'relatedness', for 'spatial perspective-taking p'& .1. 'Identification', measured with items from a questionnaire on reading experience (Appel et al. 2002, was highest for first-person narration. Here, the difference between first-person narration and external focalization turned out significant only after including dispositional empathy, thematic interest for the text and attention during reading as covariates. Results for the other two perspective-taking measures were unaffected by the inclusion of the same covariates. In conclusion, our data show that first-person and psycho-narration increased the tendency to take over the perspective of the protagonist, but FID did not.   This article is part of the special collection: Perspective Taking

Children’s perspective on learning

DEFF Research Database (Denmark)

Broström, Stig; Sandberg, Anette; Johansson, Inge

2017-01-01

This article explores how some children in Denmark, Estonia, Germany and Sweden describe their perspective on learning. The aim of the international study is to gain knowledge of how preschool children in Sweden, Denmark, Estonia and Germany reflect and perceive their learning in preschool...... and other surrounding social contexts. The results are based on 51 focus group interviews from 181 children. The results indicate that, in general, children from all four countries seem to be aware of their own learning. One can conclude that encouraging children to think about what they are doing and why...... they are doing it makes the activities more goal-oriented from the children’s perspective and thus more conscious. Children are able to describe their own perspectives on learning....

Knowledge Management from Organizational Culture Perspectives

OpenAIRE

Nguyen, Nhu T.B.

2007-01-01

This paper examines organizational culture perspectives to demonstrate their importance on knowledge management. Also, it is aimed to link three perspectives of organizational culture (Integration, Differentiation, and Fragmentation) to knowledge management. The conclusion suggests several implications of this paper and future research.

Error rate on the director's task is influenced by the need to take another's perspective but not the type of perspective.

Science.gov (United States)

Legg, Edward W; Olivier, Laure; Samuel, Steven; Lurz, Robert; Clayton, Nicola S

2017-08-01

Adults are prone to responding erroneously to another's instructions based on what they themselves see and not what the other person sees. Previous studies have indicated that in instruction-following tasks participants make more errors when required to infer another's perspective than when following a rule. These inference-induced errors may occur because the inference process itself is error-prone or because they are a side effect of the inference process. Crucially, if the inference process is error-prone, then higher error rates should be found when the perspective to be inferred is more complex. Here, we found that participants were no more error-prone when they had to judge how an item appeared (Level 2 perspective-taking) than when they had to judge whether an item could or could not be seen (Level 1 perspective-taking). However, participants were more error-prone in the perspective-taking variants of the task than in a version that only required them to follow a rule. These results suggest that having to represent another's perspective induces errors when following their instructions but that error rates are not directly linked to errors in inferring another's perspective.

VARIETIES OF SOCIAL DISCIPLINING, HISTORICAL PERSPECTIVES.

Directory of Open Access Journals (Sweden)

Tomás A. Mantecón Movellán

2011-04-01

Full Text Available Historical thought has tended to explain social disciplining according to two main analytical perspectives: on one hand, German tradition about the so-called sozialdisziplinierung and, on the other hand, Foucault perspectives (focussed on disciplines practiced on the bodies-and/or-minds of people by the authorities. From these both viewpoints social disciplining was a dynamic ingredient of change, from traditional societies up to contemporary liberal societies; a machinery to provoke top-down changes (from above. On the bases of historical evidences, this research claims for a third viewpoint that stresses dynamics of social discipline and social disciplining from below; underlines the need of integrating this third perspective in the historical explanation of change in past societies throughout the analysis of social practices of everyday life; the values underneath them and, in the end, taking into account varieties of discipline and perspectives of social disciplining from below.

A Framework for Understanding International Perspectives on Education

Science.gov (United States)

Wiseman, Alexander W.

2012-01-01

International perspectives on education have existed since the first world travelers brought stories back from their travels abroad, but the ways these perspectives are presented and understood varies as much as the cultures and communities themselves. This introduction to international perspectives on education provides a framework, which relies…

Organizational learning viewed from a social learning perspective

DEFF Research Database (Denmark)

Elkjær, Bente; Brandi, Ulrik

2011-01-01

This chapter reviews the literature on organizational learning through the lens of a social learning perspective. We start with an individual learning perspective, before moving on to a social learning perspective with a particular focus upon pragmatism. The literature review covers the following...... four issues: the content of learning, the process of learning, the relation between individual and organization, and the concept of organization. An important separator between individual and social learning perspectives is the different emphasis on learning as acquisition of skills and knowledge......, versus learning as encompassing development of identities and socialization to organizational work and life. A pragmatist social learning perspective emphasizes both learning as acquisition through experience and inquiry, and learning as development of identities and socialization through individuals...

JPRS Report, China

National Research Council Canada - National Science Library

1993-01-01

...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...

Self-control mediates the relationship between time perspective and BMI.

Science.gov (United States)

Price, Menna; Higgs, Suzanne; Lee, Michelle

2017-01-01

Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Development and Desire: A Postmodern Perspective.

Science.gov (United States)

Hargreaves, Andy

Three theoretical perspectives guide this discussion of teacher development: symbolic interactionism, critical social theory, and theories of postmodernity. Drawing on these perspectives, key dimensions of teacher development can be addressed. Good teaching involves competence in technical skills, but it also involves moral purpose; emotional…

Diverse Perspectives on Inclusive School Communities

Science.gov (United States)

Tsokova, Diana; Tarr, Jane

2012-01-01

What is an inclusive school community? How do stakeholders perceive their roles and responsibilities towards inclusive school communities? How can school communities become more inclusive through engagement with individual perspectives? "Diverse Perspectives on Inclusive School Communities" captures and presents the voices of a wide…

Reversible perspective and splitting in time.

Science.gov (United States)

Hart, Helen Schoenhals

2012-01-01

The element of time--the experience of it and the defensive use of it--is explored in conjunction with the use of reversible perspective as a psychotic defense. Clinical material from a long analysis illustrates how a psychotic patient used the reversible perspective, with its static splitting, to abolish the experience of time. When he improved and the reversible perspective became less effective for him, he replaced it with a more dynamic splitting mechanism using time gaps. With further improvement, the patient began to experience the passage of time, and along with it the excruciating pain of separation, envy, and loss.

Performance in Franchise Systems : The Franchisee Perspective

OpenAIRE

Asgharian Bourkheili, Ehsan

2015-01-01

During the last decades, franchising as an organizational form has received a lot of attention from researchers and practitioners alike. While many studies have examined various aspects of franchising from the franchisor's perspective, little research has taken the franchisee’s perspective. Therefore, given the importance of franchisees in a franchise system, the lack of research about consequences from the franchisee's perspective, and that many of the previous studies have taken a top-botto...

FAA Perspective

Science.gov (United States)

Bond, Tom

2009-01-01

This viewgraph presentation describes the Federal Aviation Administration's perspective on improvements on aircraft icing. The most important areas that are discussed include: 1) Improvements in SLD engineering tools to meet concerns about means of compliance (MOC); and 2) 3-D iced aerodynamics.

Conceptualizing Multicultural Perspective Taking Skills

Science.gov (United States)

2007-11-01

34 ( Fetterman , 1989, p. 27). This perspective highlights the cognitive aspects of culture at the exclusion of behavior. Kroeber and Parsons (1958... Fetterman , 1989; Kluckhohn, 1951; Ong, 1987). Sociologists have a similar perspective on culture and highlight that it is transmitted, is created, is...knowledge ( Fetterman , 1989). Cognition provides the cultural lens with acuity. In this regard, culture is conceptualized, in part, as a schema (organized

The Role of Perspective in Mental Time Travel.

Science.gov (United States)

Ansuini, Caterina; Cavallo, Andrea; Pia, Lorenzo; Becchio, Cristina

2016-01-01

Recent years have seen accumulating evidence for the proposition that people process time by mapping it onto a linear spatial representation and automatically "project" themselves on an imagined mental time line. Here, we ask whether people can adopt the temporal perspective of another person when travelling through time. To elucidate similarities and differences between time travelling from one's own perspective or from the perspective of another person, we asked participants to mentally project themselves or someone else (i.e., a coexperimenter) to different time points. Three basic properties of mental time travel were manipulated: temporal location (i.e., where in time the travel originates: past, present, and future), motion direction (either backwards or forwards), and temporal duration (i.e., the distance to travel: one, three, or five years). We found that time travels originating in the present lasted longer in the self- than in the other-perspective. Moreover, for self-perspective, but not for other-perspective, time was differently scaled depending on where in time the travel originated. In contrast, when considering the direction and the duration of time travelling, no dissimilarities between the self- and the other-perspective emerged. These results suggest that self- and other-projection, despite some differences, share important similarities in structure.

Perspective-Taking Increases Willingness to Engage in Intergroup Contact

OpenAIRE

Wang, Cynthia S.; Kenneth, Tai; Ku, Gillian; Galinsky, Adam D.

2014-01-01

The current research explored whether perspective-taking increases willingness to engage in contact with stereotyped outgroup members. Across three studies, we find that perspective-taking increases willingness to engage in contact with negatively-stereotyped targets. In Study 1, perspective-takers sat closer to, whereas stereotype suppressors sat further from, a hooligan compared to control participants. In Study 2, individual differences in perspective-taking tendencies predicted individual...

Ethical perspectives on the environmental impact of property ...

African Journals Online (AJOL)

Given the limitations of the instrumental and the intrinsic perspectives, it is suggested that the appropriate perspective to be adopted by ethical property developers is that of pragmatism, as being a system of moral pluralism. This perspective can be utilised as a flexible toolbox which unites both traditional ethical values and ...

Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control

Science.gov (United States)

Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan

2014-03-01

This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

Fundamental Perspectives on Supply Chain Management

NARCIS (Netherlands)

Omta, S.W.F.; Hoenen, S.J.

2012-01-01

The aim of the present literature study is to find the fundamental perspectives/models in the realm of supply chain management and to investigate whether they can be extended based on recent literature findings. The fundamental perspectives were found using a two-tier snowball collection method,

Ethical perspectives on the environmental impact of property development

Directory of Open Access Journals (Sweden)

A. Sentle Mokori

2016-08-01

Full Text Available Three perspectives that can be found in ethical decision-making are explored to suggest guidelines for ethical property development: the instrumental, the intrinsic and the pluralist perspective. Given the limitations of the instrumental and the intrinsic perspectives, it is suggested that the appropriate perspective to be adopted by ethical property developers is that of pragmatism, as being a system of moral pluralism. This perspective can be utilised as a flexible toolbox which unites both traditional ethical values and the diversity of environmental ethics, as well as allowing new values to emerge without adhering to relativism.

New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration

Directory of Open Access Journals (Sweden)

Jun Chen

2016-12-01

Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.

Perspectives East and West

Directory of Open Access Journals (Sweden)

Ken-ichi Sasaki

2013-01-01

Full Text Available The object of this paper is to elucidate the sense of space peculiar to Japanese sensibility. To accomplish this task I consult not only paintings but also waka, distinctively Japanese poetry. I also compare the structures of Japanese and Western perspective in order to highlight the distinctive features of the Japanese sense of space. In China and Japan, traditional landscape painting was called sansui painting, literally, painting of “mountains and waters,” unlike fūkei painting, which is a modern adaptation of the Western notion of landscape. Landscape as sansui is characterized by its vitalistic conception: the cosmic space is filled with ki, a vital and spiritual element. This view is reflected in the Japanese notion of keshiki (literally, color of ki, another word meaning landscape, to which I pay particular attention because it is a vernacular word and expresses the genuine Japanese sense of space, differentiated even from the Chinese perspective found in Sansui paintings. Such a space as keshiki was to be felt rather than seen. The notion of the picturesque was associated in Japan with a spatial extent. It is a concept closely related to a humid climate that produces much fog or haze. A typical description is found in the Tale of Genji. It is in waka, from the thirteenth century, that we find the first expression of Japanese perspective, which consists the combination of a tactile, sometimes auditory close range with the visual, distant range, yet without a middle range (which is obscured by fog. This is very different from Western geometrical perspective, which is essentially constituted by the middle range relating the close continuously to the distant. In painting, this Japanese perspective was realized for the first time in ukiyo-e, particularly in the work of Hokusai and Hiroshige. I assume that this composition was transplanted to the Western world during the fashion for “japonisme,” and now determines the basic

Perspective taking in children's narratives about jealousy.

Science.gov (United States)

Aldrich, Naomi J; Tenenbaum, Harriet R; Brooks, Patricia J; Harrison, Karine; Sines, Jennie

2011-03-01

This study explored relationships between perspective-taking, emotion understanding, and children's narrative abilities. Younger (23 5-/6-year-olds) and older (24 7-/8-year-olds) children generated fictional narratives, using a wordless picture book, about a frog experiencing jealousy. Children's emotion understanding was assessed through a standardized test of emotion comprehension and their ability to convey the jealousy theme of the story. Perspective-taking ability was assessed with respect to children's use of narrative evaluation (i.e., narrative coherence, mental state language, supplementary evaluative speech, use of subjective language, and placement of emotion expression). Older children scored higher than younger children on emotion comprehension and on understanding the story's complex emotional theme, including the ability to identify a rival. They were more advanced in perspective-taking abilities, and selectively used emotion expressions to highlight story episodes. Subjective perspective taking and narrative coherence were predictive of children's elaboration of the jealousy theme. Use of supplementary evaluative speech, in turn, was predictive of both subjective perspective taking and narrative coherence. ©2010 The British Psychological Society.

Soil Behavior Under Blast Loading

Science.gov (United States)

2010-12-01

in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This

Une perspective interactionniste

Directory of Open Access Journals (Sweden)

Joëlle Morrissette

2010-02-01

Full Text Available Cet article vise à montrer l’intérêt de puiser à la sociologie pour conduire des recherches dans le domaine de l’éducation. Plus précisément, il sera question de la contribution d’une perspective interactionniste pour appréhender un objet attaché à l’évaluation des apprentissages des élèves. Comme on le verra, s’inspirer en particulier d’auteurs attachés à la tradition de l’interactionnisme symbolique amène à se situer en marge des manières de dire et de faire habituelles des investigations portant sur cet objet, de la phase de problématisation à celle de l’analyse, au profit d’un point de vue (resocialisant et contextualisant. Pour illustrer le propos, je prendrai appui sur le format d’une recherche ayant documenté le savoir-faire d’un groupe d’enseignantes du primaire en matière d’évaluation formative, et ayant adopté une perspective interactionniste comme posture générale de recherche.An Interactionist PerspectiveAn Alternative Approach to Learning AssessmentThis article aims to show the usefulness of drawing from sociology to conduct research in the field of education. Specifically, it discusses the contribution of an interactionist perspective in understanding the objects attached to student learning assessment. As we shall see, drawing especially from authors working in the tradition of Symbolic Interactionism leads us outside the usual ways of thinking and doing in investigations related to assessment objects, from problematization to analysis, in favour of a (resocializing and contextualizing perspective. To illustrate this point, I will examine the format of a study documenting the expertise of a group of elementary school teachers with regard to formative assessment, and having an interactionist perspective as its basis of research.Una perspectiva interaccionista: otro punto de vista sobre la evaluación del aprendizajeEste artículo tiene como objetivo el demostrar el interés de

Use of TIME: Time perspective intervention of motivation enhancement.

NARCIS (Netherlands)

Peetsma, T.; Van der Veen, I.; Schuitema, J.; Kostić, A.; Chadee, D.

2017-01-01

Considering the association between time perspective and motivated learning, the authors draw on time perspective theory in the development of an intervention to increase adolescent students’ motivation for school: TIME (Time perspective Intervention of Motivation Enhancement). Four studies centered

Perspectives on bay-delta science and policy

Science.gov (United States)

Healey, Michael; Dettinger, Michael; Norgaard, Richard

2016-01-01

The State of Bay–Delta Science 2008 highlighted seven emerging perspectives on science and management of the Delta. These perspectives had important effects on policy and legislation concerning management of the Delta ecosystem and water exports. From the collection of papers that make up the State of Bay–Delta Science 2016, we derive another seven perspectives that augment those published in 2008. The new perspectives address nutrient and contaminant concentrations in Delta waters, the failure of the Delta food web to support native species, the role of multiple stressors in driving species toward extinction, and the emerging importance of extreme events in driving change in the ecosystem and the water supply. The scientific advances that underpin these new perspectives were made possible by new measurement and analytic tools. We briefly discuss some of these, including miniaturized acoustic fish tags, sensors for monitoring of water quality, analytic techniques for disaggregating complex contaminant mixtures, remote sensing to assess levee vulnerability, and multidimensional hydrodynamic modeling. Despite these new tools and scientific insights, species conservation objectives for the Delta are not being met. We believe that this lack of progress stems in part from the fact that science and policy do not incorporate sufficiently long-term perspectives. Looking forward half a century was central to the Delta Visioning process, but science and policy have not embraced this conceptual breadth. We are also concerned that protection and enhancement of the unique cultural, recreational, natural resource, and agricultural values of the Delta as an evolving place, as required by the Delta Reform Act, has received no critical study and analysis. Adopting wider and longer science and policy perspectives immediately encourages recognition of the need for evaluation, analysis, and public discourse on novel conservation approaches. These longer and wider perspectives

Perspectives on Bay–Delta Science and Policy

Directory of Open Access Journals (Sweden)

Michael Healey

2016-12-01

Full Text Available doi: https://doi.org/10.15447/sfews.2016v14iss4art6The State of Bay–Delta Science 2008 highlighted seven emerging perspectives on science and management of the Delta. These perspectives had important effects on policy and legislation concerning management of the Delta ecosystem and water exports. From the collection of papers that make up the State of Bay–Delta Science 2016, we derive another seven perspectives that augment those published in 2008. The new perspectives address nutrient and contaminant concentrations in Delta waters, the failure of the Delta food web to support native species, the role of multiple stressors in driving species toward extinction, and the emerging importance of extreme events in driving change in the ecosystem and the water supply. The scientific advances that underpin these new perspectives were made possible by new measurement and analytic tools. We briefly discuss some of these, including miniaturized acoustic fish tags, sensors for monitoring of water quality, analytic techniques for disaggregating complex contaminant mixtures, remote sensing to assess levee vulnerability, and multidimensional hydrodynamic modeling. Despite these new tools and scientific insights, species conservation objectives for the Delta are not being met. We believe that this lack of progress stems in part from the fact that science and policy do not incorporate sufficiently long-term perspectives. Looking forward half a century was central to the Delta Visioning process, but science and policy have not embraced this conceptual breadth. We are also concerned that protection and enhancement of the unique cultural, recreational, natural resource, and agricultural values of the Delta as an evolving place, as required by the Delta Reform Act, has received no critical study and analysis. Adopting wider and longer science and policy perspectives immediately encourages recognition of the need for evaluation, analysis, and public discourse on

Time perspective and positivity effects in Alzheimer's disease.

Science.gov (United States)

Bohn, Linzy; Kwong See, Sheree T; Fung, Helene H

2016-09-01

This study tested whether time perspective, a central tenant of socioemotional selectivity theory (Carstensen, 2006), moderates positivity effects in emotional memory. To provide measures of time perspective, young (YA; M = 22.48 years), young-old (YO; M = 67.56 years), old-old adults (OO; M = 80.24 years), and participants with moderate severity Alzheimer's disease (PAD; M = 84.28 years) completed a line task and reported subjective age. As expected, YA, YO, and OO reported successively more constrained future time perspectives. PAD showed distortion in time perspective, envisioning a future comparable with the YO, although closer matched in chronological age to OO adults. To evince positivity effects, participants were oriented to pairs of emotional images and were then tested for memory (recall and recognition) of the images. Recall and recognition memory for the images indicated an age-related advantage for positive over negative material (positivity effects). Time perspective, however, did not moderate these age effects. In memory performance, PAD were more comparable with OO adults with whom they shared a similar chronological age, rather than YO adults, who had a corresponding time perspective. These results suggest that age correlates that are shared by PAD and OO, such as reduced processing resources, rather than time perspective, may drive the age associated positivity effects. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Energy perspectives 2035 - Volume 4, side-notes

International Nuclear Information System (INIS)

2007-01-01

This comprehensive report published by the Swiss Federal Office of Energy (SFOE) presents a number of side-notes pertaining to the first three volumes of the Energy Perspectives series of reports. Various topics are discussed by the authors of the first three volumes of the perspectives in the meetings held by the Energy Perspectives Working Group. The sixteen side-notes presented here cover the following topics: General conditions, fossil resources, the influence of climate warming, CO 2 emissions trading (Joint Implementation JI and Clean Development Mechanism CDM), definition of potentials, air traffic, imported renewable electricity, hydro power, electricity cost calculation, sensitivity analysis of centralised power production facilities, heat-pumps and their power consumption, cold spells and heat-waves, risk and its perception, the 2000-Watt society and international and national energy perspectives

A Discussion of Future Time Perspective

Science.gov (United States)

McInerney, Dennis M.

2004-01-01

A growing area of research in educational psychology is future time perspective and its relationship to desired educational outcomes. This article discusses and critiques five reviews of current research on future time perspective. Key questions addressed are when do individuals begin to articulate a future, how far into the future does this…

Distance : between deixis and perspectivity

OpenAIRE

Meermann, Anastasia; Sonnenhauser, Barbara

2015-01-01

Discussing exemplary applications of the notion of distance in linguistic analysis, this paper shows that very different phenomena are described in terms of this concept. It is argued that in order to overcome the problems arising from this mixup, deixis, distance and perspectivity have to be distinguished and their interrelations need to be described. Thereby, distance emerges as part of a recursive process mediating between situation-bound deixis and discourse-level perspectivity. This is i...

The strengths perspective in client’s social case management

OpenAIRE

Valpētere, Laima

2010-01-01

The subject diploma paper is „The strengths perspective in client’s social case management.” The aim of the diploma paper is to research the strengths perspective in client’s social case management. Diploma paper consists of five chapters. In the first chapter the case management was theoretically researched. In the second chapter was done description of the strengths perspective in the social work. In the third chapter by describing principles and strategies of strengths perspective, cli...

Perspectives on Neoliberalism for Human Service Professionals

DEFF Research Database (Denmark)

Gray, Mel; Dean, Mitchell; Agllias, Kylie

2015-01-01

This article provides an overview of recent perspectives on neoliberalism, which serve as a foundation for the assessment of neoliberalism's influence on human services practice. Conventionally, neoliberalism has been conceived of as an ideology, but more recent perspectives regard neoliberalism...... as an art of government, a thought collective, and an uneven but path-dependent process of regulatory development. We argue that these new perspectives have the potential to contribute to our critical capacity and open avenues for the analysis of contemporary transformations of public policy and its...

Islamic and Western perspectives on applied media ethics

Directory of Open Access Journals (Sweden)

Saadia Izzeldin Malik

2015-12-01

Full Text Available This study discusses the compatibility of Islamic theories of ethics with Western theories of ethics regarding the ethics of global journalism. The study examines Western and Islamic approaches and perspectives on ethics and applied ethics in the field of journalism. Central to the discussion are global journalism values of freedom of expression, individual right for privacy, public right to know, and the global clashing values of media ownership vs. freedom, and consumerism values vs. media values of social responsibility. These clashing media values are part of the broader practices of newsgathering and news reporting that encompass many ethical dilemmas in the field of media and journalism. The study concludes by discussing Western perspectives on character education. It also provides an Islamic moral perspective based on character education as an approach compatible with the Western perspective on moral education. This perspective will help reconcile global clashing media values.

The effects of autobiographical memory and visual perspective on working memory.

Science.gov (United States)

Cheng, Zenghu; She, Yugui

2018-08-01

The present research aims to explore whether recalling and writing about autobiographical memory from different perspectives (first-person perspective vs. third-person perspective) could affect cognitive function. The participants first performed a working memory task to evaluate their working memory capacity as a baseline and then were instructed to recall (Study 1) or write about (Study 2) personal events (failures vs. successes) from the first-person perspective or the third-person perspective. Finally, they performed the working memory task again. The results suggested that autobiographical memory and perspective influence working memory interactively. When recalling a success, the participants who recalled from the third-person perspective performed better than those who recalled from the first-person perspective on the working memory capacity task; when recalling a failure, the opposite was true.

Time perspective and attitude-behaviour consistency in future-oriented behaviours.

Science.gov (United States)

Rabinovich, Anna; Morton, Thomas; Postmes, Tom

2010-03-01

The authors propose that the salience of a distant-future time perspective, compared to a near-future time perspective, should increase attitude-behaviour and attitude-intention consistency for future-oriented behaviours. To test this prediction, time perspective was experimentally manipulated in three studies. Across studies, participants in the distant-future time perspective condition demonstrated a strong positive relationship between attitudes towards future-oriented behaviours (saving and environmental protection) and corresponding intentions, as well as between attitudes and behaviour. In the near-future time perspective condition, the relationship between attitudes and intentions and attitudes and behaviour was significantly weaker than in the distant-future time perspective condition. The theoretical implications of these results and suggestions for future research are discussed.

Time Perspective and Physical Activity among Central Appalachian Adolescents

Science.gov (United States)

Gulley, Tauna

2013-01-01

Time perspective is a cultural behavioral concept that reflects individuals' orientations or attitudes toward the past, present, or future. Individuals' time perspectives influence their choices regarding daily activities. Time perspective is an important consideration when teaching adolescents about the importance of being physically active.…

Perspective taking in language: Integrating the spatial and action domains.

Directory of Open Access Journals (Sweden)

Madeleine Edith Louisa Beveridge

2013-09-01

Full Text Available Language is an inherently social behaviour. In this paper, we bring together two research areas that typically occupy distinct sections of the literature: perspective taking in spatial language (whether people represent a scene from their own or a different spatial perspective, and perspective taking in action language (the extent to which they simulate an action as though they were performing that action. First, we note that vocabulary is used inconsistently across the spatial and action domains, and propose a more transparent vocabulary that will allow researchers to integrate action- and spatial-perspective taking. Second, we note that embodied theories of language comprehension often make the narrow assumption that understanding action descriptions involves adopting the perspective of an agent carrying out that action. We argue that comprehenders can adopt embodied action-perspectives other than that of the agent, including those of the patient or an observer. Third, we review evidence showing that perspective taking in spatial language is a flexible process. We argue that the flexibility of spatial-perspective taking provides a means for conversation partners engaged in dialogue to maximise similarity between their situation models. These situation models can then be used as the basis for action language simulations, in which language users adopt a particular action-perspective.

Auditory Perspective Taking

National Research Council Canada - National Science Library

Martinson, Eric; Brock, Derek

2006-01-01

.... From this knowledge of another's auditory perspective, a conversational partner can then adapt his or her auditory output to overcome a variety of environmental challenges and insure that what is said is intelligible...

Comparative perspectives

African Journals Online (AJOL)

IT

Ideology, policy and implementation: Comparative perspectives from two ... how both political as well as particular language ideologies play a major role in influencing and ..... attitudes as a field of research, many scholars still draw on the concept of .... The data for this study were collected through the use of questionnaires ...

A New Perspective on Thermodynamics

CERN Document Server

Lavenda, Bernard H

2010-01-01

Dr. Bernard H. Lavenda has written A New Perspective on Thermodynamics to combine an old look at thermodynamics with a new foundation. The book presents a historical perspective, which unravels the current presentation of thermodynamics found in standard texts, and which emphasizes the fundamental role that Carnot played in the development of thermodynamics. A New Perspective on Thermodynamics will: Chronologically unravel the development of the principles of thermodynamics and how they were conceived by their discoverers Bring the theory of thermodynamics up to the present time and indicate areas of further development with the union of information theory and the theory of means and their inequalities. New areas include nonextensive thermodynamics, the thermodynamics of coding theory, multifractals, and strange attractors. Reintroduce important, yet nearly forgotten, teachings of N.L. Sardi Carnot Highlight conceptual flaws in timely topics such as endoreversible engines, finite-time thermodynamics, geometri...

Disputing Rossellini: Three French perspectives

Directory of Open Access Journals (Sweden)

James Harvey-Davitt

2014-12-01

Full Text Available In his burgeoning body of film theoretical work the French philosopher Jacques Rancière repeatedly turns to some canonical films by Neorealist pioneer Roberto Rossellini. Not simply retreading tired motifs of Neorealism, Rancière’s comments offer some profound new insights, revolutionising prior perspectives on Rossellini. In this article I shall put Rancière’s perspective into dialogue with two of the most significant of these perspectives: André Bazin’s and Gilles Deleuze’s. In doing so I shall claim that Rancière’s approach departs radically from the canonised, standardised Neorealist conception of Rossellini. Instead, I wish to claim that he describes a modernist artist primarily concerned with aesthetic clashes. In doing so I shall contemplate how the meaning of these films has evolved since the era of their contemporary reception, demonstrating the congruence and disparity between these three disparate approaches.

La perspective fonctionnelle de la phrase dans une perspective historico-philologique du foyer pragois de structuralisme fonctionnel

Directory of Open Access Journals (Sweden)

Tomáš Hoskovec

2012-09-01

Full Text Available The “functional sentence perspective” and the “topic-focus articulation” (of a sentence designate now two different schools within the Prague linguistic tradition. Yet to Vilém Ma­the­sius, the founder and promoter of the Prague structuralist programme, and the pioneer of functional re­search into sentence meaning, they rather represented two terminological variants. To him, a perspective was a way of bringing together sen­tences differing in their formal grammatical shape, but similar in their textual (utterance function, so that their respective meaning differences could be described by detailed mutual oppositions. The “functional”, i.e. communicative perspective, articulating about what (topic something is conveyed (focus when the sentence is uttered, is only one perspective among others Mathesius took into account. The article explains why, in the classical period of the Prague Linguistic Circle, sentence phonology was consciously kept apart from the study of communicative sentence perspective, and outlines how, in the post-classical periods, that branch of studies ramified into different schools.

The Power of Perspective in The Raven Cycle

Directory of Open Access Journals (Sweden)

Andrea Dumančić

2017-07-01

Full Text Available Beginning with the discussion of the terms narration and narrative, the paper asserts the difference between point of view, which is defined as “who” tells a story, and perspective, which shows “how” a narrator / a character perceives the events making up the story. To show the power of perspective in a literary work, the paper focuses on the young adult novel series The Raven Cycle by Maggie Stiefvater. The five main characters – Blue Sargent, Richard Gansey III, Adam Parrish, Ronan Lynch, and Noah Czerny – have been given unique perspectives that are unveiled through their separate character arcs. Blue’s perspective is clad with assumptions; Gansey’s is a clash between the perceived and the perceiving; Adam’s comes to light only when compared to other characters’ perspectives; Ronan’s is postponed and contrary to expectations; Noah’s is absent until the very end of the series.

Time perspective and environmental engagement: a meta-analysis.

Science.gov (United States)

Milfont, Taciano L; Wilson, Jessie; Diniz, Pollyane

2012-01-01

Environmental issues entail both a social conflict (private vs. public interests) and a temporal conflict (short- vs. long-term interests). This paper focuses on the role temporal concerns play in influencing environmental engagement by quantitatively integrating results of studies that assessed the associations between time perspective and proenvironmental attitudes and behaviors. The meta-analysis included a total of 19 independent samples and 6,301 participants from seven countries (Australia, Brazil, Germany, Mexico, New Zealand, Norway, and the United States). Results showed that the associations between time perspective and proenvironmental behaviors were higher than those for proenvironmental attitudes. Supporting predictions, the associations between future time perspective and proenvironmental behaviors were strong and nontrivial compared to those for the combined past-present time perspective. The findings indicate that future time perspective seems to play an important role in influencing individuals' attitudes and behaviors towards the environment. Implications of the findings for theory and practice are discussed.

Kinetic investigation on enantioselective hydrolytic resolution of ...

African Journals Online (AJOL)

Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...

77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection

Science.gov (United States)

2012-02-27

... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...

A futures perspective in Dutch geography education

NARCIS (Netherlands)

Pauw, Iris; Béneker, Tine

2015-01-01

Geography education offers many possibilities for futures education. In The Netherlands, a future perspective is obvious in the vision behind the curriculum for secondary education, but this perspective becomes thinner and less open when elaborated in the syllabus, textbooks and examinations. From

Reforming Social Policy: Changing Perspectives on Sustainable ...

International Development Research Centre (IDRC) Digital Library (Canada)

Reforming Social Policy: Changing Perspectives on Sustainable Human Development. Book cover Reforming Social Policy: Changing Perspectives on Sustainable Human Development. Directeur(s):. Daniel Morales-Gómez, Necla Tschirgi, and Jennifer L. Moher. Maison(s) d'édition: IDRC. 1 janvier 1999. ISBN :.

Conical Perspective Image of an Architectural Object Close to Human Perception

Science.gov (United States)

Dzwierzynska, Jolanta

2017-10-01

The aim of the study is to develop a method of computer aided constructing conical perspective of an architectural object, which is close to human perception. The conical perspective considered in the paper is a central projection onto a projection surface being a conical rotary surface or a fragment of it. Whereas, the centre of projection is a stationary point or a point moving on a circular path. The graphical mapping results of the perspective representation is realized directly on an unrolled flat projection surface. The projective relation between a range of points on a line and the perspective image of the same range of points received on a cylindrical projection surface permitted to derive formulas for drawing perspective. Next, the analytical algorithms for drawing perspective image of a straight line passing through any two points were formulated. It enabled drawing a perspective wireframe image of a given 3D object. The use of the moving view point as well as the application of the changeable base elements of perspective as the variables in the algorithms enable drawing conical perspective from different viewing positions. Due to this fact, the perspective drawing method is universal. The algorithms are formulated and tested in Mathcad Professional software, but can be implemented in AutoCAD and majority of computer graphical packages, which makes drawing a perspective image more efficient and easier. The presented conical perspective representation, and the convenient method of its mapping directly on the flat unrolled surface can find application for numerous advertisement and art presentations.

Perspectives on Problem Solving and Instruction

Science.gov (United States)

van Merrienboer, Jeroen J. G.

2013-01-01

Most educators claim that problem solving is important, but they take very different perspective on it and there is little agreement on how it should be taught. This article aims to sort out the different perspectives and discusses problem solving as a goal, a method, and a skill. As a goal, problem solving should not be limited to well-structured…

Leisure activities in an environmental perspective

DEFF Research Database (Denmark)

Røpke, Inge; Godskesen, Mirjam Irene

2006-01-01

Leisure activities in an environmental perspective In spite of the growing literature on consumption and environment, few studies have focused on leisure activities in an environmental perspective – the main exception being the relatively numerous studies on tourism. The neglect of leisure...... activities in environmental studies is surprising, as leisure-related consumption is increasing rapidly, and some of the environmental impacts are obvious. Of course, some of these impacts are indirectly analysed in research on consumption areas such as mobility, food and household electricity use, but new...... for a focus on time use and activities rather than various categories of consumer spending. In this paper we consider, in particular, how a time use perspective can inform the discussion on the environmental impacts of leisure....

M-Commerce: Global Experiences and Perspectives

DEFF Research Database (Denmark)

Dholakia, Nikhilesh; Rask, Morten; Dholakia, Ruby

-Pacific - and highlights several countries from each region. These countries are significant because of their large existing base of mobile telecom users, their future potential, their innovativeness in mobile telecom technology development, and their leadership in launching new mobile applications. M-Commerce: Global...... Experiences and Perspectives contains chapters from authors of many countries, and while each chapter examines a specific country in-depth, all the chapters use a common integrative framework called the CLIP (communications, locatability, information provision, and payment processing) application......M-Commerce: Global Experiences and Perspectives focuses on the emerging growth of mobile telecommunications and mobile commerce around the world. To provide a global perspective, this book describes approaches from three major regions of the world - North America, Europe, and Asia...

Wide Band Gap Semiconductors Symposium Held in Boston, Massachusetts on 2-6 December 1991. Materials Research Society Symposium Proceedings. Volume 242

Science.gov (United States)

1992-01-01

AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys

Developmental trajectory of time perspective: From children to older adults.

Science.gov (United States)

Chen, Tao; Liu, Lu-Lu; Cui, Ji-Fang; Chen, Xing-Jie; Wang, Ya

2016-12-01

Time perspective is a fundamental dimension of the psychological time construct, with a pervasive and powerful influence on human behavior. However, the developmental trajectory of time perspective across a human lifespan remains unclear. The current study aimed to portray the developmental trajectory of all dimensions of time perspectives from children to older adults in a large sample. A total of 1,901 individuals (aged 9-84 years) completed measures of time perspective. They were then divided into five age groups: children, teenagers, young adults, middle-aged adults, and older adults. Results suggested that each time perspective showed a unique developmental pattern across the lifespan. Moreover, perceived economic situation and education were related to some dimensions of time perspective. © 2016 The Institute of Psychology, Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

Future perspective and healthy lifestyle choices in adulthood.

Science.gov (United States)

Tasdemir-Ozdes, Aylin; Strickland-Hughes, Carla M; Bluck, Susan; Ebner, Natalie C

2016-09-01

Regardless of age, making healthy lifestyle choices is prudent. Despite that, individuals of all ages sometimes have difficulty choosing the healthy option. We argue that individuals' view of the future and position in the life span affects their current lifestyle choices. We capture the multidimensionality of future thinking by assessing 3 types of future perspective. Younger and older men and women (N = 127) reported global future time perspective, future health perspective, and perceived importance of future health-related events. They also rated their likelihood of making healthy lifestyle choices. As predicted, older participants indicated greater intention to make healthy choices in their current life than did younger participants. Compared to younger participants, older participants reported shorter global future time perspective and anticipated worse future health but perceived future health-related events as more important. Having a positive view of one's future health and seeing future health-related events as important were related to greater intention to make healthy lifestyle choices, but greater global future time perspective was not directly related to healthy choices. However, follow-up analyses suggested that greater global future time perspective indirectly affected healthy choices via a more positive view of future health. None of these relations were moderated by age. Individuals' perspective on the future is shown to be an important multidimensional construct affecting everyday healthy lifestyle choices for both younger and older adults. Implications for encouraging healthy choices across the adult life span are discussed. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

New Principals' Perspectives of Their Multifaceted Roles

Science.gov (United States)

Gentilucci, James L.; Denti, Lou; Guaglianone, Curtis L.

2013-01-01

This study utilizes Symbolic Interactionism to explore perspectives of neophyte principals. Findings explain how these perspectives are modified through complex interactions throughout the school year, and they also suggest preparation programs can help new principals most effectively by teaching "soft" skills such as active listening…

Instrumented techniques in tool - and object perspectives

DEFF Research Database (Denmark)

Andresen, Mette

2007-01-01

The aim of this paper is to report from a study of the role of instrumented techniques in the students? learning process. The paper analyses an episode from a case study of students solving differential equations in a CAS environment. The analysis demonstrates how tasks can be designed with the aim...... to encourage the students to change between the perspective of tool on a mathematical conception and the perspective of object on the conception. Reasons are given in the paper for the assertion, that changing between these two perspectives supports the instrumental genesis as well as the conceptual...

Radium in consumer products: an historical perspective

International Nuclear Information System (INIS)

Holm, W.M.

1978-01-01

This paper demonstrates in historical and technical perspective how radium began to be used in consumer products and how changing conditions in technology and regulations have greatly modified the use of radium. In addition, the various uses of radium that have been tried or have been used in consumer products have been described, and whenever possible, the historical perspective has been used to show when devices were needed and when changing conditions caused the products to be no longer required. The historical perspective attitude is again used in the evaluation of the risks and benefits of radium in comparison to radium substitutes

Ethical perspectives on the environmental impact of property ...

African Journals Online (AJOL)

What perspectives on environmental concerns exist in philosophical literature? Do these perspectives have implications for ethical property development? What are ...... implications for business ethics', PhD thesis, Department of Philosophy,.

Effects of water stress and seed mass on germination and ...

African Journals Online (AJOL)

enoh

2012-03-01

Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN，Chen YP，Li WH，Zhang HF (2003). Response of ...

Blazar Sequence in Fermi Era Liang Chen

Indian Academy of Sciences (India)

Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

Search as learning – a psychological perspective.

NARCIS (Netherlands)

Kammerer, Yvonne

2018-01-01

In my talk I gave an overview on the topic “search as learning” from a psychological perspective (specifically an educational and applied cognitive psychology perspective). The focus of psychological research in this field is on using the Internet to learn about complex, conflicting scientific or

Emotion and Emotion Regulation: From Another Perspective

Science.gov (United States)

Langlois, Judith H.

2004-01-01

An overview of the content of the From Another Perspective collection on emotion and emotion regulation is provided. The lead article identifies fundamental issues of definition and the commentaries represent varying theoretical and methodological perspectives on emotion and emotion regulation. Together, the articles discuss the promises and…

Behavioral priming: it's all in the mind, but whose mind?

Directory of Open Access Journals (Sweden)

Stéphane Doyen

Full Text Available The perspective that behavior is often driven by unconscious determinants has become widespread in social psychology. Bargh, Chen, and Burrows' (1996 famous study, in which participants unwittingly exposed to the stereotype of age walked slower when exiting the laboratory, was instrumental in defining this perspective. Here, we present two experiments aimed at replicating the original study. Despite the use of automated timing methods and a larger sample, our first experiment failed to show priming. Our second experiment was aimed at manipulating the beliefs of the experimenters: Half were led to think that participants would walk slower when primed congruently, and the other half was led to expect the opposite. Strikingly, we obtained a walking speed effect, but only when experimenters believed participants would indeed walk slower. This suggests that both priming and experimenters' expectations are instrumental in explaining the walking speed effect. Further, debriefing was suggestive of awareness of the primes. We conclude that unconscious behavioral priming is real, while real, involves mechanisms different from those typically assumed to cause the effect.

Stakeholder perspectives on carbon capture and storage in Indonesia

International Nuclear Information System (INIS)

Setiawan, Andri D.; Cuppen, Eefje

2013-01-01

Carbon capture and storage (CCS) is being considered as an option to reduce CO 2 emissions worldwide. Yet recent cases show that CCS faces divergent public acceptance issues. This paper investigates stakeholder perspectives on CCS in Indonesia. Q methodology was adopted to analyse the diversity of stakeholder perspectives. Four perspectives were identified: (1) “CO 2 emissions reduction through clean energy sources rather than CCS”; (2) “CCS as one of the options in the transition to a sustainable energy system”; (3) “CCS as the only optimal solution to reduce CO 2 emissions”; (4) “CCS is only a tactic to keep burning coal forever”. Based on these results, we argue that stakeholder acceptance of CCS should be understood as a complex notion. This means that understanding whether or under what conditions stakeholders would be willing to support CCS, requires consideration of stakeholders' viewpoints about broader questions of CO 2 emission reduction and energy supply in Indonesia, rather than studying attitudes towards CCS in isolation. We discuss how the approach taken in this study can be used and followed up in policymaking on CCS in Indonesia. - Highlights: • We investigate stakeholder perspectives on CCS in Indonesia with Q methodology. • The study revealed four shared perspectives on CCS in Indonesia. • Of the four perspectives, two are contrasting perspectives: one pro and one con CCS. • The other two are nuanced perspectives and differ in their argumentation on CCS. • From these results we derive academic and policy implications

Cancer survivors’ perspectives and experience on western medicine and traditional Chinese medicine treatment and rehabilitation: a qualitative study

Directory of Open Access Journals (Sweden)

Wang JW

2014-12-01

Full Text Available Ji-Wei Wang,1 Zhi-Qi Yang,1 Cong Liu,1 Si-Jia Chen,1 Qian Shen,1 Tian-Rui Zhang,1 Nancy S Partike,2 Zheng-Ping Yuan,3 Jin-Ming Yu1 1School of Public Health, Key Laboratory of Public Health Safety, Fudan University, Shanghai, People’s Republic of China; 2School of Public Health, University of Hawaii at Manoa, Honolulu, HI, USA; 3Shanghai Cancer Rehabilitation Club, Shanghai, People’s Republic of China Background: In the People’s Republic of China, both western medicine (WM and traditional Chinese medicine (TCM are the main treatment and rehabilitation options for cancer patients. This study aimed to explore cancer survivors’ perspectives and experience of treatment and rehabilitation, in order to promote patient-centered activities of treatment and rehabilitation.Methods: Using a qualitative research approach, 68 cancer survivors were recruited from eight community cancer rehabilitation organizations in Shanghai, People’s Republic of China. Eight focus group interviews were conducted. All these interviews were transcribed verbatim, and the data were analyzed by theme analysis.Results: WM was the main choice in treatment phase though study participants noted more side effects. TCM was primarily used in the recovery phase. The lack of communication between doctors and cancer patients appears to affect treatment adherence and impair the doctor–patient relationship. WM was expensive for diagnostic procedures and treatment, while the cumulative costs of frequent use of TCM in the long rehabilitation period were also high. Both treatment options created significant perceived economic burden on patients. Conflicting information about dietary supplements tended to make cancer survivors confused.Conclusion: Improving the communication between doctors and cancer patients helps to ameliorate cancer patient adherence and the effect of treatments. It is essential to educate cancer patients about the effect and cost of both WM and traditional TCM

Understanding online purchase intentions: contributions from technology and trust perspectives

NARCIS (Netherlands)

van der Heijden, J.G.M.; Verhagen, T.

2003-01-01

This paper explores factors that influence consumer's intentions to purchase online at an electronic commerce website. Specifically, we investigate online purchase intention using two different perspectives: a technology-oriented perspective and a trust-oriented perspective. We summarise and review

Dynamical infomorphism: form of endo-perspective

International Nuclear Information System (INIS)

Gunji, Yukio-Pegio; Takahashi, Tatsuji; Aono, Masashi

2004-01-01

The essential feature of the endo-perspective is examined, and a formal model of the endo-perspective is proposed by introducing the mixture of intra- and inter-operations. Because such a mixture in its naive realization entails a paradox within a formal system, we weaken the inter-operation in order to allow the formal system to be endowed with that mixture without a contradiction. The weakened inter-operation is related to the infomorphism proposed by Barwise [Information Flow, The Logic of Distributed Systems, Cambridge Univ. Press, 1997]. The formal model of the endo-perspective is thereby expressed as the dynamical infomorphism driven by that mixture. The endo-perspective is described as a formal system that includes the outside of the occupied perspective. If such an inclusion is applied to the common definition of a set, it entails Russel's paradox. Retaining the outside can be expressed as the mixture of the intent and the extent of a set together with the mixture of intra-operations within the intent (or the extent) and inter-operations between the intent and the extent. The endo-perspective, therefore, consists of two subsystems corresponding to the intent and the extent, respectively, and is defined as a system involving a particular mathematical tool (i.e., infomorphism) that allows for retaining the outside without a contradiction. Within that framework, the mixture of the intra- and the inter-operation drives the dynamical transition of the system, however, it can be terminated by its collapse. This collapse can be predicted from the internal logic defined within the system. The model is constructed through the verification of 'a weakened paradox'. Because the definition of the system involves a weakened paradox only, it does not always lead to a contradiction, although the collapse of the system corresponds to a contradiction. The double standards can be embedded into the system, the domain with truth-values (the inside) and the domain in which the

Time perspective and attitude-behaviour consistency in future-oriented behaviours

NARCIS (Netherlands)

Rabinovich, A.; Morton, T.; Postmes, T.

The authors propose that the salience of a distant-future time perspective, compared to a near-future time perspective, should increase attitude-behaviour and attitude-intention consistency for future-oriented behaviours. To test this prediction, time perspective was experimentally manipulated in

Sex differences in components of imagined perspective transformation.

Science.gov (United States)

Gardner, Mark R; Sorhus, Ingrid; Edmonds, Caroline J; Potts, Rosalind

2012-05-01

Little research to date has examined whether sex differences in spatial ability extend to the mental self rotation involved in taking on a third party perspective. This question was addressed in the present study by assessing components of imagined perspective transformations in twenty men and twenty women. Participants made speeded left-right judgements about the hand in which an object was held by front- and back- facing schematic human figures in an "own body transformation task." Response times were longer when the figure did not share the same spatial orientation as the participant, and were substantially longer than those made for a control task requiring left-right judgements about the same stimuli from the participant's own point of view. A sex difference in imagined perspective transformation favouring males was found to be restricted to the speed of imagined self rotation, and was not observed for components indexing readiness to take a third party point of view, nor in left-right confusion. These findings indicate that the range of spatial abilities for which a sex difference has been established should be extended to include imagined perspective transformations. They also suggest that imagined perspective transformations may not draw upon those empathic social-emotional perspective taking processes for which females show an advantage. Copyright © 2012 Elsevier B.V. All rights reserved.

Multi-Perspective Vehicle Detection and Tracking

DEFF Research Database (Denmark)

Dueholm, Jacob Velling; Kristoffersen, Miklas Strøm; Satzoda, Ravi K.

2016-01-01

this dataset is introduced along with its challenges and evaluation metrics. A vision-based multi-perspective dataset is presented, containing a full panoramic view from a moving platform driving on U.S. highways capturing 2704x1440 resolution images at 12 frames per second. The dataset serves multiple......The research community has shown significant improvements in both vision-based detection and tracking of vehicles, working towards a high level understanding of on-road maneuvers. Behaviors of surrounding vehicles in a highway environment is found as an interesting starting point, of why...... purposes to be used as traditional detection and tracking, together with tracking of vehicles across perspectives. Each of the four perspectives have been annotated, resulting in more than 4000 bounding boxes in order to evaluate and compare novel methods....

Cognitive Perspectives on Educational Administration: An Introduction.

Science.gov (United States)

Leithwood, Kenneth A.; Hallinger, Philip

1993-01-01

Cognitive perspectives offer important, unique insights about the nature of expert administrative practice, how it develops, and what can be done to assist that development. The five articles making up this issue address cognitive perspectives on educational administration based on three areas of inquiry: human thought and problem-solving…

Linking empathy to visuospatial perspective-taking in gambling addiction.

Science.gov (United States)

Tomei, Alexander; Besson, Jacques; Grivel, Jeremy

2017-04-01

It has been demonstrated that people suffering from substance-related addictions are less empathic than their non-addicted counterparts. Our first aim was to verify if this is also true for behavioral addictions. We hypothesized that problem gamblers are less empathic than healthy controls. Our second aim was to identify a cognitive marker of empathy that could be targeted in cognitive rehabilitation strategies. We propose that a potential cognitive marker of empathy could be visuospatial perspective-taking. Specifically, we hypothesized that visuospatial perspective-taking performances are lower in problem gamblers compared to healthy controls and that these visuospatial performances predict empathy. Thirty-one non-gamblers, 24 healthy gamblers, and 21 problem gamblers performed a visuospatial perspective-taking task before completing the Interpersonal Reactivity Index (IRI; Davis, 1980; Davis, 1983). Problem gamblers had decreased empathy and lower performance at the visuospatial perspective-taking task than non-gamblers and healthy gamblers. Furthermore, we confirmed that visuospatial perspective-taking abilities predict empathy on the IRI dimensions of interpersonal perspective-taking and personal distress. The present study provides new evidence that reduced empathy is not limited to subjects with substance-related addictions; rather, it extends to behavioral addictions. Visuospatial perspective-taking may be a viable cognitive marker for use as a rehabilitation target of empathy. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Shifting visual perspective during memory retrieval reduces the accuracy of subsequent memories.

Science.gov (United States)

Marcotti, Petra; St Jacques, Peggy L

2018-03-01

Memories for events can be retrieved from visual perspectives that were never experienced, reflecting the dynamic and reconstructive nature of memories. Characteristics of memories can be altered when shifting from an own eyes perspective, the way most events are initially experienced, to an observer perspective, in which one sees oneself in the memory. Moreover, recent evidence has linked these retrieval-related effects of visual perspective to subsequent changes in memories. Here we examine how shifting visual perspective influences the accuracy of subsequent memories for complex events encoded in the lab. Participants performed a series of mini-events that were experienced from their own eyes, and were later asked to retrieve memories for these events while maintaining the own eyes perspective or shifting to an alternative observer perspective. We then examined how shifting perspective during retrieval modified memories by influencing the accuracy of recall on a final memory test. Across two experiments, we found that shifting visual perspective reduced the accuracy of subsequent memories and that reductions in vividness when shifting visual perspective during retrieval predicted these changes in the accuracy of memories. Our findings suggest that shifting from an own eyes to an observer perspective influences the accuracy of long-term memories.

Vantage perspective during encoding: The effects on phenomenological memory characteristics.

Science.gov (United States)

Mooren, Nora; Krans, Julie; Näring, Gérard W B; Moulds, Michelle L; van Minnen, Agnes

2016-05-01

The vantage perspective from which a memory is retrieved influences the memory's emotional impact, intrusiveness, and phenomenological characteristics. This study tested whether similar effects are observed when participants were instructed to imagine the events from a specific perspective. Fifty student participants listened to a verbal report of car-accidents and visualized the scenery from either a field or observer perspective. There were no between-condition differences in emotionality of memories and the number of intrusions, but imagery experienced from a relative observer perspective was rated as less self-relevant. In contrast to earlier studies on memory retrieval, vantage perspective influenced phenomenological memory characteristics of the memory representation such as sensory details, and ratings of vividness and distancing of the memory. However, vantage perspective is most likely not a stable phenomenological characteristic itself. Implications and suggestions for future research are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

Euro crisis in perspective

Directory of Open Access Journals (Sweden)

Francesco Bogliacino

2017-05-01

Full Text Available In this article we analyze the process of monetary integration in Europe, identifying the structural determinants and the dysfunctional elements in the institutions of the European Union. Secondly, we explain two prevailing discourses that fail in interpreting the events: on the one hand, a purely ideological position that see integration as a process of convergence that should not be interfered with; on the other hand, a purely idealist perspective, according to which the ideal of integration will prevail over any contradiction engendered by the institutional system. The combination of these two perspectives helped justify post crisis interventions (fiscal consolidation and the institutional design that followed, which eventually aggravated the macroeconomic instability in the area.

How Many Women Are Affected by or at Risk of Preeclampsia?

Science.gov (United States)

... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...

Investigating the service brand: A customer value perspective

Directory of Open Access Journals (Sweden)

Leyla Heydari

2014-04-01

Full Text Available This paper examines the effect of the service brand on the customer value–loyalty process. The study includes the traditional effect of brand image plus three additional influences, which reflects the broader service perspective including company image, employee trust, and company trust. Using survey data of a sample of 385 bank customers, the analysis indicates there is a direct influence of some of the perspectives of the brand on customers' perceptions of value. The results indicate that brand image, organization image, trust to firm influence positively on quality of services. In addition, brand image, organization image, quality of services and trust to firm influence on customer’s perspective where quality of services maintains the lowest impact and corporate image has the highest impact on customer’s perspective.

Knowledge Management in Projects: Insights from two Perspectives

DEFF Research Database (Denmark)

Christensen, Karina Skovvang; Bukh, Per Nikolaj

2009-01-01

The article focuses on how managerial options in relation to development and sharing of knowledge in projects can be extended by analysing project management from two different, but complementary, knowledge management perspectives: an artefact-oriented and a process-oriented perspective. Further......, the article examines how a similar project management model is used in two different organisations and how its role in knowledge management differs dependent on other knowledge management initiatives and how the production processes are structured. Following the artefact-oriented perspective, the explicit...... dimension of knowledge can be captured, retrieved and reused using knowledge management systems. From the process-oriented perspective, focus is on the tacit or implicit dimension of knowledge and the context for understanding the information is more important. It is concluded that if a company offers...

Perspective

DEFF Research Database (Denmark)

Kussmann, Martin; Morine, Melissa J; Hager, Jörg

2013-01-01

We review here the status of human type 2 diabetes studies from a genetic, epidemiological, and clinical (intervention) perspective. Most studies limit analyses to one or a few omic technologies providing data of components of physiological processes. Since all chronic diseases are multifactorial...... at different time points along this longitudinal investigation are performed with a comprehensive set of omics platforms. These data sets are generated in a biological context, rather than biochemical compound class-driven manner, which we term "systems omics."...

Attachment Representations and Time Perspective in Adolescence

Science.gov (United States)

Laghi, Fiorenzo; D'Alessio, Maria; Pallini, Susanna; Baiocco, Roberto

2009-01-01

This study examines the relationship between attachment to parents and peers, time perspective and psychological adjustment in adolescence. 2,665 adolescents (M age = 17.03 years, SD = 1.48) completed self-report measures about parent and peer attachment, time perspective, sympathy and self-determination. Subjects were divided into four groups…

Time perspective and psychological well-being in younger and older adults

Directory of Open Access Journals (Sweden)

Olivia Lee Pethtel

2018-02-01

Full Text Available The purpose of the present study was to examine the present fatalistic time perspective as a mechanism that may partially account for age differences in purpose in life and personal growth. An additional purpose of this study was to explore the relations among age, time perspective, and psychological well-being. Seventy-five older adults (M=73.43, SD=7.91 and 77 younger adults (M=19.58, SD=1.19 completed surveys measuring time perspective (past positive, past negative, present fatalistic, present hedonistic, future and psychological well-being (autonomy, environmental mastery, personal growth, positive relations with others, purpose in life, and self-acceptance. Hierarchical regression analyses revealed that the present fatalistic time perspective predicted purpose in life and personal growth above and beyond age and income. Several significant correlations were found among the time perspective and psychological well-being variables. Results showed that age was positively correlated with the past negative and present fatalistic time perspectives, but negatively correlated with the future time perspective. Results showed that age negatively correlated with purpose in life and personal growth, but positively correlated with autonomy. Results are discussed in light of socioemotional selectivity theory, theory of time perspective, and implications for incorporating time perspective into mental health counseling.

Understanding emotional problems: the REBT perspective

OpenAIRE

Dryden, Windy

2008-01-01

Rational emotive behaviour therapy (REBT) is an approach to counselling and psychotherapy rooted in the CBT tradition and one that has a distinctive perspective on emotional problems.\\ud \\ud Understanding Emotional Problems provides an accurate understanding of the REBT perspective on eight major emotional problems for which help is sought: anxiety, depression, shame, guilt, unhealthy anger, hurt, unhealthy jealousy and unhealthy envy.\\ud \\ud Rather than discussing treatment methods, Windy Dr...

Perspectives for Electric Vehicles in Denmark

DEFF Research Database (Denmark)

Horstmann, Jørgen; Jørgensen, Kaj

1997-01-01

Review of the present knowledge on electric vehicles and analysis of the energy and environmental consequences of the introduction of electric vehicles in Denmark. The report focuses on the 10-15 year time perspective.......Review of the present knowledge on electric vehicles and analysis of the energy and environmental consequences of the introduction of electric vehicles in Denmark. The report focuses on the 10-15 year time perspective....

Manipulating recall vantage perspective of intrusive memories in dysphoria.

Science.gov (United States)

Williams, Alishia D; Moulds, Michelle L

2008-10-01

The current study attempted to experimentally manipulate mode of recall (field, observer perspective) in a sample of mildly dysphoric participants (N=134) who reported a distressing intrusive memory of negative autobiographical event. Specifically, the current study sought to ascertain whether shifting participants into a converse perspective would have differential effects on the reported experience of their memory. Results indicated that shifting participants from a field to an observer perspective resulted in decreased experiential ratings: specifically, reduced distress and vividness. Also, as anticipated, the converse shift in perspective (from observer to field) did not lead to a corresponding increase in experiential ratings, but did result in reduced ratings of observation and a trend was observed for decreased levels of detachment. The findings support the notion that recall perspective has a functional role in the regulation of intrusion-related distress and represents a cognitive avoidance mechanism.

Proceedings – Mathematical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...

Visual perspective taking impairment in children with autistic spectrum disorder.

Science.gov (United States)

Hamilton, Antonia F de C; Brindley, Rachel; Frith, Uta

2009-10-01

Evidence from typical development and neuroimaging studies suggests that level 2 visual perspective taking - the knowledge that different people may see the same thing differently at the same time - is a mentalising task. Thus, we would expect children with autism, who fail typical mentalising tasks like false belief, to perform poorly on level 2 visual perspective taking as well. However, prior data on this issue are inconclusive. We re-examined this question, testing a group of 23 young autistic children, aged around 8years with a verbal mental age of around 4years and three groups of typical children (n=60) ranging in age from 4 to 8years on a level 2 visual perspective task and a closely matched mental rotation task. The results demonstrate that autistic children have difficulty with visual perspective taking compared to a task requiring mental rotation, relative to typical children. Furthermore, performance on the level 2 visual perspective taking task correlated with theory of mind performance. These findings resolve discrepancies in previous studies of visual perspective taking in autism, and demonstrate that level 2 visual perspective taking is a mentalising task.

Autonomous Learning from a Social Cognitive Perspective

Science.gov (United States)

Ponton, Michael K.; Rhea, Nancy E.

2006-01-01

The current perspective of autonomous learning defines it as the agentive exhibition of resourcefulness, initiative, and persistence in self-directed learning. As a form of human agency, it has been argued in the literature that this perspective should be consistent with Bandura's (1986) Social Cognitive Theory (SCT). The purpose of this article…

Organizational identity construction in family businesses a dualities perspective

OpenAIRE

Boers, Börje

2013-01-01

This dissertation is about organizational identity construction with a dualities perspective. By taking a dualities perspective the focus shifts from assuming that organizational identity actually is in place towards organizational identity construction where identities are socially constructed. A dualities perspective is very suitable for studying family business where family and business are seen as interdependent and interconnected forming a duality. Family business is an identity statemen...

The validity and accuracy in foot-to-foot bioelectrical impedance ...

African Journals Online (AJOL)

The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...

Refined characterization of student perspectives on quantum physics

Directory of Open Access Journals (Sweden)

Charles Baily

2010-09-01

Full Text Available The perspectives of introductory classical physics students can often negatively influence how those students later interpret quantum phenomena when taking an introductory course in modern physics. A detailed exploration of student perspectives on the interpretation of quantum physics is needed, both to characterize student understanding of physics concepts, and to inform how we might teach traditional content. Our previous investigations of student perspectives on quantum physics have indicated they can be highly nuanced, and may vary both within and across contexts. In order to better understand the contextual and often seemingly contradictory stances of students on matters of interpretation, we interviewed 19 students from four introductory modern physics courses taught at the University of Colorado. We find that students have attitudes and opinions that often parallel the stances of expert physicists when arguing for their favored interpretations of quantum mechanics, allowing for more nuanced characterizations of student perspectives in terms of three key interpretive themes. We present a framework for characterizing student perspectives on quantum mechanics, and demonstrate its utility in interpreting the sometimes contradictory nature of student responses to previous surveys. We further find that students most often vacillate in their responses when what makes intuitive sense to them is not in agreement with what they consider to be a correct response, underscoring the need to distinguish between the personal and the public perspectives of introductory modern physics students.

The Social Role of Engineers: A Philosophical Perspective.

Science.gov (United States)

Vesilind, P. Aarne

1991-01-01

The perspectives that distinguish engineers and the public they serve and the educational implications of those perspectives are discussed. The philosophies of utilitarianism, ethical egoism, positivism, and idealism are presented in terms of engineers and the public. (KR)

Manager-physician relationships: an organizational theory perspective.

Science.gov (United States)

Kaissi, Amer

2005-01-01

Manager-physician relationships are a critical determinant of the success of health care organizations. As the health care industry is moving toward a situation characterized by higher scarcity of resources, fiercer competition, more corporitization, and strict cost-containment approaches, managers and physicians should, more than ever, work together under conjoint or shared authority. Thus, their relationship can be described as one of high rewards, but also of high risk because of the wide range of differences that exist between them: different socializations and trainings resulting in different worldviews, value orientation and expectations and different cultures. In brief, managers and physicians represent different "tribes," each with its language, values, culture, thought patterns, and rules of the game. This article's main objective is to determine the underlying factors in the manager-physician relationship and to suggest ways that make this relationship more effective. Four different organizational perspectives will be used. The occupational perspective will give insights on the internal characteristics of the occupational communities of managers and physicians. The theory of deprofessionalization of physicians will also be discussed. The structuring perspective will look at the manager-physician relationship as a structure in the organization and will determine the effects of contextual factors (size, task uncertainty, strategy, and environment) on this relationship and the resulting effect on performance and effectiveness of the organization. The culture and control perspective will help detect the cultural differences between managers and physicians and how these interact to affect control over the decision-making areas in the hospital. The power, conflict, and dialectics perspective will shed the light on the conflicting interests of managers and physicians and how these shape the "power game" in the organization. Consequently, a theoretical model of

Philosophical perspectives on computer-mediated communication

DEFF Research Database (Denmark)

Ess, Charles

The first anthology of analysis and reflection on CMC and the then-young Internet from perspectives rooted in both philosophy and religious studies. Several of the chapters remain watershed publications in the genre of Internet Studies.......The first anthology of analysis and reflection on CMC and the then-young Internet from perspectives rooted in both philosophy and religious studies. Several of the chapters remain watershed publications in the genre of Internet Studies....

New Perspectives of Social and Cultural History

DEFF Research Database (Denmark)

Sevelsted, Anders

2017-01-01

Report from the conference "New Perspectives of Social and Cultural History" (06.10.2016 - 07.10.2016) in Berlin. Organized by: Free University Berlin; Malmö University......Report from the conference "New Perspectives of Social and Cultural History" (06.10.2016 - 07.10.2016) in Berlin. Organized by: Free University Berlin; Malmö University...

Aspects of the Genesis of Linear Perspective

DEFF Research Database (Denmark)

Laursen, Bjørn

This article is a contribution to the study of how sighted and blind people perceive and draw cubes. For many years the author has taught sighted people perspective drawing and published books in Scandinavia about drawing. His point of departure in this article is pointing out typical obstacles s...... of psychology John M. Kennedy, that blind people intuitively and rapidly seem to invent perspective drawing, a phenomenon sighted people in The Middle Ages used more than a hundred years to develop.......This article is a contribution to the study of how sighted and blind people perceive and draw cubes. For many years the author has taught sighted people perspective drawing and published books in Scandinavia about drawing. His point of departure in this article is pointing out typical obstacles...... sighted people run into seeing and drawing linear perspective. Blind people’s conditions for drawing a cube are presented and compared with the ones sighted people meet. The overall aim of this article is to contribute pedagogically and theoretically to explain a basic paradox, pointed out by professor...

Practical implications of the new risk perspectives

International Nuclear Information System (INIS)

Aven, Terje

2013-01-01

In recent years several authors have argued for the adoption of certain new types of risk perspectives which highlight uncertainties rather than probabilities in the way risk is understood and measured. The theoretical rationale for these new perspectives is well established, but the practical implications have not been so clearly demonstrated. There is a need to show how the new perspectives change the way risk is described and communicated in real-life situations and in its turn the effects on risk management and decision making. The present paper aims at contributing to this end by considering two cases, related to a national risk level, and a specific analysis concerning an LNG plant. The paper concludes that the new risk perspectives influence the current regime in many ways, in particular the manner in which the knowledge dimension is described and dealt with. Two methods for characterising the strength of knowledge are presented, one of them based on a new concept, the “assumption deviation risk”, reflecting risks related to the deviations from the conditions/states defined by the assumption made

Personality and self-regulation: trait and information-processing perspectives.

Science.gov (United States)

Hoyle, Rick H

2006-12-01

This article introduces the special issue of Journal of Personality on personality and self-regulation. The goal of the issue is to illustrate and inspire research that integrates personality and process-oriented accounts of self-regulation. The article begins by discussing the trait perspective on self-regulation--distinguishing between temperament and personality accounts--and the information-processing perspective. Three approaches to integrating these perspectives are then presented. These range from methodological approaches, in which constructs representing the two perspectives are examined in integrated statistical models, to conceptual approaches, in which the two perspectives are unified in a holistic theoretical model of self-regulation. The article concludes with an overview of the special issue contributions, which are organized in four sections: broad, integrative models of personality and self-regulation; models that examine the developmental origins of self-regulation and self-regulatory styles; focused programs of research that concern specific aspects or applications of self-regulation; and strategies for increasing the efficiency and effectiveness of self-regulation.

Transformations and representations supporting spatial perspective taking

Science.gov (United States)

Yu, Alfred B.; Zacks, Jeffrey M.

2018-01-01

Spatial perspective taking is the ability to reason about spatial relations relative to another’s viewpoint. Here, we propose a mechanistic hypothesis that relates mental representations of one’s viewpoint to the transformations used for spatial perspective taking. We test this hypothesis using a novel behavioral paradigm that assays patterns of response time and variation in those patterns across people. The results support the hypothesis that people maintain a schematic representation of the space around their body, update that representation to take another’s perspective, and thereby to reason about the space around their body. This is a powerful computational mechanism that can support imitation, coordination of behavior, and observational learning. PMID:29545731

The relationship between time perspective and resilience in adolescence

OpenAIRE

Oishi, Ikumi; Okamoto, Yuko

2010-01-01

The purpose of this study was to examine the relationship between time perspective and resilience in adolescence. 116 university students completed two kinds of questionnaires which measured their experiential time perspective and resilience. Resilience was considered as an index of stable mental health in this study. The results were as follows, (1) there were positive correlations between positive time perspective and resilience. Especially, there was a strong, positive correlation between ...

Reflective mirrors: perspective-taking in autoscopic phenomena.

Science.gov (United States)

Brugger, Peter

2002-08-01

''Autoscopic phenomena refer to different illusory reduplications of one's own body and self. This article proposes a phenomenological differentiation of autoscopic reduplication into three distinct classes, i.e., autoscopic hallucinations, heautoscopy, and out-of-body experiences (OBEs). Published cases are analysed with special emphasis on the subject's point of view from which the reduplication is observed. In an autoscopic hallucination the observer's perspective is clearly body-centred, and the visual image of one's own body appears as a mirror reversal. Heautoscopy (i.e., the encounter with an alter ego or doppelgänger), is defined as a reduplication not only of bodily appearance, but also of aspects of one's psychological self. The observer's perspective may alternate between egocentric and ''alter-ego-centred''. As a consequence of the projection of bodily feelings into the doppelgänger (implying a mental rotation of one's own body along the vertical axis), original and reduplicated bodies are not mirror images of one another. This also holds for OBEs, where one's self is not reduplicated but appears to be completely dissociated from the body and observing it from a location in extracorporeal space. It is argued that perspective-taking in a spatial sense may be meaningfully related to perspective-taking in a psychological sense. The mirror in the autoscopic hallucination is a ''cognitively nonreflective mirror'' (Jean Cocteau), both spatially and psychologically. The reflective abilities of the heautoscopic mirror are better developed, yet frequent shifts in the observer's spatial perspective render the nature of psychological interactions between self and alter ego highly unpredictable. The doppelgänger may serve a transitivistic (i.e., own suffering is transferred to the alter ego) or aggressive function when this behaviour is directed against a patient. The mirror in an OBE is always reflective: It allows the self to view both space and one

Strategy modulates spatial perspective-taking: evidence for dissociable disembodied and embodied routes

Science.gov (United States)

Gardner, Mark R.; Brazier, Mark; Edmonds, Caroline J.; Gronholm, Petra C.

2013-01-01

Previous research provides evidence for a dissociable embodied route to spatial perspective-taking that is under strategic control. The present experiment investigated further the influence of strategy on spatial perspective-taking by assessing whether participants may also elect to employ a separable “disembodied” route loading on inhibitory control mechanisms. Participants (N = 92) undertook both the “own body transformation” (OBT) perspective-taking task, requiring speeded spatial judgments made from the perspective of an observed figure, and a control task measuring ability to inhibit spatially compatible responses in the absence of a figure. Perspective-taking performance was found to be related to performance on the response inhibition control task, in that participants who tended to take longer to adopt a new perspective also tended to show a greater elevation in response times when inhibiting spatially compatible responses. This relationship was restricted to those participants reporting that they adopted the perspective of another by reversing left and right whenever confronted with a front-view figure; it was absent in those participants who reported perspective-taking by mentally transforming their spatial orientation to align with that of the figure. Combined with previously published results, these findings complete a double dissociation between embodied and disembodied routes to spatial perspective-taking, implying that spatial perspective-taking is subject to modulation by strategy, and suggesting that embodied routes to perspective-taking may place minimal demands on domain general executive functions. PMID:23964229

Perspectives of System Informatics

National Research Council Canada - National Science Library

Bjørner, D

1999-01-01

The volume comprises extended abstracts of the papers selected for the presentation at the Third International Andrei Ershov Memorial Conference Perspectives of System Informatics, Akademgorodok (Novosibirsk, Russia), July 6-9, 1999...

Perspectives in Education

African Journals Online (AJOL)

Perspectives in Education is a professional, peer-reviewed journal that encourages the submission of previously unpublished articles on contemporary educational issues. As a journal that represents a variety of cross-disciplinary interests, both theoretical and practical, it seeks to stimulate debate on a wide range of topics.

Time perspective and medication adherence among individuals with hypertension or diabetes mellitus.

Science.gov (United States)

Sansbury, Brittany; Dasgupta, Abhijit; Guthrie, Lori; Ward, Michael

2014-04-01

The study determined if time perspective was associated with medication adherence among people with hypertension and diabetes. Using the Health Beliefs Model, we used path analysis to test direct and indirect effects of time perspective and health beliefs on adherence among 178 people who participated in a community-based survey near Washington, D.C. We measured three time perspectives (future, present fatalistic, and present hedonistic) with the Zimbardo Time Perspective Inventory and medication adherence by self-report. The total model demonstrated a good fit (RMSEA=0.17, 90% CI [0.10, 0.28], p=0.003; comparative fit index=0.91). Future time perspective and age showed direct effects on increased medication adherence; an increase by a single unit in future time perspective was associated with a 0.32 standard deviation increase in reported adherence. There were no significant indirect effects of time perspective with reported medication adherence through health beliefs. The findings provide the first evidence that time perspective plays an under-recognized role as a psychological motivator in medication adherence. Patient counseling for medication adherence may be enhanced if clinicians incorporate consideration of the patient's time perspective. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

The emotional impact of loss narratives: event severity and narrative perspectives.

Science.gov (United States)

Habermas, Tilmann; Diel, Verena

2010-06-01

Out of the complex influences of event, narrative and listener characteristics on narrative emotions, this paper focuses on event severity, narrative perspectives, mood, and dispositions for emotion regulation and empathy. Event severity and perspective representation were systematically varied in sad autobiographical narratives to study their influence on quantity and quality of readers' emotional response. Each of three stories were manipulated to contain elaborated perspectives, only the past protagonists' perspective (dramatic narration), and very little perspectives at all (impersonal narration). We predicted that event severity influences the quantity of emotional response, while degree of perspective representation influences plausibility and whether emotional responses are sympathetic or interactional, that is, directed against the narrator. Hypotheses were confirmed except for plausibility, and perspective representation had an effect only on anger against and dislike of the narrator. In a second study, impersonal narration evoked anger at and negative evaluations of the narrator which were related to blaming the narrator for showing too little emotional involvement. The generalizability of findings across emotions and implications for sharing of emotions in everyday and clinical settings are discussed.

Trust and social reciprocity in adolescence--a matter of perspective-taking.

Science.gov (United States)

Fett, Anne-Kathrin J; Shergill, Sukhi S; Gromann, Paula M; Dumontheil, Iroise; Blakemore, Sarah-Jayne; Yakub, Farah; Krabbendam, Lydia

2014-02-01

Changes in social behaviour from childhood to adulthood have been suggested to be driven by an increased sensitivity to others' perspectives. Yet, the link between perspective-taking and social processes, such as trust and reciprocity, has rarely been investigated during adolescence. Using two trust games with a cooperative and an unfair counterpart and an online perspective-taking task with 50 adolescents, we show that those with a higher perspective-taking tendency demonstrate greater trust towards others and higher levels of trust during cooperative interactions. Both low and high perspective-takers adapted their levels of trust in response to unfair behaviour. However, high perspective-takers reduced their trust more drastically and showed more malevolent and less benevolent tit-for-tat when they were treated unfairly by their counterpart. The findings suggest that a higher perspective-taking tendency in adolescence is associated with specific mechanisms of trust and reciprocity, as opposed to undifferentiated increases in positive social behaviour towards others. Copyright © 2013 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

Indian Academy of Sciences (India)

Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

New St-chromosome-specific molecular markers for identifying ...

Indian Academy of Sciences (India)

et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...

Perspective-taking: decreasing stereotype expression, stereotype accessibility, and in-group favoritism.

Science.gov (United States)

Galinsky, A D; Moskowitz, G B

2000-04-01

Using 3 experiments, the authors explored the role of perspective-taking in debiasing social thought. In the 1st 2 experiments, perspective-taking was contrasted with stereotype suppression as a possible strategy for achieving stereotype control. In Experiment 1, perspective-taking decreased stereotypic biases on both a conscious and a nonconscious task. In Experiment 2, perspective-taking led to both decreased stereotyping and increased overlap between representations of the self and representations of the elderly, suggesting activation and application of the self-concept in judgments of the elderly. In Experiment 3, perspective-taking reduced evidence of in-group bias in the minimal group paradigm by increasing evaluations of the out-group. The role of self-other overlap in producing prosocial outcomes and the separation of the conscious, explicit effects from the nonconscious, implicit effects of perspective-taking are discussed.

The Student Perspective.

Science.gov (United States)

Oltmanns, Gail V.

1995-01-01

Addresses the students' perspective of library employment. Discusses a study conducted at the University of Virginia (1987) on student attitudes and library employment practices, and provides 12 recommendations for better management. Also notes the implication of part-time work, the importance of using performance measures, and the benefits of…

Our Continent, Our Future: African Perspectives on Structural ...

International Development Research Centre (IDRC) Digital Library (Canada)

Our Continent, Our Future: African Perspectives on Structural Adjustment ... Our Future presents the emerging African perspective on this complex issue. ... This important book should be read by students, professors, academics, and ... the Council for the Development of Social Research in Africa in Dakar, Senegal.

Risks in homeownership : a perspective on The Netherlands

NARCIS (Netherlands)

Teye, A.L.; de Haan, J.; Elsinga, M.G.; Bondinuba, F.K.; Gbadegesin, J.T.

2017-01-01

Purpose
Risk in home ownership from mortgage providers’ perspectives has received tremendous attention than individual home owner’s perspectives in existing literature following the financial crisis in 2007/2008 within the euro zone. This paper explored the risks factors in homeowners from the

Evolutionary Perspectives on the Development of Social Exchanges.

Science.gov (United States)

Sheese, Brad E.; Graziano, William G.

2002-01-01

Argues that apparent incompatibilities between social exchange and developmental perspectives can be resolved by using evolutionary theories to extend the logic of social exchange. Discusses the implications of an expanded evolutionary perspective on social exchange and development, proposing that developmental context and genetic relatedness may…

Time to be wise: temporal perspective and wisdom

NARCIS (Netherlands)

Webster, Jeffrey Dean; Webster, Jeffrey Dean

2014-01-01

This thesis examined possible antecedent and consequent variables of wisdom development with an emphasis on time perspective. Chapter 1 first outlined the importance of time perspective, particularly reminiscence processes, for the development of wisdom. Next, a model of wisdom, the H.E.R.O.(E)

LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities

Energy Technology Data Exchange (ETDEWEB)

Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)

2013-12-31

This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.

Patient safety trilogy: perspectives from clinical engineering.

Science.gov (United States)

Gieras, Izabella; Sherman, Paul; Minsent, Dennis

2013-01-01

This article examines the role a clinical engineering or healthcare technology management (HTM) department can play in promoting patient safety from three different perspectives: a community hospital, a national government health system, and an academic medical center. After a general overview, Izabella Gieras from Huntington Hospital in Pasadena, CA, leads off by examining the growing role of human factors in healthcare technology, and describing how her facility uses clinical simulations in medical equipment evaluations. A section by Paul Sherman follows, examining patient safety initiatives from the perspective of the Veterans Health Administration with a focus on hazard alerts and recalls. Dennis Minsent from Oregon Health & Science University writes about patient safety from an academic healthcare perspective, and details how clinical engineers can engage in multidisciplinary safety opportunities.

A customer perspective on performance measurement in humanitarian supply chains

OpenAIRE

Schiffling, Sarah

2013-01-01

The increasing importance of services in SCM leads to a stronger focus on the customer perspective. Donors and beneficiaries are two distinct customer groups of humanitarian supply chains. This paper will analyse how this impacts performance measurement for example in the commonly used balanced scorecard, which includes a customer perspective. Keywords: Performance measurement, Humanitarian logistics, Customer perspective

Reserve reporting from a banker's perspective

International Nuclear Information System (INIS)

Larson, B.O.

1996-01-01

A banker's perspective of oil and gas reserve reporting was presented. Topics chosen for discussion emphasized oil and gas lending, and the type of capital which is most relevant to the oil and gas industry. The concept of capital differentiation, potential worst case, and least specialization, were explained. An explanation of the reasons for the lender's different perspective on reserves was given. Methods that banks use to limit risk, and the role that reserve reports play in loan approvals were also reviewed

Occupational Science in a Nordic perspective

DEFF Research Database (Denmark)

Borg, Tove; Bendixen, HJ; Frydendal, E

The book is anthology and the first of its kind to be publiched in the Nordic countries. It comprices contributions from Sweden, Norway and Denmark. The authors write from respective fields of interest, research perspectives and personal experiences. The overall goal is to present a vision and im...... and importance of Occupational Science in a Nordic perspective, in responce to the American understanding. The anthology comprise 14 articles and adresses all with an interest in research in human activity and social participation....

Intersectional perspective in elderly care.

Science.gov (United States)

Cuesta, Marta; Rämgård, Margareta

2016-01-01

Earlier research has shown that power relationships at workplaces are constructed by power structures. Processes related to power always influence the working conditions for (in this study in elderly care) the working groups involved. Power structures are central for intersectional analysis, in the sense that the intersectional perspective highlights aspects such as gender and ethnicity (subjective dimensions) and interrelates them to processes of power (objective dimension). This qualitative study aims to explore in what way an intersectional perspective could contribute to increased knowledge of power structures in a nursing home where the employees were mostly immigrants from different countries. By using reflexive dialogues related to an intersectional perspective, new knowledge which contributes to the employees' well-being could develop. Narrative analysis was the method used to conduct this study. Through a multi-stage focus group on six occasions over 6 months, the staff were engaged in intersectional and critical reflections about power relationship with the researchers, by identifying patterns in their professional activities that could be connected to their subjectivities (gender, ethnicity, etc.). The result of this study presents three themes that express the staff's experiences and connect these experiences to structural discrimination. 1) Intersectionality, knowledge, and experiences of professionalism; 2) Intersectionality, knowledge, and experiences of collaboration; and 3) Intersectionality, knowledge, and experiences of discrimination. The result demonstrates that an intersectional perspective reinforces the involved abilities, during the conversations, into being clear about, for example, their experiences of discrimination, and consequently developing a better understanding of their professionalism and collaboration. Such deeper reflections became possible through a process of consciousness raising, strengthening the employee's self

Intersectional perspective in elderly care

Directory of Open Access Journals (Sweden)

Marta Cuesta

2016-05-01

Full Text Available Earlier research has shown that power relationships at workplaces are constructed by power structures. Processes related to power always influence the working conditions for (in this study in elderly care the working groups involved. Power structures are central for intersectional analysis, in the sense that the intersectional perspective highlights aspects such as gender and ethnicity (subjective dimensions and interrelates them to processes of power (objective dimension. This qualitative study aims to explore in what way an intersectional perspective could contribute to increased knowledge of power structures in a nursing home where the employees were mostly immigrants from different countries. By using reflexive dialogues related to an intersectional perspective, new knowledge which contributes to the employees’ well-being could develop. Narrative analysis was the method used to conduct this study. Through a multi-stage focus group on six occasions over 6 months, the staff were engaged in intersectional and critical reflections about power relationship with the researchers, by identifying patterns in their professional activities that could be connected to their subjectivities (gender, ethnicity, etc.. The result of this study presents three themes that express the staff's experiences and connect these experiences to structural discrimination. 1 Intersectionality, knowledge, and experiences of professionalism; 2 Intersectionality, knowledge, and experiences of collaboration; and 3 Intersectionality, knowledge, and experiences of discrimination. The result demonstrates that an intersectional perspective reinforces the involved abilities, during the conversations, into being clear about, for example, their experiences of discrimination, and consequently developing a better understanding of their professionalism and collaboration. Such deeper reflections became possible through a process of consciousness raising, strengthening the employee

Intersectional perspective in elderly care

Science.gov (United States)

Cuesta, Marta; Rämgård, Margareta

2016-01-01

Earlier research has shown that power relationships at workplaces are constructed by power structures. Processes related to power always influence the working conditions for (in this study in elderly care) the working groups involved. Power structures are central for intersectional analysis, in the sense that the intersectional perspective highlights aspects such as gender and ethnicity (subjective dimensions) and interrelates them to processes of power (objective dimension). This qualitative study aims to explore in what way an intersectional perspective could contribute to increased knowledge of power structures in a nursing home where the employees were mostly immigrants from different countries. By using reflexive dialogues related to an intersectional perspective, new knowledge which contributes to the employees’ well-being could develop. Narrative analysis was the method used to conduct this study. Through a multi-stage focus group on six occasions over 6 months, the staff were engaged in intersectional and critical reflections about power relationship with the researchers, by identifying patterns in their professional activities that could be connected to their subjectivities (gender, ethnicity, etc.). The result of this study presents three themes that express the staff's experiences and connect these experiences to structural discrimination. 1) Intersectionality, knowledge, and experiences of professionalism; 2) Intersectionality, knowledge, and experiences of collaboration; and 3) Intersectionality, knowledge, and experiences of discrimination. The result demonstrates that an intersectional perspective reinforces the involved abilities, during the conversations, into being clear about, for example, their experiences of discrimination, and consequently developing a better understanding of their professionalism and collaboration. Such deeper reflections became possible through a process of consciousness raising, strengthening the employee's self

Our Continent, Our Future: African Perspectives on Structural ...

International Development Research Centre (IDRC) Digital Library (Canada)

Our Continent, Our Future: African Perspectives on Structural Adjustment ... Our Continent, Our Future presents the emerging African perspective on this complex issue. ... approach to structural adjustment, and it does so with the input and support ... Committee of the Association of African Universities, the International Board ...

Refined Characterization of Student Perspectives on Quantum Physics

Science.gov (United States)

Baily, Charles; Finkelstein, Noah D.

2010-01-01

The perspectives of introductory classical physics students can often negatively influence how those students later interpret quantum phenomena when taking an introductory course in modern physics. A detailed exploration of student perspectives on the interpretation of quantum physics is needed, both to characterize student understanding of…

Diachronic Perspective and Interaction

DEFF Research Database (Denmark)

Marchetti, Emanuela; Valente, Andrea

. An ongoing participatory inquiry is being conducted, to explore deeper forms of learning and communication for historical museums. Our hypothesis is that the diachronic perspective on historical processes, defined as social interaction within the environment through time, is a key missing element....... Although this interaction style may appeal to teachers, as it reminds of school teaching, it has several disadvantages: a dialogue never occurs between adults and children, who listen in silence, hence it becomes hard to evaluate what has being learnt and how deeply, and finally it is not very engaging....... Explorations of more interactive representations of the diachronic perspective, through play and tangible interaction, may foster a dialogue with young visitors. Therefore, a new interactive installation is being designed, intended as a tool to enrich learning, allowing children to experience historical...

Expanding beyond individualism: Engaging critical perspectives on occupation.

Science.gov (United States)

Gerlach, Alison J; Teachman, Gail; Laliberte-Rudman, Debbie; Aldrich, Rebecca M; Huot, Suzanne

2018-01-01

Perspectives that individualize occupation are poorly aligned with socially responsive and transformative occupation-focused research, education, and practice. Their predominant use in occupational therapy risks the perpetuation, rather than resolution, of occupational inequities. In this paper, we problematize taken-for-granted individualistic analyses of occupation and illustrate how critical theoretical perspectives can reveal the ways in which structural factors beyond an individual's immediate control and environment shape occupational possibilities and occupational engagement. Using a critically reflexive approach, we draw on three distinct qualitative research studies to examine the potential of critical theorizing for expanding beyond a reliance on individualistic analyses and practices. Our studies highlight the importance of addressing the socio-historical and political contexts of occupation and demonstrate the contribution of critical perspectives to socially responsive occupational therapy. In expanding beyond individualistic analyses of occupation, critical perspectives advance research and practices towards addressing socio-political mediators of occupational engagement and equity.

The impact of shifting vantage perspective when recalling and imagining positive events.

Science.gov (United States)

Vella, Nicholas C; Moulds, Michelle L

2014-01-01

The vantage perspective from which memories are recalled influences their emotional impact. To date, however, the impact of vantage perspective on the emotions elicited by positive memories and images of positive future events has been minimally explored. We experimentally manipulated the vantage perspective from which a sample of undergraduate students (n =80) recalled positive memories and imagined positive future events. Participants who naturally recalled their positive memories from a field perspective reported decreased vividness and positive affect (i.e., happiness, optimism, hopefulness) when they were instructed to shift to an observer perspective. The same pattern of emotionality ratings was observed when participants' vantage perspective of imagined future events was manipulated. In contrast, shifting participants from observer to field perspective recall of positive memories did not result in changes in ratings of memory-related emotion, although we found an unexpected trend towards reduced vividness. For positive future events, shifting from an observer to a field perspective resulted in decreased vividness but did not lead to any changes in positive emotion. Our findings confirm that vantage perspective plays a key role in determining the emotional impact of positive memories, and demonstrate that this relationship is also evident for images of future positive events.

Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor

Science.gov (United States)

2015-09-01

Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4

The effects of reciprocal cross on inheritance of DNA methylation in ...

African Journals Online (AJOL)

enoh

2012-03-20

Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

Time perspective and exercise, obesity, and smoking: moderation of associations by age.

Science.gov (United States)

Guthrie, Lori C; Butler, Stephen C; Lessl, Kristen; Ochi, Onyinyechukwu; Ward, Michael M

2014-01-01

Time perspective, a psychological construct denoting subjective orientation to either present or future concerns, has been inconsistently associated with healthy behaviors in adults. We hypothesized that associations would be stronger in young adults, who are first developing independent attitudes, than in older adults. Cross-sectional survey. The study was conducted in three cities in the Mid-Atlantic region. Subjects were 790 patrons of barber and beauty shops. Measures used were the Zimbardo Time Perspective Inventory future, present-fatalistic, and present-hedonistic subscales and current smoking, days per week of recreational exercise, and height and weight, by self-report. We tested if associations between time perspective and exercise, obesity, and current smoking differed by age group (18-24 years, 25-34 years, and 35 years and older) using analysis of variance and logistic regression. Higher future time perspective scores, indicating greater focus on future events, was associated with more frequent exercise, whereas higher present-fatalistic time perspective scores, indicating more hopelessness, was associated with less frequent exercise in 18- to 24-year-olds, but not in older individuals. Lower future time perspective scores, and higher present-hedonistic time perspective scores, indicating interest in pleasure-seeking, were also associated with obesity only in 18- to 24-year-olds. Current smoking was not related to time perspective in any age group. Time perspective has age-specific associations with exercise and obesity, suggesting stages when time perspective may influence health behavior decision making.

Pitfalls in VAR based return decompositions: A clarification

DEFF Research Database (Denmark)

Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten

in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...

PERSPECTIVES FOR FOG COMPUTING IN MANUFACTURING

Directory of Open Access Journals (Sweden)

Jakub PIZOŃ

2016-09-01

Full Text Available This article discusses ongoing efforts to enable the fog computing vision in manufacturing. As a new paradigm of computing implementation of fog computing faces many challenges that open perspective of new applications within a field of manufacturing. It is expected that fog computing will be one of factors that will accelerate development of in forth industrial revolution. In this article we discuss the perspectives of manufacturing companies surrounded by new solutions of CPS, CPPS and CM in relation to fog computing.

Perspectives on Video Games as Art

OpenAIRE

Bourgonjon, Jeroen; Vandermeersche, Geert; Rutten, Kris

2017-01-01

In their article "Perspectives on Video Games as Art" Jeroen Bourgonjon, Geert Vndermeer­sche, and Kris Rutten engage in discussing whether or not video games can be considered a form of art. Although this question has already been discussed elaborately, the debate is guided by many differ­ent and often conflicting positions. The aim of this article is to revisit this debate by mapping out a range of perspectives on video games as art. The authors explore the relation between games and differ...

A New Perspective of Literary Criticism

Directory of Open Access Journals (Sweden)

Deng Jun

2009-05-01

Full Text Available Paratext is a relatively new term in literary criticism, which is mainly elaborated by modern French scholar Gérard Genette. Article presents a qualitative method with its purpose to present a survey to this new literary term and probe into what may lie behind this new critic perspective. Analysis was done by exploring the new literatures in terms of paratext. It can be concluded that paratext has a great influence to the deeper understanding from different perspectives of a literature work. 

Characterizing Traffic Conditions from the Perspective of Spatial-Temporal Heterogeneity

Directory of Open Access Journals (Sweden)

Peichao Gao

2016-03-01

Full Text Available Traffic conditions are usually characterized from the perspective of travel time or the average vehicle speed in the field of transportation, reflecting the congestion degree of a road network. This article provides a method from a new perspective to characterize traffic conditions; the perspective is based on the heterogeneity of vehicle speeds. A novel measurement, the ratio of areas (RA in a rank-size plot, is included in the proposed method to capture the heterogeneity. The proposed method can be performed from the perspective of both spatial heterogeneity and temporal heterogeneity, being able to characterize traffic conditions of not only a road network but also a single road. Compared with methods from the perspective of travel time, the proposed method can characterize traffic conditions at a higher frequency. Compared to methods from the perspective of the average vehicle speed, the proposed method takes account of the heterogeneity of vehicle speeds. The effectiveness of the proposed method has been demonstrated with real-life traffic data of Shenzhen (a coastal urban city in China, and the advantage of the proposed RA has been verified by comparisons to similar measurements such as the ht-index and the CRG index.

Finding common ground: perspectives on community-based childhood obesity prevention.

Science.gov (United States)

Porter, Christine M; Pelletier, David L

2012-11-01

To support successful and inclusive community organizing for childhood obesity prevention, this research identified stakeholder perspectives on what communities should do to prevent childhood obesity. It employed factor analysis on statement sorts (Q methodology) conducted by 95 people in an upstate New York community. These participants sorted 36 statements about the issue by how much he or she agreed or disagreed with each. Participants were recruited through strategic snowball sampling to sample a variety of perspectives. The four resulting factors, or perspectives, were interpreted in the context of presort demographic surveys and postsort interviews. This research found one stance that fits the environmental perspective common in public health. The other three factors indicate important variations among perspectives centered on individual responsibility, ranging from libertarian to technocratic views. However, overall, results revealed a substantial degree of agreement among the four perspectives, including on providing access to family activities and on making fruits and vegetables more available and affordable, for example, through subsidies. This article points to common ground for community action on childhood obesity prevention, highlights areas likely to generate considerable contention, and shows whose views are not being accounted for in, at least, this community's childhood obesity prevention project.

[Impact of social disadvantages and time perspective on smoking cessation].

Science.gov (United States)

Merson, Frédéric; Perriot, Jean

2012-02-01

Smoking addiction and tobacco dependence are related to social deprivation and time perspective. The objective of this study was to understand how these factors influenced the results of smoking cessation in order to optimize the care of this population. We included 200 patients from our outpatient clinic from March 1, 2009 to June 30, 2010. This study focused on the impact of social disadvantages and time perspective on smoking cessation. Time perspective was measured with the short version of the Zimbardo Time Perspective Inventory, social disadvantages with Epices scale. Information on each individual's characteristics, smoking addiction, and smoking cessation was collected. One hundred and ninety-two patients (of whom 45% were socially disadvantaged) participated. Socially disadvantaged people tend to lean towards dimensions "Past Negative" (Pdisadvantages and time perspective in helping these addicted patients to stop smoking. Copyright © 2011. Published by Elsevier Masson SAS.

Abandon or embrace: Functionalism perspective of photojournalists on Syrian refugees

Science.gov (United States)

Tsuroyya; Tandyonomanu, D.; Dharmawan, A.

2018-01-01

This research examines photojournalist’ perspectives of Syrian refugees in Europe, encoding, and dissemination processes. It employs a qualitative approach and functionalism perspective of mass media by sending questionnaires to voluntary respondents. The findings show sharing similar background and/or having experiences in the Middle Eastern countries highly influence the perspective of photojournalists on Syrian refugees. The encoding process covers through research of priority issues, target audience, trustworthiness of photos, and audience interpretation. The distribution method includes taking advantages of personal social media to promote the links of photos. As part of mass media industry, photojournalists play a crucial role to contribute to social integration, particularly, in creating a shared understanding between European community and Syrian refugees. The current research serves as a basis to future investigations on the perspective of European community towards Syrian refugees, whether or not their perspective is influenced by such photos.

Human Geography Trains Diverse Perspectives on Global Development

Science.gov (United States)

Ahamer, Gilbert

2012-01-01

Purpose: Education for equity in global development and cultural diversity calls for professional capacity building to perceive diverse perspectives on complex procedures of globalisation. The discipline of human geography is such a "provider of perspectives". The purpose of this paper is to propose a historic series of how theories of geography…

Developmental Perspectives on Nutrition and Obesity From Gestation to Adolescence

OpenAIRE

Huang, Terry T.; Esposito, Layla; Fisher, Jennifer O.; Mennella, Julie A.; Hoelscher, Deanna M.

2009-01-01

Obesity results from a complex combination of factors that act at many stages throughout a person's life. Therefore, examining childhood nutrition and obesity from a developmental perspective is warranted. A developmental perspective recognizes the cumulative effects of factors that contribute to eating behavior and obesity, including biological and socioenvironmental factors that are relevant at different stages of development. A developmental perspective considers family, school, and commun...

Aging Perspectives

OpenAIRE

Theodore D Cosco; David Brehme; Nora Grigoruta; Lisa-Katrin Kaufmann; Liis Lemsalu; Ruth Meex; Angela Schuurmans; Neslihan Sener

2014-01-01

Despite the proliferation of successful ageing (SA) research, the literature is dominated by researcher-driven Anglophone conceptualisations. To date, lay perspectives of SA have not been examined in Europe or Turkey. The current study aims to conduct a mixed-methods examination of conceptualisations of SA in seven underrepresented countries. Using snowball sampling via social media sites, an online survey consisting of established closed-ended and open-ended items – translated into seven lan...

African Journal of Traditional, Complementary and Alternative ...

African Journals Online (AJOL)

Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.

Trend analysis and change point detection of annual and seasonal ...

Indian Academy of Sciences (India)

elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.

Perspectives on Perspective Taking: How Children Think About the Minds of Others.

Science.gov (United States)

Birch, S A J; Li, V; Haddock, T; Ghrear, S E; Brosseau-Liard, P; Baimel, A; Whyte, M

2017-01-01

Perspective taking, or "theory of mind," involves reasoning about the mental states of others (e.g., their intentions, desires, knowledge, beliefs) and is called upon in virtually every aspect of human interaction. Our goals in writing this chapter were to provide an overview of (a) the research questions developmental psychologists ask to shed light on how children think about the inner workings of the mind, and (b) why such research is invaluable in understanding human nature and our ability to interact with, and learn from, one another. We begin with a brief review of early research in this field that culminated in the so-called litmus test for a theory of mind (i.e., false-belief tasks). Next, we describe research with infants and young children that created a puzzle for many researchers, and briefly mention an intriguing approach researchers have used to attempt to "solve" this puzzle. We then turn to research examining children's understanding of a much broader range of mental states (beyond false beliefs). We briefly discuss the value of studying individual differences by highlighting their important implications for social well-being and ways to improve perspective taking. Next, we review work illustrating the value of capitalizing on children's proclivity for selective social learning to reveal their understanding of others' mental states. We close by highlighting one line of research that we believe will be an especially fruitful avenue for future research and serves to emphasize the complex interplay between our perspective-taking abilities and other cognitive processes. © 2017 Elsevier Inc. All rights reserved.

Optical illusions and life-threatening traffic crashes: A perspective on aerial perspective.

Science.gov (United States)

Redelmeier, Donald A; Raza, Sheharyar

2018-05-01

Aerial perspective illusion is a feature of visual perception where landscapes appear relatively close in clear light and distant in dim light. We hypothesized that bright sunlight might cause drivers to perceive distant terrain as relatively close and misinterpret the approach speed of surrounding landscape as unduly slow. This hypothesis would mean, in turn, that drivers in bright sunlight may underestimate their progress on the road, compensate by traveling at a faster baseline speed, and ultimately increase the prevailing risk of a life-threatening traffic crash. We conducted three pilot studies to illustrate how the illusion might contribute to a life- threatening traffic crash. The first illustration used a questionnaire to demonstrate that most respondents were mistaken when judging the distance between simple balls in different positions. The second illustration involved an experimental manipulation to assess whether aerial perspective influenced judgments about the relative positions of vehicles in traffic. The third illustration analyzed a segment of high-volume fast-speed traffic and found an increased frequency of speeding under bright sunlight. Together with past work based on the visual arts, these examples illustrate how an aerial perspective illusion can affect distance perception, may appear in realistic traffic situations, and could potentially contribute to the risk of a life-threatening traffic crash. An awareness of this hypothesis might lead to applications on how optical illusions could extend to everyday traffic and might potentially inform safety warnings to prevent life- threatening crashes. Copyright © 2018 Elsevier Ltd. All rights reserved.

Reconciling White-Box and Black-Box Perspectives on Behavioral Self-adaptation

DEFF Research Database (Denmark)

Bruni, Roberto; Corradini, Andrea; Gadducci, Fabio

2015-01-01

This paper proposes to reconcile two perspectives on behavioral adaptation commonly taken at different stages of the engineering of autonomic computing systems. Requirements engineering activities often take a black-box perspective: A system is considered to be adaptive with respect to an environ......This paper proposes to reconcile two perspectives on behavioral adaptation commonly taken at different stages of the engineering of autonomic computing systems. Requirements engineering activities often take a black-box perspective: A system is considered to be adaptive with respect...... to an environment whenever the system is able to satisfy its goals irrespectively of the environment perturbations. Modeling and programming engineering activities often take a white-box perspective: A system is equipped with suitable adaptation mechanisms and its behavior is classified as adaptive depending...

Descriptive and Computer Aided Drawing Perspective on an Unfolded Polyhedral Projection Surface

Science.gov (United States)

Dzwierzynska, Jolanta

2017-10-01

The aim of the herby study is to develop a method of direct and practical mapping of perspective on an unfolded prism polyhedral projection surface. The considered perspective representation is a rectilinear central projection onto a surface composed of several flat elements. In the paper two descriptive methods of drawing perspective are presented: direct and indirect. The graphical mapping of the effects of the representation is realized directly on the unfolded flat projection surface. That is due to the projective and graphical connection between points displayed on the polyhedral background and their counterparts received on the unfolded flat surface. For a significant improvement of the construction of line, analytical algorithms are formulated. They draw a perspective image of a segment of line passing through two different points determined by their coordinates in a spatial coordinate system of axis x, y, z. Compared to other perspective construction methods that use information about points, for computer vision and the computer aided design, our algorithms utilize data about lines, which are applied very often in architectural forms. Possibility of drawing lines in the considered perspective enables drawing an edge perspective image of an architectural object. The application of the changeable base elements of perspective as a horizon height and a station point location enable drawing perspective image from different viewing positions. The analytical algorithms for drawing perspective images are formulated in Mathcad software, however, they can be implemented in the majority of computer graphical packages, which can make drawing perspective more efficient and easier. The representation presented in the paper and the way of its direct mapping on the flat unfolded projection surface can find application in presentation of architectural space in advertisement and art.

The connection of time perspective with personality traits and subjective well-being

Directory of Open Access Journals (Sweden)

Tina Podlogar

2011-04-01

Full Text Available The aim of our study was to research the connection of the six time perspective dimensions and of balanced time perspective with personality traits and subjective well-being. Our starting point was the assumption that time perspective is closely connected to personality traits and subjective well-being. It has been theorized that so called balanced time perspective is optimal in the Western cultures. It is defined by moderately high scores on present-hedonistic and future, high scores on past-positive and low scores on past-negative and present-fatalistic, with an emphasis on individual's ability of flexible adjusting in given situations. People with balanced time perspective profile have many positive memories of the past, find enough opportunity for relaxation and pleasure in the present, and seek new challenges in the future, which gives them motivation for hard work. They are supposed to handle daily life more efficiently and to be happier than people with other time perspective profiles. Therefore we have hypothesized positive connection of balanced time perspective with positive personality traits and high scores on subjective well-being. 279 students studying different subjects at the Faculty of arts, University in Ljubljana, whose mean age was 21.2 years, participated in the study. The results reveal connections of positive time perspective dimensions (including transcendental-future and of balanced time perspective with extraversion, agreeableness, conscientiousness and higher level of subjective well-being, and connections of negative time perspective dimensions with neuroticism, lower level of subjective well-being and higher level of depression. It turned out that balance of time perspective is an important predictor of individual's level of satisfaction with life, and it also explains some variance in positive emotionality and depression.

COMPARISION OF JAVA RMI AND CORBA FROM DIFFERENT PERSPECTIVES

Directory of Open Access Journals (Sweden)

Mustafa TÜRKSEVER

2001-01-01

Full Text Available In this paper, two of the widely used distributed object system standards which are CORBA and Java RMI has been compared from different perspectives. These perspectives are performance, distributed programming and system level services.

Exposure to child and adolescent psychiatry for medical students: are there optimal "teaching perspectives"?

Science.gov (United States)

Hunt, Jeffrey; Barrett, Rowland; Grapentine, W Lex; Liguori, Gina; Trivedi, Harsh K

2008-01-01

The ability to develop quality medical student exposures in child and adolescent psychiatry is critical to the professional development of these future physicians and to the growth of recruitment efforts into the field. This study identifies teaching perspectives among child and adolescent psychiatry faculty to determine whether there are optimal perspectives that positively influence medical student satisfaction. Eighty-eight third- and fourth-year students at an allopathic U.S. medical school assessed teacher performance over a 1-year period using a standard internal teacher evaluation. Three experienced faculty members teaching the medical student seminars each completed a Teaching Perspective Inventory. The authors compared the different teaching perspectives with student satisfaction scores on the standard teacher evaluation instrument. All teachers had two dominant perspectives and one recessive perspective. Each teacher had a predominant developmental perspective but they differed in other dominant and recessive perspectives. The transmission perspective was associated with significantly less favorable scores on the standard teacher evaluation compared to the apprenticeship and nurturing perspective. The authors discuss the value of teaching perspective identification among child and adolescent psychiatry faculty for medical student education.

Another Perspective: El Sistema--A Perspective for North American Music Educators

Science.gov (United States)

Tunstall, Tricia

2013-01-01

Herein, Tricia Tunstall presents a critique of the article by Melissa Lesniak published in the December 2012 "Music Educators Journal," and offers a new perspective on the Venezuelan youth orchestra program known as "El Sistema." The program, which began in Caracas thirty-eight years ago, is dedicated to changing the lives of…

Femtochemistry – some reflections and perspectives

DEFF Research Database (Denmark)

Henriksen, Niels Engholm

2014-01-01

In this perspective we highlight some aspects of femtochemistry, that is, the creation, detection and control of non-stationary states in chemical dynamics. Some recent results are discussed with a view on the challenges and pending scientific questions. We discuss theoretical as well as experime......In this perspective we highlight some aspects of femtochemistry, that is, the creation, detection and control of non-stationary states in chemical dynamics. Some recent results are discussed with a view on the challenges and pending scientific questions. We discuss theoretical as well...

Level 2 Perspective Taking Entails Two Processes: Evidence from PRP Experiments

Science.gov (United States)

Janczyk, Markus

2013-01-01

In many situations people need to mentally adopt the (spatial) perspective of other persons, an ability that is referred to as "Level 2 perspective taking." Its underlying processes have been ascribed to mental self-rotation that can be dissociated from mental object-rotation. Recent findings suggest that perspective taking/self-rotation…

Ten Perspectives on Nordic Energy. Final report for the first phase of the Nordic Energy Perspectives project

International Nuclear Information System (INIS)

Ryden, Bo

2006-09-01

Nordic Energy Perspectives is an interdisciplinary energy research project which, from a holistic perspective, analyses and creates new insights into the consequences for energy markets and energy systems of the goals and instruments of energy policy in the light of new conditions. The project's aim is to provide better bases for decisions on energy and environmental policy at both national and international levels. It is intended to contribute to constructive dialogue between researchers, politicians, authorities and actors on the energy markets. A first phase of the project has been carried out during Apr 2005 - Sep 2006. This report summarises the most important results. Around fifteen current research issues have been analysed. Some of these issues have been analysed in detail, while others have been studied more generally. This means that we can present a comprehensive flora of results in a number of areas, whereas in regard to other questions the analysis is less deep and the conclusions are not as firmly grounded. We have nonetheless chosen to present the entire range of results in this final report. An objective of Nordic Energy Perspectives has been to create a forum for fact-based discussion and dialogue between decision-makers and other energy actors from different disciplines and different countries. Today this forum is fully active. We are very eager that the forum should survive and that the discussion should continue concerning the themes treated by Nordic Energy Perspectives. Hence, for each of the chapters 1-17 below, we identify the researchers whom the reader can contact for further dialogue. The ten perspectives, which are based on contributions from the whole research group, have the following headlines: Costly early learnings from the first year of EU ETS: Unforeseen price levels hit industries hard; Market based support schemes - do they really work as intended; New decade in the Nordic energy markets; Reduced CO 2 emissions and more

From glue to gasoline: how competition turns perspective takers unethical.

Science.gov (United States)

Pierce, Jason R; Kilduff, Gavin J; Galinsky, Adam D; Sivanathan, Niro

2013-10-01

Perspective taking is often the glue that binds people together. However, we propose that in competitive contexts, perspective taking is akin to adding gasoline to a fire: It inflames already-aroused competitive impulses and leads people to protect themselves from the potentially insidious actions of their competitors. Overall, we suggest that perspective taking functions as a relational amplifier. In cooperative contexts, it creates the foundation for prosocial impulses, but in competitive contexts, it triggers hypercompetition, leading people to prophylactically engage in unethical behavior to prevent themselves from being exploited. The experiments reported here establish that perspective taking interacts with the relational context--cooperative or competitive--to predict unethical behavior, from using insidious negotiation tactics to materially deceiving one's partner to cheating on an anagram task. In the context of competition, perspective taking can pervert the age-old axiom "do unto others as you would have them do unto you" into "do unto others as you think they will try to do unto you."

Individualism and the field viewpoint: cultural influences on memory perspective.

Science.gov (United States)

Martin, Maryanne; Jones, Gregory V

2012-09-01

Two perspectives from which memories can be retrieved have been distinguished: field resembles the view from the first-person vantage point of original experience, whereas observer resembles the view from the third-person vantage point of a spectator. There is evidence that the incidences of the two types of perspective differ between at least two different cultural groups. It is hypothesised here that this is a special case of a more general relation between memory perspective and cultural individualism, such that field and observer perspectives are more prevalent among people from, respectively, relatively individualist and relatively collectivist societies. Memory perspectives adopted by participants from a range of different countries were recorded, and were found to vary in the predicted manner. Regression analysis showed that the potential effects of three other cultural variables - uncertainty avoidance, masculinity and, to a lesser extent, power distance - were eclipsed by the influence of individualism, and the implications are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

Smartphone log data in a qualitative perspective

DEFF Research Database (Denmark)

Ørmen, Jacob; Thorhauge, Anne Mette

2015-01-01

into studies of smartphones in everyday life. Through an illustrative study, we explore a more nuanced perspective on what can be considered “log data” and how these types of data can be collected and analysed. A qualitative approach to log data analysis offers researchers new opportunities to situate......Log data from smartphones have primarily been used in large-scale research designs to draw statistical inferences from hundreds or even thousands of participants. In this article, we argue that more qualitatively oriented designs can also benefit greatly from integrating these rich data sources...... serve as cues to instigate discussion and reflection as well as act as resources for contextualizing and organizing related empirical material. In the discussion, the advantages of a qualitative perspective for research designs are assessed in relation to issues of validity. Further perspectives...

Perspectives for Planning.

Science.gov (United States)

Miner, Norris

The operations of an institution can be viewed from three perspectives: (1) the "actual operating measurement" such as income and expenditures of a cost center at a point in time; (2) the "criterion" which reflects the established policy for a time period; and (3) the "efficiency level" wherein a balance between input and output is defined.…

Perspectives on water security in the South African context

CSIR Research Space (South Africa)

Funke, Nicola S

2017-12-01

Full Text Available This presentation focuses on different perspectives of water security in the South Africa context. The authors link a number of key international perspectives on the topic of water security to official South African government and academic discourse...

Perspectives for the Development of a Working Life Policy

DEFF Research Database (Denmark)

Hvid, Helge; Hasle, Peter

2003-01-01

A discussion of the perspectives in a working life policy with development of both a humane working life and productivity.......A discussion of the perspectives in a working life policy with development of both a humane working life and productivity....

The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations

Science.gov (United States)

2011-09-01

properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman

Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings

Science.gov (United States)

2015-07-01

resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G

Evaluation of effectiveness in a novel wound healing ointment ...

African Journals Online (AJOL)

Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

Advances in SCA and RF-DNA Fingerprinting Through Enhanced Linear Regression Attacks and Application of Random Forest Classifiers

Science.gov (United States)

2014-09-18

22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen

A comparative study assessing a new tool for occluding ...

African Journals Online (AJOL)

0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...

A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

The roles of electronic books in the transformation of learning and instruction

NARCIS (Netherlands)

Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel

2014-01-01

Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies

Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal

Science.gov (United States)

2009-09-01

this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation

A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...

Exploring the Potential of Dynamic Perspective Taking on Business Processes

Directory of Open Access Journals (Sweden)

Florian Krenn

2016-10-01

Full Text Available Although many organizations have started to work with business process models in their operational practice, they have not explored the entire potential of intertwining business process modeling with organizational development. Process specifications contain workflows that require execution, in order to achieve business objectives and support business operation effectively. With the advent of Subject-oriented and Social Business Process Management, communication and stakeholder interaction have become novel perspectives on how to design and implement processes. They go beyond formal responsibilities encoded in functional roles, and are not very common across organizational hierarchies. However, stakeholders, including organizational developers and IT specialists, can be supported looking at processes and their execution from either perspective, namely, from a traditional one, focusing on functions and task accomplishment, and from an interactional perspective, focusing on communication among stakeholders and system interactions. The introduced dual-mode workflow execution engine UeberFlow allows considering both perspectives during process runtime, thus, checking operational completeness from either perspective. Stakeholders can start modeling with a perspective they are familiar with and subsequently proceed with the another one by switching dynamically to an alternate mode of execution. The presented meta-model and architecture of such a dual mode support tool enables coupling business process management directly with organizational development.

THE CONCEPT OF LANGUAGE LEARNING IN BEHAVIORISM PERSPECTIVE

Directory of Open Access Journals (Sweden)

Khoiru Rakhman Abidin

2016-07-01

Full Text Available The aims of the study are (1 the concepts of language learning in behaviorism perspective, (2 the relation between language and learning in behaviorism perspective, (3 the influence of behaviorism in language learning. This is a descriptive qualitative study. The results showed that (1 behaviorism theories of languages also give good contribution in language learning process that describes a child can learn language from their environments, (2 behaviorism perspective defines as change of behavior through experience, it means human learn something from their environments, (3 human uses language for communication in the world and he also spreads his culture with his language so  human gets  knowledge of language through learning.

Shape equivalence under perspective and projective transformations

OpenAIRE

Wagemans, Johan; Lamote, C; Van Gool, Luc

1997-01-01

When a planar shape is viewed obliquely, it is deformed by a perspective deformation. If the visual system were to pick up geometrical invariants from such projections, these would necessarily be invariant under the wider class of projective transformations. To what extent can the visual system tell the difference between perspective and nonperspective but still projective deformations of shapes? To investigate this, observers were asked to indicate which of two test patterns most resembled a...

Industry perspective on digital upgrades: A utility perspective on digital upgrades

International Nuclear Information System (INIS)

Blauw, R.J.

1994-01-01

Nuclear utilities face the need to upgrade aging and obsolete safety related and other critical equipment. This is the result of operation and maintenance concerns for reliability and maintainability. Digital technology is an option for these upgrades. A number of utilities have attempted exercising the digital option. The regulatory licensing results have been inconsistent and have raised a variety of issues. These issues and the subsequent licensing uncertainties have caused some utilities to temporarily drop digital technology as an upgrade option. Resolution of these issues and the need for regulatory stability is driving the development of industry standards and guidelines. These will provide guidance to support consistent design and implementation of digital upgrades. Successful completion of these documents is necessary for renewed consideration of the use of digital technology. This paper will present a utility perspective on how project management, configuration control, and a rigorous design process can serve to address the present regulatory issues. These issues include commercial grade dedication, reliability, electromagnetic interference, and failure and error management. This perspective is consistent with the standards and guidelines development effort

Cognitive and behavioural predictors of adolescents' communicative perspective-taking and social relationships.

Science.gov (United States)

Nilsen, Elizabeth S; Bacso, Sarah A

2017-04-01

Given the pivotal role that social interactions play for adolescents' well-being, understanding the factors that influence communication is key. The present study examined relations between adolescents' communicative perspective-taking, executive function skills, and ADHD traits and explored the role communicative perspective-taking plays in peer relations. Data was collected from a community sample of 15 to 19-years-olds (N = 46) in Waterloo, Canada. Two communicative perspective-taking tasks required participants to infer speakers' communicative intentions. A battery of tasks assessed adolescents' working memory and inhibitory control. Elevated ADHD traits were associated with weaker working memory, inhibitory control, and communicative perspective-taking. Working memory was the strongest predictor of communicative perspective-taking. Highlighting the importance of communicative perspective-taking for social interactions, adolescents with weaker skills in this area reported worse peer relations. Findings underscore the importance of communicative perspective-taking for adolescents' social relations and have relevance for understanding the social difficulties faced by adolescents with elevated ADHD traits. Copyright © 2017 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

Analytical perspectives on performance-based management

DEFF Research Database (Denmark)

Wadmann, Sarah; Johansen, Sarah; Lind, Ane

2013-01-01

Performance-based management (PBM) has become a dominant form of governance in health care and there is a need for careful assessment of its function and effects. This article contains a cross-disciplinary literature synthesis of current studies of PBM. Literature was retrieved by database search...... perspectives allows appreciation of otherwise implicit assumptions and potential implications of PBM. Reflections on such differences are important to ensure vigilant appropriation of shifting management tools in health quality governance.......Performance-based management (PBM) has become a dominant form of governance in health care and there is a need for careful assessment of its function and effects. This article contains a cross-disciplinary literature synthesis of current studies of PBM. Literature was retrieved by database searches....... In the functionalist perspective, PBM is perceived as a management tool aimed at improving health care services by means of market-based mechanisms. In the interpretive perspective, the adoption of PBM is understood as consequence of institutional and individual agents striving for public legitimacy. In the post...

Gender, Education and Child Labour: A Sociological Perspective

Science.gov (United States)

Bhat, Bilal Ahmad

2010-01-01

In all societies, boys and girls are assigned different societal roles and experience different perspectives of life as a result of their being male or female. Such differences have a gigantic impact on their lives. The importance of gender perspective is very important in understanding the convolution of child labour. Gender, as opposed to sex,…

Executive Function Is Necessary for Perspective Selection, Not Level-1 Visual Perspective Calculation: Evidence from a Dual-Task Study of Adults

Science.gov (United States)

Qureshi, Adam W.; Apperly, Ian A.; Samson, Dana

2010-01-01

Previous research suggests that perspective-taking and other "theory of mind" processes may be cognitively demanding for adult participants, and may be disrupted by concurrent performance of a secondary task. In the current study, a Level-1 visual perspective task was administered to 32 adults using a dual-task paradigm in which the secondary task…

Perspective information in the cockpit to improve situational awareness

NARCIS (Netherlands)

Breda, L. van

1999-01-01

Three simulator experiments were carried out to quantify the potential benefits of perspective visual displays in the cockpit for situational awareness support of the pilot, in local guidance and global awareness tasks. In the first experiment, the application of an egocentric perspective display

Cross-disciplinary Science and the Structure of Scientific Perspectives

DEFF Research Database (Denmark)

Alrøe, Hugo Fjelsted; Noe, Egon

2014-01-01

of science, focusing on the synchronic structure of scientific perspectives across disciplines and not on the diachronic, historical structure of shifting perspectives within single disciplines that has been widely discussed since Kuhn and Feyerabend. We show what kinds of cross-disciplinary disagreement...

THREE NEW SPECIES OF CRAMBINAE（LEPIDOPTERA ： PYRALIDAE） IN CHINA

Institute of Scientific and Technical Information of China (English)

CHENTie-mei; SONGShi-mei; YUANDe-cheng

2003-01-01

Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.

Preliminary study of visual perspective in mental time travel in schizophrenia.

Science.gov (United States)

Wang, Ya; Wang, Yi; Zhao, Qing; Cui, Ji-Fang; Hong, Xiao-Hong; Chan, Raymond Ck

2017-10-01

This study explored specificity and visual perspective of mental time travel in schizophrenia. Fifteen patients with schizophrenia and 18 controls were recruited. Participants were asked to recall or imagine specific events according to cue words. Results showed that schizophrenia patients generated fewer specific events than controls, the recalled events were more specific than imagined events. Schizophrenia adopted less field perspective and more observer perspective than controls. These results suggested that patients with schizophrenia were impaired in mental time travel both in specificity and visual perspective. Further studies are needed to identify the underlying mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

Application of an Arbitrary Lagrangian Eulerian Method to Describe High Velocity Gas-Particle Flow Behavior

Science.gov (United States)

2011-09-01

applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D

WAIS-IV and WISC-IV Structural Validity: Alternate Methods, Alternate Results. Commentary on Weiss et al. (2013a) and Weiss et al. (2013b)

Science.gov (United States)

Canivez, Gary L.; Kush, Joseph C.

2013-01-01

Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…

75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use

Science.gov (United States)

2010-01-28

... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...

Descriptions of membrane mechanics from microscopic and effective two-dimensional perspectives

DEFF Research Database (Denmark)

Lomholt, Michael Andersen; Miao, L.

2006-01-01

Mechanics of fluid membranes may be described in terms of the concepts of mechanical deformations and stresses or in terms of mechanical free-energy functions. In this paper, each of the two descriptions is developed by viewing a membrane from two perspectives: a microscopic perspective, in which...... the membrane appears as a thin layer of finite thickness and with highly inhomogeneous material and force distributions in its transverse direction, and an effective, two-dimensional perspective, in which the membrane is treated as an infinitely thin surface, with effective material and mechanical properties....... A connection between these two perspectives is then established. Moreover, the functional dependence of the variation in the mechanical free energy of the membrane on its mechanical deformations is first studied in the microscopic perspective. The result is then used to examine to what extent different...

Perspectives of joint implementation projects in Lithuania

OpenAIRE

Štreimikienė, Dalia; Mikalauskienė, Asta

2004-01-01

The paper deals with the perspectives of joint implementation (JI) projects in Lithuania. The analysis of flexible mechanisms under the Kyoto protocol including Jl benefits is presented in the paper. The main aim of the article is to analyze current macroeconomic environment which has impact on the JI perspectives in Lithuania and based on this analysis to define activities, measures and institutions necessary for the implementation of these projects. A very important issue in this context is...

Time perspective: its link to personality traits, age, and gender

OpenAIRE

Kairys, Antanas

2010-01-01

In Lithuania, as well as in other countries, psychological studies on time perspective are still making their first steps. Currently, no theoretical paradigm is extensive enough to serve well as a basis for further fundamental and applied research in this field. The goal of this study was to explore the link between time perspective and personality traits in different gender and age groups. To analyse time perspective and personality traits, two independent studies were carried out (N=636 in ...

Colorectal Anastomotic Leakage: New perspectives

NARCIS (Netherlands)

F. Daams (Freek)

2014-01-01

markdownabstract__Abstract__ This thesis provides new perspectives on colorectal anastomotic leakages. In both experimental and clinical studies, aspects of prevention, early identification, treatment and consequences of anastomotic leakage are discussed.

Social Perspective Taking

Science.gov (United States)

2009-09-01

groups” and engage in less stereotype-driven fear and hostility resulting in reduced impulsive and aggressive behavior (Richardson, Green , & Lago...and the physical world. London: Routledge & Kegan Paul. Batson, C. D. (1991). The altruism question: Towards a social-psychological answer...others. New York: The Guilford Press. Richardson, D. R., Green , L. R., & Lago, T. (1998). The relationship between perspective- taking and

Clinical Perspectives on Autobiographical Memory

DEFF Research Database (Denmark)

Autobiographical memory plays a key role in psychological well-being, and the field has been investigated from multiple perspectives for more than thirty years. One large body of research has examined the basic mechanisms and characteristics of autobiographical memory during general cognition......, and another body has studied what happens to it during psychological disorders, and how psychological therapies targeting memory disturbances can improve psychological well-being. This edited collection reviews and integrates current theories on autobiographical memory when viewed in a clinical perspective....... It presents an overview of basic applied and clinical approaches to autobiographical memory, covering memory specificity, traumatic memories, involuntary and intrusive memories, and the role of self-identity. The book discusses a wide range of psychological disorders, including depression, posttraumatic...

Molecular magnetism, status and perspectives

Science.gov (United States)

Gatteschi, Dante; Bogani, Lapo; Cornia, Andrea; Mannini, Matteo; Sorace, Lorenzo; Sessoli, Roberta

2008-12-01

A short review is made of molecular magnetism, trying to discuss what is alive and well, with perspectives for the future. All the main fields of activity are mentioned, ranging from the so-called spin cross-over systems to the quest for organic (molecular) ferromagnets. Particular attention is devoted to some of the recent advances in these fields, highlighting also the opportunities for the development of applications. Low dimensional magnets are perhaps the best opportunity to use molecules, and the status of single-molecule and single chain magnets is discussed. The last part is devoted to the organization of magnetic molecules and to the development of techniques which allow to measure the magnetic properties of thin layers and, in perspective, of single molecules.

Cyanobacteria: an economic perspective

NARCIS (Netherlands)

Sharma, N.K.; Rai, A.K.; Stal, L.J.

2014-01-01

Written by leading experts in the field, Cyanobacteria: An Economic Perspective is a comprehensive edited volume covering all areas of an important field and its application to energy, medicine and agriculture. Issues related to environment, food and energy have presented serious challenge to the

Time perspective and socioeconomic status: a link to socioeconomic disparities in health?

Science.gov (United States)

Guthrie, Lori C; Butler, Stephen C; Ward, Michael M

2009-06-01

Time perspective is a measure of the degree to which one's thinking is motivated by considerations of the future, present, or past. Time perspective has been proposed as a potential mediator of socioeconomic disparities in health because it has been associated with health behaviors and is presumed to vary with socioeconomic status. In this cross-sectional community-based survey of respondents recruited from hair salons and barber shops in a suburb of Washington DC, we examined the association between time perspective and both education level and occupation. We asked participants (N=525) to complete a questionnaire that included three subscales (future, present-fatalistic, and present-hedonistic) of the Zimbardo Time Perspective Inventory. Participants with more formal education and those with professional occupations had higher scores on the future time perspective subscale, and lower scores on the present-fatalistic subscale, than participants with less formal education or a non-professional occupation. Present-fatalistic scores were also higher among participants whose parents had less formal education. Present-hedonistic scores were not associated with either education level or professional occupation. Time perspective scores were not independently associated with the likelihood of obesity, smoking, or exercise. In this community sample, future time perspective was associated with current socioeconomic status, and past-fatalistic time perspective was associated with both current and childhood socioeconomic status.

Sustainability transitions in the perspective of ecological macroeconomics

DEFF Research Database (Denmark)

Røpke, Inge

2013-01-01

Globally, societies are facing a number of serious environmental, economic and social crises. Although the multiple crises are interrelated, research communities tend to be organised around specific complexes of problems. This paper is intended to contribute to the development of an ecological...... macroeconomics that addresses multiple crises by including insights from different, partly overlapping research communities. The main idea is to explore the usefulness of combining three different system perspectives in the study of sustainability transitions: socio-technical provision systems, distributional...... systems and macroeconomic systems. First, the theoretical concept of sustainability and the different system perspectives are outlined, and then the perspectives are brought together in the discussion of a specific topic that is key to sustainable transition: the need for considerable resources to invest...

Theory of Science Perspectives on Strategic Management Research

DEFF Research Database (Denmark)

Foss, Nicolai Juul

Arguments derived from the theory of science have been present in strategic management discourse since at least the beginning of the 1970s. The field's topjournal,the Strategic Management Journal, has printed several theory of sciencebased papers. Most positions in the theory of science...... (falsificationism, instrumentalism, realism, constructivism, etc.) have been present in the methodological discourse in the field. This chapter briefly reviews theory science applications to strategic management, before a distinctive perspective on the evolution of the strategic management field is developed....... According to this perspective, science progresses when deeper level mechanisms are identified and theorized. Theoretical reduction may therefore be an independent criterion of scientific progress. Application to the strategic management field of this perspective, which in the social sciences is closely...

Changing Set: Teaching Family Therapy from a Feminist Perspective.

Science.gov (United States)

Leslie, Leigh A.; Clossick, Michelle L.

1992-01-01

Notes that feminist writings in family therapy have critiqued models and offered alternative methods for family interventions. Attempts to expand current application of feminist perspective to family therapy by examining implications for training. Three areas are considered: implications of a feminist perspective for training, strategies for…

Implementation of enterprise resource planning systems: a user perspective

Science.gov (United States)

Reitsma, E.; Hilletofth, P.; Mukhtar, U.

2018-04-01

The purpose of this study is to evaluate critical success factors (CSFs) for the implementation of an enterprise resource planning (ERP) system from a user perspective. Users play a vital role when implementing an ERP system, but their perspective has been neglected in the literature. A better understanding of their perspective promises to contribute to the design of more effective ERP systems, its implementation, and management. In order to identify the user perspective, a survey was conducted within three Pakistani companies that recently have implemented a new ERP system. The questionnaire was developed based on thirteen CSFs deduced from literature. Based on each CSF’s level of importance, they are ranked in order of importance and divided into three groups: most important, important and not important. Findings reveal that users believe that management should prioritize the following four CSFs when implementing an ERP system: education and training, strategic decision-making, communication, and business process alignment.

A Conceptual Analysis of Perspective Taking in Support of Socioscientific Reasoning

Science.gov (United States)

Kahn, Sami

Scientific literacy is concerned with the informed citizens' ability to negotiate scientifically-related societal issues. The suite of skills necessary to negotiate these complex issues is referred to as Socioscientific Reasoning (SSR). SSR requires, among other things, perspective-taking abilities in order to consider the multi-faceted nature of these open-ended, debatable socioscientific issues (SSI). Developing interventions and instruments to foster and measure perspective taking in support of SSR is therefore critical to the promotion of functional scientific literacy through both research and practice. Although widely studied in many disciplines, perspective taking is a particularly tangled construct that has been used to describe a range of activities representing different psychological domains and applied interchangeably with related constructs such as role taking, empathy, and theory of mind. This ambiguity makes it difficult to ensure construct validity and prevents science education researchers from honing in on the precise skills they wish to study and promote. To clarify the construct of perspective taking, this study undertook a conceptual analysis to operationalize perspective taking, drawing comparisons and distinctions between it and related constructs. Further, by applying a method known as conception development, perspective taking was positioned in the context of SSR, particularly as it relates to moral development, in order to devise a more precise construct relating perspective taking to SSR called socioscientific perspective taking (SSPT). It is asserted that SSPT requires engagement with others or their circumstances, an etic/emic shift, and a moral context comprised of reflective and reflexive judgment. Finally, in order to identify promising interventions for promoting SSPT in the science classroom, the newly-developed SSPT construct was applied to a series of extensively researched curricular frameworks that promote perspective taking in

Emotion work and emotional exhaustion in teachers: The job and individual perspective

NARCIS (Netherlands)

Näring, Gérard; Vlerick, Peter; Van de Ven, Bart

2011-01-01

Teaching requires much emotion work which takes its toll on teachers. Emotion work is usually studied from one of two perspectives, a job or an individual perspective. In this study we assessed the relative importance of these two perspectives in predicting emotional exhaustion. More than 200

Emotion work and emotional exhaustion in teachers: The job and individual perspective

NARCIS (Netherlands)

Näring, G.W.B.; Vlerick, P.; Ven, B. van de

2012-01-01

Teaching requires much emotion work which takes its toll on teachers. Emotion work is usually studied from one of two perspectives, a job or an individual perspective. In this study, we assessed the relative importance of these two perspectives in predicting emotional exhaustion. More than 200

Convergence of a strengths perspective and youth development: Toward youth promotion practice

Directory of Open Access Journals (Sweden)

Jeong Woong Cheon

2008-12-01

Full Text Available In recent years, increased attention has been paid to the development and application of the strengths perspective and positive youth development. This paper develops youth promotion practice as a convergence of a strengths perspective and youth development principles. Historical and contemporary contexts of a problem-focused perspective in social work with adolescents are reviewed and a critique developed with emphasis on the evolution of strengths-focused practices. The importance and possibility of combining the strengths perspective and youth development toward youth promotion practice are addressed. Youth promotion is defined as a process of enhancing youth strengths and resources to promote positive outcomes and help young people be healthy adults. Complementary aspects of the two perspectives are expected to support and supplement the strengths and weaknesses of each perspective in synergistic ways. Several advantages of youth promotion practice are discussed as well as its implications for improved social work practices with adolescents.

Parenting and Adolescents' Depressive Symptoms: The Mediating Role of Future Time Perspective.

Science.gov (United States)

Diaconu-Gherasim, Loredana R; Bucci, Colleen M; Giuseppone, Kathryn R; Brumariu, Laura E

2017-10-03

This study investigated the relations between maternal and paternal rearing practices and adolescents' depressive symptoms, and whether time perspective in adolescence explains these links. The sample included 306 students (158 girls), aged between 10.83 and 14.42 years. Adolescents completed questionnaires assessing their perceptions of maternal and paternal acceptance and psychological control, and of their future time perspective and depressive symptoms. Adolescents who rated their mothers as more accepting and those who rated their fathers as less psychologically controlling also reported lower levels of depressive symptoms and greater future time perspective. Further, adolescents who had greater future time perspective reported lower levels of depressive symptoms. Finally, time perspective partially mediated the relations of maternal and paternal acceptance, and paternal control with depressive symptoms in adolescence. The findings highlight the unique relations of maternal acceptance and paternal psychological control with adolescents' depressive symptoms, and that future time perspective is one mechanism that might explain why parenting strategies are linked with depressive symptoms in adolescence.

When do humans spontaneously adopt another's visuospatial perspective?

Science.gov (United States)

Freundlieb, Martin; Kovács, Ágnes M; Sebanz, Natalie

2016-03-01

Perspective-taking is a key component of social interactions. However, there is an ongoing controversy about whether, when and how instances of spontaneous visuospatial perspective-taking occur. The aim of this study was to investigate the underlying factors as well as boundary conditions that characterize the spontaneous adoption of another person's visuospatial perspective (VSP) during social interactions. We used a novel paradigm, in which a participant and a confederate performed a simple stimulus-response (SR) compatibility task sitting at a 90° angle to each other. In this set-up, participants would show a spatial compatibility effect only if they adopted the confederate's VSP. In a series of 5 experiments we found that participants reliably adopted the VSP of the confederate, as long as he was perceived as an intentionally acting agent. Our results therefore show that humans are able to spontaneously adopt the differing VSP of another agent and that there is a tight link between perspective-taking and performing actions together. The results suggest that spontaneous VSP-taking can effectively facilitate and speed up spatial alignment processes accruing from dynamic interactions in multiagent environments. (c) 2016 APA, all rights reserved).

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

A reviewof the pharmacologicalmechanism of traditional Chinese ...

African Journals Online (AJOL)

A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

African Journal of Biotechnology - Vol 10, No 60 (2011)

African Journals Online (AJOL)

Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...

Three novel antioxidants from Cinnamomum plants | Cheng | African ...

African Journals Online (AJOL)

Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.

The roles of chronological age and time perspective in memory positivity.

Science.gov (United States)

Kan, Irene P; Garrison, Shaina L; Drummey, Anna B; Emmert, Brian E; Rogers, Leeland L

2018-07-01

The observation that older adults show enhanced cognition for emotionally positive information has been labeled the positivity effect (Reed, Chan, & Mikels, 2014). According to the Socioemotional Selectivity Theory (SST, Carstensen, 1991), a prominent lifespan development theory, cognition is strongly influenced by motivational goals, and these goals are impacted by subjective time perspective. Although the positivity effect is most commonly observed in older adults, as age usually co-varies with time perspective, the SST posits that time perspective, not age, is the key explanatory factor of positivity. We examined the effects of these predictors on positivity in an episodic memory task in younger and older adults and found that age, not time perspective, was a key predictor of memory positivity. Our results add to the growing literature that challenge the notion that time perspective is the driving force behind age-related differences in emotional processing and functioning.

Revision of the Agathidinae (Hymenoptera, Braconidae) of Vietnam, with the description of forty-two new species and three new genera

Science.gov (United States)

van Achterberg, Cornelis; Long, Khuat Dang

2010-01-01

Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus

Conceptualizing Multicultural Perspective Taking Skills

National Research Council Canada - National Science Library

Rentsch, Joan R; Gunderson, Allison; Goodwin, Gerald F; Abbe, Allison

2007-01-01

.... The ability to take the perspective of individuals within the context of their culture enables Army leaders to understand other cultures at a level finer than that afforded by simply using global...

Interpretations, perspectives and intentions in surrogate motherhood

OpenAIRE

van Zyl, L.; van Niekerk, A.

2000-01-01

In this paper we examine the questions "What does it mean to be a surrogate mother?" and "What would be an appropriate perspective for a surrogate mother to have on her pregnancy?" In response to the objection that such contracts are alienating or dehumanising since they require women to suppress their evolving perspective on their pregnancies, liberal supporters of surrogate motherhood argue that the freedom to contract includes the freedom to enter a contract to bear a child for an infertil...

Clinical and Insurance Perspectives on Intermediate Levels of Care in Psychiatry.

Science.gov (United States)

Plakun, Eric M

2018-03-01

This column compares a clinical perspective on the continuum of care for mental health and substance use disorders with a different perspective derived from publicly available insurance company documents and experience dealing with managed care utilization reviewers. The latter perspective tends to determine the need for access to levels of care based on the need for crisis stabilization, whereas the generally accepted clinical standard is more nuanced than the need for crisis stabilization alone. The column proposes that this discrepancy in perspectives makes a substantial contribution to disagreements between treating clinicians, such as therapists, and insurance utilization reviewers concerning the medical necessity of various requested levels of care.

The Influences on Teaching Perspectives of Australian Physical Education Teacher Education Students: The First-Year Influences on Teaching Perspectives Exploratory (FIT-PE) Study

Science.gov (United States)

Hyndman, Brendon P.; Pill, Shane

2016-01-01

There has been a paucity of literature investigating the teaching beliefs and intentions of Australian physical education teacher education (PETE) students that enter teacher training. The First-year Influences on Teaching Perspectives Exploratory (FIT-PE) study explores the teaching perspectives of first year PETE students; including teaching…

Time perspective, personality and smoking, body mass, and physical activity: an empirical study.

Science.gov (United States)

Adams, Jean; Nettle, Daniel

2009-02-01

Time perspective describes how individuals conceptualize and value future events, and may be related to health behaviours. Research to date has focused on addictive behaviours, used a variety of different measures of time perspective, and not explored the role of personality. This work aimed to: explore the relationships between: five previously used measures of time perspective; time perspective and the broad domains of the five-factor model of personality; and time perspective and smoking, body mass, and physical activity after controlling for socio-demographics and personality. Cross-sectional self-report data were collected using a web based survey. Participants (N=423) were recruited via local community internet message boards in US urban areas. The survey collected information on: delay discount rate, the Consideration of Future Consequences Scale (CFCS), the future scale of the Zimbardo Time Perspective Inventory (ZTPI), subjective probability of living to age 75, and time period for financial planning, the five-factor personality inventory, smoking, body mass index (BMI), and physical activity. After controlling for socio-demographics, most markers of time perspective were significantly correlated with each other, but the strength of correlations was rarely strong. Conscientiousness, Neuroticism, Agreeableness, and Openness were associated with some markers of time perspective. After controlling for socio-demographic and personality domains, only CFCS score was associated with smoking status and BMI. There is some overlap between previously used markers of time perspective and the five-factor personality domains but this is neither strong nor consistent. Smoking and BMI, but not physical activity, are associated with CFCS, but not other measures of time perspective.

Biotechnology : A Dutch perspective

NARCIS (Netherlands)

Van Apeldoorn, J.H.F.

1981-01-01

Biotechnology: a Dutch Perspective assesses the future potential of biotechnology in the Netherlands. It has been published in English because it is felt that the Dutch case could be of relevance to other industrialised nations. Although the report is aimed primarily at policy planners and decision

IRU Results and Perspectives

NARCIS (Netherlands)

Bronswijk, van J.E.M.H.

2003-01-01

This chapter is devoted to the disciplines within USOBuilt Graduate School as organized in International Research and Design Units, the fora where research and design at a (post)doctorate level is performed and taught. A fixed template was used to self-assess results and perspectives, consisting of

Perspective on food irradiation

International Nuclear Information System (INIS)

Anon.

1987-01-01

Recent US Food and Drug Administration approval of irradiation treatment for fruit, vegetables and pork has stimulated considerable discussion in the popular press on the safety and efficacy of irradiation processing of food. This perspective is designed to summarize the current scientific information available on this issue

Alienation in Physical Education from the Perspectives of Children

Science.gov (United States)

Spencer-Cavaliere, Nancy; Rintoul, Mary Ann

2012-01-01

The purpose of this exploratory study was to examine the phenomenon of alienation in physical education from the perspectives of children. Of particular interest were children's perspectives about the three constructs of alienation: (a) powerlessness, (b) meaninglessness, and (c) social isolation, as defined by Carlson (1995). A case study…

Lateral strukturierte Oberflächen zur THz-Strahlmanipulation

OpenAIRE

Jahn, David; Koch, Martin (Prof. Dr.)

2018-01-01

Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...

C. Huang , G. Zhao , HW Zhang & YQ Chen

Indian Academy of Sciences (India)

the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

Chaos synchronization of the fractional-order Chen's system

International Nuclear Information System (INIS)

Zhu Hao; Zhou Shangbo; He Zhongshi

2009-01-01

In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.

Professional learning for distributed leadership:Primary headteachers’ perspectives

OpenAIRE

Torrance, Deirdre

2015-01-01

This article draws from a small-scale study of headteachers motivated to positively impact on the quality of pupil experience by involving all staff in a distributed perspective on leadership. Each headteacher perceived leadership as involving learned processes requiring support and experience, expending considerable effort in providing a fertile environment for learning about its practice. This perspective developed from their personal experience of challenging established leadership orthodo...

Nature of motor control: perspectives and issues.

Science.gov (United States)

Turvey, Michael T; Fonseca, Sergio

2009-01-01

Four perspectives on motor control provide the framework for developing a comprehensive theory of motor control in biological systems. The four perspectives, of decreasing orthodoxy, are distinguished by their sources of inspiration: neuroanatomy, robotics, self-organization, and ecological realities. Twelve major issues that commonly constrain (either explicitly or implicitly) the understanding of the control and coordination of movement are identified and evaluated within the framework of the four perspectives. The issues are as follows: (1) Is control strictly neural? (2) Is there a divide between planning and execution? (3) Does control entail a frequently involved knowledgeable executive? (4) Do analytical internal models mediate control? (5) Is anticipation necessarily model dependent? (6) Are movements preassembled? (7) Are the participating components context independent? (8) Is force transmission strictly myotendinous? (9) Is afference a matter of local linear signaling? (10) Is neural noise an impediment? (11) Do standard variables (of mechanics and physiology) suffice? (12) Is the organization of control hierarchical?

Literature in Focus Perspectives on LHC Physics

CERN Multimedia

2008-01-01

The CERN Library invites you to a book presentation, a Literature in Focus event. The Large Hadron Collider (LHC) will be the world’s largest, highest energy and highest intensity particle accelerator. This is a timely book with several perspectives on the hoped-for discoveries from the LHC. This book provides an overview of the techniques that will be crucial for finding new physics at the LHC, as well as perspectives on the importance and implications of the discoveries. Among the accomplished contributors to this book are leaders and visionaries in the field of particle physics beyond the Standard Model, including two Nobel Laureates (Steven Weinberg and Frank Wilczek). With its blend of popular and technical contents, the book will have wide appeal, not only to physical scientists but also to those in related fields. Perspectives on LHC Physics (World Scientific Publishing) Gordon Kane and Aaron Pierce (eds.) Tuesday 12 August, 4.30pm Council Chamber Refresh...

Using Perspective to Resolve Reference: The Impact of Cognitive Load and Motivation

Science.gov (United States)

Cane, James E.; Ferguson, Heather J.; Apperly, Ian A.

2017-01-01

Research has demonstrated a link between perspective taking and working memory. Here we used eye tracking to examine the time course with which working memory load (WML) influences perspective-taking ability in a referential communication task and how motivation to take another's perspective modulates these effects. In Experiment 1, where there…

Discovering Complementary Colors from the Perspective of STEAM Education

Science.gov (United States)

Karabey, Burak; Koyunkaya, Melike Yigit; Enginoglu, Turan; Yurumezoglu, Kemal

2018-01-01

This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of…

Future Time Perspective in Sociocultural Contexts: A Discussion Paper

Science.gov (United States)

Phan, Huy P.

2009-01-01

Future time perspective (FTP) serves as a strong motivational force for individuals to engage in activities that may be instrumental in future outcomes. There has been a voluminous body of research studies, to date, that explored the importance of FTP. This article discusses FTP from sociocultural perspectives. Based on previous empirical…

Time Perspective and Indecision in Young and Older Adolescents

Science.gov (United States)

Ferrari, Lea; Nota, Laura; Soresi, Salvatore

2010-01-01

Career choices involve an orientation towards the future and the propensity to planning. The "mental picture" of the past, present and future was defined by Savickas as time perspective. The present paper reports the findings of two studies examining time perspective in Italian adolescents. The first study surveyed 498 students aged…

Children's pain perspectives.

Science.gov (United States)

Esteve, R; Marquina-Aponte, V

2012-05-01

Previous studies on children's pain perspectives remain limited to English-speaking populations. An exploratory cross-sectional descriptive design was used to investigate the developmental progression of children's pain perspectives, including their pain experience, its definition and attributes, causality and coping. The Children's Pain Perspectives Inventory was applied to 180 healthy Spanish children. A coding system was developed following the content analysis method. Three age groups were compared: 4-6 years, corresponding to the Piagetian pre-operational stage of cognitive development; 7-11 years, corresponding to stage of concrete operations; and 12-14 years, corresponding to the period of early formal operations. In children between 4 and 6, the predominant narratives related to physical injuries, the notion of causality and the definition of pain. In children between 7 and 11, the predominant narratives were those in which pain was described as a sensation in one part of the body. The view of pain as having an emotional basis significantly increased with age and was more frequent in adolescents. In contrast, children between 4-6 and 7-11 indicated that pain occurs spontaneously. The denial of any positive aspects of pain significantly decreased with age; some children between 7 and 11 referred to the 'possibility of relief', while the view that pain is a 'learning experience' was significantly more frequent among adolescents aged between 12 and 14 years. The use of cognitive strategies to control pain significantly increased with age. Between 12 and 14 years of age, adolescents communicate pain by non-verbal behaviour and reported that they do not express demands for relief. There was a progression from concrete to more complex notions of pain as age increased. These results may be of use to health professionals and parents to understand how children at various developmental stages express and cope with pain and to develop tools that effectively assess and

Family Perspectives on Prematurity

Science.gov (United States)

Zero to Three (J), 2003

2003-01-01

In this article, seven families describe their experiences giving birth to and raising a premature baby. Their perspectives vary, one from another, and shift over time, depending on each family's circumstances and the baby's developmental course. Experiences discussed include premature labor, medical interventions and the NICU, bringing the baby…

Strengths perspective among the homeless adolescents: A systematic review

Directory of Open Access Journals (Sweden)

Janmejaya Samal

2017-01-01

Full Text Available Background: Earlier, the scholars of family studies have primarily focused on the problems and weaknesses of the families. However, during these days, there is a shift from problems to strength-based perspective. Methodology: Search of literature was carried out through internet-based Google Scholar search engine. Of the 112 titles obtained 21 titles fit the criteria of the study objectives, of which 9 full-text articles were finally selected for the purpose of this review. Results: In this review, nine full-text articles were reviewed. Nine of these researches investigated different facets of strengths perspective among the homeless adolescents. Chronologically, nine of these reviewed studies delineated the following thematic facets of strengths perspective among the homeless adolescents. These include personal strength and informal resources, personal strength in high-risk environment, strengths perspective during the transition of adolescence to adulthood, personal and social strengths that refrained the homeless adolescents form intravenous drug use, resilience and self-esteem, religion as an important strength, “hope” as a way of living among the homeless adolescents, coping strategies of street-involved youth, and usage of internet and social media as an important strength among homeless adolescents. Conclusion: Strengths perspective helps the youth to become a master of their own lives and helps to deal with all the adversities in life.

Descriptions of membrane mechanics from microscopic and effective two-dimensional perspectives

International Nuclear Information System (INIS)

Lomholt, Michael A; Miao Ling

2006-01-01

Mechanics of fluid membranes may be described in terms of the concepts of mechanical deformations and stresses or in terms of mechanical free-energy functions. In this paper, each of the two descriptions is developed by viewing a membrane from two perspectives: a microscopic perspective, in which the membrane appears as a thin layer of finite thickness and with highly inhomogeneous material and force distributions in its transverse direction, and an effective, two-dimensional perspective, in which the membrane is treated as an infinitely thin surface, with effective material and mechanical properties. A connection between these two perspectives is then established. Moreover, the functional dependence of the variation in the mechanical free energy of the membrane on its mechanical deformations is first studied in the microscopic perspective. The result is then used to examine to what extent different, effective mechanical stresses and forces can be derived from a given, effective functional of the mechanical free energy

[Perspectives on patient competence in psychiatry: cognitive functions, emotions and values].

Science.gov (United States)

Ruissen, A; Meynen, G; Widdershoven, G A M

2011-01-01

Informed consent, a central concept in the doctor-patient relationship, is only valid if it is given by a competent patient. To review the literature on competence or decision-making capacity in psychiatry. We studied the international literature and relevant Dutch material such as health acts and medical guidelines. We found a consensus in the literature about the assessment criteria and the basic principles, but we did not find any consensus about the exact definition of competence. We review a number of perspectives on competence. The conceptualisations of competence, particularly in the field of psychiatry, are still being debated. The best known clinical tool to assess patients’ capacities to make treatment decisions is the MacArthur Competence Assessment Tool (MacCAT). There are three perspectives on competence: a cognitive perspective, a perspective concerning emotions and a perspective relating to values. Further research is needed in order to make the conceptual debate on competence relevant to psychiatric practice.

Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors

Science.gov (United States)

2008-04-01

Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

Energy forecasts, perspectives and methods

Energy Technology Data Exchange (ETDEWEB)

Svensson, J E; Mogren, A

1984-01-01

The authors have analyzed different methods for long term energy prognoses, in particular energy consumption forecasts. Energy supply and price prognoses are also treated, but in a less detailed manner. After defining and discussing the various methods/models used in forecasts, a generalized discussion of the influence on the prognoses from the perspectives (background factors, world view, norms, ideology) of the prognosis makers is given. Some basic formal demands that should be asked from any rational forecast are formulated and discussed. The authors conclude that different forecasting methodologies are supplementing each other. There is no best method, forecasts should be accepted as views of the future from differing perspectives. The primary prognostic problem is to show the possible futures, selecting the wanted future is a question of political process.

Disability, Stigma and Otherness: Perspectives of Parents and Teachers

Science.gov (United States)

Lalvani, Priya

2015-01-01

This qualitative study explored the perspectives of parents and teachers in the US with regard to the meaning and implications of disability in the context of schoolling, and of raising a child with a disability. The findings revealed broad conceptual differences in the perspectives of these two groups. Teachers' beliefs were generally consistent…

Perspective Effects during Reading: Evidence from Text Change-Detection

Science.gov (United States)

Bohan, Jason; Filik, Ruth

2018-01-01

We report two text change-detection studies in which we investigate the influence of reading perspective on text memory. In Experiment 1 participants read from the perspective of one of two characters in a series of short stories, and word changes were either semantically close or distant. Participants correctly reported more changes to…

Developmental perspectives on nutrition and obesity from gestation to adolescence.

Science.gov (United States)

Esposito, Layla; Fisher, Jennifer O; Mennella, Julie A; Hoelscher, Deanna M; Huang, Terry T

2009-07-01

Obesity results from a complex combination of factors that act at many stages throughout a person's life. Therefore, examining childhood nutrition and obesity from a developmental perspective is warranted. A developmental perspective recognizes the cumulative effects of factors that contribute to eating behavior and obesity, including biological and socioenvironmental factors that are relevant at different stages of development. A developmental perspective considers family, school, and community context. During gestation, risk factors for obesity include maternal diet, overweight, and smoking. In early childhood, feeding practices, taste acquisition, and eating in the absence of hunger must be considered. As children become more independent during middle childhood and adolescence, school nutrition, food marketing, and social networks become focal points for obesity prevention or intervention. Combining a multilevel approach with a developmental perspective can inform more effective and sustainable strategies for obesity prevention.

Visual perspective in autobiographical memories: reliability, consistency, and relationship to objective memory performance.

Science.gov (United States)

Siedlecki, Karen L

2015-01-01

Visual perspective in autobiographical memories was examined in terms of reliability, consistency, and relationship to objective memory performance in a sample of 99 individuals. Autobiographical memories may be recalled from two visual perspectives--a field perspective in which individuals experience the memory through their own eyes, or an observer perspective in which individuals experience the memory from the viewpoint of an observer in which they can see themselves. Participants recalled nine word-cued memories that differed in emotional valence (positive, negative and neutral) and rated their memories on 18 scales. Results indicate that visual perspective was the most reliable memory characteristic overall and is consistently related to emotional intensity at the time of recall and amount of emotion experienced during the memory. Visual perspective is unrelated to memory for words, stories, abstract line drawings or faces.

On the Interpretation and Use of Mediation: Multiple Perspectives on Mediation Analysis

Science.gov (United States)

Agler, Robert; De Boeck, Paul

2017-01-01

Mediation analysis has become a very popular approach in psychology, and it is one that is associated with multiple perspectives that are often at odds, often implicitly. Explicitly discussing these perspectives and their motivations, advantages, and disadvantages can help to provide clarity to conversations and research regarding the use and refinement of mediation models. We discuss five such pairs of perspectives on mediation analysis, their associated advantages and disadvantages, and their implications: with vs. without a mediation hypothesis, specific effects vs. a global model, directness vs. indirectness of causation, effect size vs. null hypothesis testing, and hypothesized vs. alternative explanations. Discussion of the perspectives is facilitated by a small simulation study. Some philosophical and linguistic considerations are briefly discussed, as well as some other perspectives we do not develop here. PMID:29187828

On the Interpretation and Use of Mediation: Multiple Perspectives on Mediation Analysis.

Science.gov (United States)

Agler, Robert; De Boeck, Paul

2017-01-01

Mediation analysis has become a very popular approach in psychology, and it is one that is associated with multiple perspectives that are often at odds, often implicitly. Explicitly discussing these perspectives and their motivations, advantages, and disadvantages can help to provide clarity to conversations and research regarding the use and refinement of mediation models. We discuss five such pairs of perspectives on mediation analysis, their associated advantages and disadvantages, and their implications: with vs. without a mediation hypothesis, specific effects vs. a global model, directness vs. indirectness of causation, effect size vs. null hypothesis testing, and hypothesized vs. alternative explanations. Discussion of the perspectives is facilitated by a small simulation study. Some philosophical and linguistic considerations are briefly discussed, as well as some other perspectives we do not develop here.

Territorial perspective of agricultural extension policies in Colombia

Directory of Open Access Journals (Sweden)

Molina Juan Patricio

2010-12-01

Full Text Available This article presents a historic perspective of agricultural extension in Colombia and highlights its scope in relationship to regional development. Four periods are identified, which show that policies have evolved towards a territorial and decentralized agricultural extension. However, this trend has not been consolidated in recent years. It is suggested that Colombia should recover an approach of agricultural extension that integrates the productive dimension with a territorial perspective.

Students’ Information Literacy: A Perspective from Mathematical Literacy

OpenAIRE

Ariyadi Wijaya

2016-01-01

Information literacy is mostly seen from the perspective of library science or information and communication technology. Taking another point of view, this study was aimed to explore students’ information literacy from the perspective of mathematical literacy. For this purpose, a test addressing Programme for International Student Assessment (PISA) mathematics tasks were administered to 381 eighth and ninth graders from nine junior high schools in the Province of Yogyakarta. PISA mathematics ...

The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica

Directory of Open Access Journals (Sweden)

Sollman Philip

2015-07-01

Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.

Koeberg - An industry perspective

International Nuclear Information System (INIS)

Birch, C.P.

1990-01-01

Many local organisations participated in the Koeberg power station project. This paper seeks to present a perspective of this from South African industry. It covers the extent of local participation, lessons learned and changes which should be considered for optimising local input into a similar project in the future. (author)

Koeberg - An industry perspective

Energy Technology Data Exchange (ETDEWEB)

Birch, C P [Industrial Machinery Supplies (Pty) Ltd. (IMS), Wendywood (South Africa)

1990-06-01

Many local organisations participated in the Koeberg power station project. This paper seeks to present a perspective of this from South African industry. It covers the extent of local participation, lessons learned and changes which should be considered for optimising local input into a similar project in the future. (author)

Aging Perspectives

Directory of Open Access Journals (Sweden)

Theodore D Cosco

2014-05-01

Full Text Available Despite the proliferation of successful ageing (SA research, the literature is dominated by researcher-driven Anglophone conceptualisations. To date, lay perspectives of SA have not been examined in Europe or Turkey. The current study aims to conduct a mixed-methods examination of conceptualisations of SA in seven underrepresented countries. Using snowball sampling via social media sites, an online survey consisting of established closed-ended and open-ended items – translated into seven languages – was administered. Grounded theory methods and descriptive statistics were used to analyse qualitative and quantitative data, respectively.

Reading the New Testament from a theological perspective | van Zyl ...

African Journals Online (AJOL)

Reading the New Testament from a theological perspective. ... Abstract. This article argues that, from the perspective of the faith community, it is not enough to read the Bible only from a “technical” point of view; ... AJOL African Journals Online.

Vantage perspective during encoding: The effects on phenomenological memory characteristics

NARCIS (Netherlands)

Mooren, N.; Krans, J.; Näring, G.W.B.; Moulds, M.L.; Minnen, A. van

2016-01-01

The vantage perspective from which a memory is retrieved influences the memory’s emotional impact, intrusiveness, and phenomenological characteristics. This study tested whether similar effects are observed when participants were instructed to imagine the events from a specific perspective. Fifty

Sex and dark times' strategy: The Dark Triad and time perspective.

Science.gov (United States)

Moraga, Fernando R G; Nima, Ali A; Garcia, Danilo

2017-03-01

We investigated the effect of sex on associations between dark traits and time perspective dimensions. Responses by participants (N = 338) to the Short Dark Triad Inventory and the Zimbardo Time Perspective Inventory showed that while sex was involved in different time perspective associations of Machiavellianism, psychopathy, and narcissism, it did not moderate the dark times' strategy. © 2017 The Institute of Psychology, Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

Biomass briquetting and its perspectives in Brazil

International Nuclear Information System (INIS)

Felfli, Felix Fonseca; Mesa P, Juan M.; Rocha, Jose Dilcio; Filippetto, Daniele; Luengo, Carlos A.; Pippo, Walfrido Alonso

2011-01-01

A study of the status of biomass briquetting and its perspectives in Brazil was conducted including determination of the availability and characteristics of the agro-residues for briquetting. Wood residues, rice husk and coffee husk were characterized and identified as the more promising agro-residues for briquetting in the short-term in Brazil. A survey was carried out in order to determine the number of briquetting factories in Brazil, and also to determine: used briquetting technologies, briquettes production, briquettes sale prices, the status of biomass briquetting market and its future perspectives. (author)

Nanobiotech in big pharma: a business perspective.

Science.gov (United States)

Würmseher, Martin; Firmin, Lea

2017-03-01

Since the early 2000s, numerous publications have presented major scientific opportunities that can be achieved through integrating insights from the area of nanotech into biotech (nanobiotech). This paper aims to explore the economic significance that nanobiotech has gained in the established pharmaceutical industry (big pharma). The empirical investigation draws on patent data as well as product revenue data; and to put the results into perspective, the amounts are compared with the established/traditional biotech sector. The results indicate that the new technology still plays only a minor role - at least from a commercial perspective.

Biomass briquetting and its perspectives in Brazil

Energy Technology Data Exchange (ETDEWEB)

Felfli, Felix Fonseca; Mesa P, Juan M. [BIOWARE Ltda., Caixa Postal 6086, 13083-970, Campinas, SP (Brazil); Rocha, Jose Dilcio [EMBRAPA-Agroenergia, Brasilia, DF (Brazil); Filippetto, Daniele; Luengo, Carlos A.; Pippo, Walfrido Alonso [Grupo Combustiveis Alternativos/Departamento de Fisica Aplicada/IFGW/UNICAMP, Caixa Postal 6165, Barao Geraldo 13083-970, Campinas, SP (Brazil)

2011-01-15

A study of the status of biomass briquetting and its perspectives in Brazil was conducted including determination of the availability and characteristics of the agro-residues for briquetting. Wood residues, rice husk and coffee husk were characterized and identified as the more promising agro-residues for briquetting in the short-term in Brazil. A survey was carried out in order to determine the number of briquetting factories in Brazil, and also to determine: used briquetting technologies, briquettes production, briquettes sale prices, the status of biomass briquetting market and its future perspectives. (author)

Organizational Change Perspectives on Software Process Improvement

DEFF Research Database (Denmark)

Müller, Sune Dueholm; Mathiassen, Lars; Balshøj, Hans Henrik

Many software organizations have engaged in Software Process Improvement (SPI) and experienced the challenges related to managing such complex organizational change efforts. As a result, there is an increasing body of research investigating change management in SPI. To provide an overview of what......, and brain perspectives. Practitioners may use these articles as a guide to SPI insights relevant to their improvement initiatives. In contrast, the impact of culture, dominance, psychic prison, flux and transformation, and politics in SPI have only received scant attention. We argue that these perspectives...

(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs

Science.gov (United States)

2012-12-21

increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha

The effects of growth time on the quality of graphene synthesized by ...

Indian Academy of Sciences (India)

by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.

Browse Title Index

African Journals Online (AJOL)

Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...

Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...

High School Students' Topic Preferences and Oral Development in an English-Only Short-Term Intensive Language Program

Science.gov (United States)

Hsieh, Hui-Chen

2016-01-01

Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…

A portuguese perspective

OpenAIRE

Machado, Helena; Silva, Susana

2008-01-01

Commentary on the Nuffield Report from a Portuguese Perspective (Nuffield Council on Bioethics (2007). The forensic use of bioinformation: ethical issues. Cambridge (18 September) (retrieved from http://www.nuffieldbioethics.org/fileLibrary/pdf/ The_forensic_use_of_bioinformation_-_ethical_issues.pdf). This is a document which is of considerable interest to professionals working in the criminal justice system, to key stakeholders, and to scholars and students focused on the forensic ap...

Classical person-centered and experiential perspectives on Rogers (1957).

Science.gov (United States)

Elliott, Robert; Friere, Elizabeth

2007-09-01

Rogers (1957; see record 2007-14639-002) foreshadows the later development of the person-centered approach in North America and elsewhere. In this paper, the authors present contrasting perspectives on the legacy of this key paper. First, from the perspective of classical person-centered therapy, Freire describes the context for this key paper within the wider frame of Rogers' body of work and emphasizes its continuing importance and relevance. Second, Elliott offers a personal history from the point of view of a psychotherapy researcher and process-experiential therapist. These two perspectives represent two major and distinct views of Rogers' legacy from within his direct intellectual and therapeutic descendents. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

Postponement : An inter-organizational perspective

NARCIS (Netherlands)

Yang, Biao; Yang, Ying; Wijngaard, Jacob

2007-01-01

In view of the slow rate of postponement applications, this paper attempts to examine postponement strategies from an inter-organizational perspective. The paper first reviews the literature on different postponement strategies (including logistics postponement, production postponement, purchasing

Can't get over me : Ego depletion attenuates prosocial effects of perspective taking

NARCIS (Netherlands)

Fennis, Bob M.

Many studies attest to the beneficial and prosocial effects of perspective taking. The present research tests the notion that such perspective taking is a process involving active self-regulation and, hence, that effects of perspective taking on prosocial behaviour are more pronounced when

Imminent perspectives for industrial application of atomic energy; Perspectives imminentes de l'application industrielle de l'energie atomique

Energy Technology Data Exchange (ETDEWEB)

Kowarski, L [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1955-07-01

This conference raises an inventory of industrial applications and their perspectives for the year 1955. The speaker extrapolate for the forthcoming years the evolution of the role of the nuclear, the nuclear fuel, the different, types of atomic reactors and the state of advancement for different countries. (M.B.) [French] Cette conference dresse un etat des lieux des applications industrielles et de leurs perspectives pour l'annee 1955. L'orateur aborde entre autre l'evolution du role du nucleaire dans les annees a venir, le combustible nucleaire, les differents types de piles atomiques et l'etat d'avancement des differents pays. (M.B.)

Rural education in brazilian education: contradictions and perspective

Directory of Open Access Journals (Sweden)

Adriana D'Agostini

2012-09-01

Full Text Available This work focuses on the rural education. It aimed to analyze and discuss the rural education in the Brazilian educational context, indicating its character and its importance from the 1990s in the perspective of building an education aimed at human emancipation and that contradictory it is also supported and guided by neoliberal educational policies. From the studies of production on rural education was found challenges, problems, difficulties and contradictions that permeate the attempt to create a perspective of rural education. The concept of rural education was initially developed within the Movement of Landless Workers (MST and other social movements from the political pressure and demands for the state to take over public education / field took dimension of public policy. This complex situation currently directs rural schools, a critical perspective that seeks an education beyond the capital.

Urbanization Level and Vulnerability to Heat-Related Mortality in Jiangsu Province, China.

Science.gov (United States)

Chen, Kai; Zhou, Lian; Chen, Xiaodong; Ma, Zongwei; Liu, Yang; Huang, Lei; Bi, Jun; Kinney, Patrick L

2016-12-01

Although adverse effects of high temperature on mortality have been studied extensively in urban areas, little is known of the heat-mortality associations outside of cities. We investigated whether heat-mortality associations differed between urban and nonurban areas and how urbanicity affected the vulnerability to heat-related mortality. We first analyzed heat-related mortality risk in each of 102 counties in Jiangsu Province, China, during 2009-2013 using a distributed-lag nonlinear model. The county-specific estimates were then pooled for more urban (percentage of urban population ≥ 57.11%) and less urban (percentage of urban population risk comparing the 99th vs. 75th percentiles of temperature was 1.43 [95% posterior intervals (PI): 1.36, 1.50] in less urban counties and 1.26 (95% PI: 1.23, 1.30) in more urban counties. The heat effects on cardiorespiratory mortality followed a similar pattern. Higher education level and prevalence of air conditioning were significantly associated with counties having lower risks, whereas percentage of elderly people was significantly associated with increased risks. Our findings reveal that nonurban areas have significant heat-related mortality risks in Jiangsu, China. These results suggest the need for enhanced adaptation planning in Chinese nonurban areas under a changing climate. Citation: Chen K, Zhou L, Chen X, Ma Z, Liu Y, Huang L, Bi J, Kinney PL. 2016. Urbanization level and vulnerability to heat-related mortality in Jiangsu Province, China. Environ Health Perspect 124:1863-1869; http://dx.doi.org/10.1289/EHP204.

Considering others in Need: On altruism, empathy and perspective taking

NARCIS (Netherlands)

Niezink, Lidewij Welmoed

2008-01-01

In the social psychological literature, empathy is seen as an emotional response which evokes the altruistic motivation to help others. One cognitive tool to increase the experience of empathy is perspective taking. The current dissertation investigates how different perspectives on the suffering of

Implications of perspective in teaching objects first and object design

DEFF Research Database (Denmark)

Christensen, Henrik Bærbak

2005-01-01

There are an increasing number of books published on the important topics of "object-oriented programming" and "object-oriented design" for use in education. However, object-orientation can be viewed from a number of different perspectives---each perspective having its benefits and liabilities...

The Dutch dominant perspective on water; risks and opportunities involved

NARCIS (Netherlands)

Offermans, A.; Valkering, P.; Vreugdenhil, H.S.I.; Wijermans, F.E.H.; Haasnoot, M.

2013-01-01

To implement or continue water management strategies social support is needed. Social support highly depends on people’s perspectives on water. However, these perspectives are not static and may change over time leading to changes in social support for strategies. Therefore, sustainable water

Time Perspective and Career Decision-Making Difficulties in Adults

Science.gov (United States)

Taber, Brian J.

2013-01-01

Decision making is not only contingent upon what takes place in the present but also on how one feels about the past and one's hopes for the future. However, when it comes to time perspective and career decision making, vocational psychology has focused exclusively on future time perspective. The present study examines the relations among past,…

How discrimination and perspective-taking influence adolescents' attitudes about justice.

Science.gov (United States)

Rasmussen, Hannah F; Ramos, Michelle C; Han, Sohyun C; Pettit, Corey; Margolin, Gayla

2018-01-01

Little is known about factors influencing adolescents' justice attitudes. This online study investigates perspective-taking and experiences with discrimination for their associations with adolescents' beliefs about how justice is best served. Participants included 179 ethnically/racially diverse high school students (M age  = 16.67 years; SD = 1.02). Higher perspective-taking was associated with less punitive and more restorative attitudes. Youth reporting more personal and ethnic/racial discrimination experiences endorsed more restorative justice attitudes. Perspective-taking also moderated the associations between reports of family, personal, and religious discrimination and punitive justice attitudes: adolescents reporting higher discrimination showed a stronger inverse relationship between perspective-taking and punitive attitudes. Findings have implications for school and community programs aiming to implement restorative policies, and for adolescents' civic participation. Copyright © 2017 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

Symbolic interactionism as a theoretical perspective for multiple method research.

Science.gov (United States)

Benzies, K M; Allen, M N

2001-02-01

Qualitative and quantitative research rely on different epistemological assumptions about the nature of knowledge. However, the majority of nurse researchers who use multiple method designs do not address the problem of differing theoretical perspectives. Traditionally, symbolic interactionism has been viewed as one perspective underpinning qualitative research, but it is also the basis for quantitative studies. Rooted in social psychology, symbolic interactionism has a rich intellectual heritage that spans more than a century. Underlying symbolic interactionism is the major assumption that individuals act on the basis of the meaning that things have for them. The purpose of this paper is to present symbolic interactionism as a theoretical perspective for multiple method designs with the aim of expanding the dialogue about new methodologies. Symbolic interactionism can serve as a theoretical perspective for conceptually clear and soundly implemented multiple method research that will expand the understanding of human health behaviour.

TEENAGE SCHOOLCHILDREN’S TIME PERSPECTIVE AS A PSYCHOLOGICAL AND PEDAGOGICAL ISSUE

Directory of Open Access Journals (Sweden)

Svetlana A. Vasyura

2017-06-01

Full Text Available Introduction: the article deals with human psychological time. Though there are observational studies focused on this topic, the psychological, pedagogical, and age-related aspects of this issue require more attention. The development of the human time perspective during the teenage period is in the authors’ field of view. The aim of the study is to identify main characteristics of teenagers’ time perspective depending on their generalized anxiety level and use them as a basis for working out a psychological and pedagogical support model for teenagers’ time perspective development. Materials and Methods: to study specific aspects of the time perspective formed by teenagers having various generalised anxiety levels, the psychodiagnostic methods were used: a trait anxiety scale for 10–16 years old students by A. M. Prikhozhan; anxiety research methods by C. D. Spielberger and Yu. L. Khanina; and the methods enabling diagnostics of the attitude to past, present, and future by A. M. Prikhozhan. The mathematical statistics methods were applied: Mann-Whitney U Test, Spearman’s rank correlation coefficient and Fisher’s angular transformation φ-index. Results: the specific aspects of the time perspective have been revealed; its interrelation with the various levels of the teenage schoolchildren’s generalised anxiety levels has been established. Based on the obtained research results, a psychological and pedagogical support model of teenage schoolchildren’s time perspective development was elaborated. The main components of this model have been introduced. Discussion and Conclusions: the time perspective of the teenagers having a higher anxiety level is inconsistent. It is characterised by a negative attitude to past, present and future. The psychological and pedagogical support to teenage schoolchildren in terms of their time perspective development will provide: psychological and pedagogical support to reduce teenagers’ personal

Innovations and research perspectives; Innovations et perspectives de recherche

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-12-31

This conference day was organized by the air-conditioning engineering section of the French association of thermal engineers. This book of proceedings contains 7 papers entitled: `Clima 2000: conclusions and perspectives`; `normative approach of the different aspects of ambience comfort`; `progress of the local discomfort evaluation methods`; `towards a global approach of air conditioning of buildings`; `simulation of the energy behaviour of industrial entities. Statement of real actions and methodological evolutions`; `modeling and simulation: state-of-the-art`; `automatized generation of a thermal and aeraulic simulation in buildings`. (J.S.)

Innovations and research perspectives; Innovations et perspectives de recherche

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-12-31

This conference day was organized by the air-conditioning engineering section of the French association of thermal engineers. This book of proceedings contains 7 papers entitled: `Clima 2000: conclusions and perspectives`; `normative approach of the different aspects of ambience comfort`; `progress of the local discomfort evaluation methods`; `towards a global approach of air conditioning of buildings`; `simulation of the energy behaviour of industrial entities. Statement of real actions and methodological evolutions`; `modeling and simulation: state-of-the-art`; `automatized generation of a thermal and aeraulic simulation in buildings`. (J.S.)

Providing Southern Perspectives on CSR

DEFF Research Database (Denmark)

Jeppesen, Søren; Kothuis, Bas

The article seeks to contribute to the SMEs and CSR literature in developing countries by providing; a) a ‘Southern’ SME perspective, which includes the voices of managers and workers, b) a perspective of CSR, which opens up to informal CSR practices that SMEs undertake, and c) an analysis...... of the key institutional issues affecting the CSR practices of SMEs. It presents perceptions of CSR practices among 21 SMEs in the garment industry in South Africa, based on 40 interviews with managers and 19 interviews with workers through the use of qualitative and quantitative interview frameworks....... It highlights a high degree of similarities between managers and workers, though knowledge of (cognitive level) the concept ‘CSR’ differ considerably. Informal practices are widespread and of key importance to the SMEs, expressed by managers and workers alike. History, industry and manager-workers relations...

Time perspective and smoking, obesity, and exercise in a community sample.

Science.gov (United States)

Guthrie, Lori C; Lessl, Kristen; Ochi, Onyinyechukwu; Ward, Michael M

2013-03-01

To examine associations between time perspective and smoking, body mass index, and exercise. In this community-based survey, adults reported smoking and exercise habits and weight and height and completed the Zimbardo Time Perspective Inventory. Subjects (N=265) who were more future oriented reported more frequent exercise, but were more likely to smoke. Fatalistic and hedonistic present orientations were not associated with smoking, obesity, or exercise. Time perspective is not consistently associated with common health behaviors in adults.

Nuclear waste issues: a perspectives document

International Nuclear Information System (INIS)

Cohen, J.J.; Smith, C.F.; Ciminese, F.J.

1983-02-01

This report contains the results of systematic survey of perspectives on the question of radioactive waste management. Sources of information for this review include the scientific literature, regulatory and government documents, pro-nuclear and anti-nuclear publications, and news media articles. In examining the sources of information, it has become evident that a major distinction can be made between the optimistic or positive viewpoints, and the pessimistic or negative ones. Consequently, these form the principal categories for presentation of the perspectives on the radioactive waste management problem have been further classified as relating to the following issue areas: the physical aspects of radiation, longevity, radiotoxicity, the quantity of radioactive wastes, and perceptual factors

Nuclear waste issues: a perspectives document

Energy Technology Data Exchange (ETDEWEB)

Cohen, J.J.; Smith, C.F.; Ciminese, F.J.

1983-02-01

This report contains the results of systematic survey of perspectives on the question of radioactive waste management. Sources of information for this review include the scientific literature, regulatory and government documents, pro-nuclear and anti-nuclear publications, and news media articles. In examining the sources of information, it has become evident that a major distinction can be made between the optimistic or positive viewpoints, and the pessimistic or negative ones. Consequently, these form the principal categories for presentation of the perspectives on the radioactive waste management problem have been further classified as relating to the following issue areas: the physical aspects of radiation, longevity, radiotoxicity, the quantity of radioactive wastes, and perceptual factors.

A designer’s view: the perspective of form and function

NARCIS (Netherlands)

Boerwinkel, D.J.; Waarlo, A.J.; Boersma, K.

2009-01-01

Perspectives are domain-specific strategies employed by experts in a specific field to formulate and investigate questions. Such strategies may therefore serve as good models for acquiring knowledge. Based on this premise, we developed the perspective of form and function, as used by both biologists

An integrative discourse perspective on positive leadership in public health care.

Science.gov (United States)

Pietiläinen, Ville; Salmi, Ilkka

2017-02-06

Purpose This study aims to take a discursive view on positive leadership (PL). A positive approach has gained momentum in recent years as appropriate leadership practices are implemented in organizations. Despite the turn toward discursive approaches in organization studies, there is insufficient evidence supporting PL as a socially constructed experience. Design/methodology/approach The present study addresses an integrative discourse perspective for capturing the PL concept as a social process within the public health-care context. Findings Four meanings of PL are highlighted: role-taking, servicing, balancing and deciphering. Research limitations/implications The meanings shift the emphasis of certain PL definitions to a contextual interpretation. For scholars, the perspective demonstrates a multidimensional process approach in the desired organizational context as a counterbalance to one unanimously agreed-upon PL definition. Practical implications For leaders, an integrative discourse perspective offers tools for comprehending PL as a process: how to identify, negotiate and reconcile various PL meanings. Originality/value An integrative discourse perspective provides a novel perspective capturing the PL concept within the public health-care field.

Terrorism in Pakistan: a behavioral sciences perspective.

Science.gov (United States)

Nizami, Asad Tamizuddin; Rana, Mowadat Hussain; Hassan, Tariq Mahmood; Minhas, Fareed Aslam

2014-01-01

This article reviews the behavioral science perspectives of terrorism in Pakistan. It can be argued that Pakistan has gained worldwide attention for "terrorism" and its role in the "war against terrorism". The region is well placed geopolitically for economic successes but has been plagued by terrorism in various shapes and forms. A behavioral sciences perspective of terrorism is an attempt to explain it in this part of the world as a complex interplay of historical, geopolitical, anthropological and psychosocial factors and forces. Drawing from theories by Western scholars to explain the behavioral and cognitive underpinnings of a terrorist mind, the authors highlight the peculiarities of similar operatives at individual and group levels. Thorny issues related to the ethical and human right dimensions of the topic are visited from the unique perspective of a society challenged by schisms and divergence of opinions at individual, family, and community levels. The authors have attempted to minimize the political descriptions, although this cannot be avoided entirely, because of the nature of terrorism. Copyright © 2014 John Wiley & Sons, Ltd.

Unique Perspectives on a Transforming Energy Economy: 2014 Annual Report (Brochure)

Energy Technology Data Exchange (ETDEWEB)

Gossett, S. [National Renewable Energy Lab. (NREL), Golden, CO (United States)

2014-03-01

What makes JISEA unique? Unique perspectives. This brochure highlights the unique perspectives provided by the Joint Institute for Strategic Energy Analysis through JISEA's recent accomplishments and the people behind them.

Perspectives in Education: Submissions

African Journals Online (AJOL)

In addition to the Perspectives in Education, Volume 26(4), December 2008 conventional book review format, ... PiE invites short reports on any aspect of theory and practice in academia. ... Name(s) of the author(s), title(s), and affiliation(s) (should not be disclosed in the text). The user ... Unpublished theses or dissertations:.

Flexible spatial perspective-taking: conversational partners weigh multiple cues in collaborative tasks.

Science.gov (United States)

Galati, Alexia; Avraamides, Marios N

2013-01-01

Research on spatial perspective-taking often focuses on the cognitive processes of isolated individuals as they adopt or maintain imagined perspectives. Collaborative studies of spatial perspective-taking typically examine speakers' linguistic choices, while overlooking their underlying processes and representations. We review evidence from two collaborative experiments that examine the contribution of social and representational cues to spatial perspective choices in both language and the organization of spatial memory. Across experiments, speakers organized their memory representations according to the convergence of various cues. When layouts were randomly configured and did not afford intrinsic cues, speakers encoded their partner's viewpoint in memory, if available, but did not use it as an organizing direction. On the other hand, when the layout afforded an intrinsic structure, speakers organized their spatial memories according to the person-centered perspective reinforced by the layout's structure. Similarly, in descriptions, speakers considered multiple cues whether available a priori or at the interaction. They used partner-centered expressions more frequently (e.g., "to your right") when the partner's viewpoint was misaligned by a small offset or coincided with the layout's structure. Conversely, they used egocentric expressions more frequently when their own viewpoint coincided with the intrinsic structure or when the partner was misaligned by a computationally difficult, oblique offset. Based on these findings we advocate for a framework for flexible perspective-taking: people weigh multiple cues (including social ones) to make attributions about the relative difficulty of perspective-taking for each partner, and adapt behavior to minimize their collective effort. This framework is not specialized for spatial reasoning but instead emerges from the same principles and memory-depended processes that govern perspective-taking in non-spatial tasks.

Caregiver perspective on pediatric attention-deficit/hyperactivity disorder: medication satisfaction and symptom control

Directory of Open Access Journals (Sweden)

Fridman M

2017-02-01

Full Text Available Moshe Fridman,1 Tobias Banaschewski,2 Vanja Sikirica,3 Javier Quintero,4 M Haim Erder,3 Kristina S Chen5 1AMF Consulting, Inc., Los Angeles, CA, USA; 2Department of Child and Adolescent Psychiatry and Psychotherapy, Central Institute of Mental Health, Medical Faculty Mannheim of the University of Heidelberg, Mannheim, Germany; 3Global Health Economics Outcomes Research and Epidemiology, Shire, Wayne, PA, USA; 4Psychiatry Department, Hospital Universitario Infanta Leonor, Complutense University, Madrid, Spain; 5Global Health Economics Outcomes Research and Epidemiology, Shire, Lexington, MA, USA Abstract: The caregiver perspective on pediatric attention-deficit/hyperactivity disorder (ADHD study (CAPPA was a web-based, cross-sectional survey of caregivers of children and adolescents (6–17 years of age with ADHD and was conducted in 10 European countries. CAPPA included caregiver assessments of global medication satisfaction, global symptom control, and satisfaction with ADHD medication attributes. Overall, 2,326 caregiver responses indicated that their child or adolescent was currently receiving ADHD medication and completed the “off medication” assessment required for inclusion in the present analyses. Responses to the single-item global medication satisfaction question indicated that 88% were satisfied (moderately satisfied to very satisfied with current medication and 18% were “very satisfied” on the single-item question. Responses to the single-item global symptom control question indicated that 47% and 19% of caregivers considered their child or adolescent’s symptoms to be “controlled” or “very well controlled”, respectively. Significant variations in response to the questions of medication satisfaction and symptom control were observed between countries. The correlation between the global medication satisfaction and global symptom control questions was 0.677 (P<0.001. Global medication satisfaction was significantly

Implementation of Provider Perspectives Resulted in Proper Health Care Resource Utilization

National Research Council Canada - National Science Library

Mclean, Hugh

2001-01-01

.... One such system is Provider Perspectives. This study shows that Provider Perspectives significantly decreased Emergency Room utilization and subsequently increased the usage of primary care clinics at Martin Army Community Hospital and Winn...

Differential Effects of Oxytocin on Visual Perspective Taking for Men and Women

Directory of Open Access Journals (Sweden)

Tong Yue

2017-11-01

Full Text Available Although oxytocin (OXT has been shown to lead to reduced self-orientation, no study to date has directly and effectively weakened the egocentric tendencies in perspective taking tasks for both men and women. In this double-blind, placebo-controlled, mixed design study we investigated the effects of OXT on men and women in visual perspective taking tasks. The results showed that OXT shortened the differences in response time between men and women in all experimental conditions. In addition, after OXT administration, the difference in reaction time between judging from one's own perspective and judging from others' perspectives decreased in female participants; however, this effect was not present in males. This may indicate that under OXT treatment, women have a higher tendency to overcome interference from their position and mindset when judging others' perspectives. However, OXT did not affect participants' accuracy, which is possibility because the used task was not suited to detect performance improvements caused by OXT. In summary, the above results may indicate that OXT could increase perspective-taking abilities through reducing self-bias and increasing the perception of others; furthermore, this trend mainly affected women rather than men.

Differential Effects of Oxytocin on Visual Perspective Taking for Men and Women.

Science.gov (United States)

Yue, Tong; Jiang, Yuhan; Yue, Caizhen; Huang, Xiting

2017-01-01

Although oxytocin (OXT) has been shown to lead to reduced self-orientation, no study to date has directly and effectively weakened the egocentric tendencies in perspective taking tasks for both men and women. In this double-blind, placebo-controlled, mixed design study we investigated the effects of OXT on men and women in visual perspective taking tasks. The results showed that OXT shortened the differences in response time between men and women in all experimental conditions. In addition, after OXT administration, the difference in reaction time between judging from one's own perspective and judging from others' perspectives decreased in female participants; however, this effect was not present in males. This may indicate that under OXT treatment, women have a higher tendency to overcome interference from their position and mindset when judging others' perspectives. However, OXT did not affect participants' accuracy, which is possibility because the used task was not suited to detect performance improvements caused by OXT. In summary, the above results may indicate that OXT could increase perspective-taking abilities through reducing self-bias and increasing the perception of others; furthermore, this trend mainly affected women rather than men.

Coping Strategies in Late Adolescence: Relationships to Parental Attachment and Time Perspective.

Science.gov (United States)

Blomgren, Anna-Sara; Svahn, Kajsa; Åström, Elisabeth; Rönnlund, Michael

2016-01-01

The authors investigated adolescents' use of coping strategies in relation to attachment to parents and time perspective. Adolescents in Grade 3 upper secondary school (M age = 18.3 years, SD = 0.6 years; n = 160) completed the Inventory of Parent and Peer Attachment, the Zimbardo Time Perspective Inventory, and the Brief COPE. Correlational analyses showed that attachment to parents was associated with a more favorable view of the past (higher past positive and lower past negative), a less fatalistic view of the present, and a more favorable view of the future (higher future positive and lower future negative). Parental attachment accounted for significant variance in composite coping scores (adaptive and maladaptive) when entered before, but not after, time perspective subscales in hierarchical regression analyses. However, time perspective (mainly present hedonistic and positive or negative future) predicted adaptive or maladaptive coping over and beyond attachment. The results are consistent with the hypothesis that most of the relationship between adolescents' attachment to parents and coping is mediated by individual differences in time perspective. By contrast, factors other than attachment to parents (e.g., temperament) must be considered to fully account for the relationship between time perspective and coping.

Radiation curing - a personal perspective

International Nuclear Information System (INIS)

Pappas, S.P.

1992-01-01

This chapter briefly introduces radiation curing from the personal perspective of the author. Topics covered in this chapter include characteristic features of radiation curing, photoinitiated polymerization -- ultraviolet (UV) curing, and general principles of electron beam (EB) curing. 57 refs., 2 tabs

Psychometric perspectives on diagnostic systems

NARCIS (Netherlands)

Borsboom, D.

2008-01-01

The author identifies four conceptualizations of the relation between symptoms and disorders as utilized in diagnostic systems such as the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV; American Psychiatric Association, 1994): A constructivist perspective, which holds

Teachers' Perceptions of Disruptive Behaviour in Schools: A Psychological Perspective

Science.gov (United States)

Nash, Poppy; Schlösser, Annette; Scarr, Tanya

2016-01-01

This article reports on an investigation into school teachers' perceptions of disruptive behaviour from a psychological perspective. The inter-disciplinary nature of this research bridges the understanding between educational and psychological perspectives on disruptive behaviour. This article discusses evidence that for the most troubled pupils,…

How public relations works: theoretical roots and public relations perspectives

NARCIS (Netherlands)

Ihlen, Ø.; van Ruler, B.

2007-01-01

Public relations is often studied from a managerial, instrumental perspective or a psychological, behavioral perspective. To understand the role of public relations in building trust or mistrust and to develop - or destroy - a license to operate, it needs also to be studied as a social phenomenon.

Prospective Secondary Mathematics Teachers' Perspectives and Mathematical Knowledge for Teaching

Science.gov (United States)

Karagöz-Akar, Gülseren

2016-01-01

This study investigated the relationship between prospective secondary mathematics teachers' perspectives and their mathematical knowledge for teaching in action. Data from two prospective teachers' practice-teachings, one in geometry and one in algebra, their lesson plans and self-reflections were analyzed with Teacher Perspectives and Knowledge…

The effects of perspective-taking on prejudice: the moderating role of self-evaluation.

Science.gov (United States)

Galinsky, Adam D; Ku, Gillian

2004-05-01

Perspective-taking, by means of creating an overlap between self and other cognitive representations, has been found to effectively decrease stereotyping and ingroup favoritism. In the present investigation, the authors examined the potential moderating role of self-esteem on the effects of perspective-taking on prejudice. In two experiments, it was found that perspective-takers, but not control participants, with temporarily or chronically high self-esteem evaluated an outgroup more positively than perspective-takers with low self-esteem. This finding suggests an irony of perspective-taking: it builds off egocentric biases to improve outgroup evaluations. The discussion focuses on how debiasing intergroup thought is often best accomplished by working through the very processes that produced the bias in the first place.

Perception through a Perspective-Taking Lens: Differential Effects on Judgment and Behavior

OpenAIRE

Ku , Gillian; Wang , Cynthia S.; Galinsky , Adam D.

2010-01-01

International audience; In contrast to the view that social perception has symmetric effects on judgments and behavior, the current research explored whether perspective-taking leads stereotypes to differentially affect judgments and behavior. Across three studies, perspective-takers consistently used stereotypes more in their own behavior while simultaneously using them less in their judgments of others. After writing about an African American, perspective-taking tendencies were positively c...

The Role of Present Time Perspective in Predicting Early Adolescent Violence.

Science.gov (United States)

Kruger, Daniel J; Carrothers, Jessica; Franzen, Susan P; Miller, Alison L; Reischl, Thomas M; Stoddard, Sarah A; Zimmerman, Marc A

2018-06-01

This study investigated the role of present and future time perspectives, and their relationships with subjective norms and beliefs regarding violence, in predicting violent behaviors among urban middle school students in the Midwestern United States. Although present time perspective covaried with subjective norms and beliefs, each made a unique prediction of self-reported violent behaviors. Future time perspective was not a significant predictor when accounting for these relationships. In addition, present orientation moderated the relationship between subjective norms and beliefs and rates of violent behaviors; those with higher present orientations exhibited stronger associations. We replicated this pattern of results in data from new participants in a subsequent wave of the study. Interventions that explicitly address issues related to time perspective may be effective in reducing early adolescent violence.

Nanomanufacturing-Perspective and applications

DEFF Research Database (Denmark)

Fang, F. Z.; Zhang, X. D.; Gao, W.W.

2017-01-01

. These include a cluster of various techniques such as nanomachining, nanofabrication, and nanometrology to produce nanotechnology components and conduct evaluation. This paper mainly focuses on the manufacturing methods for complex shapes or structures, such as textures on curves and hierarchical structures......, and outlines the research perspectives and the current application status of nanomanufacturing fundamentals and key technologies....

Value Co-creation from the Consumer Perspective

Science.gov (United States)

Baron, Steve; Warnaby, Gary

The paper provides the basis for a classification of organizational operant resources as seen from a customer perspective. It facilitates, particularly, research and further understanding of Foundational Premise 9 (FP9) of the service-dominant logic of marketing (i.e. all social and economic actors are resource integrators), and suggests areas for more focused research on other foundational premises relating to value co-creation. It is based on research undertaken for, and with, the British Library, and offers an alternative research approach to the more conventional ­customer satisfaction survey in order to ascertain value from a ­consumer perspective.

Parent Perspectives on the Individual Education Program Process and Product for the Child with Autism

Science.gov (United States)

Brandt, Camille M.

2011-01-01

This study examined the perspectives of parents of children with autism receiving special education services in an upper Midwestern state. This study sought to determine parent perspectives of priorities for the child's IEP, parent perspectives of content of the child's IEP, and parent perspectives of their experiences at the school, comfort level…

Integrative Perspectives of Academic Motivation

Science.gov (United States)

Chittum, Jessica Rebecca

My overall objective in this dissertation was to develop more integrative perspectives of several aspects of academic motivation. Rarely have researchers and theorists examined a more comprehensive model of academic motivation that pools multiple constructs that interact in a complex and dynamic fashion (Kaplan, Katz, & Flum, 2012; Turner, Christensen, Kackar-Cam, Trucano, & Fulmer, 2014). The more common trend in motivation research and theory has been to identify and explain only a few motivation constructs and their linear relationships rather than examine complex relationships involving "continuously emerging systems of dynamically interrelated components" (Kaplan et al., 2014, para. 4). In this dissertation, my co-author and I focused on a more integrative perspective of academic motivation by first reviewing varying characterizations of one motivation construct (Manuscript 1) and then empirically testing dynamic interactions among multiple motivation constructs using a person-centered methodological approach (Manuscript 2). Within the first manuscript (Chapter 2), a theoretical review paper, we summarized multiple perspectives of the need for autonomy and similar constructs in academic motivation, primarily autonomy in self-determination theory, autonomy supports, and choice. We provided an integrative review and extrapolated practical teaching implications. We concluded with recommendations for researchers and instructors, including a call for more integrated perspectives of academic motivation and autonomy that focus on complex and dynamic patterns in individuals' motivational beliefs. Within the second manuscript (Chapter 3), we empirically investigated students' motivation in science class as a complex, dynamic, and context-bound phenomenon that incorporates multiple motivation constructs. Following a person-centered approach, we completed cluster analyses of students' perceptions of 5 well-known motivation constructs (autonomy, utility value, expectancy

Cultural values and diversity management perspectives : Testing the impact of cultural values on the diversity management perspectives in Sierra Leone, Germany and Finland

OpenAIRE

Mattila, Linda

2016-01-01

Cultural values impact the attitudes towards diversity management perspectives. Therefore they convey critical opportunities and challenges that a country encounters, and which need to be identified for the successful implementation of diversity management initiatives. This thesis discusses the different diversity management perspectives and their motivations and rationales to diversify and the process in which the national culture influences the organizational culture practices. The ...

Vehicle/Guideway Interaction in Maglev Systems

Science.gov (United States)

1992-03-01

Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1

Untitled

Indian Academy of Sciences (India)

20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.

75 FR 7358 - Addition of Certain Persons to the Entity List: Addition of Persons Acting Contrary to the...

Science.gov (United States)

2010-02-19

... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...

Ethical Perspectives on the Current Controversy Regarding Openness in Adoption.

Science.gov (United States)

Tavis, Timothy M.

This paper outlines current changes in American adoption practice and the controversies surrounding these changes. It includes a discussion of the role that neo-Kantian and utilitarian perspectives have played in American adoption policy and practice, and offers an alternative, the communitarian perspective, described by Sandel (1984). Adoption…