Siettos, Constantinos I.; Anastassopoulou, Cleo; Russo, Lucia; Grigoras, Christos; Mylonakis, Eleftherios
2016-06-01
Based on multiscale agent-based computations we estimated the per-contact probability of transmission by age of the Ebola virus disease (EVD) that swept through Liberia from May 2014 to March 2015. For the approximation of the epidemic dynamics we have developed a detailed agent-based model with small-world interactions between individuals categorized by age. For the estimation of the structure of the evolving contact network as well as the per-contact transmission probabilities by age group we exploited the so called Equation-Free framework. Model parameters were fitted to official case counts reported by the World Health Organization (WHO) as well as to recently published data of key epidemiological variables, such as the mean time to death, recovery and the case fatality rate.
Manlove, Kezia R; Cassirer, E Frances; Plowright, Raina K; Cross, Paul C; Hudson, Peter J
2017-07-01
Understanding both contact and probability of transmission given contact are key to managing wildlife disease. However, wildlife disease research tends to focus on contact heterogeneity, in part because the probability of transmission given contact is notoriously difficult to measure. Here, we present a first step towards empirically investigating the probability of transmission given contact in free-ranging wildlife. We used measured contact networks to test whether bighorn sheep demographic states vary systematically in infectiousness or susceptibility to Mycoplasma ovipneumoniae, an agent responsible for bighorn sheep pneumonia. We built covariates using contact network metrics, demographic information and infection status, and used logistic regression to relate those covariates to lamb survival. The covariate set contained degree, a classic network metric describing node centrality, but also included covariates breaking the network metrics into subsets that differentiated between contacts with yearlings, ewes with lambs, and ewes without lambs, and animals with and without active infections. Yearlings, ewes with lambs, and ewes without lambs showed similar group membership patterns, but direct interactions involving touch occurred at a rate two orders of magnitude higher between lambs and reproductive ewes than between any classes of adults or yearlings, and one order of magnitude higher than direct interactions between multiple lambs. Although yearlings and non-reproductive bighorn ewes regularly carried M. ovipneumoniae, our models suggest that a contact with an infected reproductive ewe had approximately five times the odds of producing a lamb mortality event of an identical contact with an infected dry ewe or yearling. Consequently, management actions targeting infected animals might lead to unnecessary removal of young animals that carry pathogens but rarely transmit. This analysis demonstrates a simple logistic regression approach for testing a priori
Models of epidemics: when contact repetition and clustering should be included
Directory of Open Access Journals (Sweden)
Scholz Roland W
2009-06-01
Full Text Available Abstract Background The spread of infectious disease is determined by biological factors, e.g. the duration of the infectious period, and social factors, e.g. the arrangement of potentially contagious contacts. Repetitiveness and clustering of contacts are known to be relevant factors influencing the transmission of droplet or contact transmitted diseases. However, we do not yet completely know under what conditions repetitiveness and clustering should be included for realistically modelling disease spread. Methods We compare two different types of individual-based models: One assumes random mixing without repetition of contacts, whereas the other assumes that the same contacts repeat day-by-day. The latter exists in two variants, with and without clustering. We systematically test and compare how the total size of an outbreak differs between these model types depending on the key parameters transmission probability, number of contacts per day, duration of the infectious period, different levels of clustering and varying proportions of repetitive contacts. Results The simulation runs under different parameter constellations provide the following results: The difference between both model types is highest for low numbers of contacts per day and low transmission probabilities. The number of contacts and the transmission probability have a higher influence on this difference than the duration of the infectious period. Even when only minor parts of the daily contacts are repetitive and clustered can there be relevant differences compared to a purely random mixing model. Conclusion We show that random mixing models provide acceptable estimates of the total outbreak size if the number of contacts per day is high or if the per-contact transmission probability is high, as seen in typical childhood diseases such as measles. In the case of very short infectious periods, for instance, as in Norovirus, models assuming repeating contacts will also behave
Bacterial adhesion forces to Ag-impregnated contact lens cases and transmission to contact lenses.
Qu, Wenwen; Busscher, Henk J; van der Mei, Henny C; Hooymans, Johanna M M
2013-03-01
To measure adhesion forces of Pseudomonas aeruginosa, Staphylococcus aureus, and Serratia marcescens to a rigid contact lens (CL), standard polypropylene, and Ag-impregnated lens cases using atomic force microscopy and determine bacterial transmission from lens case to CL. Adhesion forces of bacterial strains to Ag-impregnated and polypropylene lens cases and a rigid CL were measured using atomic force microscopy. Adhesion forces were used to calculate Weibull distributions, from which transmission probabilities from lens case to CL were derived. Transmission probabilities were compared with actual transmission of viable bacteria from a lens case to the CL in 0.9% NaCl and in an antimicrobial lens care solution. Bacterial transmission probabilities from polypropylene lens cases based on force analysis coincided well for all strains with actual transmission in 0.9% NaCl. Bacterial adhesion forces on Ag-impregnated lens cases were much smaller than that on polypropylene and CLs, yielding a high probability of transmission. Comparison with actual bacterial transmission indicated bacterial killing due to Ag ions during colony-forming unit transmission from an Ag-impregnated lens case, especially for P. aeruginosa. Transmission of viable bacteria from Ag-impregnated lens cases could be further decreased by use of an antimicrobial lens care solution instead of 0.9% NaCl. Bacterial transmission probabilities are higher from Ag-impregnated lens cases than from polypropylene lens cases because of small adhesion forces, but this is compensated for by enhanced bacterial killing due to Ag impregnation, especially when in combination with an antimicrobial lens care solution. This calls for a balanced combination of antimicrobial lens care solutions and surface properties of a lens case and CL.
Qu, Wenwen; Hooymans, Johanna M M; Qiu, Jun; de-Bont, Nik; Gelling, Onko-Jan; van der Mei, Henny C; Busscher, Henk J
2013-05-01
Surface properties of lens cases are determinant for their cleanability and for microbial transmission from lens cases to contact lenses (CLs). PEG-polymer-brush-coatings are known to decrease microbial adhesion more than other surface-coatings. Here, we applied a robust, silica nanoparticles-based brush-coating to polypropylene cases to evaluate their ease of cleaning and probability of bacterial transmission to CLs. Adhesion forces of nine bacterial strains (Pseudomonas, Staphylococci, and Serratia) to rigid CLs, polypropylene, and silica nanoparticles-based brush-coated polypropylene were measured using atomic-force-microscopy and subjected to Weibull analyses to yield bacterial transmission probabilities. Biofilms of each strain were grown in coated and uncoated cases and rinsed with a NaCl or antimicrobial lens care solution. Residual, viable organisms were quantified. Bacterial adhesion forces of all strains were significantly, up to tenfold smaller on brush-coated than on uncoated polypropylene. This yielded, higher transmission probabilities to a CL, but mild-rinsing yielded 10-100 fold higher removal of bacteria from brush-coated than from polypropylene cases. Moreover, due to weak adhesion forces, bacteria on brush-coated cases were two-to-three fold more susceptible to an antimicrobial lens care solution than on polypropylene cases. Therewith, the design of lens case surfaces is a compromise between ease of cleaning and transmission probability to CLs. Copyright © 2013 Wiley Periodicals, Inc.
Virus isolation: Specimen type and probable transmission
Indian Academy of Sciences (India)
First page Back Continue Last page Overview Graphics. Virus isolation: Specimen type and probable transmission. Over 500 CHIK virus isolations were made. 4 from male Ae. Aegypti (?TOT). 6 from CSF (neurological involvement). 1 from a 4-day old child (transplacental transmission.
Transmission of vibration through gloves: effects of contact area.
Md Rezali, Khairil Anas; Griffin, Michael J
2017-01-01
For three samples of material (12.5, 25.0 and 37.5 mm diameter) from each of three gloves, the dynamic stiffnesses and the vibration transmissibilities of the materials (to both the palm of the hand and the thenar eminence) were measured at frequencies from 10 to 300 Hz. Additional measurements showed the apparent masses of the hand at the palm and the thenar eminence were independent of contact area at frequencies less than about 40 Hz, but increased with increasing area at higher frequencies. The stiffness and damping of the glove materials increased with increasing area. These changes caused material transmissibilities to the hand to increase with increasing area. It is concluded that the size of the area of contact has a large influence on the transmission of vibration through a glove to the hand. The area of contact should be well-defined and controlled when evaluating the transmission of vibration through gloves. Practitioner Summary: The transmission of vibration through gloves depends on both the dynamic stiffness of glove material and the dynamic response of the hand. Both of these depend on the size of the contact area between a glove material and the hand, which should be taken into account when assessing glove transmissibility.
Aiello, Christina M.; Nussear, Kenneth E.; Esque, Todd C.; Emblidge, Patrick G.; Sah, Pratha; Bansal, Shweta; Hudson, Peter J.
2016-01-01
Summary Most directly transmitted infections require some form of close contact between infectious and susceptible hosts to spread. Often disease models assume contacts are equal and use mean field estimates of transmission probability for all interactions with infectious hosts.
Probable Unusual Transmission of Zika Virus
Centers for Disease Control (CDC) Podcasts
This podcast discusses a study about the probable unusual transmission of Zika Virus Infection from a scientist to his wife, published in the May 2011 issue of Emerging Infectious Diseases. Dr. Brian Foy, Associate Professor at Colorado State University, shares details of this event.
Measuring social contacts in the emergency department.
Directory of Open Access Journals (Sweden)
Douglas W Lowery-North
Full Text Available Infectious individuals in an emergency department (ED bring substantial risks of cross infection. Data about the complex social and spatial structure of interpersonal contacts in the ED will aid construction of biologically plausible transmission risk models that can guide cross infection control.We sought to determine the number and duration of contacts among patients and staff in a large, busy ED. This prospective study was conducted between 1 July 2009 and 30 June 2010. Two 12-hour shifts per week were randomly selected for study. The study was conducted in the ED of an urban hospital. There were 81 shifts in the planned random sample of 104 (78% with usable contact data, during which there were 9183 patient encounters. Of these, 6062 (66% were approached to participate, of which 4732 (78% agreed. Over the course of the year, 88 staff members participated (84%. A radiofrequency identification (RFID system was installed and the ED divided into 89 distinct zones structured so copresence of two individuals in any zone implied a very high probability of contact <1 meter apart in space. During study observation periods, patients and staff were given RFID tags to wear. Contact events were recorded. These were further broken down with respect to the nature of the contacts, i.e., patient with patient, patient with staff, and staff with staff. 293,171 contact events were recorded, with a median of 22 contact events and 9 contacts with distinct individuals per participant per shift. Staff-staff interactions were more numerous and longer than patient-patient or patient-staff interactions.We used RFID to quantify contacts between patients and staff in a busy ED. These results are useful for studies of the spread of infections. By understanding contact patterns most important in potential transmission, more effective prevention strategies may be implemented.
Escape and transmission probabilities in cylindrical geometry
International Nuclear Information System (INIS)
Bjerke, M.A.
1980-01-01
An improved technique for the generation of escape and transmission probabilities in cylindrical geometry was applied to the existing resonance cross section processing code ROLAIDS. The algorithm of Hwang and Toppel, [ANL-FRA-TM-118] (with modifications) was employed. The probabilities generated were found to be as accurate as those given by the method previously applied in ROLAIDS, while requiring much less computer core storage and CPU time
Calculating the albedo characteristics by the method of transmission probabilities
International Nuclear Information System (INIS)
Lukhvich, A.A.; Rakhno, I.L.; Rubin, I.E.
1983-01-01
The possibility to use the method of transmission probabilities for calculating the albedo characteristics of homogeneous and heterogeneous zones is studied. The transmission probabilities method is a numerical method for solving the transport equation in the integrated form. All calculations have been conducted as a one-group approximation for the planes and rods with different optical thicknesses and capture-to-scattering ratios. Above calculations for plane and cylindrical geometries have shown the possibility to use the numerical method of transmission probabilities for calculating the albedo characteristics of homogeneous and heterogeneous zones with high accuracy. In this case the computer time consumptions are minimum even with the cylindrical geometry, if the interpolation calculation of characteristics is used for the neutrons of the first path
The transmission probability method in one-dimensional cylindrical geometry
International Nuclear Information System (INIS)
Rubin, I.E.
1983-01-01
The collision probability method widely used in solving the problems of neutron transpopt in a reactor cell is reliable for simple cells with small number of zones. The increase of the number of zones and also taking into account the anisotropy of scattering greatly increase the scope of calculations. In order to reduce the time of calculation the transmission probability method is suggested to be used for flux calculation in one-dimensional cylindrical geometry taking into account the scattering anisotropy. The efficiency of the suggested method is verified using the one-group calculations for cylindrical cells. The use of the transmission probability method allows to present completely angular and spatial dependences is neutrons distributions without the increase in the scope of calculations. The method is especially effective in solving the multi-group problems
Probable Unusual Transmission of Zika Virus
Centers for Disease Control (CDC) Podcasts
2011-05-23
This podcast discusses a study about the probable unusual transmission of Zika Virus Infection from a scientist to his wife, published in the May 2011 issue of Emerging Infectious Diseases. Dr. Brian Foy, Associate Professor at Colorado State University, shares details of this event. Created: 5/23/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID). Date Released: 5/25/2011.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Numerical determination of transmission probabilities in cylindrical geometry
International Nuclear Information System (INIS)
Queiroz Bogado Leite, S. de.
1989-11-01
Efficient methods for numerical calculation of transmission probabilities in cylindrical geometry are presented. Relative errors of the order of 10 -5 or smaller are obtained using analytical solutions and low order quadrature integration schemes. (author) [pt
Evidence for transmission of bluetongue virus serotype 26 through direct contact.
Directory of Open Access Journals (Sweden)
Carrie Batten
Full Text Available The aim of this study was to assess the mechanisms of transmission of bluetongue virus serotype 26 (BTV-26 in goats. A previous study, which investigated the pathogenicity and infection kinetics of BTV-26 in goats, unexpectedly revealed that one control goat may have been infected through a direct contact transmission route. To investigate the transmission mechanisms of BTV-26 in more detail an experimental infection study was carried out in which three goats were infected with BTV-26, three goats were kept uninfected, but were housed in direct contact with the infected goats, and an additional four goats were kept in indirect contact separated from infected goats by metal gates. This barrier allowed the goats to have occasional face-to-face contact in the same airspace, but feeding, watering, sampling and environmental cleaning was carried out separately. The three experimentally infected goats did not show clinical signs of BTV, however high levels of viral RNA were detected and virus was isolated from their blood. At 21 dpi viral RNA was detected in, and virus was isolated from the blood of the three direct contact goats, which also seroconverted. The four indirect barrier contact goats remained uninfected throughout the duration of the experiment. In order to assess replication in a laboratory model species of Culicoides biting midge, more than 300 Culicoides sonorensis were fed a BTV-26 spiked blood meal and incubated for 7 days. The dissemination of BTV-26 in individual C. sonorensis was inferred from the quantity of virus RNA and indicated that none of the insects processed at day 7 possessed transmissible infections. This study shows that BTV-26 is easily transmitted through direct contact transmission between goats, and the strain does not seem to replicate in C. sonorensis midges using standard incubation conditions.
Ma, Mai-Juan; Yang, Yang; Wang, Hai-Bin; Zhu, Yi-Fan; Fang, Li-Qun; An, Xiao-Ping; Wan, Kang-Lin; Whalen, Christopher C.; Yang, Xiao-Xian; Lauzardo, Michael; Zhang, Zhi-Yi; Cao, Jin-Feng; Tong, Yi-Gang; Dai, Er-Hei; Cao, Wu-Chun
2015-01-01
Tuberculosis (TB) outbreak occurred in a boarding middle school of China. We explored its probable sources and quantified the transmissibility and pathogenicity of TB. Clinical evaluation, tuberculin skin testing and chest radiography were conducted to identify TB cases. Mycobacterium tuberculosis isolates underwent genotyping analysis to identify the outbreak source. A chain-binomial transmission model was used to evaluate transmissibility and pathogenicity of TB. A total of 46 active cases were ascertained among 258 students and 15 teachers/staff, an attack rate of 16.8%. Genetic analyses revealed two groups of M. tuberculosis cocirculating during the outbreak and possible importation from local communities. Secondary attack rates among students were 4.1% (2.9%, 5.3%) within grade and 7.9% (4.9%, 11%) within class. An active TB case was estimated to infect 8.4 (7.2, 9.6) susceptible people on average. The smear-positive cases were 28 (8, 101) times as infective as smear-negative cases. Previous BCG vaccination could reduce the probability of developing symptoms after infection by 70% (1.4%, 91%). The integration of clinical evaluation, genetic sequencing, and statistical modeling greatly enhanced our understanding of TB transmission dynamics. Timely diagnosis of smear-positive cases, especially in the early phase of the outbreak, is the key to preventing further spread among close contacts. PMID:25757905
Minimising the risk of prion transmission by contact tonometry.
Amin, S Z; Smith, L; Luthert, P J; Cheetham, M E; Buckley, R J
2003-11-01
The unknown prevalence of variant Creutzfeldt-Jakob disease (vCJD) in the UK population has led to fears of horizontal transmission through routine medical procedures. The potential risk of transmission via contact tonometry was examined. The total amount of protein carried over by tonometer tips after applanation of patients was assessed. Tonometer tips had an inherent ability to carry proteinaceous material. There was a large variability in the load carried over between individual patients. Rinsing tonometer tips in water reduced protein carryover. Wiping the tonometer tips also reduced carriage, though less dramatically. There is a small theoretical risk of transmission of vCJD by contact tonometry through reuse, but this should be reduced if the prisms are washed and wiped. In the light of these findings a protocol for the management of reusable tonometer prisms is recommended.
International Nuclear Information System (INIS)
Wu Suzhi; Li Ning; Jin Guojun; Ma Yuqiang
2008-01-01
Persistent current and transmission probability in the Aharonov-Bohm (AB) ring with an embedded quantum dot (QD) are studied using the technique of the scattering matrix. For the first time, we find that the persistent current can arise in the absence of magnetic flux in the ring with an embedded QD. The persistent current and the transmission probability are sensitive to the lead-ring coupling and the short-range potential barrier. It is shown that increasing the lead-ring coupling or the short-range potential barrier causes the suppression of the persistent current and the increasing resonance width of the transmission probability. The effect of the potential barrier on the number of the transmission peaks is also investigated. The dependence of the persistent current and the transmission probability on the magnetic flux exhibits a periodic property with period of the flux quantum
Aiello, Christina M.; Esque, Todd; Nussear, K. E.; Emblidge, P. G.; Hudson, P. J.
2018-01-01
Interactions between wildlife hosts act as transmission routes for directly transmitted pathogens and vary in ways that affect transmission efficiency. Identifying drivers of contact variation can allow both contact inference and estimation of transmission dynamics despite limited data. In desert tortoises, mating strategy, burrow use and seasonal change influence numerous behaviours and likely shape contact patterns. In this study, we ask to what extent tortoise contact behaviour varies between sexes and seasons, and whether space or burrow-use data can be used to infer contact characteristics consistent with those recorded by proximity loggers. We identified sex and season-biased contact behaviour in both wild and captive populations indicative of female-female avoidance and seasonal male mate-seeking behaviour. Space and burrow-use patterns were informative, but did not always predict the extent of sex or seasonal biases on contact. We discuss the implications these findings have for transmission patterns and disease mitigation in tortoise populations.
Contact tracing of tuberculosis: a systematic review of transmission modelling studies.
Directory of Open Access Journals (Sweden)
Matt Begun
Full Text Available The WHO recommended intervention of Directly Observed Treatment, Short-course (DOTS appears to have been less successful than expected in reducing the burden of TB in some high prevalence settings. One strategy for enhancing DOTS is incorporating active case-finding through screening contacts of TB patients as widely used in low-prevalence settings. Predictive models that incorporate population-level effects on transmission provide one means of predicting impacts of such interventions. We aim to identify all TB transmission modelling studies addressing contact tracing and to describe and critically assess their modelling assumptions, parameter choices and relevance to policy. We searched MEDLINE, SCOPUS, COMPENDEX, Google Scholar and Web of Science databases for relevant English language publications up to February 2012. Of the 1285 studies identified, only 5 studies met our inclusion criteria of models of TB transmission dynamics in human populations designed to incorporate contact tracing as an intervention. Detailed implementation of contact processes was only present in two studies, while only one study presented a model for a high prevalence, developing world setting. Some use of relevant data for parameter estimation was made in each study however validation of the predicted impact of interventions was not attempted in any of the studies. Despite a large body of literature on TB transmission modelling, few published studies incorporate contact tracing. There is considerable scope for future analyses to make better use of data and to apply individual based models to facilitate more realistic patterns of infectious contact. Combined with a focus on high burden settings this would greatly increase the potential for models to inform the use of contract tracing as a TB control policy. Our findings highlight the potential for collaborative work between clinicians, epidemiologists and modellers to gather data required to enhance model development
Contact tracing of tuberculosis: a systematic review of transmission modelling studies.
Begun, Matt; Newall, Anthony T; Marks, Guy B; Wood, James G
2013-01-01
The WHO recommended intervention of Directly Observed Treatment, Short-course (DOTS) appears to have been less successful than expected in reducing the burden of TB in some high prevalence settings. One strategy for enhancing DOTS is incorporating active case-finding through screening contacts of TB patients as widely used in low-prevalence settings. Predictive models that incorporate population-level effects on transmission provide one means of predicting impacts of such interventions. We aim to identify all TB transmission modelling studies addressing contact tracing and to describe and critically assess their modelling assumptions, parameter choices and relevance to policy. We searched MEDLINE, SCOPUS, COMPENDEX, Google Scholar and Web of Science databases for relevant English language publications up to February 2012. Of the 1285 studies identified, only 5 studies met our inclusion criteria of models of TB transmission dynamics in human populations designed to incorporate contact tracing as an intervention. Detailed implementation of contact processes was only present in two studies, while only one study presented a model for a high prevalence, developing world setting. Some use of relevant data for parameter estimation was made in each study however validation of the predicted impact of interventions was not attempted in any of the studies. Despite a large body of literature on TB transmission modelling, few published studies incorporate contact tracing. There is considerable scope for future analyses to make better use of data and to apply individual based models to facilitate more realistic patterns of infectious contact. Combined with a focus on high burden settings this would greatly increase the potential for models to inform the use of contract tracing as a TB control policy. Our findings highlight the potential for collaborative work between clinicians, epidemiologists and modellers to gather data required to enhance model development and validation and
Bacterial Adhesion Forces to Ag-Impregnated Contact Lens Cases and Transmission to Contact Lenses
Qu, Wenwen; Busscher, Henk J.; van der Mei, Henny C.; Hooymans, Johanna M. M.
Purpose: To measure adhesion forces of Pseudomonas aeruginosa, Staphylococcus aureus, and Serratia marcescens to a rigid contact lens (CL), standard polypropylene, and Ag-impregnated lens cases using atomic force microscopy and determine bacterial transmission from lens case to CL. Methods: Adhesion
Frise, Rebecca; Bradley, Konrad; van Doremalen, Neeltje; Galiano, Monica; Elderfield, Ruth A.; Stilwell, Peter; Ashcroft, Jonathan W.; Fernandez-Alonso, Mirian; Miah, Shahjahan; Lackenby, Angie; Roberts, Kim L.; Donnelly, Christl A.; Barclay, Wendy S.
2016-01-01
Influenza viruses cause annual seasonal epidemics and occasional pandemics. It is important to elucidate the stringency of bottlenecks during transmission to shed light on mechanisms that underlie the evolution and propagation of antigenic drift, host range switching or drug resistance. The virus spreads between people by different routes, including through the air in droplets and aerosols, and by direct contact. By housing ferrets under different conditions, it is possible to mimic various routes of transmission. Here, we inoculated donor animals with a mixture of two viruses whose genomes differed by one or two reverse engineered synonymous mutations, and measured the transmission of the mixture to exposed sentinel animals. Transmission through the air imposed a tight bottleneck since most recipient animals became infected by only one virus. In contrast, a direct contact transmission chain propagated a mixture of viruses suggesting the dose transferred by this route was higher. From animals with a mixed infection of viruses that were resistant and sensitive to the antiviral drug oseltamivir, resistance was propagated through contact transmission but not by air. These data imply that transmission events with a looser bottleneck can propagate minority variants and may be an important route for influenza evolution. PMID:27430528
Directory of Open Access Journals (Sweden)
Poole Charles
2007-10-01
Full Text Available Abstract The proportion of infant pertussis cases due to transmission from casual contact in the community has not been estimated since before the introduction of pertussis vaccines in the 1950s. This study aimed to estimate the proportion of pertussis transmission due to casual contact using demographic and clinical data from a study of 95 infant pertussis cases and their close contacts enrolled at 14 hospitals in France, Germany, Canada, and the U.S. between February 2003 and September 2004. A complete case analysis was conducted as well as multiple imputation (MI to account for missing data for participants and close contacts who did not participate. By considering all possible close contacts, the MI analysis estimated 66% of source cases were close contacts, implying the minimum attributable proportion of infant cases due to transmission from casual contact with community members was 34% (95% CI = 24%, 44%. Estimates from the complete case analysis were comparable but less precise. Results were sensitive to changes in the operational definition of a source case, which broadened the range of MI point estimates of transmission from casual community contact to 20%–47%. We conclude that casual contact appears to be responsible for a substantial proportion of pertussis transmission to young infants. Medical subject headings (MeSH: multiple imputation, pertussis, transmission, casual contact, sensitivity analysis, missing data, community.
Directory of Open Access Journals (Sweden)
Pierre Nouvellet
2013-11-01
Full Text Available Chagas disease has a major impact on human health in Latin America and is becoming of global concern due to international migrations. Trypanosoma cruzi, the etiological agent of the disease, is one of the rare human parasites transmitted by the feces of its vector, as it is unable to reach the salivary gland of the insect. This stercorarian transmission is notoriously poorly understood, despite its crucial role in the ecology and evolution of the pathogen and the disease. The objective of this study was to quantify the probability of T. cruzi vectorial transmission to humans, and to use such an estimate to predict human prevalence from entomological data. We developed several models of T. cruzi transmission to estimate the probability of transmission from vector to host. Using datasets from the literature, we estimated the probability of transmission per contact with an infected triatomine to be 5.8 × 10(-4 (95%CI: [2.6 ; 11.0] × 10(-4. This estimate was consistent across triatomine species, robust to variations in other parameters, and corresponded to 900-4,000 contacts per case. Our models subsequently allowed predicting human prevalence from vector abundance and infection rate in 7/10 independent datasets covering various triatomine species and epidemiological situations. This low probability of T. cruzi transmission reflected well the complex and unlikely mechanism of transmission via insect feces, and allowed predicting human prevalence from basic entomological data. Although a proof of principle study would now be valuable to validate our models' predictive ability in an even broader range of entomological and ecological settings, our quantitative estimate could allow switching the evaluation of disease risk and vector control program from purely entomological indexes to parasitological measures, as commonly done for other major vector borne diseases. This might lead to different quantitative perspectives as these indexes are well known
Transmission of methicillin-resistant Staphylococcus aureus to household contacts
F.P.N. Mollema (Femke); J.H. Richardus (Jan Hendrik); M.D. Behrendt (Myra); N. Vaessen (Norbert); W. Lodder; W. Hendriks; H.A. Verbrugh (Henri); A. Voss (Andreas)
2010-01-01
textabstractThe frequency of and risk factors for methicillin-resistant Staphylococcus aureus (MRSA) transmission from a MRSA index person to household contacts were assessed in this prospective study. Between January 2005 and December 2007, 62 newly diagnosed MRSA index persons (46 patients and 16
Highly dynamic animal contact network and implications on disease transmission
Shi Chen; Brad J. White; Michael W. Sanderson; David E. Amrine; Amiyaal Ilany; Cristina Lanzas
2014-01-01
Contact patterns among hosts are considered as one of the most critical factors contributing to unequal pathogen transmission. Consequently, networks have been widely applied in infectious disease modeling. However most studies assume static network structure due to lack of accurate observation and appropriate analytic tools. In this study we used high temporal and spatial resolution animal position data to construct a high-resolution contact network relevant to infectious disease transmissio...
Directory of Open Access Journals (Sweden)
Cao Shi
2017-01-01
Full Text Available Due to the shortcomings of current power transmission which is used in ultrasound - assisted machining and the different transfer efficiency caused by the related parameters of the electromagnetic converter, this paper proposes an analysis model of the new non-contact power transmission device with more stable output and higher transmission efficiency. Then By utilizing Maxwell finite element analysis software, this paper studies the law of the transfer efficiency of the new non-contact transformer and compares new type with traditional type with the method of setting the boundary conditions of non-contact power supply device. At last, combining with the practical application, the relevant requirements which have a certain reference value in the application are put forward in the actual processing.
Sang, Xiaoyu; Wang, Airong; Ding, Jie; Kong, Huihui; Gao, Xiaolong; Li, Lin; Chai, Tongjie; Li, Yuanguo; Zhang, Kun; Wang, Chengyu; Wan, Zhonghai; Huang, Geng; Wang, Tiecheng; Feng, Na; Zheng, Xuexing; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Qian, Jun; Hu, Guixue; Gao, Yuwei; Xia, Xianzhu
2015-01-01
H9N2 avian influenza viruses circulate worldwide in poultry and have sporadically infected humans, raising concern whether H9N2 viruses have pandemic potential. Here, we use a guinea pig model to examine whether serial passage results in adaptive viral changes that confer a transmissible phenotype to a wild-type H9N2 virus. After nine serial passages of an H9N2 virus through guinea pigs, productive transmission by direct contact occurred in 2/3 guinea pig pairs. The efficiency of transmission by direct contact increased following the fifteenth passage and occurred in 3/3 guinea pig pairs. In contrast, airborne transmission of the passaged virus was less efficient and occurred in 1/6 guinea pig pairs and 0/6 ferret pairs after the fifteenth passage. Three amino acid substitutions, HA1-Q227P, HA2-D46E, and NP-E434K, were sufficient for contact transmission in guinea pigs (2/3 pairs). The two HA amino acid substitutions enhanced receptor binding to α2,3-linked sialic acid receptors. Additionally, the HA2-D46E substitution increased virus thermostability whereas the NP-E434K mutation enhanced viral RNA polymerase activity in vitro. Our findings suggest that adaptive changes that enhance viral receptor binding, thermostability, and replicative capacity in mammalian cells can collectively enhance the transmissibility of H9N2 AIVs by direct contact in the guinea pig model. PMID:26552719
Wikswo, Mary E; Kambhampati, Anita; Shioda, Kayoko; Walsh, Kelly A; Bowen, Anna; Hall, Aron J
2015-12-11
Acute gastroenteritis (AGE) is a major cause of illness in the United States, with an estimated 179 million episodes annually. AGE outbreaks propagated through direct person-to-person contact, contaminated environmental surfaces, and unknown modes of transmission were not systematically captured at the national level before 2009 and thus were not well characterized. 2009-2013. The National Outbreak Reporting System (NORS) is a voluntary national reporting system that supports reporting of all waterborne and foodborne disease outbreaks and all AGE outbreaks resulting from transmission by contact with contaminated environmental sources, infected persons or animals, or unknown modes. Local, state, and territorial public health agencies within the 50 U.S. states, the District of Columbia (DC), five U.S. territories, and three Freely Associated States report outbreaks to CDC via NORS using a standard online data entry system. A total of 10,756 AGE outbreaks occurred during 2009-2013, for which the primary mode of transmission occurred through person-to-person contact, environmental contamination, and unknown modes of transmission. NORS received reports from public health agencies in 50 U.S. states, DC, and Puerto Rico. These outbreaks resulted in 356,532 reported illnesses, 5,394 hospitalizations, and 459 deaths. The median outbreak reporting rate for all sites in a given year increased from 2.7 outbreaks per million population in 2009 to 11.8 outbreaks in 2013. The etiology was unknown in 31% (N = 3,326) of outbreaks. Of the 7,430 outbreaks with a suspected or confirmed etiology reported, norovirus was the most common, reported in 6,223 (84%) of these outbreaks. Other reported suspected or confirmed etiologies included Shigella (n = 332) and Salmonella (n = 320). Outbreaks were more frequent during the winter, with 5,716 (53%) outbreaks occurring during December-February, and 70% of the 7,001 outbreaks with a reported setting of exposure occurred in long
Edelson, Paul J; Phypers, M
2011-01-01
The risk of transmission when persons with active tuberculosis travel on buses or trains is uncertain and no recommendations have been published for contact investigations on these conveyances. We conducted a systematic review of the published studies of tuberculosis transmission among bus or train travelers. Twelve published reports were identified, including one retrospective cohort study and eleven contact investigations. One contact investigation involved train travelers and one involved students on a 6 h bus excursion. The remaining nine involved exposures on school buses or in commuter vans. In eight reports, evidence of tuberculosis infection was found in 8.7%-55% of those tested; six of these studies reported identifying 1-24 cases of active tuberculosis. These reports support the need to be alert to the possibility of tuberculosis transmission on buses or trains. However, they do not offer the quantitative estimate of risk needed for defining policy regarding contact tracing for persons exposed on buses or trains. Decisions to carry out contact investigations should take into account the proximity to the index case, duration of exposure, and other risk factors that may affect the infectiousness of the case or the susceptibility of the contact. Additional reports taking these factors into consideration would help clarify the risk of tuberculosis transmission on public transport. Copyright © 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Wasastjerna, F.; Lux, I.
1980-03-01
A transmission probability method implemented in the program TPHEX is described. This program was developed for the calculation of neutron flux distributions in hexagonal light water reactor fuel assemblies. The accuracy appears to be superior to diffusion theory, and the computation time is shorter than that of the collision probability method. (author)
Computing Tutte polynomials of contact networks in classrooms
Hincapié, Doracelly; Ospina, Juan
2013-05-01
Objective: The topological complexity of contact networks in classrooms and the potential transmission of an infectious disease were analyzed by sex and age. Methods: The Tutte polynomials, some topological properties and the number of spanning trees were used to algebraically compute the topological complexity. Computations were made with the Maple package GraphTheory. Published data of mutually reported social contacts within a classroom taken from primary school, consisting of children in the age ranges of 4-5, 7-8 and 10-11, were used. Results: The algebraic complexity of the Tutte polynomial and the probability of disease transmission increases with age. The contact networks are not bipartite graphs, gender segregation was observed especially in younger children. Conclusion: Tutte polynomials are tools to understand the topology of the contact networks and to derive numerical indexes of such topologies. It is possible to establish relationships between the Tutte polynomial of a given contact network and the potential transmission of an infectious disease within such network
Directory of Open Access Journals (Sweden)
Kirsty J Bolton
Full Text Available BACKGROUND: Realistic models of disease transmission incorporating complex population heterogeneities require input from quantitative population mixing studies. We use contact diaries to assess the relative importance of social settings in respiratory pathogen spread using three measures of person contact hours (PCH as proxies for transmission risk with an aim to inform bipartite network models of respiratory pathogen transmission. METHODS AND FINDINGS: Our survey examines the contact behaviour for a convenience sample of 65 adults, with each encounter classified as occurring in a work, retail, home, social, travel or "other" setting. The diary design allows for extraction of PCH-interaction (cumulative time in face-face conversational or touch interaction with contacts--analogous to the contact measure used in several existing surveys--as well as PCH-setting (product of time spent in setting and number of people present and PCH-reach (product of time spent in setting and number of people in close proximity. Heterogeneities in day-dependent distribution of risk across settings are analysed using partitioning and cluster analyses and compared between days and contact measures. Although home is typically the highest-risk setting when PCH measures isolate two-way interactions, its relative importance compared to social and work settings may reduce when adopting a more inclusive contact measure that considers the number and duration of potential exposure events. CONCLUSIONS: Heterogeneities in location-dependent contact behaviour as measured by contact diary studies depend on the adopted contact definition. We find that contact measures isolating face-face conversational or touch interactions suggest that contact in the home dominates, whereas more inclusive contact measures indicate that home and work settings may be of higher importance. In the absence of definitive knowledge of the contact required to facilitate transmission of various
Pairwise contact energy statistical potentials can help to find probability of point mutations.
Saravanan, K M; Suvaithenamudhan, S; Parthasarathy, S; Selvaraj, S
2017-01-01
To adopt a particular fold, a protein requires several interactions between its amino acid residues. The energetic contribution of these residue-residue interactions can be approximated by extracting statistical potentials from known high resolution structures. Several methods based on statistical potentials extracted from unrelated proteins are found to make a better prediction of probability of point mutations. We postulate that the statistical potentials extracted from known structures of similar folds with varying sequence identity can be a powerful tool to examine probability of point mutation. By keeping this in mind, we have derived pairwise residue and atomic contact energy potentials for the different functional families that adopt the (α/β) 8 TIM-Barrel fold. We carried out computational point mutations at various conserved residue positions in yeast Triose phosphate isomerase enzyme for which experimental results are already reported. We have also performed molecular dynamics simulations on a subset of point mutants to make a comparative study. The difference in pairwise residue and atomic contact energy of wildtype and various point mutations reveals probability of mutations at a particular position. Interestingly, we found that our computational prediction agrees with the experimental studies of Silverman et al. (Proc Natl Acad Sci 2001;98:3092-3097) and perform better prediction than i Mutant and Cologne University Protein Stability Analysis Tool. The present work thus suggests deriving pairwise contact energy potentials and molecular dynamics simulations of functionally important folds could help us to predict probability of point mutations which may ultimately reduce the time and cost of mutation experiments. Proteins 2016; 85:54-64. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Error Probability Analysis of Hardware Impaired Systems with Asymmetric Transmission
Javed, Sidrah; Amin, Osama; Ikki, Salama S.; Alouini, Mohamed-Slim
2018-01-01
Error probability study of the hardware impaired (HWI) systems highly depends on the adopted model. Recent models have proved that the aggregate noise is equivalent to improper Gaussian signals. Therefore, considering the distinct noise nature and self-interfering (SI) signals, an optimal maximum likelihood (ML) receiver is derived. This renders the conventional minimum Euclidean distance (MED) receiver as a sub-optimal receiver because it is based on the assumptions of ideal hardware transceivers and proper Gaussian noise in communication systems. Next, the average error probability performance of the proposed optimal ML receiver is analyzed and tight bounds and approximations are derived for various adopted systems including transmitter and receiver I/Q imbalanced systems with or without transmitter distortions as well as transmitter or receiver only impaired systems. Motivated by recent studies that shed the light on the benefit of improper Gaussian signaling in mitigating the HWIs, asymmetric quadrature amplitude modulation or phase shift keying is optimized and adapted for transmission. Finally, different numerical and simulation results are presented to support the superiority of the proposed ML receiver over MED receiver, the tightness of the derived bounds and effectiveness of asymmetric transmission in dampening HWIs and improving overall system performance
Error Probability Analysis of Hardware Impaired Systems with Asymmetric Transmission
Javed, Sidrah
2018-04-26
Error probability study of the hardware impaired (HWI) systems highly depends on the adopted model. Recent models have proved that the aggregate noise is equivalent to improper Gaussian signals. Therefore, considering the distinct noise nature and self-interfering (SI) signals, an optimal maximum likelihood (ML) receiver is derived. This renders the conventional minimum Euclidean distance (MED) receiver as a sub-optimal receiver because it is based on the assumptions of ideal hardware transceivers and proper Gaussian noise in communication systems. Next, the average error probability performance of the proposed optimal ML receiver is analyzed and tight bounds and approximations are derived for various adopted systems including transmitter and receiver I/Q imbalanced systems with or without transmitter distortions as well as transmitter or receiver only impaired systems. Motivated by recent studies that shed the light on the benefit of improper Gaussian signaling in mitigating the HWIs, asymmetric quadrature amplitude modulation or phase shift keying is optimized and adapted for transmission. Finally, different numerical and simulation results are presented to support the superiority of the proposed ML receiver over MED receiver, the tightness of the derived bounds and effectiveness of asymmetric transmission in dampening HWIs and improving overall system performance
The relationship between operating cash flow per share and portfolio default probability
Directory of Open Access Journals (Sweden)
Mohammad Khodaei Valahzaghard
2014-03-01
Full Text Available One of the primary duties of the depositary banks is to protect themselves against any possibility of bankruptcy. This requires the identification and measurement of risks, including default risk, which is important given the nature of the activities of banks. This paper presents an empirical investigation to study the relationship between default probability and some financial figures including operating cash flow, liabilities and return of equities. The proposed study of this paper uses historical data of twenty-two firms listed on Tehran Stock Exchange over the period 2008-2012. Default probability as the dependent variable is measured by the method developed by Moody’s KMV Company. The study uses linear regression model to examine the relationship between default probability and some independent variables. The results of the present study suggest that there were some reverse relationship between operating cash flow per share, return on equities and default probability. In addition, there was a direct relationship between log facilities and default probability. However, there was not any relationship between net sales and default probability.
A fast algorithm for estimating transmission probabilities in QTL detection designs with dense maps
Directory of Open Access Journals (Sweden)
Gilbert Hélène
2009-11-01
Full Text Available Abstract Background In the case of an autosomal locus, four transmission events from the parents to progeny are possible, specified by the grand parental origin of the alleles inherited by this individual. Computing the probabilities of these transmission events is essential to perform QTL detection methods. Results A fast algorithm for the estimation of these probabilities conditional to parental phases has been developed. It is adapted to classical QTL detection designs applied to outbred populations, in particular to designs composed of half and/or full sib families. It assumes the absence of interference. Conclusion The theory is fully developed and an example is given.
Inefficient transmission of H5N1 influenza viruses in a ferret contact model.
Yen, Hui-Ling; Lipatov, Aleksandr S; Ilyushina, Natalia A; Govorkova, Elena A; Franks, John; Yilmaz, Neziha; Douglas, Alan; Hay, Alan; Krauss, Scott; Rehg, Jerold E; Hoffmann, Erich; Webster, Robert G
2007-07-01
The abilities to infect and transmit efficiently among humans are essential for a novel influenza A virus to cause a pandemic. To evaluate the pandemic potential of widely disseminated H5N1 influenza viruses, a ferret contact model using experimental groups comprised of one inoculated ferret and two contact ferrets was used to study the transmissibility of four human H5N1 viruses isolated from 2003 to 2006. The effects of viral pathogenicity and receptor binding specificity (affinity to synthetic sialosaccharides with alpha2,3 or alpha2,6 linkages) on transmissibility were assessed. A/Vietnam/1203/04 and A/Vietnam/JP36-2/05 viruses, which possess "avian-like" alpha2,3-linked sialic acid (SA) receptor specificity, caused neurological symptoms and death in ferrets inoculated with 10(3) 50% tissue culture infectious doses. A/Hong Kong/213/03 and A/Turkey/65-596/06 viruses, which show binding affinity for "human-like" alpha2,6-linked SA receptors in addition to their affinity for alpha2,3-linked SA receptors, caused mild clinical symptoms and were not lethal to the ferrets. No transmission of A/Vietnam/1203/04 or A/Turkey/65-596/06 virus was detected. One contact ferret developed neutralizing antibodies to A/Hong Kong/213/03 but did not exhibit any clinical signs or detectable virus shedding. In two groups, one of two naïve contact ferrets had detectable virus after 6 to 8 days when housed together with the A/Vietnam/JP36-2/05 virus-inoculated ferrets. Infected contact ferrets showed severe clinical signs, although little or no virus was detected in nasal washes. This limited virus shedding explained the absence of secondary transmission from the infected contact ferret to the other naïve ferret that were housed together. Our results suggest that despite their receptor binding affinity, circulating H5N1 viruses retain molecular determinants that restrict their spread among mammalian species.
Harris, Justin A; Kwok, Dorothy W S
2018-01-01
During magazine approach conditioning, rats do not discriminate between a conditional stimulus (CS) that is consistently reinforced with food and a CS that is occasionally (partially) reinforced, as long as the CSs have the same overall reinforcement rate per second. This implies that rats are indifferent to the probability of reinforcement per trial. However, in the same rats, the per-trial reinforcement rate will affect subsequent extinction-responding extinguishes more rapidly for a CS that was consistently reinforced than for a partially reinforced CS. Here, we trained rats with consistently and partially reinforced CSs that were matched for overall reinforcement rate per second. We measured conditioned responding both during and immediately after the CSs. Differences in the per-trial probability of reinforcement did not affect the acquisition of responding during the CS but did affect subsequent extinction of that responding, and also affected the post-CS response rates during conditioning. Indeed, CSs with the same probability of reinforcement per trial evoked the same amount of post-CS responding even when they differed in overall reinforcement rate and thus evoked different amounts of responding during the CS. We conclude that reinforcement rate per second controls rats' acquisition of responding during the CS, but at the same time, rats also learn specifically about the probability of reinforcement per trial. The latter learning affects the rats' expectation of reinforcement as an outcome of the trial, which influences their ability to detect retrospectively that an opportunity for reinforcement was missed, and, in turn, drives extinction. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Directory of Open Access Journals (Sweden)
David M Williams
Full Text Available Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05-0.14, to low levels post-parturition through summer (0.00-0.02, and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m-7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response.
Ssematimba, A; Hagenaars, T J; de Wit, J J; Ruiterkamp, F; Fabri, T H; Stegeman, J A; de Jong, M C M
2013-04-01
In the 2003 epidemic of highly pathogenic avian influenza in Dutch poultry, between-farm virus transmission continued for considerable time despite control measures. Gaining more insight into the mechanisms of this spread is necessary for the possible development of better control strategies. We carried out an in-depth interview study aiming to systematically explore all the poultry production activities to identify the activities that could potentially be related to virus introduction and transmission. One of the between-farm contact risks that were identified is the movement of birds between farms during thinning with violations of on-farm biosecurity protocols. In addition, several other risky management practices, risky visitor behaviours and biosecurity breaches were identified. They include human and fomite contacts that occurred without observing biosecurity protocols, poor waste management practices, presence of other animal species on poultry farms, and poor biosecurity against risks from farm neighbourhood activities. Among the detailed practices identified, taking cell phones and jewellery into poultry houses, not observing shower-in protocols and the exchange of unclean farm equipment were common. Also, sometimes certain protocols or biosecurity facilities were lacking. We also asked the interviewed farmers about their perception of transmission risks and found that they had divergent opinions about the visitor- and neighbourhood-associated risks. We performed a qualitative assessment of contact risks (as transmission pathways) based on contact type, corresponding biosecurity practices, and contact frequency. This assessment suggests that the most risky contact types are bird movements during thinning and restocking, most human movements accessing poultry houses and proximity to other poultry farms. The overall risk posed by persons and equipment accessing storage rooms and the premises-only contacts was considered to be medium. Most of the exposure
Bacterial transmission from contact lenses to porcine corneas : An ex vivo study
Vermeltfoort, Pit B. J.; van Kooten, Theo G.; Bruinsma, Gerda .; Hooymans, Anneke M. M.; van der Mei, Henny C.; Busscher, Henk J.
PURPOSE. To quantify the transmission to ex vivo porcine eyes of Staphylococcus aureus 835 and Pseudomonas aeruginosa 3 from three types of contact lenses - one daily wear and two extended wear - differing in hydrophobicity and roughness. METHODS. One daily wear lens (etafilcon) and two
Probable Tiger-to-Tiger Transmission of Avian Influenza H5N1
Thanawongnuwech, Roongroje; Amonsin, Alongkorn; Tantilertcharoen, Rachod; Damrongwatanapokin, Sudarat; Theamboonlers, Apiradee; Payungporn, Sunchai; Nanthapornphiphat, Kamonchart; Ratanamungklanon, Somchuan; Tunak, Eakchai; Songserm, Thaweesak; Vivatthanavanich, Veravit; Lekdumrongsak, Thawat; Kesdangsakonwut, Sawang; Tunhikorn, Schwann
2005-01-01
During the second outbreak of avian influenza H5N1 in Thailand, probable horizontal transmission among tigers was demonstrated in the tiger zoo. Sequencing and phylogenetic analysis of those viruses showed no differences from the first isolate obtained in January 2004. This finding has implications for influenza virus epidemiology and pathogenicity in mammals. PMID:15890122
Directory of Open Access Journals (Sweden)
Benjamin D Dalziel
2014-10-01
Full Text Available Host-range shifts in influenza virus are a major risk factor for pandemics. A key question in the study of emerging zoonoses is how the evolution of transmission efficiency interacts with heterogeneity in contact patterns in the new host species, as this interplay influences disease dynamics and prospects for control. Here we use a synergistic mixture of models and data to tease apart the evolutionary and demographic processes controlling a host-range shift in equine H3N8-derived canine influenza virus (CIV. CIV has experienced 15 years of continuous transfer among dogs in the United States, but maintains a patchy distribution, characterized by sporadic short-lived outbreaks coupled with endemic hotspots in large animal shelters. We show that CIV has a high reproductive potential in these facilities (mean R(0 = 3.9 and that these hotspots act as refugia from the sparsely connected majority of the dog population. Intriguingly, CIV has evolved a transmission efficiency that closely matches the minimum required to persist in these refugia, leaving it poised on the extinction/invasion threshold of the host contact network. Corresponding phylogenetic analyses show strong geographic clustering in three US regions, and that the effective reproductive number of the virus (R(e in the general dog population is close to 1.0. Our results highlight the critical role of host contact structure in CIV dynamics, and show how host contact networks could shape the evolution of pathogen transmission efficiency. Importantly, efficient control measures could eradicate the virus, in turn minimizing the risk of future sustained transmission among companion dogs that could represent a potential new axis to the human-animal interface for influenza.
Leibler, Jessica H; Carone, Marco; Silbergeld, Ellen K
2010-03-25
Models of between-farm transmission of pathogens have identified service vehicles and social groups as risk factors mediating the spread of infection. Because of high levels of economic organization in much of the poultry industry, we examined the importance of company affiliation, as distinct from social contacts, in a model of the potential spread of avian influenza among broiler poultry farms in a poultry-dense region in the United States. The contribution of company affiliation to risk of between-farm disease transmission has not been previously studied. We obtained data on the nature and frequency of business and social contacts through a national survey of broiler poultry growers in the United States. Daily rates of contact were estimated using Monte Carlo analysis. Stochastic modeling techniques were used to estimate the exposure risk posed by a single infectious farm to other farms in the region and relative risk of exposure for farms under different scenarios. The mean daily rate of vehicular contact was 0.82 vehicles/day. The magnitude of exposure risk ranged from company affiliation, with farms in the same company group as the index farm facing as much as a 5-fold increase in risk compared to farms contracted with different companies. Employment of part-time workers contributed to significant increases in risk in most scenarios, notably for farms who hired day-laborers. Social visits were significantly less important in determining risk. Biosecurity interventions should be based on information on industry structure and company affiliation, and include part-time workers as potentially unrecognized sources of viral transmission. Modeling efforts to understand pathogen transmission in the context of industrial food animal production should consider company affiliation in addition to geospatial factors and pathogen characteristics. Restriction of social contacts among farmers may be less useful in reducing between-farm transmission.
Qu, Wenwen; Hooymans, Johanna M. M.; Qiu, Jun; de-Bont, Nik; Gelling, Onko-Jan; van der Mei, Henny C.; Busscher, Henk J.
Surface properties of lens cases are determinant for their cleanability and for microbial transmission from lens cases to contact lenses (CLs). PEG-polymer-brush-coatings are known to decrease microbial adhesion more than other surface-coatings. Here, we applied a robust, silica nanoparticles-based
Effectiveness of condoms in preventing HIV transmission.
Pinkerton, S D; Abramson, P R
1997-05-01
The consistent use of latex condoms continues to be advocated for primary prevention of HIV infection despite limited quantitative evidence regarding the effectiveness of condoms in blocking the sexual transmission of HIV. Although recent meta-analyses of condom effectiveness suggest that condoms are 60 to 70% effective when used for HIV prophylaxis, these studies do not isolate consistent condom use, and therefore provide only a lower bound on the true effectiveness of correct and consistent condom use. A reexamination of HIV seroconversion studies suggests that condoms are 90 to 95% effective when used consistently, i.e. consistent condom users are 10 to 20 times less likely to become infected when exposed to the virus than are inconsistent or non-users. Similar results are obtained utilizing model-based estimation techniques, which indicate that condoms decrease the per-contact probability of male-to-female transmission of HIV by about 95%. Though imperfect, condoms provide substantial protection against HIV infection. Condom promotion therefore remains an important international priority in the fight against AIDS.
Metal-clad waveguide characterization for contact-based light transmission into tissue
Chininis, Jeffrey; Whiteside, Paul; Hunt, Heather K.
2016-02-01
As contemporary laser dermatology procedures, like tattoo removal and skin resurfacing, become more popular, the complications of their operation are also becoming more prevalent. Frequent incidences of over-exposure, ocular injury, and excessive thermal damage represent mounting concerns for those seeking such procedures; moreover, each of these problems is a direct consequence of the standard, free-space method of laser transmission predominantly used in clinical settings. Therefore, an alternative method of light transmission is needed to minimize these problems. Here, we demonstrate and characterize an alternative method that uses planar waveguides to deliver light into sample tissue via direct contact. To do this, slab substrates made from glass were clad in layers of titanium and silver, constraining the light within the waveguide along the waveguide's length. By creating active areas on the waveguide surface, the propagating light could then optically tunnel into the tissue sample, when the waveguide was brought into contact with the tissue. SEM and EDS were used to characterize the metal film thickness and deposition rates onto the glass substrates. Laser light from a Q-switched Nd:YAG source operating at 532nm was coupled into the waveguide and transmitted into samples of pig skin. The amount of light transmitted was measured using photoacoustics techniques, in conjunction with a photodiode and integrating sphere. Transmitting light into tissue in this manner effectively resolves or circumvents the complications caused by free-space propagation methods as it reduces the operating distance to 0, which prevents hazardous back-reflections and allows for the ready incorporation of contact cooling technologies.
Lavelle, Michael J; Kay, Shannon L; Pepin, Kim M; Grear, Daniel A; Campa, Henry; VerCauteren, Kurt C
2016-12-01
Direct and indirect contacts among individuals drive transmission of infectious disease. When multiple interacting species are susceptible to the same pathogen, risk assessment must include all potential host species. Bovine tuberculosis (bTB) is an example of a disease that can be transmitted among several wildlife species and to cattle, although the potential role of several wildlife species in spillback to cattle remains unclear. To better understand the complex network of contacts and factors driving disease transmission, we fitted proximity logger collars to beef and dairy cattle (n=37), white-tailed deer (Odocoileus virginianus; n=29), raccoon (Procyon lotor; n=53), and Virginia opossum (Didelphis virginiana; n=79) for 16 months in Michigan's Lower Peninsula, USA. We determined inter- and intra-species direct and indirect contact rates. Data on indirect contact was calculated when collared animals visited stationary proximity loggers placed at cattle feed and water resources. Most contact between wildlife species and cattle was indirect, with the highest contact rates occurring between raccoons and cattle during summer and fall. Nearly all visits (>99%) to cattle feed and water sources were by cattle, whereas visitation to stored cattle feed was dominated by deer and raccoon (46% and 38%, respectively). Our results suggest that indirect contact resulting from wildlife species visiting cattle-related resources could pose a risk of disease transmission to cattle and deserves continued attention with active mitigation. Published by Elsevier B.V.
Nesting Bird “Host Funnel” Increases Mosquito-Bird Contact Rate
CAILLOUËT, KEVIN A.; RIGGAN, ANNA E.; BULLUCK, LESLEY P.; CARLSON, JOHN C.; SABO, ROY T.
2013-01-01
Increases in vector-host contact rates can enhance arbovirus transmission intensity. We investigated weekly fluctuations in contact rates between mosquitoes and nesting birds using the recently described Nest Mosquito Trap (NMT). The number of mosquitoes per nestling increased from < 1 mosquito per trap night to 36.2 in the final 2 wk of the nesting season. Our evidence suggests the coincidence of the end of the avian nesting season and increasing mosquito abundances may have caused a “host f...
Carnegie, Nicole Bohme
2018-01-30
Understanding the dynamics of disease spread is key to developing effective interventions to control or prevent an epidemic. The structure of the network of contacts over which the disease spreads has been shown to have a strong influence on the outcome of the epidemic, but an open question remains as to whether it is possible to estimate contact network features from data collected in an epidemic. The approach taken in this paper is to examine the distributions of epidemic outcomes arising from epidemics on networks with particular structural features to assess whether that structure could be measured from epidemic data and what other constraints might be needed to make the problem identifiable. To this end, we vary the network size, mean degree, and transmissibility of the pathogen, as well as the network feature of interest: clustering, degree assortativity, or attribute-based preferential mixing. We record several standard measures of the size and spread of the epidemic, as well as measures that describe the shape of the transmission tree in order to ascertain whether there are detectable signals in the final data from the outbreak. The results suggest that there is potential to estimate contact network features from transmission trees or pure epidemic data, particularly for diseases with high transmissibility or for which the relevant contact network is of low mean degree. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Ali, Haider; Yang, Xinbo; Weber, Klaus; Schoenfeld, Winston V.; Davis, Kristopher O.
2017-01-01
In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21
Simulated epidemics in an empirical spatiotemporal network of 50,185 sexual contacts.
Directory of Open Access Journals (Sweden)
Luis E C Rocha
2011-03-01
Full Text Available Sexual contact patterns, both in their temporal and network structure, can influence the spread of sexually transmitted infections (STI. Most previous literature has focused on effects of network topology; few studies have addressed the role of temporal structure. We simulate disease spread using SI and SIR models on an empirical temporal network of sexual contacts in high-end prostitution. We compare these results with several other approaches, including randomization of the data, classic mean-field approaches, and static network simulations. We observe that epidemic dynamics in this contact structure have well-defined, rather high epidemic thresholds. Temporal effects create a broad distribution of outbreak sizes, even if the per-contact transmission probability is taken to its hypothetical maximum of 100%. In general, we conclude that the temporal correlations of our network accelerate outbreaks, especially in the early phase of the epidemics, while the network topology (apart from the contact-rate distribution slows them down. We find that the temporal correlations of sexual contacts can significantly change simulated outbreaks in a large empirical sexual network. Thus, temporal structures are needed alongside network topology to fully understand the spread of STIs. On a side note, our simulations further suggest that the specific type of commercial sex we investigate is not a reservoir of major importance for HIV.
Inefficient Transmission of H5N1 Influenza Viruses in a Ferret Contact Model▿
Yen, Hui-Ling; Lipatov, Aleksandr S.; Ilyushina, Natalia A.; Govorkova, Elena A.; Franks, John; Yilmaz, Neziha; Douglas, Alan; Hay, Alan; Krauss, Scott; Rehg, Jerold E.; Hoffmann, Erich; Webster, Robert G.
2007-01-01
The abilities to infect and transmit efficiently among humans are essential for a novel influenza A virus to cause a pandemic. To evaluate the pandemic potential of widely disseminated H5N1 influenza viruses, a ferret contact model using experimental groups comprised of one inoculated ferret and two contact ferrets was used to study the transmissibility of four human H5N1 viruses isolated from 2003 to 2006. The effects of viral pathogenicity and receptor binding specificity (affinity to synth...
International Nuclear Information System (INIS)
Larbi, M.; Besnier, P.; Pecqueux, B.
2014-01-01
This paper deals with the risk analysis of an EMC default using a statistical approach. It is based on reliability methods from probabilistic engineering mechanics. A computation of probability of failure (i.e. probability of exceeding a threshold) of an induced current by crosstalk is established by taking into account uncertainties on input parameters influencing levels of interference in the context of transmission lines. The study has allowed us to evaluate the probability of failure of the induced current by using reliability methods having a relative low computational cost compared to Monte Carlo simulation. (authors)
Directory of Open Access Journals (Sweden)
Krishna Balasubramaniam
2016-10-01
Full Text Available In social animals, group living may impact the risk of infectious disease acquisition in two ways. On the one hand, social connectedness puts individuals at greater risk or susceptibility for acquiring enteric pathogens via contact-mediated transmission. Yet conversely, in strongly bonded societies like humans and some nonhuman primates, having close connections and strong social ties of support can also socially buffer individuals against susceptibility or transmissibility of infectious agents. Using social network analyses, we assessed the potentially competing roles of contact-mediated transmission and social buffering on the risk of infection from an enteric bacterial pathogen (Shigella flexneri among captive groups of rhesus macaques (Macaca mulatta. Our results indicate that, within two macaque groups, individuals possessing more direct and especially indirect connections in their grooming and huddling social networks were less susceptible to infection. These results are in sharp contrast to several previous studies that indicate that increased (direct contact-mediated transmission facilitates infectious disease transmission, including our own findings in a third macaque group in which individuals central in their huddling network and/or which initiated more fights were more likely to be infected. In summary, our findings reveal that an individual’s social connections may increase or decrease its chances of acquiring infectious agents. They extend the applicability of the social buffering hypothesis, beyond just stress and immune-function-related health benefits, to the additional health outcome of infectious disease resistance. Finally, we speculate that the circumstances under which social buffering versus contact-mediated transmission may occur could depend on multiple factors, such as living condition, pathogen-specific transmission routes, and/or an overall social context such as a group’s social stability.
Hughes, Anne K; Alford, Kristen R
2017-01-02
HIV infection among older adults is increasing. Previous research suggests that many older adults do not see themselves as at risk for HIV and that many subscribe to myths related to HIV transmission. In this focus group study (N = 48) we solicited the beliefs that older adults held about HIV. The older adults in this study were knowledgeable about how HIV is typically transmitted. However, we also identified that they subscribed to misconceptions regarding casual contact transmission and were fearful of transmission from the medical system. Educational efforts aimed at older adults must be tailored to address these persistent misconceptions.
Stein, Mart L.; van Steenbergen, Jim E.; Buskens, Vincent; van der Heijden, Peter G. M.; Chanyasanha, Charnchudhi; Tipayamongkholgul, Mathuros; Thorson, Anna E.; Bengtsson, Linus; Lu, Xin; Kretzschmar, Mirjam E. E.
2014-01-01
Understanding infection dynamics of respiratory diseases requires the identification and quantification of behavioural, social and environmental factors that permit the transmission of these infections between humans. Little empirical information is available about contact patterns within real-world social networks, let alone on differences in these contact networks between populations that differ considerably on a socio-cultural level. Here we compared contact network data that were collected in the Netherlands and Thailand using a similar online respondent-driven method. By asking participants to recruit contact persons we studied network links relevant for the transmission of respiratory infections. We studied correlations between recruiter and recruited contacts to investigate mixing patterns in the observed social network components. In both countries, mixing patterns were assortative by demographic variables and random by total numbers of contacts. However, in Thailand participants reported overall more contacts which resulted in higher effective contact rates. Our findings provide new insights on numbers of contacts and mixing patterns in two different populations. These data could be used to improve parameterisation of mathematical models used to design control strategies. Although the spread of infections through populations depends on more factors, found similarities suggest that spread may be similar in the Netherlands and Thailand. PMID:25423343
Folenta, Dezi; Lebo, William
1988-01-01
A 450 hp high ratio Self-Aligning Bearingless Planetary (SABP) for a helicopter application was designed, manufactured, and spin tested under NASA contract NAS3-24539. The objective of the program was to conduct research and development work on a high contact ratio helical gear SABP to reduce weight and noise and to improve efficiency. The results accomplished include the design, manufacturing, and no-load spin testing of two prototype helicopter transmissions, rated at 450 hp with an input speed of 35,000 rpm and an output speed of 350 rpm. The weight power density ratio of these gear units is 0.33 lb hp. The measured airborne noise at 35,000 rpm input speed and light load is 94 dB at 5 ft. The high speed, high contact ratio SABP transmission appears to be significantly lighter and quieter than comtemporary helicopter transmissions. The concept of the SABP is applicable not only to high ratio helicopter type transmissions but also to other rotorcraft and aircraft propulsion systems.
Quantal and thermal zero point motion formulae of barrier transmission probability
International Nuclear Information System (INIS)
Takigawa, N.; Alhassid, Y.; Balantekin, A.B.
1992-01-01
A Green's function method is developed to derive quantal zero point motion formulae for the barrier transmission probability in heavy ion fusion reactions corresponding to various nuclear intrinsic degrees of freedom. In order to apply to the decay of a hot nucleus, the formulae are then generalized to the case where the intrinsic degrees of freedom are in thermal equilibrium with a heat bath. A thermal zero point motion formula for vibrational coupling previously obtained through the use of influence functional methods naturally follows, and the effects of rotational coupling are found to be independent of temperature if the deformation is rigid
Strömgren, M; Holm, E; Dahlström, Ö; Ekberg, J; Eriksson, H; Spreco, A; Timpka, T
2017-09-01
This study aims to develop a typology of generic meeting places based on social contact and mixing of relevance for infectious disease transmission. Data were collected by means of a contact diary survey conducted on a representative sample of the Swedish population. The typology is derived from a cluster analysis accounting for four dimensions associated with transmission risk: visit propensity and its characteristics in terms of duration, number of other persons present and likelihood of physical contact. In the analysis, we also study demographic, socio-economic and geographical differences in the propensity of visiting meeting places. The typology identifies the family venue, the fixed activity site, the family vehicle, the trading plaza and the social network hub as generic meeting places. The meeting place typology represents a spatially explicit account of social contact and mixing relevant to infectious disease modelling, where the social context of the outbreak can be highlighted in light of the actual infectious disease.
International Nuclear Information System (INIS)
Larbi, M.; Besnier, P.; Pecqueux, B.
2014-01-01
This paper treats about the risk analysis of an EMC default using a statistical approach based on reliability methods. A probability of failure (i.e. probability of exceeding a threshold) of an induced current by crosstalk is computed by taking into account uncertainties on input parameters influencing extreme levels of interference in the context of transmission lines. Results are compared to Monte Carlo simulation (MCS). (authors)
Vermeltfoort, Pit B. J.; Hooymans, Johanna M. M.; Busscher, Henk J.; van der Mei, Henny C.
2008-01-01
The killing efficacies of multipurpose lens care solutions on planktonic and biofilm bacteria grown in polypropylene contact lens storage cases with and without silver impregnation and effects on bacterial transmission from storage cases to silicone hydrogel contact lenses were investigated. For
Ali, Haider
2017-08-15
In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21.6% obtained on n-type cells, featuring SiO2/TiO2/Al rear contacts and after forming gas annealing (FGA) at 350°C, is due to strong surface passivation of SiO2/TiO2 stack as well as low contact resistivity at the Si/SiO2/TiO2 heterojunction. This can be attributed to the transformation of amorphous TiO2 to a conducting TiO2-x phase. Conversely, the low efficiency (9.8%) obtained on cells featuring an a-Si:H/TiO2/Al rear contact is due to severe degradation of passivation of the a-Si:H upon FGA.
Woolhouse, Mark
2017-07-01
Transmissibility is the defining characteristic of infectious diseases. Quantifying transmission matters for understanding infectious disease epidemiology and designing evidence-based disease control programs. Tracing individual transmission events can be achieved by epidemiological investigation coupled with pathogen typing or genome sequencing. Individual infectiousness can be estimated by measuring pathogen loads, but few studies have directly estimated the ability of infected hosts to transmit to uninfected hosts. Individuals' opportunities to transmit infection are dependent on behavioral and other risk factors relevant given the transmission route of the pathogen concerned. Transmission at the population level can be quantified through knowledge of risk factors in the population or phylogeographic analysis of pathogen sequence data. Mathematical model-based approaches require estimation of the per capita transmission rate and basic reproduction number, obtained by fitting models to case data and/or analysis of pathogen sequence data. Heterogeneities in infectiousness, contact behavior, and susceptibility can have substantial effects on the epidemiology of an infectious disease, so estimates of only mean values may be insufficient. For some pathogens, super-shedders (infected individuals who are highly infectious) and super-spreaders (individuals with more opportunities to transmit infection) may be important. Future work on quantifying transmission should involve integrated analyses of multiple data sources.
Transmission of African swine fever virus from infected pigs by direct contact and aerosol routes
DEFF Research Database (Denmark)
Olesen, Ann Sofie; Lohse, Louise; Boklund, Anette
2017-01-01
from Poland (designated here POL/2015/Podlaskie/Lindholm). In both studies, pigs were inoculated intranasally with the virus and contact pigs were exposed to the experimentally infected pigs, either directly (contact within and between pens) or by air. Pigs exposed to the virus by intranasal...... and occasionally infectious virus was found in nasal-, oral-, and rectal swabs obtained from the pigs, and ASFV DNA was detected in air samples. No anti-ASFV antibodies were detected in sera.In conclusion, the study shows that the currently circulating strain of ASFV can be efficiently transmitted via direct...... contact and by aerosols. Also, the results provide quantitative transmission parameters and knowledge of infection stages in pigs infected with this ASFV....
International Nuclear Information System (INIS)
Czaplewski, David A; Nordquist, Christopher D; Dyck, Christopher W; Patrizi, Gary A; Kraus, Garth M; Cowan, William D
2012-01-01
We present lifetime limitations and failure analysis of many packaged RF MEMS ohmic contacting switches with Au–Au, Au–Ir, and Au–Pt contact materials operating with 100 µN of contact force per contact in hermetically sealed glass wall packages. All metals were tested using the same switch design in a controlled environment to provide a comparison between the performance of the different materials and their corresponding failure mechanisms. The switch lifetimes of the different contact materials varied from several hundred cycles to 200 million cycles with different mechanisms causing failures for different contact materials. Switches with Au–Au contacts failed due to adhesion when thoroughly cleaned while switches with dissimilar metal contacts (Au–Ir and Au–Pt) operated without adhesion failures but failed due to carbon accumulation on the contacts even in a clean, packaged environment as a result of the catalytic behavior of the contact materials. Switch lifetimes correlated inversely with catalytic behavior of the contact metals. The data suggests the path to increase switch lifetime is to use favorable catalytic materials as contacts, design switches with higher contact forces to break through any residual contamination, and use cleaner, probably smaller, packages. (paper)
Directory of Open Access Journals (Sweden)
Kevin A. Caillouët
2013-11-01
Full Text Available Sensitive indicators of spatial and temporal variation in vector-host contact rates are critical to understanding the transmission and eventual prevention of arboviruses such as West Nile virus (WNV. Monitoring vector contact rates on particularly susceptible and perhaps more exposed avian nestlings may provide an advanced indication of local WNV amplification. To test this hypothesis we monitored WNV infection and vector contact rates among nestlings occupying nest boxes (primarily Eastern bluebirds; Sialia sialis, Turdidae across Henrico County, Virginia, USA, from May to August 2012. Observed host-seeking rates were temporally variable and associated with absolute vector and host abundances. Despite substantial effort to monitor WNV among nestlings and mosquitoes, we did not detect the presence of WNV in these populations. Generally low vector-nestling host contact rates combined with the negative WNV infection data suggest that monitoring transmission parameters among nestling Eastern bluebirds in Henrico County, Virginia, USA may not be a sensitive indicator of WNV activity.
International Nuclear Information System (INIS)
Stacey, W.M.
1992-12-01
A new computational model for neutral particle transport in the outer regions of a diverted tokamak plasma chamber is presented. The model is based on the calculation of transmission and escape probabilities using first-flight integral transport theory and the balancing of fluxes across the surfaces bounding the various regions. The geometrical complexity of the problem is included in precomputed probabilities which depend only on the mean free path of the region
Estimating animal movement contacts between holdings of different production types.
Lindström, Tom; Sisson, Scott A; Lewerin, Susanna Stenberg; Wennergren, Uno
2010-06-01
Animal movement poses a great risk for disease transmission between holdings. Heterogeneous contact patterns are known to influence the dynamics of disease transmission and should be included in modeling. Using pig movement data from Sweden as an example, we present a method for quantification of between holding contact probabilities based on different production types. The data contained seven production types: Sow pool center, Sow pool satellite, Farrow-to-finish, Nucleus herd, Piglet producer, Multiplying herd and Fattening herd. The method also estimates how much different production types will determine the contact pattern of holdings that have more than one type. The method is based on Bayesian analysis and uses data from central databases of animal movement. Holdings with different production types are estimated to vary in the frequency of contacts as well as in what type of holding they have contact with, and the direction of the contacts. Movements from Multiplying herds to Sow pool centers, Nucleus herds to other Nucleus herds, Sow pool centers to Sow pool satellites, Sow pool satellites to Sow pool centers and Nucleus herds to Multiplying herds were estimated to be most common relative to the abundance of the production types. We show with a simulation study that these contact patterns may also be expected to result in substantial differences in disease transmission via animal movements, depending on the index holding. Simulating transmission for a 1 year period showed that the median number of infected holdings was 1 (i.e. only the index holding infected) if the infection started at a Fattening herd and 2161 if the infection started on a Nucleus herd. We conclude that it is valuable to include production types in models of disease transmission and the method presented in this paper may be used for such models when appropriate data is available. We also argue that keeping records of production types is of great value since it may be helpful in risk
Big city, small world: density, contact rates, and transmission of dengue across Pakistan.
Kraemer, M U G; Perkins, T A; Cummings, D A T; Zakar, R; Hay, S I; Smith, D L; Reiner, R C
2015-10-06
Macroscopic descriptions of populations commonly assume that encounters between individuals are well mixed; i.e. each individual has an equal chance of coming into contact with any other individual. Relaxing this assumption can be challenging though, due to the difficulty of acquiring detailed knowledge about the non-random nature of encounters. Here, we fitted a mathematical model of dengue virus transmission to spatial time-series data from Pakistan and compared maximum-likelihood estimates of 'mixing parameters' when disaggregating data across an urban-rural gradient. We show that dynamics across this gradient are subject not only to differing transmission intensities but also to differing strengths of nonlinearity due to differences in mixing. Accounting for differences in mobility by incorporating two fine-scale, density-dependent covariate layers eliminates differences in mixing but results in a doubling of the estimated transmission potential of the large urban district of Lahore. We furthermore show that neglecting spatial variation in mixing can lead to substantial underestimates of the level of effort needed to control a pathogen with vaccines or other interventions. We complement this analysis with estimates of the relationships between dengue transmission intensity and other putative environmental drivers thereof. © 2015 The Authors.
Focks, D A; Brenner, R J; Hayes, J; Daniels, E
2000-01-01
The expense and ineffectiveness of drift-based insecticide aerosols to control dengue epidemics has led to suppression strategies based on eliminating larval breeding sites. With the notable but short-lived exceptions of Cuba and Singapore, these source reduction efforts have met with little documented success; failure has chiefly been attributed to inadequate participation of the communities involved. The present work attempts to estimate transmission thresholds for dengue based on an easily-derived statistic, the standing crop of Aedes aegypti pupae per person in the environment. We have developed these thresholds for use in the assessment of risk of transmission and to provide targets for the actual degree of suppression required to prevent or eliminate transmission in source reduction programs. The notion of thresholds is based on 2 concepts: the mass action principal-the course of an epidemic is dependent on the rate of contact between susceptible hosts and infectious vectors, and threshold theory-the introduction of a few infectious individuals into a community of susceptible individuals will not give rise to an outbreak unless the density of vectors exceeds a certain critical level. We use validated transmission models to estimate thresholds as a function of levels of pre-existing antibody levels in human populations, ambient air temperatures, and size and frequency of viral introduction. Threshold levels were estimated to range between about 0.5 and 1.5 Ae. aegypti pupae per person for ambient air temperatures of 28 degrees C and initial seroprevalences ranging between 0% to 67%. Surprisingly, the size of the viral introduction used in these studies, ranging between 1 and 12 infectious individuals per year, was not seen to significantly influence the magnitude of the threshold. From a control perspective, these results are not particularly encouraging. The ratio of Ae. aegypti pupae to human density has been observed in limited field studies to range
Evidence for transmission of Pseudomonas cepacia by social contact in cystic fibrosis.
Govan, J R; Brown, P H; Maddison, J; Doherty, C J; Nelson, J W; Dodd, M; Greening, A P; Webb, A K
1993-07-03
Pulmonary colonisation with Pseudomonas cepacia in patients with cystic fibrosis can be associated with increased morbidity and mortality. The modes of transmission of P cepacia are, however, unclear. We used selective media and phenotypic and genomic typing systems to investigate the acquisition of P cepacia by adults with cystic fibrosis. An analysis of isolates from 210 patients attending regional clinics in Edinburgh and Manchester between 1986 and 1992 showed that the main cause of increased isolations of P cepacia from 1989 was the emergence of an epidemic strain that had spread between patients in both clinics. Epidemiological evidence indicated that social contact was important in spread of the epidemic strain within and between clinics. We suggest that guidelines to limit the acquisition of P cepacia should not be restricted to patients in hospital, and that intimate or frequent social contact is associated with a high risk of cross-infection.
Exposure Patterns Driving Ebola Transmission in West Africa: A Retrospective Observational Study.
Directory of Open Access Journals (Sweden)
Junerlyn Agua-Agum
2016-11-01
Full Text Available The ongoing West African Ebola epidemic began in December 2013 in Guinea, probably from a single zoonotic introduction. As a result of ineffective initial control efforts, an Ebola outbreak of unprecedented scale emerged. As of 4 May 2015, it had resulted in more than 19,000 probable and confirmed Ebola cases, mainly in Guinea (3,529, Liberia (5,343, and Sierra Leone (10,746. Here, we present analyses of data collected during the outbreak identifying drivers of transmission and highlighting areas where control could be improved.Over 19,000 confirmed and probable Ebola cases were reported in West Africa by 4 May 2015. Individuals with confirmed or probable Ebola ("cases" were asked if they had exposure to other potential Ebola cases ("potential source contacts" in a funeral or non-funeral context prior to becoming ill. We performed retrospective analyses of a case line-list, collated from national databases of case investigation forms that have been reported to WHO. These analyses were initially performed to assist WHO's response during the epidemic, and have been updated for publication. We analysed data from 3,529 cases in Guinea, 5,343 in Liberia, and 10,746 in Sierra Leone; exposures were reported by 33% of cases. The proportion of cases reporting a funeral exposure decreased over time. We found a positive correlation (r = 0.35, p < 0.001 between this proportion in a given district for a given month and the within-district transmission intensity, quantified by the estimated reproduction number (R. We also found a negative correlation (r = -0.37, p < 0.001 between R and the district proportion of hospitalised cases admitted within ≤4 days of symptom onset. These two proportions were not correlated, suggesting that reduced funeral attendance and faster hospitalisation independently influenced local transmission intensity. We were able to identify 14% of potential source contacts as cases in the case line-list. Linking cases to the contacts
Vino, Thiripura; Singh, Gurmeet R; Davison, Belinda; Campbell, Patricia T; Lydeamore, Michael J; Robinson, Andrew; McVernon, Jodie; Tong, Steven Y C; Geard, Nicholas
2017-01-01
Households are an important location for the transmission of communicable diseases. Social contact between household members is typically more frequent, of greater intensity, and is more likely to involve people of different age groups than contact occurring in the general community. Understanding household structure in different populations is therefore fundamental to explaining patterns of disease transmission in these populations. Indigenous populations in Australia tend to live in larger households than non-Indigenous populations, but limited data are available on the structure of these households, and how they differ between remote and urban communities. We have developed a novel approach to the collection of household structure data, suitable for use in a variety of contexts, which provides a detailed view of age, gender, and room occupancy patterns in remote and urban Australian Indigenous households. Here we report analysis of data collected using this tool, which quantifies the extent of crowding in Indigenous households, particularly in remote areas. We use these data to generate matrices of age-specific contact rates, as used by mathematical models of infectious disease transmission. To demonstrate the impact of household structure, we use a mathematical model to simulate an influenza-like illness in different populations. Our simulations suggest that outbreaks in remote populations are likely to spread more rapidly and to a greater extent than outbreaks in non-Indigenous populations.
Directory of Open Access Journals (Sweden)
Thiripura Vino
2017-10-01
Full Text Available Households are an important location for the transmission of communicable diseases. Social contact between household members is typically more frequent, of greater intensity, and is more likely to involve people of different age groups than contact occurring in the general community. Understanding household structure in different populations is therefore fundamental to explaining patterns of disease transmission in these populations. Indigenous populations in Australia tend to live in larger households than non-Indigenous populations, but limited data are available on the structure of these households, and how they differ between remote and urban communities. We have developed a novel approach to the collection of household structure data, suitable for use in a variety of contexts, which provides a detailed view of age, gender, and room occupancy patterns in remote and urban Australian Indigenous households. Here we report analysis of data collected using this tool, which quantifies the extent of crowding in Indigenous households, particularly in remote areas. We use these data to generate matrices of age-specific contact rates, as used by mathematical models of infectious disease transmission. To demonstrate the impact of household structure, we use a mathematical model to simulate an influenza-like illness in different populations. Our simulations suggest that outbreaks in remote populations are likely to spread more rapidly and to a greater extent than outbreaks in non-Indigenous populations.
Force Transmission Modes of Non-Cohesive and Cohesive Materials at the Critical State.
Wang, Ji-Peng
2017-08-31
This paper investigates the force transmission modes, mainly described by probability density distributions, in non-cohesive dry and cohesive wet granular materials by discrete element modeling. The critical state force transmission patterns are focused on with the contact model effect being analyzed. By shearing relatively dense and loose dry specimens to the critical state in the conventional triaxial loading path, it is observed that there is a unique critical state force transmission mode. There is a universe critical state force distribution pattern for both the normal contact forces and tangential contact forces. Furthermore, it is found that using either the linear Hooke or the non-linear Hertz model does not affect the universe force transmission mode, and it is only related to the grain size distribution. Wet granular materials are also simulated by incorporating a water bridge model. Dense and loose wet granular materials are tested, and the critical state behavior for the wet material is also observed. The critical state strength and void ratio of wet granular materials are higher than those of a non-cohesive material. The critical state inter-particle distribution is altered from that of a non-cohesive material with higher probability in relatively weak forces. Grains in non-cohesive materials are under compressive stresses, and their principal directions are mainly in the axial loading direction. However, for cohesive wet granular materials, some particles are in tension, and the tensile stresses are in the horizontal direction on which the confinement is applied. The additional confinement by the tensile stress explains the macro strength and dilatancy increase in wet samples.
Wallensten, A; Salter, M; Bennett, S; Brown, I; Hoschler, K; Oliver, I
2010-02-01
Highly pathogenic avian influenza (HPAI) subtype H5N1 remains a public health threat as long as it circulates in wild and domestic birds. Information on the transmissibility of H5N1 HPAI from wild birds is needed for evidence-based public health advice. We investigated if transmission of H5N1 HPAI had taken place in people that had unprotected contact with infected wild mute swans during an incident at the Abbotsbury Swannery in Dorset, England. Thirteen people who had been exposed to infected swans were contacted and actively followed up for symptoms. Serology was taken after 30 days. We did not find evidence of transmission of H5N1 HPAI to humans during the incident. The incident provided a rare opportunity to study the transmissibility of the virus from wild birds to humans.
Directory of Open Access Journals (Sweden)
Majid Bouzari
2014-06-01
Full Text Available Experimental infection of Muscovy ducks with V4 strain of Newcastle disease virus was undertaken to determine the response of the ducks to the virus and the possibility of virus transmission to ducks and chickens in village like conditions. Twelve ducks were randomly and equally divided into three groups of control, inoculated and in-contact. Additionally, the chickens were placed into two groups of four animals each, namely in-contact and control. The inoculated and in-contact ducks and in-contact chickens were kept together. The eye drop route was used for inoculation and hemagglutination inhibition (HI antibodies were measured for assessment of antibody response and cloacal and pharyngeal swabs were used for detection of the virus. The primary antibody response of inoculated ducks was very high and rapid (geometric mean titers [Log base 2] of up to 5.75 ± 0.50. The in-contact ducks showed antibody response with the same pattern but lower titers than the inoculated ducks (geometric mean titers [Log base 2] of up to 3.25 ± 1.70. The in-contact chickens showed a slight increase of HI antibody (geometric mean titers [Log base 2] of up to 2.25 ± 1.25 while the control chickens did not show any increase. The antibody response indicated the transmission of the virus to contact ducks and chickens. A single isolation of virus confirmed the ability of ducks to excrete the virus. It was concluded that the V4 strain of Newcastle disease virus was highly antigenic for ducks, and ducks can transmit it to other ducks and also in-contact chickens.
Chen, S-C; You, Z-S
2015-04-01
School closure is one of the most common interventions in the early weeks of an influenza pandemic. Few studies have investigated social contact patterns and compared individual student contact characteristics during the school term and holiday periods in Taiwan. Here, we conducted a well-used questionnaire survey in a junior high school (grades 7-8) in June 2013. All 150 diary-based effective questionnaires covering conversation and skin-to-skin contact behaviour were surveyed. Two questionnaires for each participant were designed to investigate the individual-level difference of contact numbers per day during the two periods. The questionnaire response rate was 44%. The average number of contacts during term time (20·0 contacts per day) and holiday periods (12·6 contacts per day) were significantly different (P holiday periods, the number of contacts decreased by 40%. This study is the first research to investigate the contact numbers and contact characteristics for school-age children during the school term and a holiday period in Taiwan. With regard to public health, this study could provide the basic contact information and database for modelling influenza epidemics for minimizing the spread of influenza that depends on personal contacts for transmission.
Litvin, F.; Chen, J.; Seol, I.; Kim, D.; Lu, J.; Zhao, X.; Handschuh, R.
1996-01-01
A general approach developed for the computerized simulation of loaded gear drives is presented. In this paper the methodology used to localize the bearing contact, provide a parabolic function of transmission errors, and simulate meshing and contact of unloaded gear drives is developed. The approach developed is applied to spur and helical gears, spiral bevel gears, face-gear drives, and worm-gear drives with cylindrical worms.
International Nuclear Information System (INIS)
Strigini, Lorenzo; Wright, David
2014-01-01
When deciding whether to accept into service a new safety-critical system, or choosing between alternative systems, uncertainty about the parameters that affect future failure probability may be a major problem. This uncertainty can be extreme if there is the possibility of unknown design errors (e.g. in software), or wide variation between nominally equivalent components. We study the effect of parameter uncertainty on future reliability (survival probability), for systems required to have low risk of even only one failure or accident over the long term (e.g. their whole operational lifetime) and characterised by a single reliability parameter (e.g. probability of failure per demand – pfd). A complete mathematical treatment requires stating a probability distribution for any parameter with uncertain value. This is hard, so calculations are often performed using point estimates, like the expected value. We investigate conditions under which such simplified descriptions yield reliability values that are sure to be pessimistic (or optimistic) bounds for a prediction based on the true distribution. Two important observations are (i) using the expected value of the reliability parameter as its true value guarantees a pessimistic estimate of reliability, a useful property in most safety-related decisions; (ii) with a given expected pfd, broader distributions (in a formally defined meaning of “broader”), that is, systems that are a priori “less predictable”, lower the risk of failures or accidents. Result (i) justifies the simplification of using a mean in reliability modelling; we discuss within which scope this justification applies, and explore related scenarios, e.g. how things improve if we can test the system before operation. Result (ii) not only offers more flexible ways of bounding reliability predictions, but also has important, often counter-intuitive implications for decision making in various areas, like selection of components, project management
International Nuclear Information System (INIS)
Queiroz Bogado Leite, S. de.
1989-10-01
A widely used but otherwise physically incorrect assumption in unit-cell calculations by the method of interface currents in cylindrical or spherical geometries, is that of that of isotropic fluxes at the surfaces of the cell annular regions, when computing transmission probabilities. In this work, new interface-current relations are developed without making use of this assumption and the effects on calculated integral parameters are shown for an idealized unit-cell example. (author) [pt
Improvement of Metal-Graphene Ohmic Contact Resistance in Bilayer Epitaxial Graphene Devices
International Nuclear Information System (INIS)
He Ze-Zhao; Yang Ke-Wu; Yu Cui; Li Jia; Liu Qing-Bin; Lu Wei-Li; Feng Zhi-Hong; Cai Shu-Jun
2015-01-01
We report on an improved metal-graphene ohmic contact in bilayer epitaxial graphene on a SiC substrate with contact resistance below 0.1 ω·mm. Monolayer and bilayer epitaxial graphenes are prepared on a 4H-SiC substrate in this work. Their contact resistances are measured by a transfer length method. An improved photoresist-free device fabrication method is used and is compared with the conventional device fabrication method. Compared with the monolayer graphene, the contact resistance R c of bilayer graphene improves from an average of 0.24 ω·mm to 0.1 ω·mm. Ohmic contact formation mechanism analysis by Landauer's approach reveals that the obtained low ohmic contact resistance in bilayer epitaxial graphene is due to their high carrier density, high carrier transmission probability, and p-type doping introduced by contact metal Au. (paper)
International Nuclear Information System (INIS)
Li, M; Zhao, Z B; Fan, L B
2015-01-01
The effect of the Rashba and Dresselhaus spin–orbit coupling (SOC) on the transmission of electrons through the GaN/AlGaN/GaN heterostructure is studied. It is found that the Dresselhaus SOC causes the evident dependence of the transmission probability on the spin polarization and the in-plane wave vector of electrons, and also induces evident spin splitting of the resonant peaks in the (E z -k) plane. Because the magnitude of the Rashba SOC is relatively small, its effect on the transmission of electrons is much less. As k increases, the peaks of transmission probability for spin-up electrons (T + ) shift to a higher energy region and increase in magnitude, while the peaks of transmission probability for spin-down electrons (T − ) shift to a lower energy region and decrease in magnitude. The polarization efficiency (P) is found to peak at the resonant energies and increases with the in-plane wave vector. Moreover, the built-in electric field caused by the spontaneous and piezoelectric polarization can increase the amplitude of P. Results obtained here are helpful for the efficient spin injection into the III-nitride heterostructures by nonmagnetic means from the device point of view. (paper)
Said, Maria A; Haile, Charles; Palabindala, Venkataraman; Barker, Naomi; Myers, Robert; Thompson, Ruth; Wilson, Lucy; Allan-Martinez, Frances; Montgomery, Jay; Monroe, Benjamin; Tack, Danielle; Reynolds, Mary; Damon, Inger; Blythe, David
2013-12-01
Severe adverse events, including eczema vaccinatum (EV), can result after smallpox vaccination. Persons at risk for EV include those with underlying dermatologic conditions, such as atopic dermatitis. We investigated a case of vaccinia infection, possibly acquired during sexual contact with a recently vaccinated military service member, in a female Maryland resident with atopic dermatitis. The U.S. Department of Defense's Vaccine Healthcare Centers Network (VHCN) and the Centers for Disease Control and Prevention (CDC) worked in conjunction with the patient's physician and the Maryland Department of Health and Mental Hygiene (DHMH) to confirm the diagnosis, ensure treatment, and prevent further transmission. Specimens collected from the patient were tested at the DHMH laboratories and were positive by real-time polymerase chain reaction for nonvariola orthopoxvirus. Testing at the CDC verified the presence of vaccinia-specific DNA signatures. Continuing spread of the patient's lesions led to the administration of vaccinia immune globulin and strict infection control measures to prevent tertiary transmission to vulnerable family members, also with atopic dermatitis. VHCN contacted the service member to reinforce vaccination site care and hygiene. This case underscores the importance of prevaccination education for those receiving the smallpox vaccine to protect contacts at risk for developing severe adverse reactions. Reprint & Copyright © 2013 Association of Military Surgeons of the U.S.
Directory of Open Access Journals (Sweden)
Moses Chapa Kiti
Full Text Available Improved understanding and quantification of social contact patterns that govern the transmission dynamics of respiratory viral infections has utility in the design of preventative and control measures such as vaccination and social distancing. The objective of this study was to quantify an age-specific matrix of contact rates for a predominantly rural low-income population that would support transmission dynamic modeling of respiratory viruses.From the population register of the Kilifi Health and Demographic Surveillance System, coastal Kenya, 150 individuals per age group (50 years exhibited the highest inter-generational contacts. Rural contact rates were higher than semiurban (18.8 vs 15.6, p = 0.002, with rural primary school students having twice as many assortative contacts as their semiurban peers.This is the first age-specific contact matrix to be defined for tropical Sub-Saharan Africa and has utility in age-structured models to assess the potential impact of interventions for directly transmitted respiratory infections.
Energy Technology Data Exchange (ETDEWEB)
Ngampitipan, Tritos, E-mail: tritos.ngampitipan@gmail.com [Faculty of Science, Chandrakasem Rajabhat University, Ratchadaphisek Road, Chatuchak, Bangkok 10900 (Thailand); Particle Physics Research Laboratory, Department of Physics, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand); Boonserm, Petarpa, E-mail: petarpa.boonserm@gmail.com [Department of Mathematics and Computer Science, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand); Chatrabhuti, Auttakit, E-mail: dma3ac2@gmail.com [Particle Physics Research Laboratory, Department of Physics, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand); Visser, Matt, E-mail: matt.visser@msor.vuw.ac.nz [School of Mathematics, Statistics, and Operations Research, Victoria University of Wellington, PO Box 600, Wellington 6140 (New Zealand)
2016-06-02
Hawking radiation is the evidence for the existence of black hole. What an observer can measure through Hawking radiation is the transmission probability. In the laboratory, miniature black holes can successfully be generated. The generated black holes are, most commonly, Myers-Perry black holes. In this paper, we will derive the rigorous bounds on the transmission probabilities for massless scalar fields of non-negative-angular-momentum modes emitted from a generated Myers-Perry black hole in six, seven, and eight dimensions. The results show that for low energy, the rigorous bounds increase with the increase in the energy of emitted particles. However, for high energy, the rigorous bounds decrease with the increase in the energy of emitted particles. When the black holes spin faster, the rigorous bounds decrease. For dimension dependence, the rigorous bounds also decrease with the increase in the number of extra dimensions. Furthermore, as comparison to the approximate transmission probability, the rigorous bound is proven to be useful.
International Nuclear Information System (INIS)
Ngampitipan, Tritos; Boonserm, Petarpa; Chatrabhuti, Auttakit; Visser, Matt
2016-01-01
Hawking radiation is the evidence for the existence of black hole. What an observer can measure through Hawking radiation is the transmission probability. In the laboratory, miniature black holes can successfully be generated. The generated black holes are, most commonly, Myers-Perry black holes. In this paper, we will derive the rigorous bounds on the transmission probabilities for massless scalar fields of non-negative-angular-momentum modes emitted from a generated Myers-Perry black hole in six, seven, and eight dimensions. The results show that for low energy, the rigorous bounds increase with the increase in the energy of emitted particles. However, for high energy, the rigorous bounds decrease with the increase in the energy of emitted particles. When the black holes spin faster, the rigorous bounds decrease. For dimension dependence, the rigorous bounds also decrease with the increase in the number of extra dimensions. Furthermore, as comparison to the approximate transmission probability, the rigorous bound is proven to be useful.
Modeling of Viral Aerosol Transmission and Detection
Khalid, Maryam; Amin, Osama; Ahmed, Sajid; Alouini, Mohamed-Slim
2018-01-01
The objective of this work is to investigate the spread mechanism of diseases in the atmosphere as an engineering problem. Among the viral transmission mechanisms that do not include physical contact, aerosol transmission is the most significant mode of transmission where virus-laden droplets are carried over long distances by wind. In this work, we focus on aerosol transmission of virus and introduce the idea of viewing virus transmission through aerosols and their transport as a molecular communication problem, where one has no control over transmission source but a robust receiver can be designed using nano-biosensors. To investigate this idea, a complete system is presented and end-toend mathematical model for the aerosol transmission channel is derived under certain constraints and boundary conditions. In addition to transmitter and channel, a receiver architecture composed of air sampler and Silicon Nanowire field effect transistor is also discussed. Furthermore, a detection problem is formulated for which maximum likelihood decision rule and the corresponding missed detection probability is discussed. At the end, simulation results are presented to investigate the parameters that affect the performance and justify the feasibility of proposed setup in related applications.
Pertussis post-exposure prophylaxis among household contacts: a cost-utility analysis.
Directory of Open Access Journals (Sweden)
Nisha Thampi
Full Text Available Recent pertussis outbreaks have prompted re-examination of post-exposure prophylaxis (PEP strategies, when immunization is not immediately protective. Chemoprophylaxis is recommended to household contacts; however there are concerns of clinical failure and significant adverse events, especially with erythromycin among infants who have the highest disease burden. Newer macrolides offer fewer side effects at higher drug costs. We sought to determine the cost-effectiveness of PEP strategies from the health care payer perspective.A Markov model was constructed to examine 4 mutually exclusive strategies: erythromycin, azithromycin, clarithromycin, or no intervention, stratified by age group of contacts ("infant", "child", and "adult". Transition probabilities, costs and quality-adjusted life years (QALYs were derived from the literature. Chronic neurologic sequelae were modeled over a lifetime, with costs and QALYs discounted at 5%. Associated health outcomes and costs were compared, and incremental cost-effectiveness ratios (ICER were calculated in 2012 Canadian dollars. Deterministic and probabilistic sensitivity analyses were performed to evaluate the degree of uncertainty in the results.Azithromycin offered the highest QALYs in all scenarios. While this was the dominant strategy among infants, it produced an ICER of $16,963 per QALY among children and $2,415 per QALY among adults. Total QALYs with azithromycin were 19.7 for a 5-kg infant, 19.4 for a 10-year-old child, and 18.8 for a 30-year-old adult. The costs of azithromycin PEP among infants, children and adults were $1,976, $132 and $90, respectively. While results were sensitive to changes in PEP effectiveness (11% to 87%, disease transmission (variable among age groups and hospitalization costs ($379 to $59,644, the choice of strategy remained unchanged.Pertussis PEP is a cost-effective strategy compared with no intervention and plays an important role in contact management, potentially in
Dynamic Variation in Sexual Contact Rates in a Cohort of HIV-Negative Gay Men.
Romero-Severson, E O; Volz, E; Koopman, J S; Leitner, T; Ionides, E L
2015-08-01
Human immunodeficiency virus (HIV) transmission models that include variability in sexual behavior over time have shown increased incidence, prevalence, and acute-state transmission rates for a given population risk profile. This raises the question of whether dynamic variation in individual sexual behavior is a real phenomenon that can be observed and measured. To study this dynamic variation, we developed a model incorporating heterogeneity in both between-person and within-person sexual contact patterns. Using novel methodology that we call iterated filtering for longitudinal data, we fitted this model by maximum likelihood to longitudinal survey data from the Centers for Disease Control and Prevention's Collaborative HIV Seroincidence Study (1992-1995). We found evidence for individual heterogeneity in sexual behavior over time. We simulated an epidemic process and found that inclusion of empirically measured levels of dynamic variation in individual-level sexual behavior brought the theoretical predictions of HIV incidence into closer alignment with reality given the measured per-act probabilities of transmission. The methods developed here provide a framework for quantifying variation in sexual behaviors that helps in understanding the HIV epidemic among gay men. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Dynamics of social contagions with limited contact capacity.
Wang, Wei; Shu, Panpan; Zhu, Yu-Xiao; Tang, Ming; Zhang, Yi-Cheng
2015-10-01
Individuals are always limited by some inelastic resources, such as time and energy, which restrict them to dedicate to social interaction and limit their contact capacities. Contact capacity plays an important role in dynamics of social contagions, which so far has eluded theoretical analysis. In this paper, we first propose a non-Markovian model to understand the effects of contact capacity on social contagions, in which each adopted individual can only contact and transmit the information to a finite number of neighbors. We then develop a heterogeneous edge-based compartmental theory for this model, and a remarkable agreement with simulations is obtained. Through theory and simulations, we find that enlarging the contact capacity makes the network more fragile to behavior spreading. Interestingly, we find that both the continuous and discontinuous dependence of the final adoption size on the information transmission probability can arise. There is a crossover phenomenon between the two types of dependence. More specifically, the crossover phenomenon can be induced by enlarging the contact capacity only when the degree exponent is above a critical degree exponent, while the final behavior adoption size always grows continuously for any contact capacity when degree exponent is below the critical degree exponent.
Transmission of MERS-coronavirus in household contacts
Drosten, Christian; Meyer, Benjamin; Müller, Marcel A; Corman, Victor M; Al-Masri, Malak; Hossain, Raheela; Madani, Hosam; Sieberg, Andrea; Bosch, Berend Jan|info:eu-repo/dai/nl/273306049; Lattwein, Erik; Alhakeem, Raafat F; Assiri, Abdullah M; Hajomar, Waleed; Albarrak, Ali M; Al-Tawfiq, Jaffar A; Zumla, Alimuddin I; Memish, Ziad A
2014-01-01
BACKGROUND: Strategies to contain the Middle East respiratory syndrome coronavirus (MERS-CoV) depend on knowledge of the rate of human-to-human transmission, including subclinical infections. A lack of serologic tools has hindered targeted studies of transmission. METHODS: We studied 26 index
Directory of Open Access Journals (Sweden)
Susan Hahné
Full Text Available BACKGROUND & AIMS: In the Netherlands, a selective hepatitis B virus (HBV vaccination programme started in 2002 for men having sex with men, drug users, commercial sex workers and heterosexuals with frequent partner changes. We assessed the programme's effectiveness to guide policy on HBV prevention. METHODS: We analysed reports of acute HBV infection in the Netherlands between 2004 and 2010 requesting serum from patients for HBV-genome S- and C-region sequencing. We used coalescence analyses to assess genetic diversity of nonimported genotype-A cases over time. RESULTS: 1687 patients with acute HBV infection were reported between 2004 and 2010. The incidence of reported acute HBV infection decreased from 1.8 to 1.2 per 100,000 inhabitants, mostly due to a reduction in the number of cases in men who have sex with men. Men were overrepresented among cases with an unknown route of transmission, especially among genotype A2 cases mainly associated with transmission through male homosexual contact. The genetic diversity of nonimported genotype-A strains obtained from men who have sex with men decreased from 2006 onwards, suggesting HBV incidence in this group decreased. CONCLUSIONS: The selective HBV-vaccination programme for behavioural high-risk groups very likely reduced the incidence of HBV infection in the Netherlands mainly by preventing HBV infections in men who have sex with men. A considerable proportion of cases in men who did not report risk behaviour was probably acquired through homosexual contact. Our findings support continuation of the programme, and adopting similar approaches in other countries where HBV transmission is focused in high-risk adults.
Koedijk, Femke; van Ballegooijen, Marijn; Cremer, Jeroen; Bruisten, Sylvia; Coutinho, Roel
2013-01-01
Background & Aims In the Netherlands, a selective hepatitis B virus (HBV) vaccination programme started in 2002 for men having sex with men, drug users, commercial sex workers and heterosexuals with frequent partner changes. We assessed the programme's effectiveness to guide policy on HBV prevention. Methods We analysed reports of acute HBV infection in the Netherlands between 2004 and 2010 requesting serum from patients for HBV-genome S- and C-region sequencing. We used coalescence analyses to assess genetic diversity of nonimported genotype-A cases over time. Results 1687 patients with acute HBV infection were reported between 2004 and 2010. The incidence of reported acute HBV infection decreased from 1.8 to 1.2 per 100,000 inhabitants, mostly due to a reduction in the number of cases in men who have sex with men. Men were overrepresented among cases with an unknown route of transmission, especially among genotype A2 cases mainly associated with transmission through male homosexual contact. The genetic diversity of nonimported genotype-A strains obtained from men who have sex with men decreased from 2006 onwards, suggesting HBV incidence in this group decreased. Conclusions The selective HBV-vaccination programme for behavioural high-risk groups very likely reduced the incidence of HBV infection in the Netherlands mainly by preventing HBV infections in men who have sex with men. A considerable proportion of cases in men who did not report risk behaviour was probably acquired through homosexual contact. Our findings support continuation of the programme, and adopting similar approaches in other countries where HBV transmission is focused in high-risk adults. PMID:23922651
Projecting social contact matrices in 152 countries using contact surveys and demographic data.
Directory of Open Access Journals (Sweden)
Kiesha Prem
2017-09-01
Full Text Available Heterogeneities in contact networks have a major effect in determining whether a pathogen can become epidemic or persist at endemic levels. Epidemic models that determine which interventions can successfully prevent an outbreak need to account for social structure and mixing patterns. Contact patterns vary across age and locations (e.g. home, work, and school, and including them as predictors in transmission dynamic models of pathogens that spread socially will improve the models' realism. Data from population-based contact diaries in eight European countries from the POLYMOD study were projected to 144 other countries using a Bayesian hierarchical model that estimated the proclivity of age-and-location-specific contact patterns for the countries, using Markov chain Monte Carlo simulation. Household level data from the Demographic and Health Surveys for nine lower-income countries and socio-demographic factors from several on-line databases for 152 countries were used to quantify similarity of countries to estimate contact patterns in the home, work, school and other locations for countries for which no contact data are available, accounting for demographic structure, household structure where known, and a variety of metrics including workforce participation and school enrolment. Contacts are highly assortative with age across all countries considered, but pronounced regional differences in the age-specific contacts at home were noticeable, with more inter-generational contacts in Asian countries than in other settings. Moreover, there were variations in contact patterns by location, with work-place contacts being least assortative. These variations led to differences in the effect of social distancing measures in an age structured epidemic model. Contacts have an important role in transmission dynamic models that use contact rates to characterize the spread of contact-transmissible diseases. This study provides estimates of mixing patterns for
Projecting social contact matrices in 152 countries using contact surveys and demographic data.
Prem, Kiesha; Cook, Alex R; Jit, Mark
2017-09-01
Heterogeneities in contact networks have a major effect in determining whether a pathogen can become epidemic or persist at endemic levels. Epidemic models that determine which interventions can successfully prevent an outbreak need to account for social structure and mixing patterns. Contact patterns vary across age and locations (e.g. home, work, and school), and including them as predictors in transmission dynamic models of pathogens that spread socially will improve the models' realism. Data from population-based contact diaries in eight European countries from the POLYMOD study were projected to 144 other countries using a Bayesian hierarchical model that estimated the proclivity of age-and-location-specific contact patterns for the countries, using Markov chain Monte Carlo simulation. Household level data from the Demographic and Health Surveys for nine lower-income countries and socio-demographic factors from several on-line databases for 152 countries were used to quantify similarity of countries to estimate contact patterns in the home, work, school and other locations for countries for which no contact data are available, accounting for demographic structure, household structure where known, and a variety of metrics including workforce participation and school enrolment. Contacts are highly assortative with age across all countries considered, but pronounced regional differences in the age-specific contacts at home were noticeable, with more inter-generational contacts in Asian countries than in other settings. Moreover, there were variations in contact patterns by location, with work-place contacts being least assortative. These variations led to differences in the effect of social distancing measures in an age structured epidemic model. Contacts have an important role in transmission dynamic models that use contact rates to characterize the spread of contact-transmissible diseases. This study provides estimates of mixing patterns for societies for which
International Nuclear Information System (INIS)
Landau, A.; Nitzan, A.
2006-01-01
Full Text: Molecular electronics, one of the major fields of the current effort in nano-science, may be de ed as the study of electronic behaviors, devices and applications that depend on the properties of matter at the molecular scale. If the miniaturization trend of microelectronic devices is to continue, elements such as transistors and contacts will soon shrink to single molecules. The promise of these new technological breakthroughs has been major driving force in this ld. Moreover, the consideration of molecular systems as electronic devices has raised new fundamental questions. In particular, while traditional quantum chemistry deals with electronically closed systems, we now face problems involving molecular systems that are open to their electronic environment, moreover, function in far from equilibrium situations. A generic molecular junction is made of two electrodes connected by a molecular spacer that takes the form of a molecular chain of varying length or a molecular layer of varying thickness. We use a simple nearest-neighbors tight-biding model with the non-equilibrium Green's function (NEGF) method to investigate and compare between a self-assembled monolayer (SAM), finite molecular layer (FML), and single molecule (SM) chemisorption to a surface of a metal substrate. In addition, we examine the difference in the transmission probability through a SAM, FML and SM sandwiched between two metallic electrodes. Dramatic differences are observed between the SM, FML and SAM density of electronic states and transmission functions. In addition, we analyze the effects of changing different physical parameters such as molecule-substrate interaction, molecule-molecule interactions, etc; interesting effects that pertain to the conduction properties of single molecules and molecular layers are observed. Intriguing results are attained when we investigate the commensurability of the SAM with the metallic surface
Objects in contact with classical scrapie sheep act as a reservoir for scrapie transmission
Directory of Open Access Journals (Sweden)
Timm eKonold
2015-09-01
Full Text Available Classical scrapie is an environmentally transmissible prion disease of sheep and goats. Prions can persist and remain potentially infectious in the environment for many years and thus pose a risk of infecting animals after re-stocking. In vitro studies using serial Protein Misfolding Cyclic Amplification (sPMCA have suggested that objects on a scrapie-affected sheep farm could contribute to disease transmission. This in vivo study aimed to determine the role of field furniture (water troughs, feeding troughs, fencing and other objects that sheep may rub against used by a scrapie-infected sheep flock as a vector for disease transmission to scrapie-free lambs with the prion protein genotype VRQ/VRQ, which is associated with high susceptibility to classical scrapie. When the field furniture was placed in clean accommodation sheep became infected when exposed to either a water trough (four out of five or to objects used for rubbing (four out of seven. This field furniture had been used by the scrapie-infected flock eight weeks earlier and had previously been shown to harbor scrapie prions by sPMCA. Sheep also became infected (20 out of 23 through exposure to contaminated field furniture placed within pasture not used by scrapie-infected sheep for 40 months, even though swabs from this furniture tested negative by PMCA. This infection rate decreased (1 out of 12 on the same paddock after replacement with clean field furniture. Twelve grazing sheep exposed to field furniture not in contact with scrapie-infected sheep for 18 months remained scrapie-free.The findings of this study highlight the role of field furniture used by scrapie-infected sheep to act as a reservoir for disease re-introduction although infectivity declines considerably if the field furniture has not been in contact with scrapie-infected sheep for several months. PMCA may not be as sensitive as VRQ/VRQ sheep to test for environmental contamination.
Romero-Montoya, Marcela; Beltran-Alzate, Juan Camilo; Cardona-Castro, Nora
2017-01-01
Leprosy in Colombia is in a stage of post elimination-since 1997, prevalence of the disease is less than 1/10000. However, the incidence of leprosy has remained stable, with 400-500 new cases reported annually, with MB leprosy representing 70% of these case and 10% having grade 2 disability. Thus, leprosy transmission is still occurring, and household contacts (HHCs) of leprosy patients are a population at high risk of contracting and suffering from the effects of the disease during their lifetime. We performed a cross-sectional study with the aim of evaluating leprosy transmission within Family Groups (FGs) from four Colombian departments: Antioquia, Bolívar, Córdoba and Sucre. This study included 159 FGs formed by 543 HHCs; 45 FGs were monitored twice, first in 2003 and again in 2012. Migration, forced displacement by violence, loss of contact with the health center and the lack of an agreement to participate in the second monitoring were the primary reasons not all FGs were tested a second time. In each HHC, a clinical examination was performed, epidemiological data recorded, the bacillary index determined, DNA was isolated for M. leprae detection by nested PCR and IgM anti-phenolic glycolipid-I (PGL-I) titers were inspected. Further, DNA from M. leprae isolates were typed and compared among FGs. Twenty-two (4.1%) of the 543 HHCs had IgM anti-PGL-I positive antibody titers, indicating infection. Nasal swabs (NS) taken from 113 HHCs were tested by RLEP PCR; 18 (16%) were positive for M. leprae DNA and two new leprosy cases were detected among the HHCs. Of the confirmed HHCs with leprosy, it was possible to genotype the bacterial strains from both the index case and their HHCs. We found that the genotype of these two strains agreed at 9 markers, showing the individuals to be infected by the same strain, indicating familiar transmission. HHCs of leprosy patients not only are a high-risk population for M. leprae infection, they can act as M. leprae carriers and
Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.
Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun
2015-12-30
A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.
Wibawa, Hendra; Karo-Karo, Desniwaty; Pribadi, Eko Sugeng; Bouma, Annemarie; Bodewes, Rogier; Vernooij, Hans; Diyantoro; Sugama, Agus; Muljono, David H; Koch, Guus; Tjatur Rasa, Fadjar Sumping; Stegeman, Arjan
2018-08-01
Highly pathogenic avian influenza virus (HPAIV) H5N1 has been reported in Asia, including Indonesia since 2003. Although several risk factors related to the HPAIV outbreaks in poultry in Indonesia have been identified, little is known of the contact structure of farms of different poultry production types (backyard chickens, broilers, layers, and ducks). This study aims to quantify the contact rates associated with the movement of people, and movements of live birds and products and equipment that affect the risk of HPAIV H5N1 transmission between poultry farms in Indonesia. On 124 poultry farms in 6 districts in West Java, logbooks were distributed to record the movements of farmers/staff and visitors and their poultry contacts. Most movements in backyard chicken, commercial native chicken, broiler and duck farms were visits to and from other poultry farms, whilst in layer farms visits to and from poultry companies, visits to egg collection houses and visit from other poultry farms were most frequent. Over 75% of persons visiting backyard chicken and duck farms had previously visited other poultry farms on the same day. Visitors of backyard chicken farms had the highest average contact rate, either direct contact with poultry on other farms before the visits (1.35 contact/day) or contact during their visits in the farms (10.03 contact/day). These results suggest that backyard chicken farms are most at risk for transmission of HPAIV compared to farms of the other poultry production types. Since visits of farm-to-farm were high, backyard farms could also a potential source for HPAIV transmission to commercial poultry farms. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
The effect of contact precautions on healthcare worker activity in acute care hospitals.
Morgan, Daniel J; Pineles, Lisa; Shardell, Michelle; Graham, Margaret M; Mohammadi, Shahrzad; Forrest, Graeme N; Reisinger, Heather S; Schweizer, Marin L; Perencevich, Eli N
2013-01-01
Contact precautions are a cornerstone of infection prevention but have also been associated with less healthcare worker (HCW) contact and adverse events. We studied how contact precautions modified HCW behavior in 4 acute care facilities. Prospective cohort study. Four acute care facilities in the United States performing active surveillance for methicillin-resistant Staphylococcus aureus. Trained observers performed "secret shopper" monitoring of HCW activities during routine care, using a standardized collection tool and fixed 1-hour observation periods. A total of 7,743 HCW visits were observed over 1,989 hours. Patients on contact precautions had 36.4% fewer hourly HCW visits than patients not on contact precautions (2.78 vs 4.37 visits per hour; [Formula: see text]) as well as 17.7% less direct patient contact time with HCWs (13.98 vs 16.98 minutes per hour; [Formula: see text]). Patients on contact precautions tended to have fewer visitors (23.6% fewer; [Formula: see text]). HCWs were more likely to perform hand hygiene on exiting the room of a patient on contact precautions (63.2% vs 47.4% in rooms of patients not on contact precautions; [Formula: see text]). Contact precautions were found to be associated with activities likely to reduce transmission of resistant pathogens, such as fewer visits and better hand hygiene at exit, while exposing patients on contact precautions to less HCW contact, less visitor contact, and potentially other unintended outcomes.
Clustering of contacts relevant to the spread of infectious disease.
Xiao, Xiong; van Hoek, Albert Jan; Kenward, Michael G; Melegaro, Alessia; Jit, Mark
2016-12-01
Infectious disease spread depends on contact rates between infectious and susceptible individuals. Transmission models are commonly informed using empirically collected contact data, but the relevance of different contact types to transmission is still not well understood. Some studies select contacts based on a single characteristic such as proximity (physical/non-physical), location, duration or frequency. This study aimed to explore whether clusters of contacts similar to each other across multiple characteristics could better explain disease transmission. Individual contact data from the POLYMOD survey in Poland, Great Britain, Belgium, Finland and Italy were grouped into clusters by the k medoids clustering algorithm with a Manhattan distance metric to stratify contacts using all four characteristics. Contact clusters were then used to fit a transmission model to sero-epidemiological data for varicella-zoster virus (VZV) in each country. Across the five countries, 9-15 clusters were found to optimise both quality of clustering (measured using average silhouette width) and quality of fit (measured using several information criteria). Of these, 2-3 clusters were most relevant to VZV transmission, characterised by (i) 1-2 clusters of age-assortative contacts in schools, (ii) a cluster of less age-assortative contacts in non-school settings. Quality of fit was similar to using contacts stratified by a single characteristic, providing validation that single stratifications are appropriate. However, using clustering to stratify contacts using multiple characteristics provided insight into the structures underlying infection transmission, particularly the role of age-assortative contacts, involving school age children, for VZV transmission between households. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Liu Guoming [Department of Nuclear Engineering, Xi' an Jiaotong University, Xi' an, Shaanxi 710049 (China)], E-mail: gmliusy@gmail.com; Wu Hongchun; Cao Liangzhi [Department of Nuclear Engineering, Xi' an Jiaotong University, Xi' an, Shaanxi 710049 (China)
2008-09-15
This paper presents a transmission probability method (TPM) to solve the neutron transport equation in three-dimensional triangular-z geometry. The source within the mesh is assumed to be spatially uniform and isotropic. At the mesh surface, the constant and the simplified P{sub 1} approximation are invoked for the anisotropic angular flux distribution. Based on this model, a code TPMTDT is encoded. It was verified by three 3D Takeda benchmark problems, in which the first two problems are in XYZ geometry and the last one is in hexagonal-z geometry, and an unstructured geometry problem. The results of the present method agree well with those of Monte-Carlo calculation method and Spherical Harmonics (P{sub N}) method.
Yilmaz, Ferkan; Kucur, Oǧuz; Alouini, Mohamed-Slim
2010-01-01
In this paper, we propose an analytical framework on the exact computation of the average symbol error probabilities (ASEP) of multihop transmission over generalized fading channels when an arbitrary number of amplify-and-forward relays is used. Our approach relies on moment generating function (MGF) framework to obtain exact single integral expressions which can be easily computed by Gauss-Chebyshev Quadrature (GCQ) rule. As such, the derived results are a convenient tool to analyze the ASEP performance of multihop transmission over amplify-and-forward relay fading channels. Numerical and simulation results, performed to verify the correctness of the proposed formulation, are in perfect agreement. © 2010 IEEE.
Yilmaz, Ferkan
2010-09-01
In this paper, we propose an analytical framework on the exact computation of the average symbol error probabilities (ASEP) of multihop transmission over generalized fading channels when an arbitrary number of amplify-and-forward relays is used. Our approach relies on moment generating function (MGF) framework to obtain exact single integral expressions which can be easily computed by Gauss-Chebyshev Quadrature (GCQ) rule. As such, the derived results are a convenient tool to analyze the ASEP performance of multihop transmission over amplify-and-forward relay fading channels. Numerical and simulation results, performed to verify the correctness of the proposed formulation, are in perfect agreement. © 2010 IEEE.
Household Transmission of Vibrio cholerae in Bangladesh.
Directory of Open Access Journals (Sweden)
Jonathan D Sugimoto
2014-11-01
Full Text Available Vibrio cholerae infections cluster in households. This study's objective was to quantify the relative contribution of direct, within-household exposure (for example, via contamination of household food, water, or surfaces to endemic cholera transmission. Quantifying the relative contribution of direct exposure is important for planning effective prevention and control measures.Symptom histories and multiple blood and fecal specimens were prospectively collected from household members of hospital-ascertained cholera cases in Bangladesh from 2001-2006. We estimated the probabilities of cholera transmission through 1 direct exposure within the household and 2 contact with community-based sources of infection. The natural history of cholera infection and covariate effects on transmission were considered. Significant direct transmission (p-value<0.0001 occurred among 1414 members of 364 households. Fecal shedding of O1 El Tor Ogawa was associated with a 4.9% (95% confidence interval: 0.9%-22.8% risk of infection among household contacts through direct exposure during an 11-day infectious period (mean length. The estimated 11-day risk of O1 El Tor Ogawa infection through exposure to community-based sources was 2.5% (0.8%-8.0%. The corresponding estimated risks for O1 El Tor Inaba and O139 infection were 3.7% (0.7%-16.6% and 8.2% (2.1%-27.1% through direct exposure, and 3.4% (1.7%-6.7% and 2.0% (0.5%-7.3% through community-based exposure. Children under 5 years-old were at elevated risk of infection. Limitations of the study may have led to an underestimation of the true risk of cholera infection. For instance, available covariate data may have incompletely characterized levels of pre-existing immunity to cholera infection. Transmission via direct exposure occurring outside of the household was not considered.Direct exposure contributes substantially to endemic transmission of symptomatic cholera in an urban setting. We provide the first estimate of
Duval, Audrey; Obadia, Thomas; Martinet, Lucie; Boëlle, Pierre-Yves; Fleury, Eric; Guillemot, Didier; Opatowski, Lulla; Temime, Laura
2018-01-26
Understanding transmission routes of hospital-acquired infections (HAI) is key to improve their control. In this context, describing and analyzing dynamic inter-individual contact patterns in hospitals is essential. In this study, we used wearable sensors to detect Close Proximity Interactions (CPIs) among patients and hospital staff in a 200-bed long-term care facility over 4 months. First, the dynamic CPI data was described in terms of contact frequency and duration per individual status or activity and per ward. Second, we investigated the individual factors associated with high contact frequency or duration using generalized linear mixed-effect models to account for inter-ward heterogeneity. Hospital porters and physicians had the highest daily number of distinct contacts, making them more likely to disseminate HAI among individuals. Conversely, contact duration was highest between patients, with potential implications in terms of HAI acquisition risk. Contact patterns differed among hospital wards, reflecting varying care patterns depending on reason for hospitalization, with more frequent contacts in neurologic wards and fewer, longer contacts in geriatric wards. This study is the first to report proximity-sensing data informing on inter-individual contacts in long-term care settings. Our results should help better understand HAI spread, parameterize future mathematical models, and propose efficient control strategies.
Transmission Dynamics of Methicillin-Resistant Staphylococcus aureus in Pigs
Crombé, Florence; Argudín, M. Angeles; Vanderhaeghen, Wannes; Hermans, Katleen; Haesebrouck, Freddy; Butaye, Patrick
2013-01-01
From the mid-2000s on, numerous studies have shown that methicillin-resistant Staphylococcus aureus (MRSA), renowned as human pathogen, has a reservoir in pigs and other livestock. In Europe and North America, clonal complex (CC) 398 appears to be the predominant lineage involved. Especially worrisome is its capacity to contaminate humans in close contact with affected animals. Indeed, the typical multi-resistant phenotype of MRSA CC398 and its observed ability of easily acquiring genetic material suggests that MRSA CC398 strains with an increased virulence potential may emerge, for which few therapeutic options would remain. This questions the need to implement interventions to control the presence and spread of MRSA CC398 among pigs. MRSA CC398 shows a high but not fully understood transmission potential in the pig population and is able to persist within that population. Although direct contact is probably the main route for MRSA transmission between pigs, also environmental contamination, the presence of other livestock, the herd size, and farm management are factors that may be involved in the dissemination of MRSA CC398. The current review aims at summarizing the research that has so far been done on the transmission dynamics and risk factors for introduction and persistence of MRSA CC398 in farms. PMID:23518663
Hydrogen transmission/storage with a metal hydride/organic slurry
Energy Technology Data Exchange (ETDEWEB)
Breault, R.W.; Rolfe, J.; McClaine, A. [Thermo Power Corp., Waltham, MA (United States)
1998-08-01
Thermo Power Corporation has developed a new approach for the production, transmission, and storage of hydrogen. In this approach, a chemical hydride slurry is used as the hydrogen carrier and storage media. The slurry protects the hydride from unanticipated contact with moisture in the air and makes the hydride pumpable. At the point of storage and use, a chemical hydride/water reaction is used to produce high-purity hydrogen. An essential feature of this approach is the recovery and recycle of the spent hydride at centralized processing plants, resulting in an overall low cost for hydrogen. This approach has two clear benefits: it greatly improves energy transmission and storage characteristics of hydrogen as a fuel, and it produces the hydrogen carrier efficiently and economically from a low cost carbon source. The preliminary economic analysis of the process indicates that hydrogen can be produced for $3.85 per million Btu based on a carbon cost of $1.42 per million Btu and a plant sized to serve a million cars per day. This compares to current costs of approximately $9.00 per million Btu to produce hydrogen from $3.00 per million Btu natural gas, and $25 per million Btu to produce hydrogen by electrolysis from $0.05 per Kwh electricity. The present standard for production of hydrogen from renewable energy is photovoltaic-electrolysis at $100 to $150 per million Btu.
Vermeltfoort, Pit B J; Hooymans, Johanna M M; Busscher, Henk J; van der Mei, Henny C
2008-10-01
The killing efficacies of multipurpose lens care solutions on planktonic and biofilm bacteria grown in polypropylene contact lens storage cases with and without silver impregnation and effects on bacterial transmission from storage cases to silicone hydrogel contact lenses were investigated. For transmission studies, biofilms of Staphylococcus aureus 835 or Pseudomonas aeruginosa no. 3 were grown on lens storage cases and incubated with a contact lens in different multipurpose lens care solutions (Opti-Free(R)Express(R), ReNu(R) MultiPlus(R), and SoloCare Aquatrade mark) or 0.9% NaCl. In addition, planktonic bacteria were directly suspended in multipurpose solutions and their killing efficacies were determined. The numbers of transmitted live and dead bacteria on the lenses were measured using a combination of plate counting and fluorescence microscopy. The highest killing efficacies were shown by Opti-Free(R) Express(R) for planktonic as well as for biofilm bacteria. Silver impregnation of lens cases in combination with the prescribed solution increased the killing efficacy for P. aeruginosa in biofilms, whereas effects for S. aureus were minor. Lowest numbers of live and dead bacteria were transmitted to a lens in Opti-Free(R) Express(R) multipurpose solution, with no significant differences between lens types and no effects of silver impregnation. (c) 2008 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater 2008. (c) 2008 Wiley Periodicals, Inc.
Tachibana, Tomihisa; Tanahashi, Katsuto; Mochizuki, Toshimitsu; Shirasawa, Katsuhiko; Takato, Hidetaka
2018-04-01
Bifacial interdigitated-back-contact (IBC) silicon solar cells with a high bifaciality of 0.91 were fabricated. Screen printing and firing technology were used to reduce the production cost. For the first time, the relationship between the rear side structure and carrier collection probability was evaluated using internal quantum efficiency (IQE) mapping. The measurement results showed that the screen-printed electrode and back surface field (BSF) area led to low IQE. The low carrier collection probability by BSF area can be explained by electrical shading effects. Thus, it is clear that the IQE mapping system is useful to evaluate the IBC cell.
Kuhn, Susan; Twele-Montecinos, Loreto; MacDonald, Judy; Webster, Patricia; Law, Barbara
2011-01-01
The 17D yellow fever vaccine is a live-virus vaccine that has been in use since the 1940s. The incidence of encephalitis after yellow fever vaccination among young infants is much higher than among children older than nine months of age. Until recently, avoidance of vaccination by breastfeeding women who have received yellow fever vaccine had been based on theoretical grounds only. We report the probable transmission of vaccine strain of yellow fever virus from a mother to her infant through ...
Nest Mosquito Trap quantifies contact rates between nesting birds and mosquitoes.
Caillouët, Kevin A; Riggan, Anna E; Rider, Mark; Bulluck, Lesley P
2012-06-01
Accurate estimates of host-vector contact rates are required for precise determination of arbovirus transmission intensity. We designed and tested a novel mosquito collection device, the Nest Mosquito Trap (NMT), to collect mosquitoes as they attempt to feed on unrestrained nesting birds in artificial nest boxes. In the laboratory, the NMT collected nearly one-third of the mosquitoes introduced to the nest boxes. We then used these laboratory data to estimate our capture efficiency of field-collected bird-seeking mosquitoes collected over 66 trap nights. We estimated that 7.5 mosquitoes per trap night attempted to feed on nesting birds in artificial nest boxes. Presence of the NMT did not have a negative effect on avian nest success when compared to occupied nest boxes that were not sampled with the trap. Future studies using the NMT may elucidate the role of nestlings in arbovirus transmission and further refine estimates of nesting bird and vector contact rates. © 2012 The Society for Vector Ecology.
Toward a generalized probability theory: conditional probabilities
International Nuclear Information System (INIS)
Cassinelli, G.
1979-01-01
The main mathematical object of interest in the quantum logic approach to the foundations of quantum mechanics is the orthomodular lattice and a set of probability measures, or states, defined by the lattice. This mathematical structure is studied per se, independently from the intuitive or physical motivation of its definition, as a generalized probability theory. It is thought that the building-up of such a probability theory could eventually throw light on the mathematical structure of Hilbert-space quantum mechanics as a particular concrete model of the generalized theory. (Auth.)
Energy Technology Data Exchange (ETDEWEB)
Heland, Joerg; Rick, Frank; Sarnes, Bernhard [DB Systemtechnik GmbH, Muenchen (Germany); Puschmann, Rainer [Siemens AG, Erlangen (Germany). Infrastructure and Cities
2012-07-15
The reliable energy transmission from overhead contact line to pantograph of traction units without interruption decides on the successful operation of high-speed railway lines. Measurements of contact wire position and contact forces are suited to assess interaction of overhead contact line and pantograph. Chinese Railways actually implement the biggest electrification program for high-speed lines worldwide. For these projects contact wire position and contact forces are monitored by procedures developed in Germany. The experience confirms that keeping the contact wire position within the specified limits lead to a superior energy transmission up to 350 km/h. (orig.)
Directory of Open Access Journals (Sweden)
E. Santermans
2015-06-01
Full Text Available The basic reproduction number R0 and the effective reproduction number R are pivotal parameters in infectious disease epidemiology, quantifying the transmission potential of an infection in a population. We estimate both parameters from 13 pre-vaccination serological data sets on varicella zoster virus (VZV in 12 European countries and from population-based social contact surveys under the commonly made assumptions of endemic and demographic equilibrium. The fit to the serology is evaluated using the inferred effective reproduction number R as a model eligibility criterion combined with AIC as a model selection criterion. For only 2 out of 12 countries, the common choice of a constant proportionality factor is sufficient to provide a good fit to the seroprevalence data. For the other countries, an age-specific proportionality factor provides a better fit, assuming physical contacts lasting longer than 15 min are a good proxy for potential varicella transmission events. In all countries, primary infection with VZV most often occurs in early childhood, but there is substantial variation in transmission potential with R0 ranging from 2.8 in England and Wales to 7.6 in The Netherlands. Two non-parametric methods, the maximal information coefficient (MIC and a random forest approach, are used to explain these differences in R0 in terms of relevant country-specific characteristics. Our results suggest an association with three general factors: inequality in wealth, infant vaccination coverage and child care attendance. This illustrates the need to consider fundamental differences between European countries when formulating and parameterizing infectious disease models.
Directory of Open Access Journals (Sweden)
Ifeanyi-Stanley Muoghalu
2017-07-01
Full Text Available IntroductionSierra Leone experienced an unprecedented Ebola virus disease (EVD outbreak in all its districts. Koinadugu District was the last to report an EVD case. Several outbreak response strategies were implemented. As part of lessons learnt, we conducted an observational study to describe the transmission chain in the district and the impact of the control measures implemented to contain the outbreak.MethodsWe reconstructed the transmission chain, positioning both confirmed and probable cases, described the distribution of the EVD confirmed cases in the context of the routes of transmission (Community, Funeral or Health facility setting and assessed the impact of control measures using the surveillance data collected during the outbreak.ResultsAll 142 confirmed and probable EVD cases registered were fully resolved in the transmission chain. 72.5% of all the EVD cases in the district were exposed in the community, 26.1% exposed during funerals, and 1.4% exposed in the health facility setting. Health-care workers contributed little to the EVD outbreak. 71.1% of EVD transmission occurred among family members. Female EVD cases generated more secondary cases than their male counterparts (P = 0.03. With removal of EVD cases from the community and admission to the community care center (CCC, the EVD transmission in the community decreased to substantially lower rates. In addition, transmission due to exposure in health facilities was further reduced with the implementation of full infection and prevention controls.ConclusionThis study details the transmission chain of EVD in a rural district setting and the public health interventions implemented to successfully limit the outbreak to just one of 11 chiefdoms. Heightened community-based surveillance for early case detection, swift isolation of suspect cases, efficient contact tracing and monitoring, and good infection prevention and control measures in health facilities were highly effective in
Application of Face-Gear Drives in Helicopter Transmissions
Litvin, F. L.; Wang, J.-C.; Bossler, R. B., Jr.; Chen, Y.-J. D.; Heath, G.; Lewicki, D. G.
1992-01-01
The use of face gears in helicopter transmissions was explored. A light-weight, split torque transmission design utilizing face gears was described. Face-gear design and geometry were investigated. Topics included tooth generation, limiting inner and outer radii, tooth contact analysis, contact ratio, gear eccentricity, and structural stiffness. Design charts were developed to determine minimum and maximum face-gear inner and outer radii. Analytical study of transmission error showed face-gear drives were relatively insensitive to gear misalignment, but tooth contact was affected by misalignment. A method of localizing bearing contact to compensate for misalignment was explored. The proper choice of shaft support stiffness enabled good load sharing in the split torque transmission design. Face-gear experimental studies were also included and the feasibility of face gears in high-speed, high-load applications such as helicopter transmissions was demonstrated.
Wireless Transmission of Big Data: A Transmission Time Analysis over Fading Channel
Wang, Wen-Jing; Yang, Hong-Chuan; Alouini, Mohamed-Slim
2018-01-01
In this paper, we investigate the transmission time of a large amount of data over fading wireless channel with adaptive modulation and coding (AMC). Unlike traditional transmission systems, where the transmission time of a fixed amount of data is typically regarded as a constant, the transmission time with AMC becomes a random variable, as the transmission rate varies with the fading channel condition. To facilitate the design and optimization of wireless transmission schemes for big data applications, we present an analytical framework to determine statistical characterizations for the transmission time of big data with AMC. In particular, we derive the exact statistics of transmission time over block fading channels. The probability mass function (PMF) and cumulative distribution function (CDF) of transmission time are obtained for both slow and fast fading scenarios. We further extend our analysis to Markov channel, where transmission time becomes the sum of a sequence of exponentially distributed time slots. Analytical expression for the probability density function (PDF) of transmission time is derived for both fast fading and slow fading scenarios. These analytical results are essential to the optimal design and performance analysis of future wireless transmission systems for big data applications.
Wireless Transmission of Big Data: A Transmission Time Analysis over Fading Channel
Wang, Wen-Jing
2018-04-10
In this paper, we investigate the transmission time of a large amount of data over fading wireless channel with adaptive modulation and coding (AMC). Unlike traditional transmission systems, where the transmission time of a fixed amount of data is typically regarded as a constant, the transmission time with AMC becomes a random variable, as the transmission rate varies with the fading channel condition. To facilitate the design and optimization of wireless transmission schemes for big data applications, we present an analytical framework to determine statistical characterizations for the transmission time of big data with AMC. In particular, we derive the exact statistics of transmission time over block fading channels. The probability mass function (PMF) and cumulative distribution function (CDF) of transmission time are obtained for both slow and fast fading scenarios. We further extend our analysis to Markov channel, where transmission time becomes the sum of a sequence of exponentially distributed time slots. Analytical expression for the probability density function (PDF) of transmission time is derived for both fast fading and slow fading scenarios. These analytical results are essential to the optimal design and performance analysis of future wireless transmission systems for big data applications.
LaCour, Michael J; Green, Donald P
2014-12-12
Can a single conversation change minds on divisive social issues, such as same-sex marriage? A randomized placebo-controlled trial assessed whether gay (n = 22) or straight (n = 19) messengers were effective at encouraging voters (n = 972) to support same-sex marriage and whether attitude change persisted and spread to others in voters' social networks. The results, measured by an unrelated panel survey, show that both gay and straight canvassers produced large effects initially, but only gay canvassers' effects persisted in 3-week, 6-week, and 9-month follow-ups. We also find strong evidence of within-household transmission of opinion change, but only in the wake of conversations with gay canvassers. Contact with gay canvassers further caused substantial change in the ratings of gay men and lesbians more generally. These large, persistent, and contagious effects were confirmed by a follow-up experiment. Contact with minorities coupled with discussion of issues pertinent to them is capable of producing a cascade of opinion change. Copyright © 2014, American Association for the Advancement of Science.
Im, K. H.; Chang, M.; Hsu, D. K.; Song, S. J.; Cho, H.; Park, J. W.; Kweon, Y. S.; Sim, J. K.; Yang, I. Y.
2007-03-01
Advanced materials are to be required to have specific functions associated with extremely environments. One of them is carbon/carbon(C/C) composite material, which has obvious advantages over conventional materials. The C/Cs have become to be utilized as parts of aerospace applications and its low density, high thermal conductivity and excellent mechanical properties at elevated temperatures make it an ideal material for aircraft brake disks. Because of permeation of coupling medium such as water, it is desirable to perform contact-less nondestructive evaluation to assess material properties and part homogeneity. In this work, a C/C composite material was characterized with non-contact and contact ultrasonic methods using a scanner with automatic-data acquisition function. Also through transmission mode was performed because of the main limitation for air-coupled transducers, which is the acoustic impedance mismatch between most materials and air. Especially ultrasonic images and velocities for C/C composite disk brake were compared and found to be consistent to some degree with the non-contact and contact ultrasonic measurement methods. Low frequency through-transmission scans based on both amplitude of the ultrasonic pulse was used for mapping out the material property inhomogeneity. Measured results were compared with those obtained by the dry-coupling ultrasonic UT system and through transmission method in immersion. Finally, feasibility has been found to measure and compare ultrasonic velocities of C/C composites with using the contact/noncontact peak-delay measurement method based on the pulse overlap method.
Energy Technology Data Exchange (ETDEWEB)
Ballif, C. [Fraunhofer ISE, Laboratory and Service Center Gelsenkirchen (Germany); Huljic, D.M.; Willeke, G. [Fraunhofer-Institut fuer Solare Energiesysteme (ISE), Freiburg im Breisgau (Germany); Hessler-Wyser, A. [Swiss Federal Inst. of Technology, CIME, Lausanne (Switzerland)
2002-07-01
As screen printed contacts are the predominant metallisation technique in industrial production of Si solar cells, a better understanding of their properties is necessary. In this work, we show that high-quality cross-sectional samples can be prepared, whose study by transmission electron microscopy (TEM) reveals precisely the structure of the contact between the silver fingers and the Si. On diffused [100] Si wafers, direct firing of an Ag paste results in interfaces which are mainly composed of shaped Ag crystallites penetrating the emitter up to 120 nm. These crystallites are in epitaxial relation with the Sl substrate. When firing the contacts through a SiN{sub x} layer, larger Ag crystallites are present at the interface with Si and the orientation relation is lost. In both cases, high resolution TEM imaging and EDX analyses reveal a crystalline Ag/Si interface, where neither oxide nor glass frit can be detected. The presence of a significant glass frit layer between the Ag crystallites contacting the Si and the large Ag grains forming the bulk of the fingers can partly explain why lowly doped emitters are difficult to contact by screen-printing. (orig.)
Wildlife Contact Rates at Artificial Feeding Sites in Texas
Campbell, Tyler A.; Long, David B.; Shriner, Susan A.
2013-06-01
Given the popularity of feeding white-tailed deer ( Odocoileus virginianus) in Texas and the increasing amount of corn that is distributed, more information is needed on the impacts of this activity on non-target wildlife. Our objectives were to report visitation, intra- and interspecific contact, and contact rates of wildlife at artificial feeding sites in Texas. Our study was conducted at three sites in Kleberg and Nueces counties, Texas. We trapped animals from February to April and August to September, 2009 and marked animals with passive integrated transponder (PIT) tags. At each site and season, we placed one feeder system containing a PIT tag reader within 600 m of trap locations. Readers detected PIT tags from a distance of 25 cm. We determined a contact event to occur when two different PIT tags were detected by feeder systems within 5 s. We recorded 62,719 passes by raccoons ( Procyon lotor), 103,512 passes by collared peccaries ( Pecari tajacu), 2,923 passes by feral swine ( Sus scrofa), 1,336 passes by fox squirrels ( Sciurus niger), and no passes by opossums ( Didelphis virginiana) at feeder systems. For site-season combinations in which contact events occurred, we found intraspecific contact rates (contacts per day) for raccoons, collared peccaries, and feral swine to be 0.81-124.77, 0.69-38.08, and 0.0-0.66, respectively. Throughout our study we distributed ~2,625 kg of whole kernel corn, which resulted in 6,351 contact events between marked wildlife (2.4 contacts per kg of corn). If 136 million kg of corn is distributed in Texas annually, we would expect >5.2 billion unnatural contact events between wildlife would result from this activity each year in Texas. Consequently, we do not believe that it is wise for natural resource managers to maintain artificial feeding sites for white-tailed deer or other wildlife due to pathogen transmission risks.
High-resolution measurements of face-to-face contact patterns in a primary school.
Directory of Open Access Journals (Sweden)
Juliette Stehlé
Full Text Available BACKGROUND: Little quantitative information is available on the mixing patterns of children in school environments. Describing and understanding contacts between children at school would help quantify the transmission opportunities of respiratory infections and identify situations within schools where the risk of transmission is higher. We report on measurements carried out in a French school (6-12 years children, where we collected data on the time-resolved face-to-face proximity of children and teachers using a proximity-sensing infrastructure based on radio frequency identification devices. METHODS AND FINDINGS: Data on face-to-face interactions were collected on Thursday, October 1(st and Friday, October 2(nd 2009. We recorded 77,602 contact events between 242 individuals (232 children and 10 teachers. In this setting, each child has on average 323 contacts per day with 47 other children, leading to an average daily interaction time of 176 minutes. Most contacts are brief, but long contacts are also observed. Contacts occur mostly within each class, and each child spends on average three times more time in contact with classmates than with children of other classes. We describe the temporal evolution of the contact network and the trajectories followed by the children in the school, which constrain the contact patterns. We determine an exposure matrix aimed at informing mathematical models. This matrix exhibits a class and age structure which is very different from the homogeneous mixing hypothesis. CONCLUSIONS: We report on important properties of the contact patterns between school children that are relevant for modeling the propagation of diseases and for evaluating control measures. We discuss public health implications related to the management of schools in case of epidemics and pandemics. Our results can help define a prioritization of control measures based on preventive measures, case isolation, classes and school closures, that
Mathematical model of Zika virus with vertical transmission
Directory of Open Access Journals (Sweden)
F.B. Agusto
2017-05-01
Full Text Available Zika is a flavivirus transmitted to humans through either the bites of infected Aedes mosquitoes or sexual transmission. Zika has been linked to congenital anomalies such as microcephaly. In this paper, we analyze a new system of ordinary differential equations which incorporates human vertical transmission of Zika virus, the birth of babies with microcephaly and asymptomatically infected individuals. The Zika model is locally and globally asymptotically stable when the basic reproduction number is less than unity. Our model shows that asymptomatic individuals amplify the disease burden in the community, and the most important parameters for ZIKV spread are the death rate of mosquitoes, the mosquito biting rate, the mosquito recruitment rate, and the transmission per contact to mosquitoes and to adult humans. Scenario exploration indicates that personal-protection is a more effective control strategy than mosquito-reduction strategy. It also shows that delaying conception reduces the number of microcephaly cases, although this does little to prevent Zika transmission in the broader community. However, by coupling aggressive vector control and personal protection use, it is possible to reduce both microcephaly and Zika transmission. 2000 Mathematics Subject Classifications: 92B05, 93A30, 93C15. Keywords: Zika virus, Vertical transmission, Microcephaly, Stability, Control
Energy Technology Data Exchange (ETDEWEB)
Wu Hongchun [Nuclear Engineering Department, Xi' an Jiaotong University, Xi' an 710049, Shaanxi (China)]. E-mail: hongchun@mail.xjtu.edu.cn; Liu Pingping [Nuclear Engineering Department, Xi' an Jiaotong University, Xi' an 710049, Shaanxi (China); Zhou Yongqiang [Nuclear Engineering Department, Xi' an Jiaotong University, Xi' an 710049, Shaanxi (China); Cao Liangzhi [Nuclear Engineering Department, Xi' an Jiaotong University, Xi' an 710049, Shaanxi (China)
2007-01-15
In the advanced reactor, the fuel assembly or core with unstructured geometry is frequently used and for calculating its fuel assembly, the transmission probability method (TPM) has been used widely. However, the rectangle or hexagon meshes are mainly used in the TPM codes for the normal core structure. The triangle meshes are most useful for expressing the complicated unstructured geometry. Even though finite element method and Monte Carlo method is very good at solving unstructured geometry problem, they are very time consuming. So we developed the TPM code based on the triangle meshes. The TPM code based on the triangle meshes was applied to the hybrid fuel geometry, and compared with the results of the MCNP code and other codes. The results of comparison were consistent with each other. The TPM with triangle meshes would thus be expected to be able to apply to the two-dimensional arbitrary fuel assembly.
Vodopyanov, B P
2010-05-12
The influence of the spin-dependent phase shifts (SDPSs) associated with the electronic reflection and transmission amplitudes acquired by electrons upon scattering at the potential barrier on the Andreev reflection probability of electron and hole excitations for a ferromagnet/isolator/d-wave superconductor (FIS) contact and on the charge conductance of the FIS contact is studied. Various superconductor orientations are considered. It has been found that for strong ferromagnets and ultrathin interface potential for the {110} oriented d-wave superconductor the presence of the SDPS can lead to the appearance of finite-voltage peaks in the charge conductance of the F/I/d-wave superconductor contact. On the contrary, for the {100} orientation of the d-wave superconductor the presence of the SDPS can lead to restoration of the zero-voltage peak and suppression of finite-voltage peaks. The spin-dependent amplitudes of the Andreev reflection probability and energy levels of the spin-dependent Andreev bound states are found.
Estimating the Probability of Electrical Short Circuits from Tin Whiskers. Part 2
Courey, Karim J.; Asfour, Shihab S.; Onar, Arzu; Bayliss, Jon A.; Ludwig, Larry L.; Wright, Maria C.
2010-01-01
To comply with lead-free legislation, many manufacturers have converted from tin-lead to pure tin finishes of electronic components. However, pure tin finishes have a greater propensity to grow tin whiskers than tin-lead finishes. Since tin whiskers present an electrical short circuit hazard in electronic components, simulations have been developed to quantify the risk of said short circuits occurring. Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that had an unknown probability associated with it. Note however that due to contact resistance electrical shorts may not occur at lower voltage levels. In our first article we developed an empirical probability model for tin whisker shorting. In this paper, we develop a more comprehensive empirical model using a refined experiment with a larger sample size, in which we studied the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From the resulting data we estimated the probability distribution of an electrical short, as a function of voltage. In addition, the unexpected polycrystalline structure seen in the focused ion beam (FIB) cross section in the first experiment was confirmed in this experiment using transmission electron microscopy (TEM). The FIB was also used to cross section two card guides to facilitate the measurement of the grain size of each card guide's tin plating to determine its finish .
Directory of Open Access Journals (Sweden)
Rossana Mastrandrea
Full Text Available Given their importance in shaping social networks and determining how information or transmissible diseases propagate in a population, interactions between individuals are the subject of many data collection efforts. To this aim, different methods are commonly used, ranging from diaries and surveys to decentralised infrastructures based on wearable sensors. These methods have each advantages and limitations but are rarely compared in a given setting. Moreover, as surveys targeting friendship relations might suffer less from memory biases than contact diaries, it is interesting to explore how actual contact patterns occurring in day-to-day life compare with friendship relations and with online social links. Here we make progresses in these directions by leveraging data collected in a French high school and concerning (i face-to-face contacts measured by two concurrent methods, namely wearable sensors and contact diaries, (ii self-reported friendship surveys, and (iii online social links. We compare the resulting data sets and find that most short contacts are not reported in diaries while long contacts have a large reporting probability, and that the durations of contacts tend to be overestimated in the diaries. Moreover, measured contacts corresponding to reported friendship can have durations of any length but all long contacts do correspond to a reported friendship. On the contrary, online links that are not also reported in the friendship survey correspond to short face-to-face contacts, highlighting the difference of nature between reported friendships and online links. Diaries and surveys suffer moreover from a low sampling rate, as many students did not fill them, showing that the sensor-based platform had a higher acceptability. We also show that, despite the biases of diaries and surveys, the overall structure of the contact network, as quantified by the mixing patterns between classes, is correctly captured by both networks of self
Mastrandrea, Rossana; Fournet, Julie; Barrat, Alain
2015-01-01
Given their importance in shaping social networks and determining how information or transmissible diseases propagate in a population, interactions between individuals are the subject of many data collection efforts. To this aim, different methods are commonly used, ranging from diaries and surveys to decentralised infrastructures based on wearable sensors. These methods have each advantages and limitations but are rarely compared in a given setting. Moreover, as surveys targeting friendship relations might suffer less from memory biases than contact diaries, it is interesting to explore how actual contact patterns occurring in day-to-day life compare with friendship relations and with online social links. Here we make progresses in these directions by leveraging data collected in a French high school and concerning (i) face-to-face contacts measured by two concurrent methods, namely wearable sensors and contact diaries, (ii) self-reported friendship surveys, and (iii) online social links. We compare the resulting data sets and find that most short contacts are not reported in diaries while long contacts have a large reporting probability, and that the durations of contacts tend to be overestimated in the diaries. Moreover, measured contacts corresponding to reported friendship can have durations of any length but all long contacts do correspond to a reported friendship. On the contrary, online links that are not also reported in the friendship survey correspond to short face-to-face contacts, highlighting the difference of nature between reported friendships and online links. Diaries and surveys suffer moreover from a low sampling rate, as many students did not fill them, showing that the sensor-based platform had a higher acceptability. We also show that, despite the biases of diaries and surveys, the overall structure of the contact network, as quantified by the mixing patterns between classes, is correctly captured by both networks of self-reported contacts and
Transmission probability-based dynamic power control for multi-radio mesh networks
CSIR Research Space (South Africa)
Olwal, TO
2008-09-01
Full Text Available This paper presents an analytical model for the selection of the transmission power based on the bi-directional medium access information. Most of dynamic transmission power control algorithms are based on the single directional channel...
Social contact patterns relevant to the spread of respiratory infectious diseases in Hong Kong.
Leung, Kathy; Jit, Mark; Lau, Eric H Y; Wu, Joseph T
2017-08-11
The spread of many respiratory infections is determined by contact patterns between infectious and susceptible individuals in the population. There are no published data for quantifying social contact patterns relevant to the spread of respiratory infectious diseases in Hong Kong which is a hotspot for emerging infectious diseases due to its high population density and connectivity in the air transportation network. We adopted a commonly used diary-based design to conduct a social contact survey in Hong Kong in 2015/16 using both paper and online questionnaires. Participants using paper questionnaires reported more contacts and longer contact duration than those using online questionnaires. Participants reported 13 person-hours of contact and 8 contacts per day on average, which decreased over age but increased with household size, years of education and income level. Prolonged and frequent contacts, and contacts at home, school and work were more likely to involve physical contacts. Strong age-assortativity was observed in all age groups. We evaluated the characteristics of social contact patterns relevant to the spread of respiratory infectious diseases in Hong Kong. Our findings could help to improve the design of future social contact surveys, parameterize transmission models of respiratory infectious diseases, and inform intervention strategies based on model outputs.
Contact lens surface by electron beam
International Nuclear Information System (INIS)
Shin, Jung Hyuck; Lee, Suk Ju; Hwang, Kwang Ha; Jeon Jin
2011-01-01
Contact lens materials needs good biocompatibility, high refractive index, high optical transparency, high water content etc. Surface treat method by using plasma and radiation can modify the physical and/or chemical properties of the contact lens surface. Radiation technology such as electron beam irradiation can apply to polymerization reaction and enhance the functionality of the polymer.The purpose of this study is to modify of contact lens surface by using Eb irradiation technology. Electron beam was irradiated to the contact lens surface which was synthesized thermal polymerization method and commercial contact lens to modify physical and chemical properties. Ft-IR, XP, UV-vis spectrophotometer, water content, oxygen trans-metastability were used to characterize the surface state, physicochemical, and optical property of the contact lens treated with Eb. The water content and oxygen transmissibility of the contact lens treated with Eb were increased due to increase in the hydrophilic group such as O-C=O and OH group on the contact lens surface which could be produced by possible reaction between carbon and oxygen during the Eb irradiation. All of the lenses showed the high optical transmittance above 90%. In this case of B/Es, TES, Ti contact lens, the optical transmittance decreased about 5% with increasing Eb dose in the wavelength of UV-B region. The contact lens modified by Eb irradiation could improve the physical properties of the contact lens such as water content and oxygen transmissibility
Time of Arrival Estimation in Probability-Controlled Generalized CDMA Systems
Directory of Open Access Journals (Sweden)
Hagit Messer
2007-11-01
Full Text Available In recent years, more and more wireless communications systems are required to provide also a positioning measurement. In code division multiple access (CDMA communication systems, the positioning accuracy is significantly degraded by the multiple access interference (MAI caused by other users in the system. This MAI is commonly managed by a power control mechanism, and yet, MAI has a major effect on positioning accuracy. Probability control is a recently introduced interference management mechanism. In this mechanism, a user with excess power chooses not to transmit some of its symbols. The information in the nontransmitted symbols is recovered by an error-correcting code (ECC, while all other users receive a more reliable data during these quiet periods. Previous research had shown that the implementation of a probability control mechanism can significantly reduce the MAI. In this paper, we show that probability control also improves the positioning accuracy. We focus on time-of-arrival (TOA based positioning systems. We analyze the TOA estimation performance in a generalized CDMA system, in which the probability control mechanism is employed, where the transmitted signal is noncontinuous with a symbol transmission probability smaller than 1. The accuracy of the TOA estimation is determined using appropriate modifications of the Cramer-Rao bound on the delay estimation. Keeping the average transmission power constant, we show that the TOA accuracy of each user does not depend on its transmission probability, while being a nondecreasing function of the transmission probability of any other user. Therefore, a generalized, noncontinuous CDMA system with a probability control mechanism can always achieve better positioning performance, for all users in the network, than a conventional, continuous, CDMA system.
Experimental investigation on the electrical contact behavior of rolling contact connector
Energy Technology Data Exchange (ETDEWEB)
Chen, Junxing; Yang, Fei, E-mail: yfei2007@mail.xjtu.edu.cn; Luo, Kaiyu; Zhu, Mingliang; Wu, Yi; Rong, Mingzhe [State Key Laboratory of Electrical Insulation and Power Equipment, Xi’an Jiaotong University, Xi’an 710049 (China)
2015-12-15
Rolling contact connector (RCC) is a new technology utilized in high performance electric power transfer systems with one or more rotating interfaces, such as radars, satellites, wind generators, and medical computed tomography machines. Rolling contact components are used in the RCC instead of traditional sliding contacts to transfer electrical power and/or signal. Since the requirement of the power transmission is increasing in these years, the rolling electrical contact characteristics become more and more important for the long-life design of RCC. In this paper, a typical form of RCC is presented. A series of experimental work are carried out to investigate the rolling electrical contact characteristics during its lifetime. The influence of a variety of factors on the electrical contact degradation behavior of RCC is analyzed under both vacuum and air environment. Based on the surface morphology and elemental composition changes in the contact zone, which are assessed by field emission scanning electron microscope and confocal laser scanning microscope, the mechanism of rolling electrical contact degradation is discussed.
Small passenger car transmission test; Chevrolet LUV transmission
Bujold, M. P.
1980-01-01
A 1978 Chevrolet LUV manual transmission tested per the applicable portions of a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the upper ninety percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Chevrolet LUV transmission.
Hong, Changki; Park, Jinhong; Chung, Yunchul; Choi, Hyungkook; Umansky, Vladimir
2017-11-01
Transmission through a quantum point contact (QPC) in the quantum Hall regime usually exhibits multiple resonances as a function of gate voltage and high nonlinearity in bias. Such behavior is unpredictable and changes sample by sample. Here, we report the observation of a sharp transition of the transmission through an open QPC at finite bias, which was observed consistently for all the tested QPCs. It is found that the bias dependence of the transition can be fitted to the Fermi-Dirac distribution function through universal scaling. The fitted temperature matches quite nicely to the electron temperature measured via shot-noise thermometry. While the origin of the transition is unclear, we propose a phenomenological model based on our experimental results that may help to understand such a sharp transition. Similar transitions are observed in the fractional quantum Hall regime, and it is found that the temperature of the system can be measured by rescaling the quasiparticle energy with the effective charge (e*=e /3 ). We believe that the observed phenomena can be exploited as a tool for measuring the electron temperature of the system and for studying the quasiparticle charges of the fractional quantum Hall states.
International Nuclear Information System (INIS)
Ekonomou, L; Karampelas, P; Vita, V; Chatzarakis, G E
2011-01-01
One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service
Ekonomou, L.; Karampelas, P.; Vita, V.; Chatzarakis, G. E.
2011-04-01
One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service.
Feeder density enhances house finch disease transmission in experimental epidemics.
Moyers, Sahnzi C; Adelman, James S; Farine, Damien R; Thomason, Courtney A; Hawley, Dana M
2018-05-05
Anthropogenic food provisioning of wildlife can alter the frequency of contacts among hosts and between hosts and environmental sources of pathogens. Despite the popularity of garden bird feeding, few studies have addressed how feeders influence host contact rates and disease dynamics. We experimentally manipulated feeder density in replicate aviaries containing captive, pathogen-naive, groups of house finches ( Haemorhous mexicanus ) and continuously tracked behaviours at feeders using radio-frequency identification devices. We then inoculated one bird per group with Mycoplasma gallisepticum (Mg), a common bacterial pathogen for which feeders are fomites of transmission, and assessed effects of feeder density on house finch behaviour and pathogen transmission. We found that pathogen transmission was significantly higher in groups with the highest density of bird feeders, despite a significantly lower rate of intraspecific aggressive interactions relative to the low feeder density groups. Conversely, among naive group members that never showed signs of disease, we saw significantly higher concentrations of Mg-specific antibodies in low feeder density groups, suggesting that birds in low feeder density treatments had exposure to subclinical doses of Mg. We discuss ways in which the density of garden bird feeders could play an important role in mediating the intensity of Mg epidemics.This article is part of the theme issue 'Anthropogenic resource subsidies and host-parasite dynamics in wildlife'. © 2018 The Author(s).
Controlling infectious disease through the targeted manipulation of contact network structure
Directory of Open Access Journals (Sweden)
M. Carolyn Gates
2015-09-01
Full Text Available Individuals in human and animal populations are linked through dynamic contact networks with characteristic structural features that drive the epidemiology of directly transmissible infectious diseases. Using animal movement data from the British cattle industry as an example, this analysis explores whether disease dynamics can be altered by placing targeted restrictions on contact formation to reconfigure network topology. This was accomplished using a simple network generation algorithm that combined configuration wiring with stochastic block modelling techniques to preserve the weighted in- and out-degree of individual nodes (farms as well as key demographic characteristics of the individual network connections (movement date, livestock market, and animal production type. We then tested a control strategy based on introducing additional constraints into the network generation algorithm to prevent farms with a high in-degree from selling cattle to farms with a high out-degree as these particular network connections are predicted to have a disproportionately strong role in spreading disease. Results from simple dynamic disease simulation models predicted significantly lower endemic disease prevalences on the trade restricted networks compared to the baseline generated networks. As expected, the relative magnitude of the predicted changes in endemic prevalence was greater for diseases with short infectious periods and low transmission probabilities. Overall, our study findings demonstrate that there is significant potential for controlling multiple infectious diseases simultaneously by manipulating networks to have more epidemiologically favourable topological configurations. Further research is needed to determine whether the economic and social benefits of controlling disease can justify the costs of restricting contact formation.
Controlling infectious disease through the targeted manipulation of contact network structure
Gates, M. Carolyn; Woolhouse, Mark E.J.
2015-01-01
Individuals in human and animal populations are linked through dynamic contact networks with characteristic structural features that drive the epidemiology of directly transmissible infectious diseases. Using animal movement data from the British cattle industry as an example, this analysis explores whether disease dynamics can be altered by placing targeted restrictions on contact formation to reconfigure network topology. This was accomplished using a simple network generation algorithm that combined configuration wiring with stochastic block modelling techniques to preserve the weighted in- and out-degree of individual nodes (farms) as well as key demographic characteristics of the individual network connections (movement date, livestock market, and animal production type). We then tested a control strategy based on introducing additional constraints into the network generation algorithm to prevent farms with a high in-degree from selling cattle to farms with a high out-degree as these particular network connections are predicted to have a disproportionately strong role in spreading disease. Results from simple dynamic disease simulation models predicted significantly lower endemic disease prevalences on the trade restricted networks compared to the baseline generated networks. As expected, the relative magnitude of the predicted changes in endemic prevalence was greater for diseases with short infectious periods and low transmission probabilities. Overall, our study findings demonstrate that there is significant potential for controlling multiple infectious diseases simultaneously by manipulating networks to have more epidemiologically favourable topological configurations. Further research is needed to determine whether the economic and social benefits of controlling disease can justify the costs of restricting contact formation. PMID:26342238
Evaluation of metal–nanowire electrical contacts by measuring contact end resistance
International Nuclear Information System (INIS)
Park, Hongsik; Beresford, Roderic; Xu, Jimmy; Ha, Ryong; Choi, Heon-Jin; Shin, Hyunjung
2012-01-01
It is known, but often unappreciated, that the performance of nanowire (NW)-based electrical devices can be significantly affected by electrical contacts between electrodes and NWs, sometimes to the extent that it is really the contacts that determine the performance. To correctly understand and design NW device operation, it is thus important to carefully measure the contact resistance and evaluate the contact parameters, specific contact resistance and transfer length. A four-terminal pattern or a transmission line model (TLM) pattern has been widely used to measure contact resistance of NW devices and the TLM has been typically used to extract contact parameters of NW devices. However, the conventional method assumes that the electrical properties of semiconducting NW regions covered by a metal are not changed after electrode formation. In this study, we report that the conventional methods for contact evaluation can give rise to considerable errors because of an altered property of the NW under the electrodes. We demonstrate that more correct contact resistance can be measured from the TLM pattern rather than the four-terminal pattern and correct contact parameters including the effects of changed NW properties under electrodes can be evaluated by using the contact end resistance measurement method. (paper)
Rumor propagation with heterogeneous transmission in social networks
Vega-Oliveros, Didier A.; Costa, Luciano da F.; Rodrigues, Francisco A.
2017-02-01
Rumor models consider that information transmission occurs with the same probability between each pair of nodes. However, this assumption is not observed in social networks, which contain influential spreaders. To overcome this limitation, we assume that central individuals have a higher capacity to convince their neighbors than peripheral subjects. From extensive numerical simulations we find that spreading is improved in scale-free networks when the transmission probability is proportional to the PageRank, degree, and betweenness centrality. In addition, the results suggest that spreading can be controlled by adjusting the transmission probabilities of the most central nodes. Our results provide a conceptual framework for understanding the interplay between rumor propagation and heterogeneous transmission in social networks.
Springer, Andrea; Kappeler, Peter M; Nunn, Charles L
2017-05-01
Social networks provide an established tool to implement heterogeneous contact structures in epidemiological models. Dynamic temporal changes in contact structure and ranging behaviour of wildlife may impact disease dynamics. A consensus has yet to emerge, however, concerning the conditions in which network dynamics impact model outcomes, as compared to static approximations that average contact rates over longer time periods. Furthermore, as many pathogens can be transmitted both environmentally and via close contact, it is important to investigate the relative influence of both transmission routes in real-world populations. Here, we use empirically derived networks from a population of wild primates, Verreaux's sifakas (Propithecus verreauxi), and simulated networks to investigate pathogen spread in dynamic vs. static social networks. First, we constructed a susceptible-exposed-infected-recovered model of Cryptosporidium spread in wild Verreaux's sifakas. We incorporated social and environmental transmission routes and parameterized the model for two different climatic seasons. Second, we used simulated networks and greater variation in epidemiological parameters to investigate the conditions in which dynamic networks produce larger outbreak sizes than static networks. We found that average outbreak size of Cryptosporidium infections in sifakas was larger when the disease was introduced in the dry season than in the wet season, driven by an increase in home range overlap towards the end of the dry season. Regardless of season, dynamic networks always produced larger average outbreak sizes than static networks. Larger outbreaks in dynamic models based on simulated networks occurred especially when the probability of transmission and recovery were low. Variation in tie strength in the dynamic networks also had a major impact on outbreak size, while network modularity had a weaker influence than epidemiological parameters that determine transmission and recovery
Bjørnson, S; Keddie, B A
2001-02-01
Isolated colonies of the predatory mite, Phytoseiulus persimilis, were used to gain information regarding prevalence and transmission of Microsporidium phytoseiuli. Two colonies of P. persimilis were reared on spider mite (Tetranychus urticae)-infested bean plants in isolated cages. Disease prevalence of predators from Colony 1 remained relatively low (between 0 and 15%) over 57 weeks of observation whereas disease prevalence of predators from Colony 2 increased over 3 months (from 12 to 100%). Disease prevalence among predators from Colony 1 had increased to 100% 2 months after weekly sampling had ceased for this colony and periodic sampling confirmed that disease prevalence among individuals of both colonies remained at 100%. Microsporidian spores were not detected in randomly chosen samples of T. urticae prey mites that were removed and examined biweekly during this period. Although numerous microsporidian spores were observed in smear preparations of fecal pellets examined by light microscopy, spores were not observed on leaf surfaces or predator feces when examined by SEM. The latter appeared as intact aggregates composed of numerous dumbbell-shaped crystals and it is unlikely that spores are liberated from intact fecal pellets onto leaf surfaces. Vertical transmission of M. phytoseiuli was 100%; horizontal transmission was low (14.3%) and occurred only when immature P. persimilis were permitted to develop in contact with infected immature and adult predators. The mean number of eggs produced per mated pair was highest when uninfected females were mated with uninfected males (63.2 eggs per mated pair). Although mean egg production decreased when one or both parents were infected, not all differences were significant. Male predatory mites did not contribute to infection of their progeny. Results suggest that routine examination of P. persimilis for microsporidian spores is essential for the management of M. phytoseiuli within P. persimilis colonies. Low disease
Fuzzy Failure Probability of Transmission Pipelines in the Niger ...
African Journals Online (AJOL)
We undertake the apportioning of failure possibility on twelve identified third party activities contributory to failure of transmission pipelines in the Niger Delta region of Nigeria, using the concept of fuzzy possibility scores. Expert elicitation technique generates linguistic variables that are transformed using fuzzy set theory ...
Ti/Al Ohmic Contacts to n-Type GaN Nanowires
Directory of Open Access Journals (Sweden)
Gangfeng Ye
2011-01-01
Full Text Available Titanium/aluminum ohmic contacts to tapered n-type GaN nanowires with triangular cross-sections were studied. To extract the specific contact resistance, the commonly used transmission line model was adapted to the particular nanowire geometry. The most Al-rich composition of the contact provided a low specific contact resistance (mid 10−8 Ωcm2 upon annealing at 600 °C for 15 s, but it exhibited poor thermal stability due to oxidation of excess elemental Al remaining after annealing, as revealed by transmission electron microscopy. On the other hand, less Al-rich contacts required higher annealing temperatures (850 or 900 °C to reach a minimum specific contact resistance but exhibited better thermal stability. A spread in the specific contact resistance from contact to contact was tentatively attributed to the different facets that were contacted on the GaN nanowires with a triangular cross-section.
Outage Probability Analysis of FSO Links over Foggy Channel
Esmail, Maged Abdullah
2017-02-22
Outdoor Free space optic (FSO) communication systems are sensitive to atmospheric impairments such as turbulence and fog, in addition to being subject to pointing errors. Fog is particularly severe because it induces an attenuation that may vary from few dBs up to few hundreds of dBs per kilometer. Pointing errors also distort the link alignment and cause signal fading. In this paper, we investigate and analyze the FSO systems performance under fog conditions and pointing errors in terms of outage probability. We then study the impact of several effective communication mitigation techniques that can improve the system performance including multi-hop, transmit laser selection (TLS) and hybrid RF/FSO transmission. Closed-form expressions for the outage probability are derived and practical and comprehensive numerical examples are suggested to assess the obtained results. We found that the FSO system has limited performance that prevents applying FSO in wireless microcells that have a 500 m minimum cell radius. The performance degrades more when pointing errors appear. Increasing the transmitted power can improve the performance under light to moderate fog. However, under thick and dense fog the improvement is negligible. Using mitigation techniques can play a major role in improving the range and outage probability.
Outage Probability Analysis of FSO Links over Foggy Channel
Esmail, Maged Abdullah; Fathallah, Habib; Alouini, Mohamed-Slim
2017-01-01
Outdoor Free space optic (FSO) communication systems are sensitive to atmospheric impairments such as turbulence and fog, in addition to being subject to pointing errors. Fog is particularly severe because it induces an attenuation that may vary from few dBs up to few hundreds of dBs per kilometer. Pointing errors also distort the link alignment and cause signal fading. In this paper, we investigate and analyze the FSO systems performance under fog conditions and pointing errors in terms of outage probability. We then study the impact of several effective communication mitigation techniques that can improve the system performance including multi-hop, transmit laser selection (TLS) and hybrid RF/FSO transmission. Closed-form expressions for the outage probability are derived and practical and comprehensive numerical examples are suggested to assess the obtained results. We found that the FSO system has limited performance that prevents applying FSO in wireless microcells that have a 500 m minimum cell radius. The performance degrades more when pointing errors appear. Increasing the transmitted power can improve the performance under light to moderate fog. However, under thick and dense fog the improvement is negligible. Using mitigation techniques can play a major role in improving the range and outage probability.
Monkeys in the middle: parasite transmission through the social network of a wild primate.
Directory of Open Access Journals (Sweden)
Andrew J J MacIntosh
Full Text Available In wildlife populations, group-living is thought to increase the probability of parasite transmission because contact rates increase at high host densities. Physical contact, such as social grooming, is an important component of group structure, but it can also increase the risk of exposure to infection for individuals because it provides a mechanism for transmission of potentially pathogenic organisms. Living in groups can also create variation in susceptibility to infection among individuals because circulating levels of immunosuppressive hormones like glucocorticoids often depend on an individual's position within the group's social structure. Yet, little is known about the relative roles of socially mediated exposure versus susceptibility in parasite transmission among free-living animal groups. To address this issue, we investigate the relationship between host dominance hierarchy and nematode parasite transmission among females in a wild group of Japanese macaques (Macaca fuscata yakui. We use social network analysis to describe each individual female's position within the grooming network in relation to dominance rank and relative levels of infection. Our results suggest that the number of directly-transmitted parasite species infecting each female, and the relative amount of transmission stages that one of these species sheds in faeces, both increase with dominance rank. Female centrality within the network, which shows positive associations with dominance hierarchy, is also positively associated with infection by certain parasite species, suggesting that the measured rank-bias in transmission may reflect variation in exposure rather than susceptibility. This is supported by the lack of a clear relationship between rank and faecal cortisol, as an indicator of stress, in a subset of these females. Thus, socially mediated exposure appears to be important for direct transmission of nematode parasites, lending support to the idea that a
Monkeys in the Middle: Parasite Transmission through the Social Network of a Wild Primate
MacIntosh, Andrew J. J.; Jacobs, Armand; Garcia, Cécile; Shimizu, Keiko; Mouri, Keiko; Huffman, Michael A.; Hernandez, Alexander D.
2012-01-01
In wildlife populations, group-living is thought to increase the probability of parasite transmission because contact rates increase at high host densities. Physical contact, such as social grooming, is an important component of group structure, but it can also increase the risk of exposure to infection for individuals because it provides a mechanism for transmission of potentially pathogenic organisms. Living in groups can also create variation in susceptibility to infection among individuals because circulating levels of immunosuppressive hormones like glucocorticoids often depend on an individual’s position within the group’s social structure. Yet, little is known about the relative roles of socially mediated exposure versus susceptibility in parasite transmission among free-living animal groups. To address this issue, we investigate the relationship between host dominance hierarchy and nematode parasite transmission among females in a wild group of Japanese macaques (Macaca fuscata yakui). We use social network analysis to describe each individual female’s position within the grooming network in relation to dominance rank and relative levels of infection. Our results suggest that the number of directly-transmitted parasite species infecting each female, and the relative amount of transmission stages that one of these species sheds in faeces, both increase with dominance rank. Female centrality within the network, which shows positive associations with dominance hierarchy, is also positively associated with infection by certain parasite species, suggesting that the measured rank-bias in transmission may reflect variation in exposure rather than susceptibility. This is supported by the lack of a clear relationship between rank and faecal cortisol, as an indicator of stress, in a subset of these females. Thus, socially mediated exposure appears to be important for direct transmission of nematode parasites, lending support to the idea that a classical fitness
Full Text Available ... sell contacts without a prescription are breaking the law, and may be fined $11,000 per violation. " ... wear any kind of contact lens. In Butler's case, the lenses caused an infection and left her ...
Full Text Available ... not require the same level of care or consideration as a standard contact lens because they can ... sell contacts without a prescription are breaking the law, and may be fined $11,000 per violation. " ...
We'll meet again: revealing distributional and temporal patterns of social contact.
Directory of Open Access Journals (Sweden)
Thorsten Pachur
Full Text Available What are the dynamics and regularities underlying social contact, and how can contact with the people in one's social network be predicted? In order to characterize distributional and temporal patterns underlying contact probability, we asked 40 participants to keep a diary of their social contacts for 100 consecutive days. Using a memory framework previously used to study environmental regularities, we predicted that the probability of future contact would follow in systematic ways from the frequency, recency, and spacing of previous contact. The distribution of contact probability across the members of a person's social network was highly skewed, following an exponential function. As predicted, it emerged that future contact scaled linearly with frequency of past contact, proportionally to a power function with recency of past contact, and differentially according to the spacing of past contact. These relations emerged across different contact media and irrespective of whether the participant initiated or received contact. We discuss how the identification of these regularities might inspire more realistic analyses of behavior in social networks (e.g., attitude formation, cooperation.
Face-gear drives: Design, analysis, and testing for helicopter transmission applications
Litvin, F. L.; Wang, J.-C.; Bossler, R. B., Jr.; Chen, Y.-J. D.; Heath, G.; Lewicki, D. G.
1992-01-01
The use of face-gears in helicopter transmissions was explored. A light-weight, split-torque transmission design utilizing face-gears is described. Face-gear design and geometry were investigated. Topics included tooth generation, limiting inner and outer radii, tooth contact analysis, contact ratio, gear eccentricity, grinding, and structural stiffness. Design charts were developed to determine minimum and maximum face-gear inner and outer radii. An analytical study showed that the face-gear drive is relatively insensitive to gear misalignment with respect to transmission errors, but the tooth contact is affected by misalignment. A method of localizing the bearing contact to permit operation with misalignment was explored. Two new methods for grinding of the face-gear tooth surfaces were also investigated. The proper choice of shaft stiffness enabled good load sharing in the split-torque transmission design. Face-gear experimental studies were also conducted. These tests demonstrated the feasibility of face-gears in high-speed, high-load applications such as helicopter transmissions.
Effect of contact area on electron transport through graphene-metal interface.
Liu, Hongmei; Kondo, Hisashi; Ohno, Takahisa
2013-08-21
We perform first-principles investigations of electron transport in armchair graphene nanoribbons adsorbed on Cu(111) and Ni(111) surfaces with various contact areas. We find that the contact area between metals and graphene has different influences on the conductance. The Cu-graphene system shows an increase in differential conductance for more contact area at a low bias voltage, primarily originating from the shift of transmission peaks relative to the Fermi energy. As the bias increases, there is an irregular change of conductance, including a weak negative differential conductance for more contact area. In contrast, the conductance of the Ni-graphene junction is monotonically enhanced with increasing overlap area. The minority spin which shows a broad transmission is responsible for the conductance increase of Ni-graphene. These behaviors can be attributed to different mechanisms of the interfacial electron transport: Charge transfer between graphene and Cu largely dominates the transmission enhancement of Cu-graphene, whereas hybridization between graphene and Ni states plays a more important role in the transmission enhancement of Ni-graphene. The different behaviors of transmission increase correlate with not only the strength of the graphene-metal interaction but also the location of metal d states.
Drivers of Tuberculosis Transmission.
Mathema, Barun; Andrews, Jason R; Cohen, Ted; Borgdorff, Martien W; Behr, Marcel; Glynn, Judith R; Rustomjee, Roxana; Silk, Benjamin J; Wood, Robin
2017-11-03
Measuring tuberculosis transmission is exceedingly difficult, given the remarkable variability in the timing of clinical disease after Mycobacterium tuberculosis infection; incident disease can result from either a recent (ie, weeks to months) or a remote (ie, several years to decades) infection event. Although we cannot identify with certainty the timing and location of tuberculosis transmission for individuals, approaches for estimating the individual probability of recent transmission and for estimating the fraction of tuberculosis cases due to recent transmission in populations have been developed. Data used to estimate the probable burden of recent transmission include tuberculosis case notifications in young children and trends in tuberculin skin test and interferon γ-release assays. More recently, M. tuberculosis whole-genome sequencing has been used to estimate population levels of recent transmission, identify the distribution of specific strains within communities, and decipher chains of transmission among culture-positive tuberculosis cases. The factors that drive the transmission of tuberculosis in communities depend on the burden of prevalent tuberculosis; the ways in which individuals live, work, and interact (eg, congregate settings); and the capacity of healthcare and public health systems to identify and effectively treat individuals with infectious forms of tuberculosis. Here we provide an overview of these factors, describe tools for measurement of ongoing transmission, and highlight knowledge gaps that must be addressed. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Small passenger car transmission test-Chevrolet 200 transmission
Bujold, M. P.
1980-01-01
The small passenger car transmission was tested to supply electric vehicle manufacturers with technical information regarding the performance of commerically available transmissions which would enable them to design a more energy efficient vehicle. With this information the manufacturers could estimate vehicle driving range as well as speed and torque requirements for specific road load performance characteristics. A 1979 Chevrolet Model 200 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. The transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. Torque, speed and efficiency curves map the complete performance characteristics for Chevrolet Model 200 transmission.
Modeling infection transmission in primate networks to predict centrality-based risk.
Romano, Valéria; Duboscq, Julie; Sarabian, Cécile; Thomas, Elodie; Sueur, Cédric; MacIntosh, Andrew J J
2016-07-01
Social structure can theoretically regulate disease risk by mediating exposure to pathogens via social proximity and contact. Investigating the role of central individuals within a network may help predict infectious agent transmission as well as implement disease control strategies, but little is known about such dynamics in real primate networks. We combined social network analysis and a modeling approach to better understand transmission of a theoretical infectious agent in wild Japanese macaques, highly social animals which form extended but highly differentiated social networks. We collected focal data from adult females living on the islands of Koshima and Yakushima, Japan. Individual identities as well as grooming networks were included in a Markov graph-based simulation. In this model, the probability that an individual will transmit an infectious agent depends on the strength of its relationships with other group members. Similarly, its probability of being infected depends on its relationships with already infected group members. We correlated: (i) the percentage of subjects infected during a latency-constrained epidemic; (ii) the mean latency to complete transmission; (iii) the probability that an individual is infected first among all group members; and (iv) each individual's mean rank in the chain of transmission with different individual network centralities (eigenvector, strength, betweenness). Our results support the hypothesis that more central individuals transmit infections in a shorter amount of time and to more subjects but also become infected more quickly than less central individuals. However, we also observed that the spread of infectious agents on the Yakushima network did not always differ from expectations of spread on random networks. Generalizations about the importance of observed social networks in pathogen flow should thus be made with caution, since individual characteristics in some real world networks appear less relevant than
Nipah virus transmission in a hamster model.
Directory of Open Access Journals (Sweden)
Emmie de Wit
2011-12-01
Full Text Available Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks.
International Nuclear Information System (INIS)
Radford, E.P.
1980-07-01
The report evaluates major public health impacts of electric power generation and transmission associated with the nuclear fuel cycle and with coal use. Only existing technology is evaluated. For the nuclear cycle, effects of future use of fuel reprocessing and long-term radioactive waste disposal are briefly considered. The health effects of concern are those leading to definable human disease and injury. Health effects are scaled to numbers of persons and activities associated with a nominal 1000-megawatt electric plant fueled by either option. Comparison of the total health effects to the general public shows that the health risks from the coal cycle are about 50 times greater than for the nuclear cycle (coal, 0.7-3.7 major health effects per 1000 MWe per year; nuclear, 0.03-0.05 per 1000 MWe per year). For workers, these rates are higher. No evidence is found that electrical transmission contributes any health effects to the general public, except when broken power lines come in contact with people
van Duijkeren, E; Kamphuis, M; van der Mije, I C; Laarhoven, L M; Duim, B; Wagenaar, J A; Houwers, D J
2011-06-02
The objective of this study was to investigate the prevalence of methicillin-resistant Staphylococcus pseudintermedius (MRSP) in people, pets and the environment in households with a pet with a clinical MRSP-infection within the past year. Personnel and the environment at veterinary clinics were also screened. Nasal swabs (humans), nasal and perineal swabs (pets) and environmental wipes were examined using selective culturing. Twenty households were enrolled; 10/20 index cases still had clinical signs of infection at the start of the study and all were MRSP-positive. Of the remaining 10 index cases five were MRSP-positive in nasal and/or perineal samples. Five of 14 (36%) contact dogs and four of 13 (31%) contact cats were found MRSP-positive. In the households with an index case with clinical signs of infection 6/7 (86%) contact animals were MRSP-positive. MRSP was cultured from 2/45 (4%) human nasal samples. Domestic contamination was widespread as positive samples were found in 70% of the households and 44% of all environmental samples were MRSP-positive. In all but one of these MRSP-positive households the index case was still MRSP positive. Among the personnel in veterinary clinics 4/141 (3%) were MRSP-positive. MRSP was cultured from 31/200 environmental samples in 7/13 clinics at the first sampling and in 3/6 clinics the environment remained MRSP-positive after cleaning and disinfection indicating that current cleaning procedures often were unable to eliminate MRSP. These results show that transmission of MRSP between infected or colonized dogs and cats and healthy people does occur but is relatively uncommon, while transmission to contact pets occurs frequently, especially when the index case still has clinical signs of MRSP-infection. Copyright © 2011 Elsevier B.V. All rights reserved.
Controlling infectious disease through the targeted manipulation of contact network structure.
Gates, M Carolyn; Woolhouse, Mark E J
2015-09-01
Individuals in human and animal populations are linked through dynamic contact networks with characteristic structural features that drive the epidemiology of directly transmissible infectious diseases. Using animal movement data from the British cattle industry as an example, this analysis explores whether disease dynamics can be altered by placing targeted restrictions on contact formation to reconfigure network topology. This was accomplished using a simple network generation algorithm that combined configuration wiring with stochastic block modelling techniques to preserve the weighted in- and out-degree of individual nodes (farms) as well as key demographic characteristics of the individual network connections (movement date, livestock market, and animal production type). We then tested a control strategy based on introducing additional constraints into the network generation algorithm to prevent farms with a high in-degree from selling cattle to farms with a high out-degree as these particular network connections are predicted to have a disproportionately strong role in spreading disease. Results from simple dynamic disease simulation models predicted significantly lower endemic disease prevalences on the trade restricted networks compared to the baseline generated networks. As expected, the relative magnitude of the predicted changes in endemic prevalence was greater for diseases with short infectious periods and low transmission probabilities. Overall, our study findings demonstrate that there is significant potential for controlling multiple infectious diseases simultaneously by manipulating networks to have more epidemiologically favourable topological configurations. Further research is needed to determine whether the economic and social benefits of controlling disease can justify the costs of restricting contact formation. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Clinical and epidemiological predictors of transmission in Severe Acute Respiratory Syndrome (SARS
Directory of Open Access Journals (Sweden)
Leong Hoe
2006-10-01
Full Text Available Abstract Background Only a minority of probable SARS cases caused transmission. We assess if any epidemiological or clinical factors in SARS index patients were associated with increased probability of transmission. Methods We used epidemiological and clinical data on probable SARS patients admitted to Tan Tock Seng Hospital. Using a case-control approach, index patients who had probable SARS who subsequently transmitted the disease to at least one other patient were analysed as "cases" against patients with no transmission as "controls", using multivariate logistic regression analysis. Results 98 index patients were available for analysis (22 with transmission, 76 with no transmission. Covariates positively associated with transmission in univariate analysis at p 650 IU/L (OR 6.4, 23.8 and 4.7 respectively. Conclusion Clinical and epidemiological factors can help us to explain why transmission was observed in some instances but not in others.
Effects of low-density feeding on elk–fetus contact rates on Wyoming feedgrounds
Creech, Tyler G.; Cross, Paul C.; Scurlock, Brandon M.; Maichak, Eric J.; Rogerson, Jared D.; Henningsen, John C.; Creel, Scott
2012-01-01
High seroprevalance for Brucella abortus among elk on Wyoming feedgrounds suggests that supplemental feeding may influence parasite transmission and disease dynamics by altering the rate at which elk contact infectious materials in their environment. We used proximity loggers and video cameras to estimate rates of elk-to-fetus contact (the primary source of brucellosis transmission) during winter supplemental feeding. We compared contact rates during high-density and low-density (LD) feeding treatments that provided the same total amount of food distributed over different areas. Low-density feeding led to >70% reductions in total number of contacts and number of individuals contacting a fetus. Proximity loggers and video cameras provided similar estimates of elk–fetus contact rates. Elk contacted fetuses and random control points equally, suggesting that elk were not attracted to fetuses but encountered them incidentally while feeding. The modeled relationship between contact rate and disease prevalence is nonlinear and LD feeding may result in large reductions in brucellosis prevalence, but this depends on the amount of transmission that occurs on and off feedgrounds.
Theoretical research of probability of wedging of particulate matters at polishing
Directory of Open Access Journals (Sweden)
V.F. Molchanov
2017-12-01
Full Text Available The mechanism of formation of mikroprofile of the polished surface is expounded taking into account influence of particulate matters, contained in lubricating-coolings liquids. Probability of wedging of abrasive particles is investigational in the area of contact of diamond-impregnated with the surface of detail. It is set that for determination of probability of event, when a particle, getting together with a liquid in the area of contact, abandons track-scratch on a superficial layer, it is necessary to take into account, that three mutual locations of hard particle are possible in the area of contact of diamond-impregnated with the surface of detail. It is set researches, that a hard particle, getting together with a liquid in the area of contact, abandons track-scratch on-the-spot in that case, when the sizes of particle are equal or a few exceed distance from the surface of detail to the ledges on-the-spot diamond-impregnated. Researches allow mathematically to define probability of wedging of particulate matters in the area of contact of diamond-impregnated with the surface of the polished detail.
Directory of Open Access Journals (Sweden)
Thomas S Churcher
2017-01-01
Full Text Available Over a century since Ronald Ross discovered that malaria is caused by the bite of an infectious mosquito it is still unclear how the number of parasites injected influences disease transmission. Currently it is assumed that all mosquitoes with salivary gland sporozoites are equally infectious irrespective of the number of parasites they harbour, though this has never been rigorously tested. Here we analyse >1000 experimental infections of humans and mice and demonstrate a dose-dependency for probability of infection and the length of the host pre-patent period. Mosquitoes with a higher numbers of sporozoites in their salivary glands following blood-feeding are more likely to have caused infection (and have done so quicker than mosquitoes with fewer parasites. A similar dose response for the probability of infection was seen for humans given a pre-erythrocytic vaccine candidate targeting circumsporozoite protein (CSP, and in mice with and without transfusion of anti-CSP antibodies. These interventions prevented infection more efficiently from bites made by mosquitoes with fewer parasites. The importance of parasite number has widespread implications across malariology, ranging from our basic understanding of the parasite, how vaccines are evaluated and the way in which transmission should be measured in the field. It also provides direct evidence for why the only registered malaria vaccine RTS,S was partially effective in recent clinical trials.
Aspler, Anne; Chong, Huey; Kunimoto, Dennis; Chui, Linda; Der, Evelina; Boffa, Jody; Long, Richard
2010-01-01
A context-specific, spatial-temporal understanding of a chain of tuberculosis (TB) transmission can inform TB elimination strategy. Clinical, public health and molecular epidemiologic data were used to: 1) identify and describe a complex cluster of TB cases in Alberta, 2) elucidate transmission sequences, and 3) assess case-patient mobility. Socio-economic indicators in loci of transmission and the province at large were described. Factors seen to be fostering or hampering TB elimination were identified. Over a 15-year period, 18 TB cases in Alberta and multiple cases in the Northwest Territories were determined to be due to the same strain. One patient was diagnosed at death; all others completed directly-observed therapy (DOT). Case-level analysis revealed that patients were highly mobile with transmission of the strain over 26,569 km2, an average of 2.8 different places of residence per patient during treatment, and contacts of sputum smear-positive cases spanning 9 of 17 regional health authorities. The majority of the contacts (57%) were attached to a single infectious case living in a homeless shelter. The three loci of transmission in Alberta were separated geographically but similar in terms of median incomes, rates of unemployment, levels of post-secondary education, and rates of population mobility (p network analysis, engineering controls in shelters and better determinants of health in loci of transmission were seen as hampering TB elimination.
Nezafati, Kaveh A; Carroll, Bryan; Storrs, Frances J; Cruz, Ponciano D
2013-01-01
The American Contact Dermatitis Society (ACDS) is the principal organization representing the subspecialty of contact dermatitis in the United States. The aim of this study was to characterize ACDS members with respect to demographic characteristics, patch-test practices, and sentiments regarding the Society and its journal Dermatitis. We conducted cross-sectional postal and online surveys of ACDS members. More than a third of ACDS members responded to the survey, 92% of whom practice dermatology, and most of whom are community practitioners. Responders manage patients with allergic and irritant dermatitis at a similar frequency. On average, they patch test 4 patients per week using 66 allergens per patient, which often include customized trays. Almost half of these practitioners learned patch testing from their residency programs. Most of the responders read and value the Society journal, value the Contact Allergen Management Program database, and attend society meetings. The ACDS is comprised overwhelmingly of dermatologists who are primarily community-based, young relative to the start of their practices, and use the Society's resources for continuing education.
Extinction times of epidemic outbreaks in networks.
Holme, Petter
2013-01-01
In the Susceptible-Infectious-Recovered (SIR) model of disease spreading, the time to extinction of the epidemics happens at an intermediate value of the per-contact transmission probability. Too contagious infections burn out fast in the population. Infections that are not contagious enough die out before they spread to a large fraction of people. We characterize how the maximal extinction time in SIR simulations on networks depend on the network structure. For example we find that the average distances in isolated components, weighted by the component size, is a good predictor of the maximal time to extinction. Furthermore, the transmission probability giving the longest outbreaks is larger than, but otherwise seemingly independent of, the epidemic threshold.
Extinction times of epidemic outbreaks in networks.
Directory of Open Access Journals (Sweden)
Petter Holme
Full Text Available In the Susceptible-Infectious-Recovered (SIR model of disease spreading, the time to extinction of the epidemics happens at an intermediate value of the per-contact transmission probability. Too contagious infections burn out fast in the population. Infections that are not contagious enough die out before they spread to a large fraction of people. We characterize how the maximal extinction time in SIR simulations on networks depend on the network structure. For example we find that the average distances in isolated components, weighted by the component size, is a good predictor of the maximal time to extinction. Furthermore, the transmission probability giving the longest outbreaks is larger than, but otherwise seemingly independent of, the epidemic threshold.
Directory of Open Access Journals (Sweden)
Vincent Chi-Chung Cheng
Full Text Available OBJECTIVE: To control nosocomial transmission of methicillin-resistant Staphylococcus aureus (MRSA in resource-limited healthcare setting with high endemicity. METHODS: Three phases of infection control interventions were implemented in a University-affiliated hospital between 1-January-2004 and 31-December-2012. The first phase of baseline period, defined as the first 48-months of the study period, when all MRSA patients were managed with standard precautions, followed by a second phase of 24-months, when a hospital-wide hand hygiene campaign was launched. In the third phase of 36-months, contact precautions in open cubicle, use of dedicated medical items, and 2% chlorhexidine gluconate daily bathing for MRSA-positive patients were implemented while hand hygiene campaign was continued. The changes in the incidence rates of hospital-acquired MRSA-per-1000-patient admissions, per-1000-patient-days, and per-1000-MRSA-positive-days were analyzed using segmented Poisson regression (an interrupted time series model. Usage density of broad-spectrum antibiotics was monitored. RESULTS: During the study period, 4256 MRSA-positive patients were newly diagnosed, of which 1589 (37.3% were hospital-acquired. The reduction of hospital-acquired MRSA per 1000-patient admissions, per 1000-patient-days, and per 1000-MRSA-positive-days from phase 1 to 2 was 36.3% (p<0.001, 30.4% (p<0.001, and 19.6% (p = 0.040, while the reduction of hospital-acquired MRSA per 1000-patient admissions, per 1000-patient-days, and per 1000-MRSA-positive-days from phase 2 to 3 was 27.4% (p<0.001, 24.1% (p<0.001, and 21.9% (p = 0.041 respectively. This reduction is sustained despite that the usage density of broad-spectrum antibiotics has increased from 132.02 (phase 1 to 168.99 per 1000 patient-days (phase 3. CONCLUSIONS: Nosocomial transmission of MRSA can be reduced with hand hygiene campaign, contact precautions in open cubicle, and 2% chlorhexidine gluconate daily bathing
Beyond bushmeat: animal contact, injury, and zoonotic disease risk in Western Uganda.
Paige, Sarah B; Frost, Simon D W; Gibson, Mhairi A; Jones, James Holland; Shankar, Anupama; Switzer, William M; Ting, Nelson; Goldberg, Tony L
2014-12-01
Zoonotic pathogens cause an estimated 70% of emerging and re-emerging infectious diseases in humans. In sub-Saharan Africa, bushmeat hunting and butchering is considered the primary risk factor for human-wildlife contact and zoonotic disease transmission, particularly for the transmission of simian retroviruses. However, hunting is only one of many activities in sub-Saharan Africa that bring people and wildlife into contact. Here, we examine human-animal interaction in western Uganda, identifying patterns of injuries from animals and contact with nonhuman primates. Additionally, we identify individual-level risk factors associated with contact. Nearly 20% (246/1,240) of participants reported either being injured by an animal or having contact with a primate over their lifetimes. The majority (51.7%) of injuries were dog bites that healed with no long-term medical consequences. The majority (76.8%) of 125 total primate contacts involved touching a carcass; however, butchering (20%), hunting (10%), and touching a live primate (10%) were also reported. Red colobus (Piliocolobus rufomitratus tephrosceles) accounted for most primate contact events. Multivariate logistic regression indicated that men who live adjacent to forest fragments are at elevated risk of animal contact and specifically primate contact. Our results provide a useful comparison to West and Central Africa where "bushmeat hunting" is the predominant paradigm for human-wildlife contact and zoonotic disease transmission.
Possible sexual transmission of Crimean-Congo hemorrhagic fever
Directory of Open Access Journals (Sweden)
Natalia Yurievna Pshenichnaya
2016-04-01
Full Text Available Three cases of family transmission of laboratory-confirmed Crimean-Congo hemorrhagic fever (CCHF among spouses are reported. These spouses had sexual contact at the end of the incubation period or during the early stage of the mild form of CCHF, without any hemorrhagic symptoms in the first infected spouse. This report demonstrates that sexual contact may represent a real risk of CCHF transmission, even if the patient only experiences mild symptoms.
Nesting bird "host funnel" increases mosquito-bird contact rate.
Caillouët, Kevin A; Riggan, Anna E; Bulluck, Lesley P; Carlson, John C; Sabo, Roy T
2013-03-01
Increases in vector-host contact rates can enhance arbovirus transmission intensity. We investigated weekly fluctuations in contact rates between mosquitoes and nesting birds using the recently described Nest Mosquito Trap (NMT). The number of mosquitoes per nestling increased from nesting season. Our evidence suggests the coincidence of the end of the avian nesting season and increasing mosquito abundances may have caused a "host funnel," concentrating host-seeking mosquitoes to the few remaining nestlings. The relative abundance of mosquitoes collected by the NMT suggests that significantly more Aedes albopictus (Skuse) and Culex pipiens (L.) /restuans (Theobald) sought nesting bird bloodmeals than were predicted by their relative abundances in CO2-baited Centers for Disease Control and Prevention light and gravid traps. Culex salinarius (Coquillett) and Culex erraticus Dyar and Knab were collected in NMTs in proportion to their relative abundances in the generic traps. Temporal host funnels and nesting bird host specificity may enhance arbovirus amplification and explain observed West Nile virus and St. Louis encephalitis virus amplification periods.
Unpacking the great transmission debate
Denning, Kathryn
2010-12-01
The debate about the wisdom of sending interstellar transmissions is well-known to those involved in SETI, and frustrating for many. Its tendency towards intractability is a result of multiple factors, including: different models of the scientist's role as citizen and/or leader; disparate ideas about society's readiness to cope with frontier science; variable political substrates, particularly ideas concerning individual freedom and state control; competing ideologies of globalization; and the perceived relative risks and benefits of contact. (Variations in the latter, i.e. assessments of the risks and benefits of contact, derive partly from different thinking styles, including tolerance for risk, and partly from inferences based upon episodes of biological and cultural contact on Earth.) Unpacking the debate into its components may be of use to those debating policy about SETI transmissions, or at the very least, help keep in focus what, precisely, the perennial arguments are really about.
Directory of Open Access Journals (Sweden)
Hao Dong
2015-01-01
Full Text Available In order to implement the uniform load distribution of the power-split transmission system, a pseudostatic model is built. Based on the loaded tooth contact analysis (LTCA technique, the actual meshing process of each gear pair is simulated and the fitting curve of time-varying mesh stiffness is obtained. And then, the torsional angle deformation compatibility conditions are proposed according to the closed-loop characteristic of power flow, which will be combined with the torque equilibrium conditions and elastic support conditions to calculate the transfer torque of each gear pair. Finally, the load-sharing coefficient of the power-split transmission system is obtained, and the influences of the installation errors are analyzed. The results show that the above-mentioned installation errors comprehensively influence the load-sharing characteristics, and the reduction of only one error could not effectively achieve perfect load-sharing characteristics. Allowing for the spline clearance floating and constrained by the radial spacing ring, the influence of the floating pinion is analyzed. It shows that the floating pinion can improve the load-sharing characteristics. Through the comparison between the theoretical and related experimental data, the reasonability and feasibility of the above-proposed method and model are verified.
Tuberculosis transmission in the Indigenous peoples of the Canadian prairies.
Patel, Smit; Paulsen, Catherine; Heffernan, Courtney; Saunders, Duncan; Sharma, Meenu; King, Malcolm; Hoeppner, Vernon; Orr, Pamela; Kunimoto, Dennis; Menzies, Dick; Christianson, Sara; Wolfe, Joyce; Boffa, Jody; McMullin, Kathleen; Lopez-Hille, Carmen; Senthilselvan, Ambikaipakan; Long, Richard
2017-01-01
The prairie provinces of Canada. To characterize tuberculosis (TB) transmission among the Indigenous and non-Indigenous Canadian-born peoples of the prairie provinces of Canada. A prospective epidemiologic study of consecutively diagnosed adult (age ≥ 14 years) Canadian-born culture-positive pulmonary TB cases on the prairies, hereafter termed "potential transmitters," and the transmission events generated by them. "Transmission events" included new positive tuberculin skin tests (TSTs), TST conversions, and secondary cases among contacts. In the years 2007 and 2008, 222 potential transmitters were diagnosed on the prairies. Of these, the vast majority (198; 89.2%) were Indigenous peoples who resided in either an Indigenous community (135; 68.2%) or a major metropolitan area (44; 22.2%). Over the 4.5-year period between July 1st, 2006 and December 31st 2010, 1085 transmission events occurred in connection with these potential transmitters. Most of these transmission events were attributable to potential transmitters who identified as Indigenous (94.5%). With a few notable exceptions most transmitters and their infected contacts resided in the same community type. In multivariate models positive smear status and a higher number of close contacts were associated with increased transmission; adjusted odds ratios (ORs) and 95% confidence intervals (CIs), 4.30 [1.88, 9.84] and 2.88 [1.31, 6.34], respectively. Among infected contacts, being Indigenous was associated with disease progression; OR and 95% CI, 3.59 [1.27, 10.14] and 6.89 [2.04, 23.25] depending upon Indigenous group, while being an infected casual contact was less likely than being a close contact to be associated with disease progression, 0.66 [0.44, 1.00]. In the prairie provinces of Canada and among Canadian-born persons, Indigenous peoples account for the vast majority of cases with the potential to transmit as well as the vast majority of infected contacts. Active case finding and preventative therapy
Directory of Open Access Journals (Sweden)
Ning Li
2016-11-01
Full Text Available Because wireless sensor networks (WSNs have been widely used in recent years, how to reduce their energy consumption and interference has become a major issue. Topology control is a common and effective approach to improve network performance, such as reducing the energy consumption and network interference, improving the network connectivity, etc. Many topology control algorithms reduce network interference by dynamically adjusting the node transmission range. However, reducing the network interference by adjusting the transmission range is probabilistic. Therefore, in this paper, we analyze the probability of interference-optimality for the WSNs and prove that the probability of interference-optimality increases with the increasing of the original transmission range. Under a specific transmission range, the probability reaches the maximum value when the transmission range is 0.85r in homogeneous networks and 0.84r in heterogeneous networks. In addition, we also prove that when the network is energy-efficient, the network is also interference-optimal with probability 1 both in the homogeneous and heterogeneous networks.
Full Text Available ... eye-care professional. Retailers that sell contacts without a prescription are breaking the law, and may be fined $11,000 per violation. "Many of the lenses found online or in beauty salons, novelty shops or in pop-up ... contact lenses from a retailer that does not ask for a prescription. ...
Evaluation of Low-Noise, Improved-Bearing-Contact Spiral Bevel Gears
National Research Council Canada - National Science Library
Lewicki, Davide
2003-01-01
.... Experimental tests were performed on the OH-58D helicopter main-rotor transmission in the NASA Glenn 500-hp Helicopter Transmission Test Stand Low-noise, improved-bearing- contact spiral-bevel gears...
Directory of Open Access Journals (Sweden)
Willemijn J Idema
Full Text Available BACKGROUND: With 249,007 new leprosy patients detected globally in 2008, it remains necessary to develop new and effective interventions to interrupt the transmission of M. leprae. We assessed the economic benefits of single dose rifampicin (SDR for contacts as chemoprophylactic intervention in the control of leprosy. METHODS: We conducted a single centre, double blind, cluster randomised, placebo controlled trial in northwest Bangladesh between 2002 and 2007, including 21,711 close contacts of 1,037 patients with newly diagnosed leprosy. We gave a single dose of rifampicin or placebo to close contacts, with follow-up for four years. The main outcome measure was the development of clinical leprosy. We assessed the cost effectiveness by calculating the incremental cost effectiveness ratio (ICER between the standard multidrug therapy (MDT program with the additional chemoprophylaxis intervention versus the standard MDT program only. The ICER was expressed in US dollars per prevented leprosy case. FINDINGS: Chemoprophylaxis with SDR for preventing leprosy among contacts of leprosy patients is cost-effective at all contact levels and thereby a cost-effective prevention strategy. In total, $6,009 incremental cost was invested and 38 incremental leprosy cases were prevented, resulting in an ICER of $158 per one additional prevented leprosy case. It was the most cost-effective in neighbours of neighbours and social contacts (ICER $214, slightly less cost-effective in next door neighbours (ICER $497 and least cost-effective among household contacts (ICER $856. CONCLUSION: Chemoprophylaxis with single dose rifampicin given to contacts of newly diagnosed leprosy patients is a cost-effective intervention strategy. Implementation studies are necessary to establish whether this intervention is acceptable and feasible in other leprosy endemic areas of the world.
Contact replacement for NMR resonance assignment.
Xiong, Fei; Pandurangan, Gopal; Bailey-Kellogg, Chris
2008-07-01
Complementing its traditional role in structural studies of proteins, nuclear magnetic resonance (NMR) spectroscopy is playing an increasingly important role in functional studies. NMR dynamics experiments characterize motions involved in target recognition, ligand binding, etc., while NMR chemical shift perturbation experiments identify and localize protein-protein and protein-ligand interactions. The key bottleneck in these studies is to determine the backbone resonance assignment, which allows spectral peaks to be mapped to specific atoms. This article develops a novel approach to address that bottleneck, exploiting an available X-ray structure or homology model to assign the entire backbone from a set of relatively fast and cheap NMR experiments. We formulate contact replacement for resonance assignment as the problem of computing correspondences between a contact graph representing the structure and an NMR graph representing the data; the NMR graph is a significantly corrupted, ambiguous version of the contact graph. We first show that by combining connectivity and amino acid type information, and exploiting the random structure of the noise, one can provably determine unique correspondences in polynomial time with high probability, even in the presence of significant noise (a constant number of noisy edges per vertex). We then detail an efficient randomized algorithm and show that, over a variety of experimental and synthetic datasets, it is robust to typical levels of structural variation (1-2 AA), noise (250-600%) and missings (10-40%). Our algorithm achieves very good overall assignment accuracy, above 80% in alpha-helices, 70% in beta-sheets and 60% in loop regions. Our contact replacement algorithm is implemented in platform-independent Python code. The software can be freely obtained for academic use by request from the authors.
Extreme control of impulse transmission by cylinder-based nonlinear phononic crystals
Chaunsali, Rajesh; Toles, Matthew; Yang, Jinkyu; Kim, Eunho
2017-10-01
We present a novel device that can offer two extremes of elastic wave propagation - nearly complete transmission and strong attenuation under impulse excitation. The mechanism of this highly tunable device relies on intermixing effects of dispersion and nonlinearity. The device consists of identical cylinders arranged in a chain, which interact with each other as per nonlinear Hertz contact law. For a 'dimer' configuration, i.e., two different contact angles alternating in the chain, we analytically, numerically, and experimentally show that impulse excitation can either propagate as a localized wave, or it can travel as a highly dispersive wave. Remarkably, these extremes can be achieved in this periodic arrangement simply by in-situ control of contact angles between cylinders. We close the discussion by highlighting the key characteristics of the mechanisms that facilitate strong attenuation of incident impulse. These include low-to-high frequency scattering, and turbulence-like cascading in a periodic system. We thus envision that these adaptive, cylinder-based nonlinear phononic crystals, in conjunction with conventional impact mitigation mechanisms, could be used to design highly tunable and efficient impact manipulation devices.
Nanoscale roughness contact in a slider-disk interface.
Hua, Wei; Liu, Bo; Yu, Shengkai; Zhou, Weidong
2009-07-15
The nanoscale roughness contact between molecularly smooth surfaces of a slider-disk interface in a hard disk drive is analyzed, and the lubricant behavior at very high shear rate is presented. A new contact model is developed to study the nanoscale roughness contact behavior by classifying various forms of contact into slider-lubricant contact, slider-disk elastic contact and plastic contact. The contact pressure and the contact probabilities of the three types of contact are investigated. The new contact model is employed to explain and provide insight to an interesting experimental result found in a thermal protrusion slider. The protrusion budget for head surfing in the lubricant, which is the ideal state for contact recording, is also discussed.
Nanoscale roughness contact in a slider-disk interface
International Nuclear Information System (INIS)
Hua Wei; Liu Bo; Yu Shengkai; Zhou Weidong
2009-01-01
The nanoscale roughness contact between molecularly smooth surfaces of a slider-disk interface in a hard disk drive is analyzed, and the lubricant behavior at very high shear rate is presented. A new contact model is developed to study the nanoscale roughness contact behavior by classifying various forms of contact into slider-lubricant contact, slider-disk elastic contact and plastic contact. The contact pressure and the contact probabilities of the three types of contact are investigated. The new contact model is employed to explain and provide insight to an interesting experimental result found in a thermal protrusion slider. The protrusion budget for head surfing in the lubricant, which is the ideal state for contact recording, is also discussed.
International Nuclear Information System (INIS)
Radford, E.P.
1980-01-01
Major public health impacts of electric power generation and transmission associated with the nuclear fuel cycle and with coal use are evaluated. Only existing technology is evaluated. The only health effects of concern are those leading to definable human disease and injury. Health effects are scaled to a nominal 1000 Megawatt (electric) plant fueled by either option. Comparison of the total health effects to the general public gives: nuclear, 0.03 to 0.05 major health effects per 1000 MWe per year; coal, 0.7 to 3.7 per 1000 MWe per year. Thus for the general public the health risks from the coal cycle are about 50 times greater than for the nuclear cycle. Health effects to workers in the industry are currently quite high. For the nuclear cycle, 4.6 to 5.1 major health impacts per 1000 MWe per year; for coal, 6.5 to 10.9. The two-fold greater risk for the coal cycle is primarily due to high injury rates in coal miners. There is no evidence that electrical transmission contributes any health effects to the general public, except for episodes where broken power lines come in contact with people. For power line workers, the risk is estimated at 0.1 serious injury per 1000 MWe per year
Directory of Open Access Journals (Sweden)
Judith R Glynn
Full Text Available The proportion of tuberculosis attributable to transmission from close contacts is not well known. Comparison of the genome of strains from index patients and prior contacts allows transmission to be confirmed or excluded.In Karonga District, Malawi, all tuberculosis patients are asked about prior contact with others with tuberculosis. All available strains from culture-positive patients were sequenced. Up to 10 single nucleotide polymorphisms between index patients and their prior contacts were allowed for confirmation, and ≥ 100 for exclusion. The population attributable fraction was estimated from the proportion of confirmed transmissions and the proportion of patients with contacts.From 1997-2010 there were 1907 new culture-confirmed tuberculosis patients, of whom 32% reported at least one family contact and an additional 11% had at least one other contact; 60% of contacts had smear-positive disease. Among case-contact pairs with sequences available, transmission was confirmed from 38% (62/163 smear-positive prior contacts and 0/17 smear-negative prior contacts. Confirmed transmission was more common in those related to the prior contact (42.4%, 56/132 than in non-relatives (19.4%, 6/31, p = 0.02, and in those with more intense contact, to younger index cases, and in more recent years. The proportion of tuberculosis attributable to known contacts was estimated to be 9.4% overall.In this population known contacts only explained a small proportion of tuberculosis cases. Even those with a prior family contact with smear positive tuberculosis were more likely to have acquired their infection elsewhere.
Courey, Karim J.; Asfour, Shihab S.; Onar, Arzu; Bayliss, Jon A.; Ludwig, Larry L.; Wright, Maria C.
2009-01-01
To comply with lead-free legislation, many manufacturers have converted from tin-lead to pure tin finishes of electronic components. However, pure tin finishes have a greater propensity to grow tin whiskers than tin-lead finishes. Since tin whiskers present an electrical short circuit hazard in electronic components, simulations have been developed to quantify the risk of said short circuits occurring. Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that had an unknown probability associated with it. Note however that due to contact resistance electrical shorts may not occur at lower voltage levels. In our first article we developed an empirical probability model for tin whisker shorting. In this paper, we develop a more comprehensive empirical model using a refined experiment with a larger sample size, in which we studied the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From the resulting data we estimated the probability distribution of an electrical short, as a function of voltage. In addition, the unexpected polycrystalline structure seen in the focused ion beam (FIB) cross section in the first experiment was confirmed in this experiment using transmission electron microscopy (TEM). The FIB was also used to cross section two card guides to facilitate the measurement of the grain size of each card guide's tin plating to determine its finish.
Jones, Jefferson; Klein, Ron; Popescu, Saskia; Rose, Karen; Kretschmer, Melissa; Carrigan, Alice; Trembath, Felicia; Koski, Lia; Zabel, Karen; Ostdiek, Scott; Rowell-Kinnard, Paula; Munoz, Esther; Sunenshine, Rebecca; Sylvester, Tammy
2015-08-07
On January 23, 2015, the Maricopa County Department of Public Health (MCDPH) was notified of a suspected measles case in a nurse, a woman aged 48 years. On January 11, the nurse had contact with a patient with laboratory-confirmed measles associated with the Disneyland theme park-related outbreak in California. On January 21, she developed a fever (103°F [39.4°C]), on January 23 she experienced cough and coryza, and on January 24, she developed a rash. The patient was instructed to isolate herself at home. On January 26, serum, a nasopharyngeal swab, and a urine specimen were collected. The following day, measles infection was diagnosed by real time reverse transcription polymerase chain reaction testing of the nasopharyngeal swab and urine specimen and by detection of measles-specific immunoglobulin (Ig)M and IgG in serum by enzyme-linked immunosorbent assay. Because of her symptoms and laboratory results, the patient was considered to be infectious.
Directory of Open Access Journals (Sweden)
Slavche Pejoski
2014-01-01
Full Text Available We present a framework for cross-layer optimized real time multiuser encoding of video using a single layer H.264/AVC and transmission over MIMO wireless channels. In the proposed cross-layer adaptation, the channel of every user is characterized by the probability density function of its channel mutual information and the performance of the H.264/AVC encoder is modeled by a rate distortion model that takes into account the channel errors. These models are used during the resource allocation of the available slots in a TDMA MIMO communication system with capacity achieving channel codes. This framework allows for adaptation to the statistics of the wireless channel and to the available resources in the system and utilization of the multiuser diversity of the transmitted video sequences. We show the effectiveness of the proposed framework for video transmission over Rayleigh MIMO block fading channels, when channel distribution information is available at the transmitter.
Energy Technology Data Exchange (ETDEWEB)
Thumm, G. [ThyssenKrupp Aufzuege, Stuttgart-Vaihingen (Germany); Jetter, M. [ThyssenKrupp Aufzugswerke, Neuhausen (Germany)
2004-07-01
For many years, traveling cables have been used to supply power to elevator cabs and transmit the required control signals. In difficult conditions, however, e.g. exposed outdoor elevators or installations in very tall structures, traveling cables can be problematic and frequently disrupt operations. In such cases, new technologies such as inductive energy transmission and radio transmission of safety-related signals allow the traveling cable to be dispensed with completely and guarantee safe and reliable elevator operation even in difficult conditions. (orig.) [German] Es ist eine seit vielen Jahren bewaehrte Technik, den Aufzugsfahrkorb ueber ein Haengekabel mit Energie zu versorgen und ueber dieses auch die notwendigen Steuerungssignale zu uebertragen. Es gibt aber Einsatzbereiche in schwierigen Umgebungsbedingungen, z.B. im Freien oder bei grossen Foerderhoehen, bei denen die Anwendung eines Haengekabels mit grossen Schwierigkeiten verbunden ist und im Betrieb oftmals zu Stoerungen fuehrt. Neue Technologien, wie die induktive Energieuebertragung und eine sicherheitsgerichtete Datenuebertragung per Funk, erlauben es nun in diesen Faellen, ganz auf das Haengekabel zu verzichten und den sicheren und zuverlaessigen Betrieb der Aufzugsanlagen auch in schwierigem Umfeld zu gewaehrleisten. (orig.)
Current contact device for a superconducting magnet coil
International Nuclear Information System (INIS)
Hieronymus, H.
1987-01-01
The invention concerns a current supply device for a superconducting magnet coil to be shortcircuited, with a separating device per coil end, which contains a fixed cooled contact and a moving contact connected to a power supply device and a mechanical actuating device for closing and opening the contacts. When closing the heated contact on to the cooled contact, relatively large quantities of heat can be transferred to the cooled contact and therefore to the connected superconducting coil end and can cause normal conduction there. The invention therefore provides that the mass ratio of the cooled contact to the moving contact is at least 5:1, preferably at least 10:1, and that the cooled contact part is provided, at the end away from the contact area, with means for increasing the area, for example cooling fins and is connected to the coil end has a thermal resistance between the contact area and the coil end of at least 0.2 k/W, preferably at least 0.5 k/W per 1000 A of current to be transmitted. (orig.) [de
Lei, Hao; Jones, Rachael M; Li, Yuguo
2017-01-18
Cleaning of environmental surfaces in hospitals is important for the control of methicillin-resistant Staphylococcus aureus (MRSA) and other hospital-acquired infections transmitted by the contact route. Guidance regarding the best approaches for cleaning, however, is limited. In this study, a mathematical model based on ordinary differential equations was constructed to study MRSA concentration dynamics on high-touch and low-touch surfaces, and on the hands and noses of two patients (in two hospitals rooms) and a health care worker in a hypothetical hospital environment. Two cleaning interventions - whole room cleaning and wipe cleaning of touched surfaces - were considered. The performance of the cleaning interventions was indicated by a reduction in MRSA on the nose of a susceptible patient, relative to no intervention. Whole room cleaning just before first patient care activities of the day was more effective than whole room cleaning at other times, but even with 100% efficiency, whole room cleaning only reduced the number of MRSA transmitted to the susceptible patient by 54%. Frequent wipe cleaning of touched surfaces was shown to be more effective that whole room cleaning because surfaces are rapidly re-contaminated with MRSA after cleaning. Wipe cleaning high-touch surfaces was more effective than wipe cleaning low-touch surfaces for the same frequency of cleaning. For low wipe cleaning frequency (≤3 times per hour), high-touch surfaces should be targeted, but for high wipe cleaning frequency (>3 times per hour), cleaning should target high- and low-touch surfaces in proportion to the surface touch frequency. This study reproduces the observations from a field study of room cleaning, which provides support for the validity of our findings. Daily whole room cleaning, even with 100% cleaning efficiency, provides limited reduction in the number of MRSA transmitted to susceptible patients via the contact route; and should be supplemented with frequent targeted
Sheep movement networks and the transmission of infectious diseases.
Directory of Open Access Journals (Sweden)
Victoriya V Volkova
2010-06-01
Full Text Available Various approaches have been used to investigate how properties of farm contact networks impact on the transmission of infectious diseases. The potential for transmission of an infection through a contact network can be evaluated in terms of the basic reproduction number, R(0. The magnitude of R(0 is related to the mean contact rate of a host, in this case a farm, and is further influenced by heterogeneities in contact rates of individual hosts. The latter can be evaluated as the second order moments of the contact matrix (variances in contact rates, and co-variance between contacts to and from individual hosts. Here we calculate these quantities for the farms in a country-wide livestock network: >15,000 Scottish sheep farms in each of 4 years from July 2003 to June 2007. The analysis is relevant to endemic and chronic infections with prolonged periods of infectivity of affected animals, and uses different weightings of contacts to address disease scenarios of low, intermediate and high animal-level prevalence.Analysis of networks of Scottish farms via sheep movements from July 2003 to June 2007 suggests that heterogeneities in movement patterns (variances and covariances of rates of movement on and off the farms make a substantial contribution to the potential for the transmission of infectious diseases, quantified as R(0, within the farm population. A small percentage of farms (80% and these farms could be efficiently targeted by interventions aimed at reducing spread of diseases via animal movement.
Wang, W. L.; Tsui, K. L.; Lo, S. M.; Liu, S. B.
2018-01-01
Crowded transportation hubs such as metro stations are thought as ideal places for the development and spread of epidemics. However, for the special features of complex spatial layout, confined environment with a large number of highly mobile individuals, it is difficult to quantify human contacts in such environments, wherein disease spreading dynamics were less explored in the previous studies. Due to the heterogeneity and dynamic nature of human interactions, increasing studies proved the importance of contact distance and length of contact in transmission probabilities. In this study, we show how detailed information on contact and exposure patterns can be obtained by statistical analyses on microscopic crowd simulation data. To be specific, a pedestrian simulation model-CityFlow was employed to reproduce individuals' movements in a metro station based on site survey data, values and distributions of individual contact rate and exposure in different simulation cases were obtained and analyzed. It is interesting that Weibull distribution fitted the histogram values of individual-based exposure in each case very well. Moreover, we found both individual contact rate and exposure had linear relationship with the average crowd densities of the environments. The results obtained in this paper can provide reference to epidemic study in complex and confined transportation hubs and refine the existing disease spreading models.
Directory of Open Access Journals (Sweden)
Lena Fiebig
2009-11-01
Full Text Available Ongoing economic losses by and exposure of humans to highly pathogenic avian influenza (HPAI in poultry flocks across Asia and parts of Africa and Europe motivate also outbreak-free countries such as Switzerland to invest in preparedness planning. Country-specific population data on between-farm contacts are required to anticipate probable patterns of pathogen spread. Information is scarce; in particular on how strongly small, non-commercial poultry farms are involved in between-farm contacts. We aimed to identify between-farm contacts of interest for HPAI spread at both commercial and non-commercial farms in a non-outbreak situation: whether or not commercial and non-commercial farms were involved in poultry and person movements and shared resources by company integration. Focus was on poultry movements for the purpose of purchase, sale and poultry show visits, their spatial dimension, their frequencies and the farm types they connected. Of the total 49,437 recorded poultry farms in Switzerland, 95% had less than 500 birds. The farm number resulted in densities of up to 8 poultry farms per km2 and a median number of 47 neighbour farms within a 3 km radius around the farms. Person movements and shared resources were identified in 78% of the surveyed farms (93% among commercials, 67% among non-commercials. Poultry trading movements over extensive spatial ranges were stated at 65% (79% among commercials, 55% among non-commercials. Movement frequencies depended on farm specialization and were higher for commercial than for non-commercial farms except for poultry show visits. Estimates however for the entire population revealed 3.5 times higher chances of a poultry purchase, and 14.6 times higher chances of exhibiting birds at poultry shows occurring in a given time by a farm smaller than 500 birds (non-commercial farm than by a larger (commercial farm. These findings indicate that both commercial and non-commercial farms are involved in
Estimation of the transmission of foot-and-mouth disease virus from infected sheep to cattle
Bravo De Rueda, C.; Jong, de M.C.M.; Eble, P.L.; Dekker, A.
2014-01-01
The quantitative role of sheep in the transmission of foot-and-mouth disease virus (FMDV) is not well known. To estimate the role of sheep in the transmission of FMDV, a direct contact transmission experiment with 10 groups of animals each consisting of 2 infected lambs and 1 contact calf was
Acanthamoeba keratitis in Scotland: risk factors for contact lens wearers.
Seal, D V; Kirkness, C M; Bennett, H G; Peterson, M
1999-01-01
To investigate risk factors for Acanthamoeba keratitis amongst contact lens wearers in Scotland. Patients with Acanthamoeba keratitis in the Scottish study, all of whom wore contact lenses, were compared with 46 healthy asymptomatic contact lens-wearing controls. They were all visited at home for contact lens and environmental microbiological sampling. In addition, all 288 optical practices in the West of Scotland were polled for contact lens types and disinfecting solutions sold in 1995, and a sample, each of whom fitted more than 500 contact lenses per year, were polled for a second time. Independently, a poll was commissioned by the Eyecare Information Service in July/August 1995 to estimate the numbers of contact lens wearers in Scotland and the UK. Industry was polled for numbers of each contact lens disinfecting regimen sold in Scotland in 1995. West of Scotland, UK. All contact lens wearers among the 3 million population of the West of Scotland Health Board Areas. Risk factors for Acanthamoeba infection and recommendations for its prevention. When Acanthamoeba infection occurred, patients' home water systems were frequently (54%) found to be colonised by this amoeba. Patients more frequently washed their storage cases in tap water than controls (Pmethods (chlorine tablets or no disinfection). However further investigation showed that these methods were associated with an increased probability of rinsing the storage case in tap water, so that these two behaviours are confounded in the group studied. Failure to disinfect contact lenses, non-compliant use of chlorine tablets and/or introduction of tap water rinsing of storage cases were associated with increased risk of Acanthamoeba infection. New multipurpose solutions and hydrogen peroxide gave the lowest risk of Acanthamoeba infection, with no statistically significant difference between them. Ionic high-water content (FDA group 4) contact lenses were at increased risk of being associated with Acanthamoeba
Household transmission of rotavirus in a community with rotavirus vaccination in Quininde, Ecuador.
Directory of Open Access Journals (Sweden)
Ben Lopman
Full Text Available We studied the transmission of rotavirus infection in households in peri-urban Ecuador in the vaccination era.Stool samples were collected from household contacts of child rotavirus cases, diarrhea controls and healthy controls following presentation of the index child to health facilities. Rotavirus infection status of contacts was determined by RT-qPCR. We examined factors associated with transmissibility (index-case characteristics and susceptibility (household-contact characteristics.Amongst cases, diarrhea controls and healthy control household contacts, infection attack rates (iAR were 55%, 8% and 2%, (n = 137, 130, 137 respectively. iARs were higher from index cases with vomiting, and amongst siblings. Disease ARs were higher when the index child was <18 months and had vomiting, with household contact <10 years and those sharing a room with the index case being more susceptible. We found no evidence of asymptomatic infections leading to disease transmission.Transmission rates of rotavirus are high in households with an infected child, while background infections are rare. We have identified factors associated with transmission (vomiting/young age of index case and susceptibility (young age/sharing a room/being a sibling of the index case. Vaccination may lead to indirect benefits by averting episodes or reducing symptoms in vaccinees.
A Procedure for 3-D Contact Stress Analysis of Spiral Bevel Gears
Kumar, A.; Bibel, G.
1994-01-01
Contact stress distribution of spiral bevel gears using nonlinear finite element static analysis is presented. Procedures have been developed to solve the nonlinear equations that identify the gear and pinion surface coordinates based on the kinematics of the cutting process and orientate the pinion and the gear in space to mesh with each other. Contact is simulated by connecting GAP elements along the intersection of a line from each pinion point (parallel to the normal at the contact point) with the gear surface. A three dimensional model with four gear teeth and three pinion teeth is used to determine the contact stresses at two different contact positions in a spiral bevel gearset. A summary of the elliptical contact stress distribution is given. This information will be helpful to helicopter and aircraft transmission designers who need to minimize weight of the transmission and maximize reliability.
Park, Andrew W.; Magori, Krisztian; White, Brad A.; Stallknecht, David E.
2013-01-01
The assumed straightforward connection between transmission intensity and disease occurrence impacts surveillance and control efforts along with statistical methodology, including parameter inference and niche modeling. Many infectious disease systems have the potential for this connection to be more complicated–although demonstrating this in any given disease system has remained elusive. Hemorrhagic disease (HD) is one of the most important diseases of white-tailed deer and is caused by viruses in the Orbivirus genus. Like many infectious diseases, the probability or severity of disease increases with age (after loss of maternal antibodies) and the probability of disease is lower upon re-infection compared to first infection (based on cross-immunity between virus strains). These broad criteria generate a prediction that disease occurrence is maximized at intermediate levels of transmission intensity. Using published US field data, we first fit a statistical model to predict disease occurrence as a function of seroprevalence (a proxy for transmission intensity), demonstrating that states with intermediate seroprevalence have the highest level of case reporting. We subsequently introduce an independently parameterized mechanistic model supporting the theory that high case reporting should come from areas with intermediate levels of transmission. This is the first rigorous demonstration of this phenomenon and illustrates that variation in transmission rate (e.g. along an ecologically-controlled transmission gradient) can create cryptic refuges for infectious diseases. PMID:23579922
Isoe, G. M.; Wassin, S.; Gamatham, R. R. G.; Leitch, A. W. R.; Gibbon, T. B.
2017-01-01
Access networks based on vertical cavity surface emitting laser (VCSEL) transmitters offer alternative solution in delivering different high bandwidth, cost effective services to the customer premises. Clock and reference frequency distribution is critical for applications such as Coordinated Universal Time (UTC), GPS, banking and big data science projects. Simultaneous distribution of both data and timing signals over shared infrastructure is thus desirable. In this paper, we propose and experimentally demonstrate a novel, cost-effective technique for multi-signal modulation on a single VCSEL transmitter. Two signal types, an intensity modulated 10 Gbps data signal and a polarization-based pulse per second (PPS) clock signal are directly modulated onto a single VCSEL carrier at 1310 nm. Spectral efficiency is maximized by exploiting inherent orthogonal polarization switching of the VCSEL with changing bias in transmission of the PPS signal. A 10 Gbps VCSEL transmission with PPS over 11 km of G.652 fibre introduced a transmission penalty of 0.52 dB. The contribution of PPS to this penalty was found to be 0.08 dB.
Evaluation of contact sensitivity to topical drugs in patients with contact dermatitis
Directory of Open Access Journals (Sweden)
Bilge Bülbül Şen
2013-03-01
Full Text Available Background and Design: Topical drugs are an important group of contact allergens. The present study aimed to evaluate contact sensitivity to topical drugs in patients with contact dermatitis. Materials and Methods: Between 2003 and 2008, 129 patients were followed up at the Department of Dermatology at Ankara University School of Medicine with clinically suspected contact sensitivity to topical drugs. In this study, the patch test reactions to the European Standard Battery and topical drugs used by the patients and medicament patch test results were evaluated. Results: Positive patch test reaction to one or more allergens was found in 80 (62.0% of 129 patients included in the study. Sixty-one of the 80 patients (61/129, 47.3% had positive patch test reaction to medicaments. Medicament sensitivity was detected in 37.9% (49/129 of subjects. Nitrofurazone was found to be the most common allergen (18.6%. Discussion: The present study showed that topical drugs are a frequent cause of allergic contact dermatitis. Therefore, the probability of contact sensitivity to topical drugs should also be considered in patients with the clinical diagnosis of allergic contact dermatitis and, suspected cases should be evaluated further with patch testing in order to find the responsible allergens.
Optimization of solar cell contacts by system cost-per-watt minimization
Redfield, D.
1977-01-01
New, and considerably altered, optimum dimensions for solar-cell metallization patterns are found using the recently developed procedure whose optimization criterion is the minimum cost-per-watt effect on the entire photovoltaic system. It is also found that the optimum shadow fraction by the fine grid is independent of metal cost and resistivity as well as cell size. The optimum thickness of the fine grid metal depends on all these factors, and in familiar cases it should be appreciably greater than that found by less complete analyses. The optimum bus bar thickness is much greater than those generally used. The cost-per-watt penalty due to the need for increased amounts of metal per unit area on larger cells is determined quantitatively and thereby provides a criterion for the minimum benefits that must be obtained in other process steps to make larger cells cost effective.
Modeling and calculation of impact friction caused by corner contact in gear transmission
Zhou, Changjiang; Chen, Siyu
2014-09-01
Corner contact in gear pair causes vibration and noise, which has attracted many attentions. However, teeth errors and deformation make it difficulty to determine the point situated at corner contact and study the mechanism of teeth impact friction in the current researches. Based on the mechanism of corner contact, the process of corner contact is divided into two stages of impact and scratch, and the calculation model including gear equivalent error—combined deformation is established along the line of action. According to the distributive law, gear equivalent error is synthesized by base pitch error, normal backlash and tooth profile modification on the line of action. The combined tooth compliance of the first point lying in corner contact before the normal path is inversed along the line of action, on basis of the theory of engagement and the curve of tooth synthetic compliance & load-history. Combined secondarily the equivalent error with the combined deflection, the position standard of the point situated at corner contact is probed. Then the impact positions and forces, from the beginning to the end during corner contact before the normal path, are calculated accurately. Due to the above results, the lash model during corner contact is founded, and the impact force and frictional coefficient are quantified. A numerical example is performed and the averaged impact friction coefficient based on the presented calculation method is validated. This research obtains the results which could be referenced to understand the complex mechanism of teeth impact friction and quantitative calculation of the friction force and coefficient, and to gear exact design for tribology.
Ahmad, Samir Mahmmod; Leong, Cheow Siu; Sopian, K.; Zaidi, Saleem H.
2018-03-01
Formation of an Ohmic contact requires a suitable firing temperature, appropriate doping profile, and contact dimensions within resolution limits of the screen-printing process. In this study, the role of the peak firing temperature in standard rapid thermal annealing (RTA) six-zone conveyor belt furnace (CBF) and two inexpensive alternate RTA systems [a custom-designed, three-zone, 5″-diameter quartz tube furnace (QTF) and a tabletop, 3″-diameter rapid thermal processing (RTP)] has been investigated. In addition, the role of sheet resistance and contact area in achieving low-resistance ohmic contacts has been examined. Electrical measurements of ohmic contacts between silver paste/ n +-emitter layer with varying sheet resistances and aluminum paste/ p-doped wafer were carried out in transmission line method configuration. Experimental measurements of the contact resistivity ( ρ c) exhibited the lowest values for CBF at 0.14 mΩ cm2 for Ag and 100 mΩ cm2 for Al at a peak firing temperature of 870°C. For the QTF configuration, lowest measured contact resistivities were 3.1 mΩ cm2 for Ag and 74.1 mΩ cm2 for Al at a peak firing temperature of 925°C. Finally, for the RTP configuration, lowest measured contact resistivities were 1.2 mΩ cm2 for Ag and 68.5 mΩ cm2 for Al at a peak firing temperature of 780°C. The measured contact resistivity exhibits strong linear dependence on sheet resistance. The contact resistivity for Ag decreases with contact area, while for Al the opposite behavior is observed.
The effects of online social networks on tacit knowledge transmission
Zhu, Hong-Miao; Zhang, Sheng-Tai; Jin, Zhen
2016-01-01
Due to the popular use of online social networks in today's world, how to propagate employees' tacit knowledge via online social networks has attracted managers' attention, which is critical to enhance the competitiveness of firms. In this paper, we propose a tacit knowledge transmission model on networks with even mixing based on the propagation property of tacit knowledge and the application of online social networks. We consider two routes of transmission, which are contact through online social networks and face-to-face physical contact, and derive the threshold that governs whether or not a kind of tacit knowledge can be shared in an organization with few initial employees who have acquired it. The impact of the degree distribution of the users' contact network on the transmission is investigated analytically. Some numerical simulations are presented to support the theoretical results. We perform the sensitivity analysis of the threshold in terms of the propagation parameters and confirm that online social networks contribute significantly to enhancing the transmission of tacit knowledge among employees.
Rugged Low-Resistance Contacts To High-Tc Superconductors
Caton, Randall; Selim, Raouf; Byvik, Charles E.; Buoncristiani, A. Martin
1992-01-01
Newly developed technique involving use of gold makes possible to fabricate low-resistance contacts with rugged connections to high-Tc superconductors. Gold diffused into specimen of superconducting material by melting gold beads onto surface of specimen, making strong mechanical contacts. Shear strength of gold bead contacts greater than epoxy or silver paste. Practical use in high-current-carrying applications of new high-Tc materials, including superconducting magnets, long-wavelength sensors, electrical ground planes at low temperatures, and efficient transmission of power.
High power RF transmission line component development
International Nuclear Information System (INIS)
Hong, B. G.; Hwang, C. K.; Bae, Y. D.; Yoon, J. S.; Wang, S. J.; Gu, S. H.; Yang, J. R.; Hahm, Y. S.; Oh, G. S.; Lee, J. R.; Lee, W. I.; Park, S. H.; Kang, M. S.; Oh, S. H.; Lee, W.I.
1999-12-01
We developed the liquid stub and phase shifter which are the key high RF power transmission line components. They show reliable operation characteristics and increased insulation capability, and reduced the size by using liquid (silicon oil, dielectric constant ε=2.72) instead of gas for insulating dielectric material. They do not have finger stock for the electric contact so the local temperature rise due to irregular contact and RF breakdown due to scratch in conductor are prevented. They can be utilized in broadcasting, radar facility which require high RF power transmission. Moreover, they are key components in RF heating system for fusion reactor. (author)
High power RF transmission line component development
Energy Technology Data Exchange (ETDEWEB)
Hong, B. G.; Hwang, C. K.; Bae, Y. D.; Yoon, J. S.; Wang, S. J.; Gu, S. H.; Yang, J. R.; Hahm, Y. S.; Oh, G. S.; Lee, J. R.; Lee, W. I.; Park, S. H.; Kang, M. S.; Oh, S. H.; Lee, W.I
1999-12-01
We developed the liquid stub and phase shifter which are the key high RF power transmission line components. They show reliable operation characteristics and increased insulation capability, and reduced the size by using liquid (silicon oil, dielectric constant {epsilon}=2.72) instead of gas for insulating dielectric material. They do not have finger stock for the electric contact so the local temperature rise due to irregular contact and RF breakdown due to scratch in conductor are prevented. They can be utilized in broadcasting, radar facility which require high RF power transmission. Moreover, they are key components in RF heating system for fusion reactor. (author)
International Nuclear Information System (INIS)
Smith, M. D.; Parbrook, P. J.; O'Mahony, D.; Conroy, M.; Schmidt, M.
2015-01-01
This paper correlates the micro-structural and electrical characteristics associated with annealing of metallic multi-layers typically used in the formation of Ohmic contacts to InAlN high electron mobility transistors. The multi-layers comprised Ti/Al/Ni/Au and were annealed via rapid thermal processing at temperatures up to 925 °C with electrical current-voltage analysis establishing the onset of Ohmic (linear IV) behaviour at 750–800 °C. In-situ temperature dependent transmission electron microscopy established that metallic diffusion and inter-mixing were initiated near a temperature of 500 °C. Around 800 °C, inter-diffusion of the metal and semiconductor (nitride) was observed, correlating with the onset of Ohmic electrical behaviour. The sheet resistance associated with the InAlN/AlN/GaN interface is highly sensitive to the anneal temperature, with the range depending on the Ti layer thickness. The relationship between contact resistivity and measurement temperature follow that predicted by thermionic field emission for contacts annealed below 850 °C, but deviated above this due to excessive metal-semiconductor inter-diffusion
Horizontal versus familial transmission of Helicobacter pylori.
Directory of Open Access Journals (Sweden)
Sandra Schwarz
2008-10-01
Full Text Available Transmission of Helicobacter pylori is thought to occur mainly during childhood, and predominantly within families. However, due to the difficulty of obtaining H. pylori isolates from large population samples and to the extensive genetic diversity between isolates, the transmission and spread of H. pylori remain poorly understood. We studied the genetic relationships of H. pylori isolated from 52 individuals of two large families living in a rural community in South Africa and from 43 individuals of 11 families living in urban settings in the United Kingdom, the United States, Korea, and Colombia. A 3,406 bp multilocus sequence haplotype was determined for a total of 142 H. pylori isolates. Isolates were assigned to biogeographic populations, and recent transmission was measured as the occurrence of non-unique isolates, i.e., isolates whose sequences were identical to those of other isolates. Members of urban families were almost always infected with isolates from the biogeographic population that is common in their location. Non-unique isolates were frequent in urban families, consistent with familial transmission between parents and children or between siblings. In contrast, the diversity of H. pylori in the South African families was much more extensive, and four distinct biogeographic populations circulated in this area. Non-unique isolates were less frequent in South African families, and there was no significant correlation between kinship and similarity of H. pylori sequences. However, individuals who lived in the same household did have an increased probability of carrying the same non-unique isolates of H. pylori, independent of kinship. We conclude that patterns of spread of H. pylori under conditions of high prevalence, such as the rural South African families, differ from those in developed countries. Horizontal transmission occurs frequently between persons who do not belong to a core family, blurring the pattern of familial
Calculation of the tunneling time using the extended probability of the quantum histories approach
International Nuclear Information System (INIS)
Rewrujirek, Jiravatt; Hutem, Artit; Boonchui, Sutee
2014-01-01
The dwell time of quantum tunneling has been derived by Steinberg (1995) [7] as a function of the relation between transmission and reflection times τ t and τ r , weighted by the transmissivity and the reflectivity. In this paper, we reexamine the dwell time using the extended probability approach. The dwell time is calculated as the weighted average of three mutually exclusive events. We consider also the scattering process due to a resonance potential in the long-time limit. The results show that the dwell time can be expressed as the weighted sum of transmission, reflection and internal probabilities.
Endoscopic transmission of Helicobacter pylori
Tytgat, G. N.
1995-01-01
The contamination of endoscopes and biopsy forceps with Helicobacter pylori occurs readily after endoscopic examination of H. pylori-positive patients. Unequivocal proof of iatrogenic transmission of the organism has been provided. Estimates for transmission frequency approximate to 4 per 1000
Inference of Transmission Network Structure from HIV Phylogenetic Trees.
Giardina, Federica; Romero-Severson, Ethan Obie; Albert, Jan; Britton, Tom; Leitner, Thomas
2017-01-01
Phylogenetic inference is an attractive means to reconstruct transmission histories and epidemics. However, there is not a perfect correspondence between transmission history and virus phylogeny. Both node height and topological differences may occur, depending on the interaction between within-host evolutionary dynamics and between-host transmission patterns. To investigate these interactions, we added a within-host evolutionary model in epidemiological simulations and examined if the resulting phylogeny could recover different types of contact networks. To further improve realism, we also introduced patient-specific differences in infectivity across disease stages, and on the epidemic level we considered incomplete sampling and the age of the epidemic. Second, we implemented an inference method based on approximate Bayesian computation (ABC) to discriminate among three well-studied network models and jointly estimate both network parameters and key epidemiological quantities such as the infection rate. Our ABC framework used both topological and distance-based tree statistics for comparison between simulated and observed trees. Overall, our simulations showed that a virus time-scaled phylogeny (genealogy) may be substantially different from the between-host transmission tree. This has important implications for the interpretation of what a phylogeny reveals about the underlying epidemic contact network. In particular, we found that while the within-host evolutionary process obscures the transmission tree, the diversification process and infectivity dynamics also add discriminatory power to differentiate between different types of contact networks. We also found that the possibility to differentiate contact networks depends on how far an epidemic has progressed, where distance-based tree statistics have more power early in an epidemic. Finally, we applied our ABC inference on two different outbreaks from the Swedish HIV-1 epidemic.
Avian influenza H5N1 transmission in households, Indonesia.
Directory of Open Access Journals (Sweden)
Tjandra Y Aditama
Full Text Available BACKGROUND: Disease transmission patterns are needed to inform public health interventions, but remain largely unknown for avian influenza H5N1 virus infections. A recent study on the 139 outbreaks detected in Indonesia between 2005 and 2009 found that the type of exposure to sources of H5N1 virus for both the index case and their household members impacted the risk of additional cases in the household. This study describes the disease transmission patterns in those outbreak households. METHODOLOGY/PRINCIPAL FINDINGS: We compared cases (n = 177 and contacts (n = 496 in the 113 sporadic and 26 cluster outbreaks detected between July 2005 and July 2009 to estimate attack rates and disease intervals. We used final size household models to fit transmission parameters to data on household size, cases and blood-related household contacts to assess the relative contribution of zoonotic and human-to-human transmission of the virus, as well as the reproduction number for human virus transmission. The overall household attack rate was 18.3% and secondary attack rate was 5.5%. Secondary attack rate remained stable as household size increased. The mean interval between onset of subsequent cases in outbreaks was 5.6 days. The transmission model found that human transmission was very rare, with a reproduction number between 0.1 and 0.25, and the upper confidence bounds below 0.4. Transmission model fit was best when the denominator population was restricted to blood-related household contacts of index cases. CONCLUSIONS/SIGNIFICANCE: The study only found strong support for human transmission of the virus when a single large cluster was included in the transmission model. The reproduction number was well below the threshold for sustained transmission. This study provides baseline information on the transmission dynamics for the current zoonotic virus and can be used to detect and define signatures of a virus with increasing capacity for human
The neutron transmission of single crystal MgO filters
International Nuclear Information System (INIS)
Carpenter, J.M.; Hilleke, R.O.
1989-01-01
We have measured and analyzed the wavelength dependence of the transmission probability of a beam of neutrons passing through a single crystal MgO filter at 77 K. The 12.7 cm filter transmits 70% or more of the incident beam at wavelengths greater than about 1.8 A. At shorter wavelengths the transmission probability drops sharply, with 50% transmission occurring at about 1.2 A, and 1% transmission for the range 0.1-0.4 A. We have determined that cooling the filter to 77 K improves the transmission of >1 A neutrons, while further cooling to 25 K shows little additional improvement, and no improvement for short wavelengths. We have identified the wavelengths of the sharp dips in the transmission found in this region caused by Bragg scattering in MgO. We also show how these peaks may be used to calibrate the wavelength scale of time-of-flight measurements taken on instruments using similar filters. (orig.)
Probability and Bayesian statistics
1987-01-01
This book contains selected and refereed contributions to the "Inter national Symposium on Probability and Bayesian Statistics" which was orga nized to celebrate the 80th birthday of Professor Bruno de Finetti at his birthplace Innsbruck in Austria. Since Professor de Finetti died in 1985 the symposium was dedicated to the memory of Bruno de Finetti and took place at Igls near Innsbruck from 23 to 26 September 1986. Some of the pa pers are published especially by the relationship to Bruno de Finetti's scientific work. The evolution of stochastics shows growing importance of probability as coherent assessment of numerical values as degrees of believe in certain events. This is the basis for Bayesian inference in the sense of modern statistics. The contributions in this volume cover a broad spectrum ranging from foundations of probability across psychological aspects of formulating sub jective probability statements, abstract measure theoretical considerations, contributions to theoretical statistics an...
The role of adaptations in two-strain competition for sylvatic Trypanosoma cruzi transmission.
Kribs-Zaleta, Christopher M; Mubayi, Anuj
2012-01-01
This study presents a continuous-time model for the sylvatic transmission dynamics of two strains of Trypanosoma cruzi enzootic in North America, in order to study the role that adaptations of each strain to distinct modes of transmission (classical stercorarian transmission on the one hand, and vertical and oral transmission on the other) may play in the competition between the two strains. A deterministic model incorporating contact process saturation predicts competitive exclusion, and reproductive numbers for the infection provide a framework for evaluating the competition in terms of adaptive trade-off between distinct transmission modes. Results highlight the importance of oral transmission in mediating the competition between horizontal (stercorarian) and vertical transmission; its presence as a competing contact process advantages vertical transmission even without adaptation to oral transmission, but such adaptation appears necessary to explain the persistence of (vertically-adapted) T. cruzi IV in raccoons and woodrats in the southeastern United States.
The contribution of social behaviour to the transmission of influenza A in a human population.
Kucharski, Adam J; Kwok, Kin O; Wei, Vivian W I; Cowling, Benjamin J; Read, Jonathan M; Lessler, Justin; Cummings, Derek A; Riley, Steven
2014-06-01
Variability in the risk of transmission for respiratory pathogens can result from several factors, including the intrinsic properties of the pathogen, the immune state of the host and the host's behaviour. It has been proposed that self-reported social mixing patterns can explain the behavioural component of this variability, with simulated intervention studies based on these data used routinely to inform public health policy. However, in the absence of robust studies with biological endpoints for individuals, it is unclear how age and social behaviour contribute to infection risk. To examine how the structure and nature of social contacts influenced infection risk over the course of a single epidemic, we designed a flexible disease modelling framework: the population was divided into a series of increasingly detailed age and social contact classes, with the transmissibility of each age-contact class determined by the average contacts of that class. Fitting the models to serologically confirmed infection data from the 2009 Hong Kong influenza A/H1N1p pandemic, we found that an individual's risk of infection was influenced strongly by the average reported social mixing behaviour of their age group, rather than by their personal reported contacts. We also identified the resolution of social mixing that shaped transmission: epidemic dynamics were driven by intense contacts between children, a post-childhood drop in risky contacts and a subsequent rise in contacts for individuals aged 35-50. Our results demonstrate that self-reported social contact surveys can account for age-associated heterogeneity in the transmission of a respiratory pathogen in humans, and show robustly how these individual-level behaviours manifest themselves through assortative age groups. Our results suggest it is possible to profile the social structure of different populations and to use these aggregated data to predict their inherent transmission potential.
National Research Council Canada - National Science Library
Litvin, F
1999-01-01
An integrated tooth contact analysis (TCA) computer program for the simulation of meshing and contact of gear drives that calculates transmission errors and shift of hearing contact for misaligned gear drives has been developed...
VanderWaal, Kimberly L; Atwill, Edward R; Isbell, Lynne A; McCowan, Brenda
2014-03-01
Although network analysis has drawn considerable attention as a promising tool for disease ecology, empirical research has been hindered by limitations in detecting the occurrence of pathogen transmission (who transmitted to whom) within social networks. Using a novel approach, we utilize the genetics of a diverse microbe, Escherichia coli, to infer where direct or indirect transmission has occurred and use these data to construct transmission networks for a wild giraffe population (Giraffe camelopardalis). Individuals were considered to be a part of the same transmission chain and were interlinked in the transmission network if they shared genetic subtypes of E. coli. By using microbial genetics to quantify who transmits to whom independently from the behavioural data on who is in contact with whom, we were able to directly investigate how the structure of contact networks influences the structure of the transmission network. To distinguish between the effects of social and environmental contact on transmission dynamics, the transmission network was compared with two separate contact networks defined from the behavioural data: a social network based on association patterns, and a spatial network based on patterns of home-range overlap among individuals. We found that links in the transmission network were more likely to occur between individuals that were strongly linked in the social network. Furthermore, individuals that had more numerous connections or that occupied 'bottleneck' positions in the social network tended to occupy similar positions in the transmission network. No similar correlations were observed between the spatial and transmission networks. This indicates that an individual's social network position is predictive of transmission network position, which has implications for identifying individuals that function as super-spreaders or transmission bottlenecks in the population. These results emphasize the importance of association patterns in
International Nuclear Information System (INIS)
Dundulis, Gintautas; Žutautaitė, Inga; Janulionis, Remigijus; Ušpuras, Eugenijus; Rimkevičius, Sigitas; Eid, Mohamed
2016-01-01
In this paper, the authors present an approach as an overall framework for the estimation of the failure probability of pipelines based on: the results of the deterministic-probabilistic structural integrity analysis (taking into account loads, material properties, geometry, boundary conditions, crack size, and defected zone thickness), the corrosion rate, the number of defects and failure data (involved into the model via application of Bayesian method). The proposed approach is applied to estimate the failure probability of a selected part of the Lithuanian natural gas transmission network. The presented approach for the estimation of integrated failure probability is a combination of several different analyses allowing us to obtain: the critical crack's length and depth, the failure probability of the defected zone thickness, dependency of the failure probability on the age of the natural gas transmission pipeline. A model's uncertainty analysis and uncertainty propagation analysis are performed, as well. - Highlights: • Degradation mechanisms of natural gas transmission pipelines. • Fracture mechanic analysis of the pipe with crack. • Stress evaluation of the pipe with critical crack. • Deterministic-probabilistic structural integrity analysis of gas pipeline. • Integrated estimation of pipeline failure probability by Bayesian method.
Kaltenbrunner, Martin; Adam, Getachew; Głowacki, Eric Daniel; Drack, Michael; Schwödiauer, Reinhard; Leonat, Lucia; Apaydin, Dogukan Hazar; Groiss, Heiko; Scharber, Markus Clark; White, Matthew Schuette; Sariciftci, Niyazi Serdar; Bauer, Siegfried
2015-10-01
Photovoltaic technology requires light-absorbing materials that are highly efficient, lightweight, low cost and stable during operation. Organolead halide perovskites constitute a highly promising class of materials, but suffer limited stability under ambient conditions without heavy and costly encapsulation. Here, we report ultrathin (3 μm), highly flexible perovskite solar cells with stabilized 12% efficiency and a power-per-weight as high as 23 W g-1. To facilitate air-stable operation, we introduce a chromium oxide-chromium interlayer that effectively protects the metal top contacts from reactions with the perovskite. The use of a transparent polymer electrode treated with dimethylsulphoxide as the bottom layer allows the deposition--from solution at low temperature--of pinhole-free perovskite films at high yield on arbitrary substrates, including thin plastic foils. These ultra-lightweight solar cells are successfully used to power aviation models. Potential future applications include unmanned aerial vehicles--from airplanes to quadcopters and weather balloons--for environmental and industrial monitoring, rescue and emergency response, and tactical security applications.
Macedo, Alexandre Casimiro de; Cunha, José Evandro; Yaochite, Juliana Navarro Ueda; Tavares, Clodis Maria; Nagao-Dias, Aparecida Tiemi
Considering that the main route of Mycobacterium leprae transmission is the upper respiratory tract, detection of salivary antibodies can be a useful tool for diagnosing early infection. The study aimed to analyze salivary anti-PGL-1 IgA and IgM antibodies in 169 children aged 4-16 years old, who lived nearby or inside the house of multibacillary or paucibacillary leprosy patients in two endemic cities in Alagoas State - Brazil. Salivary anti-PGL-1 antibodies were quantified by modified ELISA method. The frequency of contact and clinical form of the index case were significantly associated with salivary antibody levels. High frequency of IgM positivity strongly suggests active transmission of M. leprae in these communities. We suggest in the present work that salivary anti-PGL IgA and IgM are important biomarkers to be used for identifying communities with probable active transmission of M. leprae. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
The Josephson effect in atomic contacts; Effect Josephson dans les contacts atomiques
Energy Technology Data Exchange (ETDEWEB)
Chauvin, M
2005-11-15
The Josephson effect appears when a weak-link establishes phase coherence between two superconductors. A unifying theory of this effect emerged in the 90's within the framework of mesoscopic physics. Based on two cornerstone concepts, conduction channels and Andreev reflection, it predicts the current-phase relation for the most basic weak-link: a single conduction channel of arbitrary transmission. This thesis illustrates this mesoscopic point of view with experiments on superconducting atomic size contacts. In particular, we have focused on the supercurrent peak around zero voltage, put into evidence the ac Josephson currents in a contact under constant bias voltage (Shapiro resonances and photon assisted multiple Andreev reflections), and performed direct measurements of the current-phase relation. (author)
The dynamics of transmission and the dynamics of networks.
Farine, Damien
2017-05-01
A toy example depicted here highlighting the results of a study in this issue of the Journal of Animal Ecology that investigates the impact of network dynamics on potential disease outbreaks. Infections (stars) that spread by contact only (left) reduce the predicted outbreak size compared to situations where individuals can become infected by moving through areas that previously contained infected individuals (right). This is potentially important in species where individuals, or in this case groups, have overlapping ranges (as depicted on the top right). Incorporating network dynamics that maintain information about the ordering of contacts (central blocks; including the ordering of spatial overlap as noted by the arrows that highlight the blue group arriving after the red group in top-right of the figure) is important for capturing how a disease might not have the opportunity to spread to all individuals. By contrast, a static or 'average' network (lower blocks) does not capture any of these dynamics. Interestingly, although static networks generally predict larger outbreak sizes, the authors find that in cases when transmission probability is low, this prediction can switch as a result of changes in the estimated intensity of contacts among individuals. [Colour figure can be viewed at wileyonlinelibrary.com]. Springer, A., Kappeler, P.M. & Nunn, C.L. (2017) Dynamic vs. static social networks in models of parasite transmission: Predicting Cryptosporidium spread in wild lemurs. Journal of Animal Ecology, 86, 419-433. The spread of disease or information through networks can be affected by several factors. Whether and how these factors are accounted for can fundamentally change the predicted impact of a spreading epidemic. Springer, Kappeler & Nunn () investigate the role of different modes of transmission and network dynamics on the predicted size of a disease outbreak across several groups of Verreaux's sifakas, a group-living species of lemur. While some factors
International Nuclear Information System (INIS)
Otsuka, Naoto
2013-01-01
Highlights: • A theoretical foundation is presented for more efficient Integrated Safeguards (IS). • Probability of undetected nuclear proliferation activities should be maintained low. • For nations under IS, the probability to start proliferation activities is very low. • The fact can decrease the detection probability of IS by dozens of percentage points. • The cost of IS per nation can be cut down by reducing inspection frequencies etc. - Abstract: A theoretical foundation is presented for implementing more efficiently the present International Atomic Energy Agency (IAEA) integrated safeguards (ISs) on the basis of fuzzy evaluation of the probability that the evaluated nation will continue peaceful activities. It is shown that by determining the presence probability of undetected nuclear proliferating activities, nations under IS can be maintained at acceptably low proliferation risk levels even if the detection probability of current IS is decreased by dozens of percentage from the present value. This makes it possible to reduce inspection frequency and the number of collected samples, allowing the IAEA to cut costs per nation. This will contribute to further promotion and application of IS to more nations by the IAEA, and more efficient utilization of IAEA resources from the viewpoint of whole IS framework
Coates, Peter S.; Howe, Kristy B.; Casazza, Michael L.; Delehanty, David J.
2014-01-01
Energy-related infrastructure and other human enterprises within sagebrush steppe of the American West often results in changes that promote common raven (Corvus corax; hereafter, raven) populations. Ravens, a generalist predator capable of behavioral innovation, present a threat to many species of conservation concern. We evaluate the effects of detailed features of an altered landscape on the probability of raven occurrence using extensive raven survey (n= 1045) and mapping data from southern Idaho, USA. We found nonlinear relationships between raven occurrence and distances to transmission lines, roads, and facilities. Most importantly, raven occurrence was greater with presence of transmission lines up to 2.2 km from the corridor.We further explain variation in raven occurrence along anthropogenic features based on the amount of non-native vegetation and cover type edge, such that ravens select fragmented sagebrush stands with patchy, exotic vegetative introgression. Raven occurrence also increased with greater length of edge formed by the contact of big sagebrush (Artemisia tridentate spp.) with non-native vegetation cover types. In consideration of increasing alteration of sagebrush steppe, these findings will be useful for planning energy transmission corridor placement and other management activities where conservation of sagebrush obligate species is a priority.
Magneto-optical transmission-reflection beam splitter for multi-level atoms
International Nuclear Information System (INIS)
Murphy, J.E.; Goodman, P.; Sidorov, A.I.
1994-01-01
An atomic de Broglie wave beam splitter is proposed. The interaction of multi-level atoms (J g = 1 - J e = 0) with a laser beam in the presence of a static magnetic field leads to the partial transmission and reflection of the atomic beam. The coherent splitting of the atomic beam occurs due to non-adiabatic transitions between different dressed states in the vicinity of avoided crossings. The transition probabilities and populations of split beams are dependent on the value of the magnetic field, laser detuning, and the ratio between different polarization components in the laser beam. For optimal conditions the population of each of the two transmitted and two reflected beams is 25 per cent. For cooled atoms it is possible to obtain splitting angles of 80 mrad. The effect of spontaneous emission during the atom-light interaction was estimated and for a reasonable detuning losses were reduced to less than 10 per cent. 14 refs., 1 tab., 6 figs
Are You at Risk for Contact Dermatitis? | Poster
You probably don’t give much thought to hand health. Until something goes wrong, almost everyone takes for granted that these crucial appendages will continue working as they always have. But hand health is an important consideration, especially at work. According to the Centers for Disease Control and Prevention (CDC), allergic contact dermatitis and irritant contact
Directory of Open Access Journals (Sweden)
Nathan Paula M
2010-06-01
Full Text Available Abstract Background Mathematical models of infection that consider targeted interventions are exquisitely dependent on the assumed mixing patterns of the population. We report on a pilot study designed to assess three different methods (one retrospective, two prospective for obtaining contact data relevant to the determination of these mixing patterns. Methods 65 adults were asked to record their social encounters in each location visited during 6 study days using a novel method whereby a change in physical location of the study participant triggered data entry. Using a cross-over design, all participants recorded encounters on 3 days in a paper diary and 3 days using an electronic recording device (PDA. Participants were randomised to first prospective recording method. Results Both methods captured more contacts than a pre-study questionnaire, but ascertainment using the paper diary was superior to the PDA (mean difference: 4.52 (95% CI 0.28, 8.77. Paper diaries were found more acceptable to the participants compared with the PDA. Statistical analysis confirms that our results are broadly consistent with those reported from large-scale European based surveys. An association between household size (trend 0.14, 95% CI (0.06, 0.22, P P Conclusions The study's location-based reporting design allows greater scope compared to other methods for examining differences in the characteristics of encounters over a range of environments. Improved parameterisation of dynamic transmission models gained from work of this type will aid in the development of more robust decision support tools to assist health policy makers and planners.
Topology of modified helical gears and Tooth Contact Analysis (TCA) program
Litvin, Faydor L.; Zhang, Jiao
1989-01-01
The contents of this report covers: (1) development of optimal geometries for crowned helical gears; (2) a method for their generation; (3) tooth contact analysis (TCA) computer programs for the analysis of meshing and bearing contact of the crowned helical gears; and (4) modelling and simulation of gear shaft deflection. The developed method for synthesis was used to determine the optimal geometry for a crowned helical pinion surface and was directed to localize the bearing contact and guarantee favorable shape and a low level of transmission errors. Two new methods for generation of the crowned helical pinion surface are proposed. One is based on the application of a tool with a surface of revolution that slightly deviates from a regular cone surface. The tool can be used as a grinding wheel or as a shaver. The other is based on a crowning pinion tooth surface with predesigned transmission errors. The pinion tooth surface can be generated by a computer-controlled automatic grinding machine. The TCA program simulates the meshing and bearing contact of the misaligned gears. The transmission errors are also determined. The gear shaft deformation was modelled and investigated. It was found that the deflection of gear shafts has the same effect as gear misalignment.
The collision probability modules of WIMS-E
International Nuclear Information System (INIS)
Roth, M.J.
1985-04-01
This report describes how flat source first flight collision probabilities are calculated and used in the WIMS-E modular program. It includes a description of the input to the modules W-FLU, W-THES, W-PIP, W-PERS and W-MERGE. Input to other collision probability modules are described in separate reports. WIMS-E is capable of calculating collision probabilities in a wide variety of geometries, some of them quite complicated. It can also use them for a variety of purposes. (author)
The Influence of the Mounting Errors in RodToothed Transmissions
Directory of Open Access Journals (Sweden)
M. Yu. Sachkov
2015-01-01
Full Text Available In the paper we consider an approximate transmission. The work is aimed at development of gear-powered transmission on parallel axes, which is RF patent-protected. The paper justifies a relevance of the synthesis of new kinds of engagement with the simplified geometry of the contacting condition. A typical solution for powered mechanisms received by F. L. Livinin and his disciples is characterized.The paper describes the arrangement of the coordinate systems used to obtain the function of the position of the gear-powered transmission consisting of two wheels with fifteen leads. For them, also the coordinates of the contact points are obtained, and errors of function of the position in tooth changeover are calculated. To obtain the function position was used a method of matrix transformation and equality of radius and unit normal vectors at the contact point. This transmission can be used in mechanical and instrumentation engineering, and other sectors of the economy. Both reducers and multipliers can be made on its basis. It has high manufacturability (with no special equipment required for its production, and a displacement function is close to linear.This article describes the influence of the axle spacing error on the quality of the transmission characteristics. The paper presents the graphic based relationships and tabular estimates for nominal axle spacing and offsets within 0.2 mm. This error of axle spacing is significant for gearing. From the results of this work we can say that the transmission is almost insensitive to errors of axle spacing. Engagement occurs without an exit of contact point on the lead edge. To solve the obtained system of equations, the numerical methods of the software MathCAD package have been applied.In the future, the authors expect to consider other possible manufacturing and mounting errors of gear-powered transmission (such as the error of the step, misalignment, etc. to assess their impact on the quality
Contact networks structured by sex underpin sex-specific epidemiology of infection.
Silk, Matthew J; Weber, Nicola L; Steward, Lucy C; Hodgson, David J; Boots, Mike; Croft, Darren P; Delahay, Richard J; McDonald, Robbie A
2018-02-01
Contact networks are fundamental to the transmission of infection and host sex often affects the acquisition and progression of infection. However, the epidemiological impacts of sex-related variation in animal contact networks have rarely been investigated. We test the hypothesis that sex-biases in infection are related to variation in multilayer contact networks structured by sex in a population of European badgers Meles meles naturally infected with Mycobacterium bovis. Our key results are that male-male and between-sex networks are structured at broader spatial scales than female-female networks and that in male-male and between-sex contact networks, but not female-female networks, there is a significant relationship between infection and contacts with individuals in other groups. These sex differences in social behaviour may underpin male-biased acquisition of infection and may result in males being responsible for more between-group transmission. This highlights the importance of sex-related variation in host behaviour when managing animal diseases. © 2017 The Authors. Ecology Letters published by CNRS and John Wiley & Sons Ltd.
Non-contact magnetic coupled power and data transferring system for an electric vehicle
International Nuclear Information System (INIS)
Matsuda, Y.; Sakamoto, H.
2007-01-01
We have developed a system which transmits electric power and communication data simultaneously in a non-contact method using a magnetic coupling coil. Already, we are developing the fundamental technology of a non-contact charging system, and this is applied in electric shavers, electric toothbrushes, etc. Moreover, basic experiments are being conducted for applying this non-contact charging system to electric equipments such as an electric vehicle (EV), which is a zero emission vehicle and environmentally excellent and will be the transportation means of the next generation. The technology can also be applied in other electronic equipment, etc. However, since the power supply route for these individual devices is independent, the supply system is complicated. EV also has to perform the transmission of electric power and the transmission of information (data), such as the amount of the charge, in a separate system, and thus is quite complicated. In this study, by performing simultaneously the transmission of electric power and information (data) using magnetic coupling technology in which it does not contact, the basic experiment aimed at attaining and making unification of a system simple was conducted, and the following good results were obtained: (1) Electric power required for load can be transmitted easily by non-contact. (2) A signal can easily be transmitted bidirectionally by non-contact. (3) This system is reliable, and is widely applicable
Transmission of Hepatitis E Virus in Developing Countries
Directory of Open Access Journals (Sweden)
Mohammad S. Khuroo
2016-09-01
Full Text Available Hepatitis E virus (HEV, an RNA virus of the Hepeviridae family, has marked heterogeneity. While all five HEV genotypes can cause human infections, genotypes HEV-1 and -2 infect humans alone, genotypes HEV-3 and -4 primarily infect pigs, boars and deer, and genotype HEV-7 primarily infects dromedaries. The global distribution of HEV has distinct epidemiological patterns based on ecology and socioeconomic factors. In resource-poor countries, disease presents as large-scale waterborne epidemics, and few epidemics have spread through person-to-person contact; however, endemic diseases within these countries can potentially spread through person-to-person contact or fecally contaminated water and foods. Vertical transmission of HEV from infected mother to fetus causes high fetal and perinatal mortality. Other means of transmission, such as zoonotic transmission, can fluctuate depending upon the region and strain of the virus. For instance, zoonotic transmission can sometimes play an insignificant role in human infections, such as in India, where human and pig HEV infections are unrelated. However, recently China and Southeast Asia have experienced a zoonotic spread of HEV-4 from pigs to humans and this has become the dominant mode of transmission of hepatitis E in eastern China. Zoonotic HEV infections in humans occur by eating undercooked pig flesh, raw liver, and sausages; through vocational contact; or via pig slurry, which leads to environmental contamination of agricultural products and seafood. Lastly, blood transfusion-associated HEV infections occur in many countries and screening of donors for HEV RNA is currently under serious consideration. To summarize, HEV genotypes 1 and 2 cause epidemic and endemic diseases in resource poor countries, primarily spreading through contaminated drinking water. HEV genotypes 3 and 4 on the other hand, cause autochthonous infections in developed, and many developing countries, by means of a unique zoonotic
Full Text Available ... sell contacts without a prescription are breaking the law, and may be fined $11,000 per violation. " ... Us About the Academy Jobs at the Academy Financial Relationships with Industry Medical Disclaimer Privacy Policy Terms ...
Full Text Available ... sell contacts without a prescription are breaking the law, and may be fined $11,000 per violation. " ... 13, 2017 Histoplasmosis Diagnosis Sep 01, 2017 How common is retinal detachment for people with high myopia? ...
Tracking social contact networks with online respondent-driven detection : who recruits whom?
Stein, Mart L.; van der Heijden, P.G.M.; Buskens, V.W.; van Steenbergen, Jim E.; Bengtsson, Linus; Koppeschaar, Carl E.; Thorson, Anna E.; Kretzschmar, Mirjam E. E.
2015-01-01
Background: Transmission of respiratory pathogens in a population depends on the contact network patterns of individuals. To accurately understand and explain epidemic behaviour information on contact networks is required, but only limited empirical data is available. Online respondent-driven
Tracking social contact networks with online respondent-driven detection : who recruits whom?
Stein, Mart L; van der Heijden, Peter G M; Buskens, Vincent; van Steenbergen, Jim E; Bengtsson, Linus; Koppeschaar, Carl E; Thorson, Anna; Kretzschmar, MEE
2015-01-01
BACKGROUND: Transmission of respiratory pathogens in a population depends on the contact network patterns of individuals. To accurately understand and explain epidemic behaviour information on contact networks is required, but only limited empirical data is available. Online respondent-driven
Inference of R 0 and Transmission Heterogeneity from the Size Distribution of Stuttering Chains
Blumberg, Seth; Lloyd-Smith, James O.
2013-01-01
For many infectious disease processes such as emerging zoonoses and vaccine-preventable diseases, and infections occur as self-limited stuttering transmission chains. A mechanistic understanding of transmission is essential for characterizing the risk of emerging diseases and monitoring spatio-temporal dynamics. Thus methods for inferring and the degree of heterogeneity in transmission from stuttering chain data have important applications in disease surveillance and management. Previous researchers have used chain size distributions to infer , but estimation of the degree of individual-level variation in infectiousness (as quantified by the dispersion parameter, ) has typically required contact tracing data. Utilizing branching process theory along with a negative binomial offspring distribution, we demonstrate how maximum likelihood estimation can be applied to chain size data to infer both and the dispersion parameter that characterizes heterogeneity. While the maximum likelihood value for is a simple function of the average chain size, the associated confidence intervals are dependent on the inferred degree of transmission heterogeneity. As demonstrated for monkeypox data from the Democratic Republic of Congo, this impacts when a statistically significant change in is detectable. In addition, by allowing for superspreading events, inference of shifts the threshold above which a transmission chain should be considered anomalously large for a given value of (thus reducing the probability of false alarms about pathogen adaptation). Our analysis of monkeypox also clarifies the various ways that imperfect observation can impact inference of transmission parameters, and highlights the need to quantitatively evaluate whether observation is likely to significantly bias results. PMID:23658504
Transmission of severe acute respiratory syndrome in dynamical small-world networks
Masuda, Naoki; Konno, Norio; Aihara, Kazuyuki
2004-03-01
The outbreak of severe acute respiratory syndrome (SARS) is still threatening the world because of a possible resurgence. In the current situation that effective medical treatments such as antiviral drugs are not discovered yet, dynamical features of the epidemics should be clarified for establishing strategies for tracing, quarantine, isolation, and regulating social behavior of the public at appropriate costs. Here we propose a network model for SARS epidemics and discuss why superspreaders emerged and why SARS spread especially in hospitals, which were key factors of the recent outbreak. We suggest that superspreaders are biologically contagious patients, and they may amplify the spreads by going to potentially contagious places such as hospitals. To avoid mass transmission in hospitals, it may be a good measure to treat suspected cases without hospitalizing them. Finally, we indicate that SARS probably propagates in small-world networks associated with human contacts and that the biological nature of individuals and social group properties are factors more important than the heterogeneous rates of social contacts among individuals. This is in marked contrast with epidemics of sexually transmitted diseases or computer viruses to which scale-free network models often apply.
Sexual transmission of Lyme disease: challenging the tickborne disease paradigm.
Stricker, Raphael B; Middelveen, Marianne J
2015-01-01
Lyme disease caused by the spirochete Borrelia burgdorferi has become a major worldwide epidemic. In this article, we explore the clinical, epidemiological and experimental evidence for sexual transmission of Lyme disease in animal models and humans. Although the likelihood of sexual transmission of the Lyme spirochete remains speculative, the possibility of Lyme disease transmission via intimate human contact merits further study.
Network flow model of force transmission in unbonded and bonded granular media.
Tordesillas, Antoinette; Tobin, Steven T; Cil, Mehmet; Alshibli, Khalid; Behringer, Robert P
2015-06-01
An established aspect of force transmission in quasistatic deformation of granular media is the existence of a dual network of strongly versus weakly loaded particles. Despite significant interest, the regulation of strong and weak forces through the contact network remains poorly understood. We examine this aspect of force transmission using data on microstructural fabric from: (I) three-dimensional discrete element models of grain agglomerates of bonded subspheres constructed from in situ synchrotron microtomography images of silica sand grains under unconfined compression and (II) two-dimensional assemblies of unbonded photoelastic circular disks submitted to biaxial compression under constant volume. We model force transmission as a network flow and solve the maximum flow-minimum cost (MFMC) problem, the solution to which yields a percolating subnetwork of contacts that transmits the "maximum flow" (i.e., the highest units of force) at "least cost" (i.e., the dissipated energy from such transmission). We find the MFMC describes a two-tier hierarchical architecture. At the local level, it encapsulates intraconnections between particles in individual force chains and in their conjoined 3-cycles, with the most common configuration having at least one force chain contact experiencing frustrated rotation. At the global level, the MFMC encapsulates interconnections between force chains. The MFMC can be used to predict most of the force chain particles without need for any information on contact forces, thereby suggesting the network flow framework may have potential broad utility in the modeling of force transmission in unbonded and bonded granular media.
Possible non-sexual modes of transmission of human papilloma virus.
Sabeena, Sasidharanpillai; Bhat, Parvati; Kamath, Veena; Arunkumar, Govindakarnavar
2017-03-01
There is strong evidence to suggest vertical and horizontal modes of transmission of human papilloma virus (HPV), an established etiologic agent of cervical cancer. Infants, children, and adults can acquire both high-risk and low-risk infections by birth or by close contact even though HPV is mainly transmitted sexually. A thorough review of the literature was performed to assess the possible non-sexual modes of transmission of HPV. An electronic search of databases for review articles, cross-sectional studies, cohort studies, and case reports on non-sexual modes of transmission among sexually unexposed women and children was carried out using search terms such as "human papilloma virus, HPV, transmission, horizontal transmission, vertical transmission, and fomites". Articles published between 1983 and 2015 were retrieved. Epidemiological and clinical data support various non-sexual modes of transmission especially at the time of birth and by close contact. Even though the role of fomites in the transmission of HPV is not well established, HPV-DNA positivity has been reported in transvaginal ultrasound probes and colposcopes after routine disinfection. Awareness needs to be spread among the public about alternate modes of transmission. For a proper understanding of the exact natural history of HPV infection acquired via the non-sexual route, long-term prospective studies need to be undertaken. © 2017 Japan Society of Obstetrics and Gynecology.
Exposure Patterns Driving Ebola Transmission in West Africa: A Retrospective Observational Study.
Agua-Agum, Junerlyn; Ariyarajah, Archchun; Aylward, Bruce; Bawo, Luke; Bilivogui, Pepe; Blake, Isobel M; Brennan, Richard J; Cawthorne, Amy; Cleary, Eilish; Clement, Peter; Conteh, Roland; Cori, Anne; Dafae, Foday; Dahl, Benjamin; Dangou, Jean-Marie; Diallo, Boubacar; Donnelly, Christl A; Dorigatti, Ilaria; Dye, Christopher; Eckmanns, Tim; Fallah, Mosoka; Ferguson, Neil M; Fiebig, Lena; Fraser, Christophe; Garske, Tini; Gonzalez, Lice; Hamblion, Esther; Hamid, Nuha; Hersey, Sara; Hinsley, Wes; Jambei, Amara; Jombart, Thibaut; Kargbo, David; Keita, Sakoba; Kinzer, Michael; George, Fred Kuti; Godefroy, Beatrice; Gutierrez, Giovanna; Kannangarage, Niluka; Mills, Harriet L; Moller, Thomas; Meijers, Sascha; Mohamed, Yasmine; Morgan, Oliver; Nedjati-Gilani, Gemma; Newton, Emily; Nouvellet, Pierre; Nyenswah, Tolbert; Perea, William; Perkins, Devin; Riley, Steven; Rodier, Guenael; Rondy, Marc; Sagrado, Maria; Savulescu, Camelia; Schafer, Ilana J; Schumacher, Dirk; Seyler, Thomas; Shah, Anita; Van Kerkhove, Maria D; Wesseh, C Samford; Yoti, Zabulon
2016-11-01
The ongoing West African Ebola epidemic began in December 2013 in Guinea, probably from a single zoonotic introduction. As a result of ineffective initial control efforts, an Ebola outbreak of unprecedented scale emerged. As of 4 May 2015, it had resulted in more than 19,000 probable and confirmed Ebola cases, mainly in Guinea (3,529), Liberia (5,343), and Sierra Leone (10,746). Here, we present analyses of data collected during the outbreak identifying drivers of transmission and highlighting areas where control could be improved. Over 19,000 confirmed and probable Ebola cases were reported in West Africa by 4 May 2015. Individuals with confirmed or probable Ebola ("cases") were asked if they had exposure to other potential Ebola cases ("potential source contacts") in a funeral or non-funeral context prior to becoming ill. We performed retrospective analyses of a case line-list, collated from national databases of case investigation forms that have been reported to WHO. These analyses were initially performed to assist WHO's response during the epidemic, and have been updated for publication. We analysed data from 3,529 cases in Guinea, 5,343 in Liberia, and 10,746 in Sierra Leone; exposures were reported by 33% of cases. The proportion of cases reporting a funeral exposure decreased over time. We found a positive correlation (r = 0.35, p Ebola treatment units were better than other health care facilities at preventing exposure from hospitalised and deceased individuals. The principal limitation of our analysis is limited data quality, with cases not being entered into the database, cases not reporting exposures, or data being entered incorrectly (especially dates, and possible misclassifications). Achieving elimination of Ebola is challenging, partly because of super-spreading. Safe funeral practices and fast hospitalisation contributed to the containment of this Ebola epidemic. Continued real-time data capture, reporting, and analysis are vital to track
Contact resistance and stability study for Au, Ti, Hf and Ni contacts on thin-film Mg2Si
Zhang, Bo
2016-12-28
We present a detailed study of post-deposition annealing effects on contact resistance of Au, Ti, Hf and Ni electrodes on Mg2Si thin films. Thin-film Mg2Si and metal contacts were deposited using magnetron sputtering. Various post-annealing temperatures were studied to determine the thermal stability of each contact metal. The specific contact resistivity (SCR) was determined using the Cross Bridge Kelvin Resistor (CBKR) method. Ni contacts exhibits the best thermal stability, maintaining stability up to 400 °C, with a SCR of approximately 10−2 Ω-cm2 after annealing. The increased SCR after high temperature annealing is correlated with the formation of a Mg-Si-Ni mixture identified by cross-sectional scanning transmission electron microscopy (STEM) characterization, X-ray diffraction characterization (XRD) and other elemental analyses. The formation of this Mg-Si-Ni mixture is attributed to Ni diffusion and its reaction with the Mg2Si film.
The Effect of High Frequency Pulse on the Discharge Probability in Micro EDM
Liu, Y.; Qu, Y.; Zhang, W.; Ma, F.; Sha, Z.; Wang, Y.; Rolfe, B.; Zhang, S.
2017-12-01
High frequency pulse improves the machining efficiency of micro electric discharge machining (micro EDM), while it also brings some changes in micro EDM process. This paper focuses on the influence of skin-effect under the high frequency pulse on energy distribution and transmission in micro EDM, based on which, the rules of discharge probability of electrode end face are also analysed. On the basis of the electrical discharge process under the condition of high frequency pulse in micro EDM, COMSOL Multiphysics software is used to establish energy transmission model in micro electrode. The discharge energy distribution and transmission within tool electrode under different pulse frequencies, electrical currents, and permeability situation are studied in order to get the distribution pattern of current density and electric field intensity in the electrode end face under the influence of electrical parameters change. The electric field intensity distribution is regarded as the influencing parameter of discharge probability on the electrode end. Finally, MATLAB is used to fit the curve and obtain the distribution of discharge probability of electrode end face.
Contact variables for exposure to avian influenza H5N1 virus at the human-animal interface.
Rabinowitz, P; Perdue, M; Mumford, E
2010-06-01
Although the highly pathogenic avian influenza H5N1 virus continues to cause infections in both avian and human populations, the specific zoonotic risk factors remain poorly understood. This review summarizes available evidence regarding types of contact associated with transmission of H5N1 virus at the human-animal interface. A systematic search of the published literature revealed five analytical studies and 15 case reports describing avian influenza transmission from animals to humans for further review. Risk factors identified in analytical studies were compared, and World Health Organization-confirmed cases, identified in case reports, were classified according to type of contact reported using a standardized algorithm. Although cases were primarily associated with direct contact with sick/unexpectedly dead birds, some cases reported only indirect contact with birds or contaminated environments or contact with apparently healthy birds. Specific types of contacts or activities leading to exposure could not be determined from data available in the publications reviewed. These results support previous reports that direct contact with sick birds is not the only means of human exposure to avian influenza H5N1 virus. To target public health measures and disease awareness messaging for reducing the risk of zoonotic infection with avian influenza H5N1 virus, the specific types of contacts and activities leading to transmission need to be further understood. The role of environmental virus persistence, shedding of virus by asymptomatic poultry and disease pathophysiology in different avian species relative to human zoonotic risk, as well as specific modes of zoonotic transmission, should be determined.
Probable transmission of coxsackie B3 virus from human to chimpanzee, Denmark
DEFF Research Database (Denmark)
Nielsen, Sandra Cathrine Abel; Mourier, Tobias; Baandrup, Ulrik
2012-01-01
In 2010, a chimpanzee died at Copenhagen Zoo following an outbreak of respiratory disease among chimpanzees in the zoo. Identification of coxsackie B3 virus, a common human pathogen, as the causative agent, and its severe manifestation, raise questions about pathogenicity and transmissibility among...
Directory of Open Access Journals (Sweden)
de Jong Mart CM
2009-02-01
Full Text Available Abstract Background Worldwide, hepatitis E virus (HEV genotype 3 is observed in pigs and transmission to humans is implied. To be able to estimate public health risks from e.g. contact with pigs or consumption of pork products, the transmission routes and dynamics of infection should be identified. Hence, the course of HEV-infection in naturally infected pigs should be studied. Results To resemble natural transmission, 24 HEV-susceptible pigs were infected either by one-to-one exposure to intravenously inoculated pigs (C1-pigs; n = 10, by one-to-one exposure to contact-infected pigs (C2-pigs: n = 7; C3-pigs: n = 5 or due to an unknown non-intravenous infection route (one C2-pig and one C3-pig. The course of HEV-infection for contact-infected pigs was characterized by: faecal HEV RNA excretion that started at day 7 (95% confidence interval: 5–10 postexposure and lasted 23 (19–28 days; viremia that started after 13 (8–17 days of faecal HEV RNA excretion and lasted 11 (8–13 days; antibody development that was detected after 13 (10–16 days of faecal HEV RNA excretion. The time until onset of faecal HEV RNA excretion and onset of viremia was significantly shorter for iv-pigs compared to contact-infected pigs, whereas the duration of faecal HEV RNA excretion was significantly longer. At 28 days postinfection HEV RNA was detected less frequently in organs of contact-infected pigs compared to iv-pigs. For contact-infected pigs, HEV RNA was detected in 20 of 39 muscle samples that were proxies for pork at retail and in 4 of 7 urine samples. Conclusion The course of infection differed between infection routes, suggesting that contact-infection could be a better model for natural transmission than iv inoculation. Urine and meat were identified as possible HEV-sources for pig-to-pig and pig-to-human HEV transmission.
Transmission of infectious diseases en route to habitat hotspots.
Benavides, Julio; Walsh, Peter D; Meyers, Lauren Ancel; Raymond, Michel; Caillaud, Damien
2012-01-01
The spread of infectious diseases in wildlife populations is influenced by patterns of between-host contacts. Habitat "hotspots"--places attracting a large numbers of individuals or social groups--can significantly alter contact patterns and, hence, disease propagation. Research on the importance of habitat hotspots in wildlife epidemiology has primarily focused on how inter-individual contacts occurring at the hotspot itself increase disease transmission. However, in territorial animals, epidemiologically important contacts may primarily occur as animals cross through territories of conspecifics en route to habitat hotspots. So far, the phenomenon has received little attention. Here, we investigate the importance of these contacts in the case where infectious individuals keep visiting the hotspots and in the case where these individuals are not able to travel to the hotspot any more. We developed a simulation epidemiological model to investigate both cases in a scenario when transmission at the hotspot does not occur. We find that (i) hotspots still exacerbate epidemics, (ii) when infectious individuals do not travel to the hotspot, the most vulnerable individuals are those residing at intermediate distances from the hotspot rather than nearby, and (iii) the epidemiological vulnerability of a population is the highest when the number of hotspots is intermediate. By altering animal movements in their vicinity, habitat hotspots can thus strongly increase the spread of infectious diseases, even when disease transmission does not occur at the hotspot itself. Interestingly, when animals only visit the nearest hotspot, creating additional artificial hotspots, rather than reducing their number, may be an efficient disease control measure.
Contact-dependent cytopathogenic mechanisms of Trichomonas vaginalis
Energy Technology Data Exchange (ETDEWEB)
Krieger, J.N.; Ravdin, J.I.; Rein, M.F.
1985-12-01
The cytopathogenic mechanisms of Trichomonas vaginalis have been debated since the 1940s. We examined the following three proposed pathogenic mechanisms: contact-dependent extracellular killing, cytophagocytosis, and extracellular cytotoxins. Serial observations of Chinese hamster ovary (CHO) cell monolayers exposed to trichomonads revealed that (i) trichomonads form clumps, (ii) the clumps adhere to cells in culture, and (iii) monolayer destruction occurs only in areas of contact with T. vaginalis. Kinetic analysis of target cell killing by trichomonads revealed that the probability of CHO cell death was related to the probability of contact with T. vaginalis, supporting the observation by microscopy that trichomonads kill cells only by direct contact. Simultaneous studies of /sup 111/indium oxine label release from CHO cells and trypan blue dye exclusion demonstrated that T. vaginalis kills target cells without phagocytosis. Filtrates of trichomonad cultures or from media in which trichomonads were killing CHO cells had no effect on CHO cell monolayers, indicating that trichomonads do not kill cells by a cell-free or secreted cytotoxin. The microfilament inhibitor cytochalasin D (10 micrograms/ml) inhibited trichomonad killing of CHO cell monolayers by 80% (P less than 0.0001). In contrast, the microtubule inhibitor vinblastine (10(-6) M) caused only 17% inhibition of trichomonad destruction of CHO cell monolayers (P less than 0.020), whereas colchicine (10(-6) M) had no effect. T. vaginalis kills target cells by direct contact without phagocytosis. This event requires intact trichomonad microfilament function; microtubule function appears not to be essential.
Contact-dependent cytopathogenic mechanisms of Trichomonas vaginalis
International Nuclear Information System (INIS)
Krieger, J.N.; Ravdin, J.I.; Rein, M.F.
1985-01-01
The cytopathogenic mechanisms of Trichomonas vaginalis have been debated since the 1940s. We examined the following three proposed pathogenic mechanisms: contact-dependent extracellular killing, cytophagocytosis, and extracellular cytotoxins. Serial observations of Chinese hamster ovary (CHO) cell monolayers exposed to trichomonads revealed that (i) trichomonads form clumps, (ii) the clumps adhere to cells in culture, and (iii) monolayer destruction occurs only in areas of contact with T. vaginalis. Kinetic analysis of target cell killing by trichomonads revealed that the probability of CHO cell death was related to the probability of contact with T. vaginalis, supporting the observation by microscopy that trichomonads kill cells only by direct contact. Simultaneous studies of 111 indium oxine label release from CHO cells and trypan blue dye exclusion demonstrated that T. vaginalis kills target cells without phagocytosis. Filtrates of trichomonad cultures or from media in which trichomonads were killing CHO cells had no effect on CHO cell monolayers, indicating that trichomonads do not kill cells by a cell-free or secreted cytotoxin. The microfilament inhibitor cytochalasin D (10 micrograms/ml) inhibited trichomonad killing of CHO cell monolayers by 80% (P less than 0.0001). In contrast, the microtubule inhibitor vinblastine (10(-6) M) caused only 17% inhibition of trichomonad destruction of CHO cell monolayers (P less than 0.020), whereas colchicine (10(-6) M) had no effect. T. vaginalis kills target cells by direct contact without phagocytosis. This event requires intact trichomonad microfilament function; microtubule function appears not to be essential
Directory of Open Access Journals (Sweden)
Oliver F Brandenberg
2017-05-01
Full Text Available The potential of broadly neutralizing antibodies targeting the HIV-1 envelope trimer to prevent HIV-1 transmission has opened new avenues for therapies and vaccines. However, their implementation remains challenging and would profit from a deepened mechanistic understanding of HIV-antibody interactions and the mucosal transmission process. In this study we experimentally determined stoichiometric parameters of the HIV-1 trimer-antibody interaction, confirming that binding of one antibody is sufficient for trimer neutralization. This defines numerical requirements for HIV-1 virion neutralization and thereby enables mathematical modelling of in vitro and in vivo antibody neutralization efficacy. The model we developed accurately predicts antibody efficacy in animal passive immunization studies and provides estimates for protective mucosal antibody concentrations. Furthermore, we derive estimates of the probability for a single virion to start host infection and the risks of male-to-female HIV-1 transmission per sexual intercourse. Our work thereby delivers comprehensive quantitative insights into both the molecular principles governing HIV-antibody interactions and the initial steps of mucosal HIV-1 transmission. These insights, alongside the underlying, adaptable modelling framework presented here, will be valuable for supporting in silico pre-trial planning and post-hoc evaluation of HIV-1 vaccination or antibody treatment trials.
Reduction of buffering requirements: Another advantage of cooperative transmission
Bader, Ahmed
2015-04-01
Yet another advent of cooperative transmission is exposed in this letter. It is shown that cooperation lends itself to the reduction of buffer sizes of wireless sensor nodes. It is less likely to find the channel busy when cooperative transmission is employed in the network. Otherwise, in the lack of cooperation, the probability of build up of packet queues in transmission buffers increases.
On the properties of collision probability integrals in annular geometry-II evaluation
International Nuclear Information System (INIS)
Milgram, M.S.; Sly, K.N.
1979-02-01
To calculate neutron flux distributions in infinitely long annular regions, the inner-outer and outer-outer transmission probabilities psup(io) and psup(oo) are required. Efficient algorithms for the computation of these probabilities as functions of two variables (the ratio of inner/outer radii kappa, and cross-section Σ) are given for 0 -5 . (author)
Directory of Open Access Journals (Sweden)
Vered Schechner
Full Text Available Clostridium difficile infection (CDI is a common and potentially fatal healthcare-associated infection. Improving diagnostic tests and infection control measures may prevent transmission. We aimed to determine, in resource-limited settings, whether it is more effective and cost-effective to allocate resources to isolation or to diagnostics.We constructed a mathematical model of CDI transmission based on hospital data (9 medical wards, 350 beds between March 2010 and February 2013. The model consisted of three compartments: susceptible patients, asymptomatic carriers and CDI patients. We used our model results to perform a cost-effectiveness analysis, comparing four strategies that were different combinations of 2 test methods (the two-step test and uniform PCR and 2 infection control measures (contact isolation in multiple-bed rooms or single-bed rooms/cohorting. For each strategy, we calculated the annual cost (of CDI diagnosis and isolation for a decrease of 1 in the average daily number of CDI patients; the strategy of the two-step test and contact isolation in multiple-bed rooms was the reference strategy.Our model showed that the average number of CDI patients increased exponentially as the transmission rate increased. Improving diagnosis by adopting uniform PCR assay reduced the average number of CDI cases per day per 350 beds from 9.4 to 8.5, while improving isolation by using single-bed rooms reduced the number to about 1; the latter was cost saving.CDI can be decreased by better isolation and more sensitive laboratory methods. From the hospital perspective, improving isolation is more cost-effective than improving diagnostics.
Schechner, Vered; Carmeli, Yehuda; Leshno, Moshe
2017-01-01
Clostridium difficile infection (CDI) is a common and potentially fatal healthcare-associated infection. Improving diagnostic tests and infection control measures may prevent transmission. We aimed to determine, in resource-limited settings, whether it is more effective and cost-effective to allocate resources to isolation or to diagnostics. We constructed a mathematical model of CDI transmission based on hospital data (9 medical wards, 350 beds) between March 2010 and February 2013. The model consisted of three compartments: susceptible patients, asymptomatic carriers and CDI patients. We used our model results to perform a cost-effectiveness analysis, comparing four strategies that were different combinations of 2 test methods (the two-step test and uniform PCR) and 2 infection control measures (contact isolation in multiple-bed rooms or single-bed rooms/cohorting). For each strategy, we calculated the annual cost (of CDI diagnosis and isolation) for a decrease of 1 in the average daily number of CDI patients; the strategy of the two-step test and contact isolation in multiple-bed rooms was the reference strategy. Our model showed that the average number of CDI patients increased exponentially as the transmission rate increased. Improving diagnosis by adopting uniform PCR assay reduced the average number of CDI cases per day per 350 beds from 9.4 to 8.5, while improving isolation by using single-bed rooms reduced the number to about 1; the latter was cost saving. CDI can be decreased by better isolation and more sensitive laboratory methods. From the hospital perspective, improving isolation is more cost-effective than improving diagnostics.
Transmission rights and market power
International Nuclear Information System (INIS)
Bushnell, J.
1999-01-01
Most of the concerns about physical transmission rights relate to the ability to implicitly or explicitly remove that transmission capacity from the market-place. Under a very strict form of physical right, owners could simply choose not to sell it if they don't want to use it. Modifications that require the release of spare capacity back into an open market could potentially alleviate this problem but there is concern that such releases would not occur far enough in advance to be of much use to schedulers. Similarly, the transmission capacity that is made available for use by non-rights holders can also be manipulated by the owners of transmission rights. The alternative form, financial transmission rights, provide to their owners congestion payments, but physical control of transmission paths. In electricity markets such as California's, even financial transmission rights could potentially be utilized to effectively withhold transmission capacity from the marketplace. However, methods for withholding transmission capacity are somewhat more convoluted, and probably more difficult, for owners of financial rights than for owners of physical rights. In this article, the author discusses some of the potential concerns over transmission rights and their use for the exercise of various forms of market power
Energy Technology Data Exchange (ETDEWEB)
Ovchinnikova, Olga S [ORNL; Bhandari, Deepak [ORNL; Lorenz, Matthias [ORNL; Van Berkel, Gary J [ORNL
2014-01-01
RATIONALE: Capture of material from a laser ablation plume into a continuous flow stream of solvent provides the means for uninterrupted sampling, transport and ionization of collected material for coupling with mass spectral analysis. Reported here is the use of vertically aligned transmission geometry laser ablation in combination with a new non-contact liquid vortex capture probe coupled with electrospray ionization for spot sampling and chemical imaging with mass spectrometry. Methods: A vertically aligned continuous flow liquid vortex capture probe was positioned directly underneath a sample surface in a transmission geometry laser ablation (355 nm, 10 Hz, 7 ns pulse width) setup to capture into solution the ablated material. The outlet of the vortex probe was coupled to the Turbo V ion source of an AB SCIEX TripleTOF 5600+ mass spectrometer. System operation and performance metrics were tested using inked patterns and thin tissue sections. Glass slides and slides designed especially for laser capture microdissection, viz., DIRECTOR slides and PEN 1.0 (polyethylene naphthalate) membrane slides, were used as sample substrates. Results: The estimated capture efficiency of laser ablated material was 24%, which was enabled by the use of a probe with large liquid surface area (~ 2.8 mm2) and with gravity to help direct ablated material vertically down towards the probe. The swirling vortex action of the liquid surface potentially enhanced capture and dissolution of not only particulates, but also gaseous products of the laser ablation. The use of DIRECTOR slides and PEN 1.0 (polyethylene naphthalate) membrane slides as sample substrates enabled effective ablation of a wide range of sample types (basic blue 7, polypropylene glycol, insulin and cyctochrome c) without photodamage using a UV laser. Imaging resolution of about 6 m was demonstrated for stamped ink on DIRECTOR slides based on the ability to distinguish features present both in the optical and in the
Microbial contamination of soft contact lenses & accessories in asymptomatic contact lens users
Directory of Open Access Journals (Sweden)
Deeksha V Thakur
2014-01-01
Full Text Available Background & objectives: With increasing use of soft contact lenses the incidence of contact lens induced infections is also increasing. This study was aimed to assess the knowledge of new and existing contact lens users about the risk of microbial contamination associated with improper use and maintenance of contact lenses, type of microbial flora involved and their potential to cause ophthalmic infections. Methods: Four samples each from 50 participants (n=200 were collected from the lenses, lens care solutions, lens care solution bottles and lens cases along with a questionnaire regarding their lens use. The samples were inoculated onto sheep blood agar, Mac Conkey′s agar and Sabouraud′s dextrose agar. Organisms were identified using standard laboratory protocols. Results: Overall rate of microbial contamination among the total samples was 52 per cent. The most and the least contaminated samples were found to be lens cases (62% and lens care solution (42%, respectively. The most frequently isolated contaminant was Staphylococcus aureus (21% followed by Pseudomonas species (19.5%. Majority (64% of the participants showed medium grade of compliance to lens cleaning practices. Rate of contamination was 100 and 93.75 per cent respectively in those participants who showed low and medium compliance to lens care practices as compared to those who had high level of compliance (43.75% ( p0 <0.05. Interpretation & conclusions: Lens care practices amongst the participants were not optimum which resulted into high level contamination. Hence, creating awareness among the users about the lens care practices and regular cleaning and replacements of lens cases are required.
Conduction of molecular electronic devices: Qualitative insights through atom-atom polarizabilities
International Nuclear Information System (INIS)
Stuyver, T.; Fias, S.; De Proft, F.; Geerlings, P.; Fowler, P. W.
2015-01-01
The atom-atom polarizability and the transmission probability at the Fermi level, as obtained through the source-and-sink-potential method for every possible configuration of contacts simultaneously, are compared for polycyclic aromatic compounds. This comparison leads to the conjecture that a positive atom-atom polarizability is a necessary condition for transmission to take place in alternant hydrocarbons without non-bonding orbitals and that the relative transmission probability for different configurations of the contacts can be predicted by analyzing the corresponding atom-atom polarizability. A theoretical link between the two considered properties is derived, leading to a mathematical explanation for the observed trends for transmission based on the atom-atom polarizability
Conduction of molecular electronic devices: Qualitative insights through atom-atom polarizabilities
Energy Technology Data Exchange (ETDEWEB)
Stuyver, T.; Fias, S., E-mail: sfias@vub.ac.be; De Proft, F.; Geerlings, P. [ALGC, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussel (Belgium); Fowler, P. W. [Department of Chemistry, University of Sheffield, Sheffield S3 7HF (United Kingdom)
2015-03-07
The atom-atom polarizability and the transmission probability at the Fermi level, as obtained through the source-and-sink-potential method for every possible configuration of contacts simultaneously, are compared for polycyclic aromatic compounds. This comparison leads to the conjecture that a positive atom-atom polarizability is a necessary condition for transmission to take place in alternant hydrocarbons without non-bonding orbitals and that the relative transmission probability for different configurations of the contacts can be predicted by analyzing the corresponding atom-atom polarizability. A theoretical link between the two considered properties is derived, leading to a mathematical explanation for the observed trends for transmission based on the atom-atom polarizability.
Conduction of molecular electronic devices: qualitative insights through atom-atom polarizabilities.
Stuyver, T; Fias, S; De Proft, F; Fowler, P W; Geerlings, P
2015-03-07
The atom-atom polarizability and the transmission probability at the Fermi level, as obtained through the source-and-sink-potential method for every possible configuration of contacts simultaneously, are compared for polycyclic aromatic compounds. This comparison leads to the conjecture that a positive atom-atom polarizability is a necessary condition for transmission to take place in alternant hydrocarbons without non-bonding orbitals and that the relative transmission probability for different configurations of the contacts can be predicted by analyzing the corresponding atom-atom polarizability. A theoretical link between the two considered properties is derived, leading to a mathematical explanation for the observed trends for transmission based on the atom-atom polarizability.
Development of non-contract fiber jumper cord and evaluation of light transmission performance
International Nuclear Information System (INIS)
Kim, Heon Young; Kang, Dong Hoon
2016-01-01
Recently, fiber optic sensors, which have many advantages are being applied in various fields by replacing conventional electric sensors. To transmit the light signals between an interrogator and a sensor head, optical components such as an optical adapt or and optical jumper cords are generally used. When signals are transmitted using an adapt or, the end surface of each jumper cord is faced together. If alien substances exist on the core surface of an optical fiber, those can cause light transmission loss and signal disappearance. For this reason, non-contact fiber jumper cords are developed to overcome the problems that require continual attention. The light transmission performance of non-contact fiber jumper cords are also evaluated. From the test results, conventional fiber jumper cords are unable to transmit the signals over 2 mm cavity between the ends of both cords. Otherwise, non-contact fiber jumper cords can transmit the signals with stability up to the cavity of 7 mm though they have more transmission loss than the conventional ones. Consequently, non-contact fiber jumper cords that have better signal stability than conventional ones in environments are highly recommended in field applications, especially if they play a role as a cable for signal transmission between fiber optic sensors
Development of non-contract fiber jumper cord and evaluation of light transmission performance
Energy Technology Data Exchange (ETDEWEB)
Kim, Heon Young; Kang, Dong Hoon [Advanced Materials Research Team, Korea Railroad Research Institute, Uiwang (Korea, Republic of)
2016-10-15
Recently, fiber optic sensors, which have many advantages are being applied in various fields by replacing conventional electric sensors. To transmit the light signals between an interrogator and a sensor head, optical components such as an optical adapt or and optical jumper cords are generally used. When signals are transmitted using an adapt or, the end surface of each jumper cord is faced together. If alien substances exist on the core surface of an optical fiber, those can cause light transmission loss and signal disappearance. For this reason, non-contact fiber jumper cords are developed to overcome the problems that require continual attention. The light transmission performance of non-contact fiber jumper cords are also evaluated. From the test results, conventional fiber jumper cords are unable to transmit the signals over 2 mm cavity between the ends of both cords. Otherwise, non-contact fiber jumper cords can transmit the signals with stability up to the cavity of 7 mm though they have more transmission loss than the conventional ones. Consequently, non-contact fiber jumper cords that have better signal stability than conventional ones in environments are highly recommended in field applications, especially if they play a role as a cable for signal transmission between fiber optic sensors.
Do doctors need statistics? Doctors' use of and attitudes to probability and statistics.
Swift, Louise; Miles, Susan; Price, Gill M; Shepstone, Lee; Leinster, Sam J
2009-07-10
There is little published evidence on what doctors do in their work that requires probability and statistics, yet the General Medical Council (GMC) requires new doctors to have these skills. This study investigated doctors' use of and attitudes to probability and statistics with a view to informing undergraduate teaching.An email questionnaire was sent to 473 clinicians with an affiliation to the University of East Anglia's Medical School.Of 130 respondents approximately 90 per cent of doctors who performed each of the following activities found probability and statistics useful for that activity: accessing clinical guidelines and evidence summaries, explaining levels of risk to patients, assessing medical marketing and advertising material, interpreting the results of a screening test, reading research publications for general professional interest, and using research publications to explore non-standard treatment and management options.Seventy-nine per cent (103/130, 95 per cent CI 71 per cent, 86 per cent) of participants considered probability and statistics important in their work. Sixty-three per cent (78/124, 95 per cent CI 54 per cent, 71 per cent) said that there were activities that they could do better or start doing if they had an improved understanding of these areas and 74 of these participants elaborated on this. Themes highlighted by participants included: being better able to critically evaluate other people's research; becoming more research-active, having a better understanding of risk; and being better able to explain things to, or teach, other people.Our results can be used to inform how probability and statistics should be taught to medical undergraduates and should encourage today's medical students of the subjects' relevance to their future careers. Copyright 2009 John Wiley & Sons, Ltd.
Poulos, H M; Camp, A E
2010-02-01
Vegetation management is a critical component of rights-of-way (ROW) maintenance for preventing electrical outages and safety hazards resulting from tree contact with conductors during storms. Northeast Utility's (NU) transmission lines are a critical element of the nation's power grid; NU is therefore under scrutiny from federal agencies charged with protecting the electrical transmission infrastructure of the United States. We developed a decision support system to focus right-of-way maintenance and minimize the potential for a tree fall episode that disables transmission capacity across the state of Connecticut. We used field data on tree characteristics to develop a system for identifying hazard trees (HTs) in the field using limited equipment to manage Connecticut power line ROW. Results from this study indicated that the tree height-to-diameter ratio, total tree height, and live crown ratio were the key characteristics that differentiated potential risk trees (danger trees) from trees with a high probability of tree fall (HTs). Products from this research can be transferred to adaptive right-of-way management, and the methods we used have great potential for future application to other regions of the United States and elsewhere where tree failure can disrupt electrical power.
Nishino, Takayuki
The face hobbing process has been widely applied in automotive industry. But so far few analytical tools have been developed. This makes it difficult for us to optimize gear design. To settle this situation, this study aims at developing a computerized tool to predict the running performances such as loaded tooth contact pattern, static transmission error and so on. First, based upon kinematical analysis of a cutting machine, a mathematical description of tooth surface generation is given. Second, based upon the theory of gearing and differential geometry, conjugate tooth surfaces are studied. Then contact lines are generated. Third, load distribution along contact lines is formulated. Last, the numerical model is validated by measuring loaded transmission error and loaded tooth contact pattern.
Hagan, José E; Moraga, Paula; Costa, Federico; Capian, Nicolas; Ribeiro, Guilherme S; Wunder, Elsio A; Felzemburgh, Ridalva D M; Reis, Renato B; Nery, Nivison; Santana, Francisco S; Fraga, Deborah; Dos Santos, Balbino L; Santos, Andréia C; Queiroz, Adriano; Tassinari, Wagner; Carvalho, Marilia S; Reis, Mitermayer G; Diggle, Peter J; Ko, Albert I
2016-01-01
Rat-borne leptospirosis is an emerging zoonotic disease in urban slum settlements for which there are no adequate control measures. The challenge in elucidating risk factors and informing approaches for prevention is the complex and heterogeneous environment within slums, which vary at fine spatial scales and influence transmission of the bacterial agent. We performed a prospective study of 2,003 slum residents in the city of Salvador, Brazil during a four-year period (2003-2007) and used a spatiotemporal modelling approach to delineate the dynamics of leptospiral transmission. Household interviews and Geographical Information System surveys were performed annually to evaluate risk exposures and environmental transmission sources. We completed annual serosurveys to ascertain leptospiral infection based on serological evidence. Among the 1,730 (86%) individuals who completed at least one year of follow-up, the infection rate was 35.4 (95% CI, 30.7-40.6) per 1,000 annual follow-up events. Male gender, illiteracy, and age were independently associated with infection risk. Environmental risk factors included rat infestation (OR 1.46, 95% CI, 1.00-2.16), contact with mud (OR 1.57, 95% CI 1.17-2.17) and lower household elevation (OR 0.92 per 10m increase in elevation, 95% CI 0.82-1.04). The spatial distribution of infection risk was highly heterogeneous and varied across small scales. Fixed effects in the spatiotemporal model accounted for the majority of the spatial variation in risk, but there was a significant residual component that was best explained by the spatial random effect. Although infection risk varied between years, the spatial distribution of risk associated with fixed and random effects did not vary temporally. Specific "hot-spots" consistently had higher transmission risk during study years. The risk for leptospiral infection in urban slums is determined in large part by structural features, both social and environmental. Our findings indicate that
Directory of Open Access Journals (Sweden)
José E Hagan
2016-01-01
Full Text Available Rat-borne leptospirosis is an emerging zoonotic disease in urban slum settlements for which there are no adequate control measures. The challenge in elucidating risk factors and informing approaches for prevention is the complex and heterogeneous environment within slums, which vary at fine spatial scales and influence transmission of the bacterial agent.We performed a prospective study of 2,003 slum residents in the city of Salvador, Brazil during a four-year period (2003-2007 and used a spatiotemporal modelling approach to delineate the dynamics of leptospiral transmission. Household interviews and Geographical Information System surveys were performed annually to evaluate risk exposures and environmental transmission sources. We completed annual serosurveys to ascertain leptospiral infection based on serological evidence. Among the 1,730 (86% individuals who completed at least one year of follow-up, the infection rate was 35.4 (95% CI, 30.7-40.6 per 1,000 annual follow-up events. Male gender, illiteracy, and age were independently associated with infection risk. Environmental risk factors included rat infestation (OR 1.46, 95% CI, 1.00-2.16, contact with mud (OR 1.57, 95% CI 1.17-2.17 and lower household elevation (OR 0.92 per 10m increase in elevation, 95% CI 0.82-1.04. The spatial distribution of infection risk was highly heterogeneous and varied across small scales. Fixed effects in the spatiotemporal model accounted for the majority of the spatial variation in risk, but there was a significant residual component that was best explained by the spatial random effect. Although infection risk varied between years, the spatial distribution of risk associated with fixed and random effects did not vary temporally. Specific "hot-spots" consistently had higher transmission risk during study years.The risk for leptospiral infection in urban slums is determined in large part by structural features, both social and environmental. Our findings
Contact parameter identification for vibrational response variability prediction
DEFF Research Database (Denmark)
Creixell Mediante, Ester; Brunskog, Jonas; Jensen, Jakob Søndergaard
2018-01-01
industry, where the vibrational behavior of the structures within the hearing frequency range is critical for the performance of the devices. A procedure to localize the most probable contact areas and determine the most sensitive contact points with respect to variations in the modes of vibration......Variability in the dynamic response of assembled structures can arise due to variations in the contact conditions between the parts that conform them. Contact conditions are difficult to model accurately due to randomness in physical properties such as contact surface, load distribution...... or geometric details. Those properties can vary for a given structure due to the assembly and disassembly process, and also across nominally equal items that are produced in series. This work focuses on modeling the contact between small light-weight plastic pieces such as those used in the hearing aid...
Inference of R(0 and transmission heterogeneity from the size distribution of stuttering chains.
Directory of Open Access Journals (Sweden)
Seth Blumberg
Full Text Available For many infectious disease processes such as emerging zoonoses and vaccine-preventable diseases, [Formula: see text] and infections occur as self-limited stuttering transmission chains. A mechanistic understanding of transmission is essential for characterizing the risk of emerging diseases and monitoring spatio-temporal dynamics. Thus methods for inferring [Formula: see text] and the degree of heterogeneity in transmission from stuttering chain data have important applications in disease surveillance and management. Previous researchers have used chain size distributions to infer [Formula: see text], but estimation of the degree of individual-level variation in infectiousness (as quantified by the dispersion parameter, [Formula: see text] has typically required contact tracing data. Utilizing branching process theory along with a negative binomial offspring distribution, we demonstrate how maximum likelihood estimation can be applied to chain size data to infer both [Formula: see text] and the dispersion parameter that characterizes heterogeneity. While the maximum likelihood value for [Formula: see text] is a simple function of the average chain size, the associated confidence intervals are dependent on the inferred degree of transmission heterogeneity. As demonstrated for monkeypox data from the Democratic Republic of Congo, this impacts when a statistically significant change in [Formula: see text] is detectable. In addition, by allowing for superspreading events, inference of [Formula: see text] shifts the threshold above which a transmission chain should be considered anomalously large for a given value of [Formula: see text] (thus reducing the probability of false alarms about pathogen adaptation. Our analysis of monkeypox also clarifies the various ways that imperfect observation can impact inference of transmission parameters, and highlights the need to quantitatively evaluate whether observation is likely to significantly bias results.
Media planning by optimizing contact frequencies
N. Piersma (Nanda); S. Kapsenberg; P. Kloprogge; A.P.M. Wagelmans (Albert)
1998-01-01
textabstractIn this paper we study a model to estimate the probability that a target group of an advertising campaign is reached by a commercial message a given number of times. This contact frequency distribution is known to be computationally difficult to calculate because of dependence between
Modeling of contact tracing in social networks
Tsimring, Lev S.; Huerta, Ramón
2003-07-01
Spreading of certain infections in complex networks is effectively suppressed by using intelligent strategies for epidemic control. One such standard epidemiological strategy consists in tracing contacts of infected individuals. In this paper, we use a recently introduced generalization of the standard susceptible-infectious-removed stochastic model for epidemics in sparse random networks which incorporates an additional (traced) state. We describe a deterministic mean-field description which yields quantitative agreement with stochastic simulations on random graphs. We also discuss the role of contact tracing in epidemics control in small-world and scale-free networks. Effectiveness of contact tracing grows as the rewiring probability is reduced.
Probability of spent fuel transportation accidents
International Nuclear Information System (INIS)
McClure, J.D.
1981-07-01
The transported volume of spent fuel, incident/accident experience and accident environment probabilities were reviewed in order to provide an estimate of spent fuel accident probabilities. In particular, the accident review assessed the accident experience for large casks of the type that could transport spent (irradiated) nuclear fuel. This review determined that since 1971, the beginning of official US Department of Transportation record keeping for accidents/incidents, there has been one spent fuel transportation accident. This information, coupled with estimated annual shipping volumes for spent fuel, indicated an estimated annual probability of a spent fuel transport accident of 5 x 10 -7 spent fuel accidents per mile. This is consistent with ordinary truck accident rates. A comparison of accident environments and regulatory test environments suggests that the probability of truck accidents exceeding regulatory test for impact is approximately 10 -9 /mile
Using the probability method for multigroup calculations of reactor cells in a thermal energy range
International Nuclear Information System (INIS)
Rubin, I.E.; Pustoshilova, V.S.
1984-01-01
The possibility of using the transmission probability method with performance inerpolation for determining spatial-energy neutron flux distribution in cells of thermal heterogeneous reactors is considered. The results of multigroup calculations of several uranium-water plane and cylindrical cells with different fuel enrichment in a thermal energy range are given. A high accuracy of results is obtained with low computer time consumption. The use of the transmission probability method is particularly reasonable in algorithms of the programmes compiled computer with significant reserve of internal memory
A macroecological characterization of infectious disease transmission:
DEFF Research Database (Denmark)
Andersen-Ranberg, Emilie Ulrikka
2017-01-01
Presentation: Per M. Jensen*, Miguel L. Grilo, Christian B. Pipper, Emilie U. Andersen-Ranberg. A macroecological characterization of infectious disease transmission: the cases of Mycobacterium and Leptospira sp. The 2017 OIKOS meeting, 10th -11th March 2017, Copenhagen, Denmark......Presentation: Per M. Jensen*, Miguel L. Grilo, Christian B. Pipper, Emilie U. Andersen-Ranberg. A macroecological characterization of infectious disease transmission: the cases of Mycobacterium and Leptospira sp. The 2017 OIKOS meeting, 10th -11th March 2017, Copenhagen, Denmark...
de Souza-Galvão, Maria Luiza; Latorre, Irene; Altet-Gómez, Neus; Jiménez-Fuentes, María Ángeles; Milà, Celia; Solsona, Jordi; Seminario, Maria Asunción; Cantos, Adela; Ruiz-Manzano, Juan; Domínguez, José
2014-05-13
The aim of the study was to assess the correlation between the tuberculin skin test (TST) and in vitro interferon-gamma released assays (IGRAs) with risk factors for the spread of infection in smear positive pulmonary tuberculosis (TB) contacts. We recruited prospective contacts with smear positive pulmonary TB cases. We looked at human immunodeficiency virus (HIV) infection and other conditions of immunosuppression, presence of BCG vaccination and the degree of exposure to the index case. Patients underwent the TST, chest radiography, sputum analysis when necessary, and IGRA assays (QFN-G-IT and T-SPOT.TB). Presence of cough, diagnostic delay (days between first symptoms and TB diagnostic), contact conditions: room size (square meters) and index of overcrowding (square meters per person) were investigated in the index case. 156 contacts (119 adults, 37 children) of 66 TB patients were enrolled, 2.4 (1-14) contacts per TB case. The positivity of the TST did not correlate with the risk factors studied: presence of cough (p = 0.929); delayed diagnosis (p = 0.244); room size (p = 0.462); overcrowding (p = 0.800). Both QFN-G-IT and T-SPOT.TB, showed significant association with cough (p = 0.001, and p = 0.007) and room size (p = 0.020, and p = 0.023), respectively. Both IGRA associated better than TST with certain host-related risk factors involved in the transmission of disease, such as the presence of cough.
Takagaki, Shunsuke; Yamada, Hirofumi; Noda, Kei
2018-03-01
Contact effects in organic thin-film transistors (OTFTs) were examined by using our previously proposed parameter extraction method from the electrical characteristics of a single staggered-type device. Gate-voltage-dependent contact resistance and channel mobility in the linear regime were evaluated for bottom-gate/top-contact (BGTC) pentacene TFTs with active layers of different thicknesses, and for pentacene TFTs with contact-doped layers prepared by coevaporation of pentacene and tetrafluorotetracyanoquinodimethane (F4TCNQ). The extracted parameters suggested that the influence of the contact resistance becomes more prominent with the larger active-layer thickness, and that contact-doping experiments give rise to a drastic decrease in the contact resistance and a concurrent considerable improvement in the channel mobility. Additionally, the estimated energy distributions of trap density in the transistor channel probably reflect the trap filling with charge carriers injected into the channel regions. The analysis results in this study confirm the effectiveness of our proposed method, with which we can investigate contact effects and circumvent the influences of characteristic variations in OTFT fabrication.
Directory of Open Access Journals (Sweden)
Kumar VA
2016-05-01
Full Text Available Introduction: The risk of transmission from the index case to its contacts is more in case of smear positive Pulmonary Tuberculosis cases. Any delay in diagnosis and treatment increases the risk of disease transmission to their contacts. Contact screening is important for early detection of transmission of infection. Thus, active case finding of TB is needed to identify the case yield among household contacts. This study will yield the burden of Tuberculosis among the household contact. Objective: To identify the TB suspect and estimate the prevalence of TB among household contacts. Material and Methods: A two stage cross study was done in 472 households of 157 ‘Index cases’ registered in the State Tuberculosis Unit, Puducherry. The study duration was one year and eight months. Data was entered and analyzed by using Epi_Info (Version 3.4.3 software package. Results: A total of 96 (20.3% symptomatic was found from the 472 households contacts who participated in this study. Out of 90 symptomatics, 70 (72.9% were symptomatic within two months of visit and 26 (27.1% were found to have symptoms after eight months. The overall prevalence of tuberculosis in symptomatic household contacts was 4.3% and all tuberculosis confirmed cases were found at the end of in second month only. Conclusion: Considering the prevalence tuberculosis among the symptomatic of household contact to be 4.3%, their investigation to rule out TB in earlier stages is a need. It may help prevent further spread of M. tuberculosis infection in the local community.
Assessing the role of contact tracing in a suspected H7N2 influenza A outbreak in humans in Wales
Directory of Open Access Journals (Sweden)
Salmon Roland
2010-05-01
Full Text Available Abstract Background The detailed analysis of an outbreak database has been undertaken to examine the role of contact tracing in controlling an outbreak of possible avian influenza in humans. The outbreak, initiating from the purchase of infected domestic poultry, occurred in North Wales during May and June 2007. During this outbreak, extensive contact tracing was carried out. Following contact tracing, cases and contacts believed to be at risk of infection were given treatment/prophylaxis. Methods We analyse the database of cases and their contacts identified for the purposes of contact tracing in relation to both the contact tracing burden and effectiveness. We investigate the distribution of numbers of contacts identified, and use network structure to explore the speed with which treatment/prophylaxis was made available and to estimate the risk of transmission in different settings. Results Fourteen cases of suspected H7N2 influenza A in humans were associated with a confirmed outbreak among poultry in May-June 2007. The contact tracing dataset consisted of 254 individuals (cases and contacts, of both poultry and humans who were linked through a network of social contacts. Of these, 102 individuals were given treatment or prophylaxis. Considerable differences between individuals' contact patterns were observed. Home and workplace encounters were more likely to result in transmission than encounters in other settings. After an initial delay, while the outbreak proceeded undetected, contact tracing rapidly caught up with the cases and was effective in reducing the time between onset of symptoms and treatment/prophylaxis. Conclusions Contact tracing was used to link together the individuals involved in this outbreak in a social network, allowing the identification of the most likely paths of transmission and the risks of different types of interactions to be assessed. The outbreak highlights the substantial time and cost involved in contact
Assessing the role of contact tracing in a suspected H7N2 influenza A outbreak in humans in Wales.
Eames, Ken T D; Webb, Cerian; Thomas, Kathrin; Smith, Josie; Salmon, Roland; Temple, J Mark F
2010-05-28
The detailed analysis of an outbreak database has been undertaken to examine the role of contact tracing in controlling an outbreak of possible avian influenza in humans. The outbreak, initiating from the purchase of infected domestic poultry, occurred in North Wales during May and June 2007. During this outbreak, extensive contact tracing was carried out. Following contact tracing, cases and contacts believed to be at risk of infection were given treatment/prophylaxis. We analyse the database of cases and their contacts identified for the purposes of contact tracing in relation to both the contact tracing burden and effectiveness. We investigate the distribution of numbers of contacts identified, and use network structure to explore the speed with which treatment/prophylaxis was made available and to estimate the risk of transmission in different settings. Fourteen cases of suspected H7N2 influenza A in humans were associated with a confirmed outbreak among poultry in May-June 2007. The contact tracing dataset consisted of 254 individuals (cases and contacts, of both poultry and humans) who were linked through a network of social contacts. Of these, 102 individuals were given treatment or prophylaxis. Considerable differences between individuals' contact patterns were observed. Home and workplace encounters were more likely to result in transmission than encounters in other settings. After an initial delay, while the outbreak proceeded undetected, contact tracing rapidly caught up with the cases and was effective in reducing the time between onset of symptoms and treatment/prophylaxis. Contact tracing was used to link together the individuals involved in this outbreak in a social network, allowing the identification of the most likely paths of transmission and the risks of different types of interactions to be assessed. The outbreak highlights the substantial time and cost involved in contact tracing, even for an outbreak affecting few individuals. However, when
Finite-size scaling of survival probability in branching processes
Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Alvaro
2014-01-01
Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We reveal the finite-size scaling law of the survival probability for a given branching process ruled by a probability distribution of the number of offspring per element whose standard deviation is finite, obtaining the exact scaling function as well as the critical exponents. Our findings prove the universal behavi...
An epidemiological model of virus transmission in salmonid fishes of the Columbia River Basin
Ferguson, Paige F. B.; Breyta, Rachel; Brito, Ilana L.; Kurath, Gael; LaDeau, Shannon L.
2018-01-01
We have developed a dynamic epidemiological model informed by records of viral presence and genotypes to evaluate potential transmission routes maintaining a viral pathogen in economically and culturally important anadromous fish populations. In the Columbia River Basin, infectious hematopoietic necrosis virus (IHNV) causes severe disease, predominantly in juvenile steelhead trout (Oncorhynchus mykiss) and less frequently in Chinook salmon (O. tshawytscha). Mortality events following IHNV infection can be devastating for individual hatchery programs. Despite reports of high local mortality and extensive surveillance efforts, there are questions about how viral transmission is maintained. Modeling this system offers important insights into disease transmission in natural aquatic systems, as well as about the data requirements for generating accurate estimates about transmission routes and infection probabilities. We simulated six scenarios in which testing rates and the relative importance of different transmission routes varied. The simulations demonstrated that the model accurately identified routes of transmission and inferred infection probabilities accurately when there was testing of all cohort-sites. When testing records were incomplete, the model accurately inferred which transmission routes exposed particular cohort-sites but generated biased infection probabilities given exposure. After validating the model and generating guidelines for result interpretation, we applied the model to data from 14 annual cohorts (2000–2013) at 24 focal sites in a sub-region of the Columbia River Basin, the lower Columbia River (LCR), to quantify the relative importance of potential transmission routes in this focal sub-region. We demonstrate that exposure to IHNV via the return migration of adult fish is an important route for maintaining IHNV in the LCR sub-region, and the probability of infection following this exposure was relatively high at 0.16. Although only 1% of
Neglected Non-Traditional Routes of Hepatitis B Virus Transmission
Directory of Open Access Journals (Sweden)
Ling Wang
2016-11-01
Full Text Available According to Chinese Guideline of Prevention and Treatment for Chronic Hepatitis B which is published in October, 2015, hepatitis B virus (HBV is mainly transmitted via injection, vertical transmission, and sexual contact, furthermore, invasive procedures including pedicure and tattooing as well as sharing shavers and toothbrushes are also regarded as risk factors. These traditional HBV transmission pathways are in accordance with the corresponding WHO guideline. However, some of the statements in the guidelines such as close contact with active HBV carriers like sharing hygiene facilities and dining together as well as bites by blood-sucking arthropod like mosquito do not transmit HBV need to be questioned because related previous studies did not support these statements.
On the Meta Distribution of Coverage Probability in Uplink Cellular Networks
Elsawy, Hesham; Alouini, Mohamed-Slim
2017-01-01
This letter studies the meta distribution of coverage probability (CP), within a stochastic geometry framework, for cellular uplink transmission with fractional path-loss inversion power control. Using the widely accepted Poisson point process (PPP
Zein, Rizqy Amelia; Suhariadi, Fendy; Hendriani, Wiwin
2017-01-01
The research aimed to investigate the effect of lay knowledge of pulmonary tuberculosis (TB) and prior contact with pulmonary TB patients on a health-belief model (HBM) as well as to identify the social determinants that affect lay knowledge. Survey research design was conducted, where participants were required to fill in a questionnaire, which measured HBM and lay knowledge of pulmonary TB. Research participants were 500 residents of Semampir, Asemrowo, Bubutan, Pabean Cantian, and Simokerto districts, where the risk of pulmonary TB transmission is higher than other districts in Surabaya. Being a female, older in age, and having prior contact with pulmonary TB patients significantly increase the likelihood of having a higher level of lay knowledge. Lay knowledge is a substantial determinant to estimate belief in the effectiveness of health behavior and personal health threat. Prior contact with pulmonary TB patients is able to explain the belief in the effectiveness of a health behavior, yet fails to estimate participants' belief in the personal health threat. Health authorities should prioritize males and young people as their main target groups in a pulmonary TB awareness campaign. The campaign should be able to reconstruct people's misconception about pulmonary TB, thereby bringing around the health-risk perception so that it is not solely focused on improving lay knowledge.
[Ebola contacts' surveillance: social impact and ethical issues in Senegal].
Desclaux, A; Ndione, A G; Badji, D; Sow, K
2016-10-01
Quarantine has been widely used during the Ebola outbreak in West Africa mainly to control transmission chains. This measure raises ethical issues that require documentation of the modalities of quarantine at the field level and its social effects for contact persons. In Senegal, 74 people were in contact with the Ebola case coming from Guinea in September 2014. Of these, 34 members of the case's household were contained together at home and monitored by officers. The remaining 40 health care workers from two facilities were dispersed in their family households and monitored by telephone or during doctors' visits. The study is based on in-depth interviews with 43 adult contacts about their experiences and perceptions, with additional observation for interpretation and contextualization.Containment at home was applied differently to contacts who lived with patient zero than to professional health care contacts. No coercion was used at first since all contacts adhered to surveillance, but some of them did not fully comply with movement restrictions. Contacts found biosafety precautions stigmatizing, especially during the first days when health workers and contacts were feeling an acute fear of contagion. The material support that was provided-food and money-was necessary since contacts could not work nor get resources, but it was too limited and delayed. The relational support they received was appreciated, as well as the protection from stigmatization by the police and follow-up workers. But the information delivered to contacts was insufficient, and some of them, including health workers, had little knowledge about EVD and Ebola transmission, which caused anxiety and emotional suffering. Some contacts experienced the loss of their jobs and loss of income; several could not easily or fully return to their previous living routines.Beyond its recommendations to enhance support measures, the study identifies the ethical stakes of quarantine in Senegal regarding
Formation and Evolution of Contact Binaries
Directory of Open Access Journals (Sweden)
Peter P. Eggleton
2012-06-01
Full Text Available describe a series of processes, including hierarchical fragmentation, gravitational scattering, Kozai cycles within triple systems, tidal friction and magnetic braking, that I believe are responsible for producing the modest but significant fraction of stars that are observed as contact binaries. I also discuss further processes, namely heat transport, mass transport, nuclear evolution, thermal relaxation oscillations, and further magnetic braking with tidal friction, that influence the evolution during contact. The endpoint, for contact, is that the two components merge into a single star, as recently was observed in the remarkable system V1309 Sco. The single star probably throws off some mass and rotates rapidly at first, and then slows by magnetic braking to become a rather inconspicuous but normal dwarf or subgiant. If however the contact binary was part of a triple system originally–as I suggested above was rather likely–then the result could be a widish binary with apparently non-coeval components. There are several such known.
Conductance histogram evolution of an EC-MCBJ fabricated Au atomic point contact
Energy Technology Data Exchange (ETDEWEB)
Yang Yang; Liu Junyang; Chen Zhaobin; Tian Jinghua; Jin Xi; Liu Bo; Yang Fangzu; Tian Zhongqun [State Key Laboratory of Physical Chemistry of Solid Surfaces and Department of Chemistry, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Li Xiulan; Tao Nongjian [Center for Bioelectronics and Biosensors, Biodesign Institute, Department of Electrical Engineering, Arizona State University, Tempe, AZ 85287-6206 (United States); Luo Zhongzi; Lu Miao, E-mail: zqtian@xmu.edu.cn [Micro-Electro-Mechanical Systems Research Center, Pen-Tung Sah Micro-Nano Technology Institute, Xiamen University, Xiamen 361005 (China)
2011-07-08
This work presents a study of Au conductance quantization based on a combined electrochemical deposition and mechanically controllable break junction (MCBJ) method. We describe the microfabrication process and discuss improved features of our microchip structure compared to the previous one. The improved structure prolongs the available life of the microchip and also increases the success rate of the MCBJ experiment. Stepwise changes in the current were observed at the last stage of atomic point contact breakdown and conductance histograms were constructed. The evolution of 1G{sub 0} peak height in conductance histograms was used to investigate the probability of formation of an atomic point contact. It has been shown that the success rate in forming an atomic point contact can be improved by decreasing the stretching speed and the degree that the two electrodes are brought into contact. The repeated breakdown and formation over thousands of cycles led to a distinctive increase of 1G{sub 0} peak height in the conductance histograms, and this increased probability of forming a single atomic point contact is discussed.
Conductance histogram evolution of an EC-MCBJ fabricated Au atomic point contact
International Nuclear Information System (INIS)
Yang Yang; Liu Junyang; Chen Zhaobin; Tian Jinghua; Jin Xi; Liu Bo; Yang Fangzu; Tian Zhongqun; Li Xiulan; Tao Nongjian; Luo Zhongzi; Lu Miao
2011-01-01
This work presents a study of Au conductance quantization based on a combined electrochemical deposition and mechanically controllable break junction (MCBJ) method. We describe the microfabrication process and discuss improved features of our microchip structure compared to the previous one. The improved structure prolongs the available life of the microchip and also increases the success rate of the MCBJ experiment. Stepwise changes in the current were observed at the last stage of atomic point contact breakdown and conductance histograms were constructed. The evolution of 1G 0 peak height in conductance histograms was used to investigate the probability of formation of an atomic point contact. It has been shown that the success rate in forming an atomic point contact can be improved by decreasing the stretching speed and the degree that the two electrodes are brought into contact. The repeated breakdown and formation over thousands of cycles led to a distinctive increase of 1G 0 peak height in the conductance histograms, and this increased probability of forming a single atomic point contact is discussed.
Reitzel, Ruth; Rosenblatt, Joel; Jiang, Ying; Hachem, Ray; Raad, Issam
2014-01-01
Transmission of organisms by contact of gloves with surfaces following contact with a pathogen source has been recognized as an important vector for pathogenesis of health care-associated infections. In these cases, the gloves protect the wearer from contact with the pathogenic organisms; however, this personal protection can facilitate the wearer unwittingly becoming a carrier of the pathogens from one location to another. A novel gendine (combination of chlorhexidine and gentian violet) antiseptic coating for the external surface of the glove was developed as a potential intervention to prevent this mode of transmission. We characterized the ability of the coating to rapidly kill bacterial and fungal pathogens within 1 minute of contact with the glove surface. The International Organization of Standardization 22196 concentrated inoculum contact testing methodology was followed. The gendine-coated gloves were able to fully eradicate multidrug-resistant organisms included methicillin-resistant Staphylococcus aureus, vancomycin-resistant enterocci, multidrug-resistant Pseudomonas aeruginosa, and Klebsiella pneumoniae carbapenemase producing. In addition, Candida albicans, Candida glabarata, and 2 pathogenic Escherichia coli strains commonly associated with invasive gastroenteritis were also fully eradicated within 1 minute of contact. The gendine coating did not adversely impact the finish or integrity of the disposable gloves. The highly efficacious gendine-coated antimicrobial gloves potentially provide an additional means of protection against horizontal transmission of common pathogens in a hospital setting. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.
Inspection of complex geometry pieces with an intelligent contact transducer
International Nuclear Information System (INIS)
Chatillon, S.; Roy, O.; Mahaut, St.
2000-01-01
A new multi-element contact transducer has been developed to improve the inspection of components with complex geometry. The emitting surface is flexible in order to optimize the contact with pieces. An algorithm, based on a simplified geometric model, has been used to determine the delays law which allows to control the focal characteristics of the transmitted field. Acquisition data lead in transmission with an articulated transducer validate the behavior provided by simulation. Thus the optimization of the delays law ensures the transmission of a beam which is homogeneous and controlled during the moving of the transducer. Inspections in echo-pulse mode are implemented on a sample simulating a component controlled on site. Results show that the dynamical adaptation of the delays law to the geometry of the piece leads to very good performances
Episodic sexual transmission of HIV revealed by molecular phylodynamics.
Directory of Open Access Journals (Sweden)
Fraser Lewis
2008-03-01
Full Text Available The structure of sexual contact networks plays a key role in the epidemiology of sexually transmitted infections, and their reconstruction from interview data has provided valuable insights into the spread of infection. For HIV, the long period of infectivity has made the interpretation of contact networks more difficult, and major discrepancies have been observed between the contact network and the transmission network revealed by viral phylogenetics. The high rate of HIV evolution in principle allows for detailed reconstruction of links between virus from different individuals, but often sampling has been too sparse to describe the structure of the transmission network. The aim of this study was to analyze a high-density sample of an HIV-infected population using recently developed techniques in phylogenetics to infer the short-term dynamics of the epidemic among men who have sex with men (MSM.Sequences of the protease and reverse transcriptase coding regions from 2,126 patients, predominantly MSM, from London were compared: 402 of these showed a close match to at least one other subtype B sequence. Nine large clusters were identified on the basis of genetic distance; all were confirmed by Bayesian Monte Carlo Markov chain (MCMC phylogenetic analysis. Overall, 25% of individuals with a close match with one sequence are linked to 10 or more others. Dated phylogenies of the clusters using a relaxed clock indicated that 65% of the transmissions within clusters took place between 1995 and 2000, and 25% occurred within 6 mo after infection. The likelihood that not all members of the clusters have been identified renders the latter observation conservative.Reconstruction of the HIV transmission network using a dated phylogeny approach has revealed the HIV epidemic among MSM in London to have been episodic, with evidence of multiple clusters of transmissions dating to the late 1990s, a period when HIV prevalence is known to have doubled in this
The Josephson effect in atomic contacts
International Nuclear Information System (INIS)
Chauvin, M.
2005-11-01
The Josephson effect appears when a weak-link establishes phase coherence between two superconductors. A unifying theory of this effect emerged in the 90's within the framework of mesoscopic physics. Based on two cornerstone concepts, conduction channels and Andreev reflection, it predicts the current-phase relation for the most basic weak-link: a single conduction channel of arbitrary transmission. This thesis illustrates this mesoscopic point of view with experiments on superconducting atomic size contacts. In particular, we have focused on the supercurrent peak around zero voltage, put into evidence the ac Josephson currents in a contact under constant bias voltage (Shapiro resonances and photon assisted multiple Andreev reflections), and performed direct measurements of the current-phase relation. (author)
Parasite transmission in social interacting hosts: Monogenean epidemics in guppies
Johnson, Mirelle B.; Lafferty, Kevin D.; van Oosterhout, Cock; Cable, Joanne
2011-01-01
Background Infection incidence increases with the average number of contacts between susceptible and infected individuals. Contact rates are normally assumed to increase linearly with host density. However, social species seek out each other at low density and saturate their contact rates at high densities. Although predicting epidemic behaviour requires knowing how contact rates scale with host density, few empirical studies have investigated the effect of host density. Also, most theory assumes each host has an equal probability of transmitting parasites, even though individual parasite load and infection duration can vary. To our knowledge, the relative importance of characteristics of the primary infected host vs. the susceptible population has never been tested experimentally. Methodology/Principal Findings Here, we examine epidemics using a common ectoparasite, Gyrodactylus turnbulli infecting its guppy host (Poecilia reticulata). Hosts were maintained at different densities (3, 6, 12 and 24 fish in 40 L aquaria), and we monitored gyrodactylids both at a population and individual host level. Although parasite population size increased with host density, the probability of an epidemic did not. Epidemics were more likely when the primary infected fish had a high mean intensity and duration of infection. Epidemics only occurred if the primary infected host experienced more than 23 worm days. Female guppies contracted infections sooner than males, probably because females have a higher propensity for shoaling. Conclusions/Significance These findings suggest that in social hosts like guppies, the frequency of social contact largely governs disease epidemics independent of host density.
International Nuclear Information System (INIS)
Biringer, B.E.
1976-11-01
This report documents a study of the annual probabilities of aircraft impact with the Sandia Pulsed Reactor (SPR) and Bldg. 836 at Sandia Laboratories, Albuquerque. The probability of aircraft impact into each structure was estimated using total yearly operations, effective structure area, structure location relative to air activity, and accident rate per kilometer. The estimated probability for an aircraft impact with SPR is 1.1 x 10 -4 per year; the estimated probability for impact with Bldg. 836 is 1.0 x 10 -3 per year
Compliance and hygiene behaviour among soft contact lens wearers in the Maldives.
Gyawali, Rajendra; Nestha Mohamed, Fathimath; Bist, Jeewanand; Kandel, Himal; Marasini, Sanjay; Khadka, Jyoti
2014-01-01
Significant levels of non-compliance and poor hygiene among contact lens wearers have been reported previously from different parts of the world. This survey aimed at identifying the scope of hygiene and non-compliant behaviour of soft contact lens wearers in the Maldives. Established soft lens wearers attending two eye clinics in Male' city, were interviewed in office or via telephone. A set of interviewer-administered questions was used to access the subjective response on compliance and hygiene behaviour (hand and lens case hygiene, water exposure, adherence to lens replacement schedule, dozing and overnight wear, awareness of aftercare visits and reuse of disinfecting solution). Participants were also asked to rate themselves as a contact lens user based on their perceived compliance and hygiene practices. Out of 107 participants, 79 (74.8 per cent) were interviewed in the office and the rest via telephone. The majority of lens wearers were female, office workers and students, with a mean age of 20.64 ± 4.4 years. Mean duration of lens wear was 28.04 ± 8.36 months. Most of them were using spherical lenses (86.9 per cent) on a daily wear basis (96.3 per cent). Major reported forms of non-compliance were poor hand hygiene (60.7 per cent), lack of aftercare awareness (39.3 per cent), water exposure (35.5 per cent) and over-use of lenses (24.3 per cent). While females were more likely to overuse their lenses than males (p hygienic behaviour. A significant number of Maldivian contact lens wearers exhibited poor levels of hygiene and compliance with contact lenses and lens care systems. An effective educational reinforcement strategy needs to be developed to modify lens wearers' non-compliance. © 2013 The Authors. Clinical and Experimental Optometry © 2013 Optometrists Association Australia.
Transmission of the L-Zagreb mumps vaccine virus, Croatia, 2005-2008.
Kaic, B; Gjenero-Margan, I; Aleraj, B; Ljubin-Sternak, S; Vilibic-Cavlek, T; Kilvain, S; Pavic, I; Stojanovic, D; Ilic, A
2008-04-17
We report on three cases of symptomatic transmission of the L-Zagreb mumps vaccine virus from three vaccinated children to five adult contacts. The five contact cases were parents of the vaccinated children and presented with parotitis and in one case also with aseptic meningitis. The etiology of the contacts' illness was determined by viral culture, genomic sequencing, serology and epidemiological linking. Two of the vaccinated children developed vaccine associated parotitis as an adverse event three weeks following immunization. Symptoms in contact cases developed five to seven weeks after the vaccination of the children. The five contact cases, as well as the three children with adverse events recovered completely. The children had been vaccinated with MMR vaccine produced by the Institute of Immunology Zagreb, each of them with a different lot. One of the possible explanations for these adverse events is that the very low levels of wild mumps virus circulation in the last decade, combined with waning immunity in those who received one dose of vaccine or suffered from mumps in childhood, resulted in susceptible young adults and that this unique epidemiological situation allows us to detect horizontal transmission of mumps vaccine virus.
The study about planetary gearbox virtual prototyping with nonlinear gear contact characteristics
International Nuclear Information System (INIS)
Yin Huabing; Zhou Guangming
2010-01-01
The virtual prototypes of gear transmission system built in most multi-body dynamic software have difficulties in describing the gear mesh characteristics. The gear mesh contact is modelled as rigid contact and this is not accurate for the gear mesh contact, which is elastic or flexible. The gear contact formula used in the multi-body dynamic software does not reveal the gear contact nonlinear stiffness characteristic. The model built with gear meshing contact is difficult to solve because of its time-consuming algorithm. In the paper a new method is put forward to build the virtual prototype of planetary gearbox system according to the nonlinear mesh stiffness and mesh phase obtained through FEM models. This new FEM method of gear mesh stiffness calculation is much more accurate than the common formulas. The gear mesh nonlinear stiffness of sun gear- pinion and pinion-ring gear of all the planetary gear sets in gearbox are obtained through MATALB code, which is used to read and plot the analyzing result data. The gear mesh phase differences between different pinions with suns or rings of different planetary gear set can be also obtained. With all these data modelled in simulink (or other software) and integrated with the multi-body dynamic planetary gearbox model and the gear meshing contact problem in multi-body gear models is solved easily and accurately. The interfaces for gear mesh stiffness and mesh phases are designed for multi-body dynamic model and simulink. The nonlinear planetary gear set prototyping models are integrated to become the whole planetary gear box model and the whole vehicle system model built in multi-body dynamic software can be integrated to simulate different duty conditions. At last high speed input is put into the nonlinear planetary transmission model and the different duty cases are simulated. The dynamic characteristics of different parts are obtained. The dynamic characteristic comparison between nonlinear and linear models is made
The dynamic contact area of elastomers at different velocities
Khafidh, Muhammad; Rodriguez, N.V.; Masen, Marc Arthur; Schipper, Dirk J.
2016-01-01
The friction in tribo-systems that contain viscoelastic materials, such as elastomers, is relevant for a large number of applications. Examples include tyres, hoses, transmission and conveyor belts. To quantify the friction in these applications, one must first understand the contact behaviour of
Directory of Open Access Journals (Sweden)
Rahul Sampath
2017-05-01
Full Text Available The role of infection with Mycoplasma hominis following cardiothoracic organ transplantation and its source of transmission have not been well-defined. Here, we identify and describe infection with M. hominis in patients following cardiothoracic organ transplantation after reviewing all cardiothoracic transplantations performed at our center between 1998 and July 2015. We found seven previously unreported cases of M. hominis culture positive infection all of whom presented with pleuritis, surgical site infection, and/or mediastinitis. PCR was used to establish the diagnosis in four cases. In two instances, paired single lung transplant recipients manifested infection, and in one of these pairs, isolates were indistinguishable by multilocus sequence typing (MLST. To investigate the prevalence of M. hominis in the lower respiratory tract, we tested 178 bronchoalveolar lavage (BAL fluids collected from immunocompromised subjects for M. hominis by PCR; all were negative. Review of the literature revealed an additional 15 cases of M. hominis in lung transplant recipients, most with similar clinical presentations to our cases. We recommend that M. hominis should be considered in post-cardiothoracic transplant infections presenting with pleuritis, surgical site infection, or mediastinitis. M. hominis PCR may facilitate early diagnosis and prompt therapy. Evaluation for possible donor transmission should be considered.
Linker-dependent Junction Formation Probability in Single-Molecule Junctions
Energy Technology Data Exchange (ETDEWEB)
Yoo, Pil Sun; Kim, Taekyeong [HankukUniversity of Foreign Studies, Yongin (Korea, Republic of)
2015-01-15
We compare the junction formation probabilities of single-molecule junctions with different linker molecules by using a scanning tunneling microscope-based break-junction technique. We found that the junction formation probability varies as SH > SMe > NH2 for the benzene backbone molecule with different types of anchoring groups, through quantitative statistical analysis. These results are attributed to different bonding forces according to the linker groups formed with Au atoms in the electrodes, which is consistent with previous works. Our work allows a better understanding of the contact chemistry in the metal.molecule junction for future molecular electronic devices.
Children in Greenland: disease patterns and contacts to the health care system
Directory of Open Access Journals (Sweden)
Marius Kløvgaard
2016-12-01
Full Text Available Background: Previous studies of Greenlandic children’s disease pattern and contacts to the health care system are sparse and have focused on the primary health care sector. Objective: We aimed to identify the disease pattern and use of health care facilities of children aged 0–10 in two Greenlandic cohorts. Methods and design: In a retrospective, descriptive follow-up of the Ivaaq (The Greenland Child Cohort and the CLEAR (climate changes, environmental contaminants and reproductive health birth cohorts (total n=1,000, we reviewed medical records of children aged 6–10 in 2012 with residence in Nuuk or Ilulissat (n=332. Data on diseases and health care system contacts were extracted. Diagnoses were validated retrospectively. Primary health care contacts were reviewed for a random sample of 1:6. Results: In 311 children with valid social security number, the total number of health care system contacts was 12,471 equalling 4.6 contacts per child per year. The annual incidence rate of hospital admissions was 1:10 children (total n=266, 1,220 days, 4.6 days/admission, outpatient contacts 2:10 children and primary care 3.6 per child. Contacts were overall more frequent in boys compared with girls, 39.5 versus 34.6 during the study period, p=0.02. The highest annual contact rates for diseases were: hospitalisations/acute respiratory diseases 13.9:1,000; outpatient contacts/otitis media 5.1:1,000; primary care/conjunctivitis or nasopharyngitis 410:1,000 children. Outpatient screening for respiratory tuberculosis accounted 6.2:1,000, primary care non-disease (Z-diagnosis 2,081:1,000 annually. Complete adherence to the child vaccination programme was seen in 40%, while 5% did not receive any vaccinations. Conclusions: In this first study of its kind, the health care contact pattern in Greenlandic children showed a relatively high hospitalisation rate and duration per admission, and a low primary health care contact rate. The overall contact rate and
Mean field theory of epidemic spreading with effective contacts on networks
International Nuclear Information System (INIS)
Wu, Qingchu; Chen, Shufang
2015-01-01
We present a general approach to the analysis of the susceptible-infected-susceptible model with effective contacts on networks, where each susceptible node will be infected with a certain probability only for effective contacts. In the network, each node has a given effective contact number. By using the one-vertex heterogenous mean-field (HMF) approximation and the pair HMF approximation, we obtain conditions for epidemic outbreak on degree-uncorrelated networks. Our results suggest that the epidemic threshold is closely related to the effective contact and its distribution. However, when the effective contact is only dependent of node degree, the epidemic threshold can be established by the degree distribution of networks.
Assigning probability gain for precursors of four large Chinese earthquakes
Energy Technology Data Exchange (ETDEWEB)
Cao, T.; Aki, K.
1983-03-10
We extend the concept of probability gain associated with a precursor (Aki, 1981) to a set of precursors which may be mutually dependent. Making use of a new formula, we derive a criterion for selecting precursors from a given data set in order to calculate the probability gain. The probabilities per unit time immediately before four large Chinese earthquakes are calculated. They are approximately 0.09, 0.09, 0.07 and 0.08 per day for 1975 Haicheng (M = 7.3), 1976 Tangshan (M = 7.8), 1976 Longling (M = 7.6), and Songpan (M = 7.2) earthquakes, respectively. These results are encouraging because they suggest that the investigated precursory phenomena may have included the complete information for earthquake prediction, at least for the above earthquakes. With this method, the step-by-step approach to prediction used in China may be quantified in terms of the probability of earthquake occurrence. The ln P versus t curve (where P is the probability of earthquake occurrence at time t) shows that ln P does not increase with t linearly but more rapidly as the time of earthquake approaches.
Aerosol transmission of foot-and-mouth disease virus Asia-1 under experimental conditions
Colenutt, C.; Gonzales, J.L.; Paton, D.J.; Gloster, J.; Nelson, N.; Sanders, C.
2016-01-01
Foot-and-mouth disease virus (FMDV) control measures rely on understanding of virus transmission mechanisms. Direct contact between naïve and infected animals or spread by contaminated fomites is prevented by quarantines and rigorous decontamination procedures during outbreaks. Transmission of
Gidengil, Courtney A; Gay, Charlene; Huang, Susan S; Platt, Richard; Yokoe, Deborah; Lee, Grace M
2015-01-01
OBJECTIVE To create a national policy model to evaluate the projected cost-effectiveness of multiple hospital-based strategies to prevent methicillin-resistant Staphylococcus aureus (MRSA) transmission and infection. DESIGN Cost-effectiveness analysis using a Markov microsimulation model that simulates the natural history of MRSA acquisition and infection. PATIENTS AND SETTING Hypothetical cohort of 10,000 adult patients admitted to a US intensive care unit. METHODS We compared 7 strategies to standard precautions using a hospital perspective: (1) active surveillance cultures; (2) active surveillance cultures plus selective decolonization; (3) universal contact precautions (UCP); (4) universal chlorhexidine gluconate baths; (5) universal decolonization; (6) UCP + chlorhexidine gluconate baths; and (7) UCP+decolonization. For each strategy, both efficacy and compliance were considered. Outcomes of interest were: (1) MRSA colonization averted; (2) MRSA infection averted; (3) incremental cost per colonization averted; (4) incremental cost per infection averted. RESULTS A total of 1989 cases of colonization and 544 MRSA invasive infections occurred under standard precautions per 10,000 patients. Universal decolonization was the least expensive strategy and was more effective compared with all strategies except UCP+decolonization and UCP+chlorhexidine gluconate. UCP+decolonization was more effective than universal decolonization but would cost $2469 per colonization averted and $9007 per infection averted. If MRSA colonization prevalence decreases from 12% to 5%, active surveillance cultures plus selective decolonization becomes the least expensive strategy. CONCLUSIONS Universal decolonization is cost-saving, preventing 44% of cases of MRSA colonization and 45% of cases of MRSA infection. Our model provides useful guidance for decision makers choosing between multiple available hospital-based strategies to prevent MRSA transmission.
Spur gears: Optimal geometry, methods for generation and Tooth Contact Analysis (TCA) program
Litvin, Faydor L.; Zhang, Jiao
1988-01-01
The contents of this report include the following: (1) development of optimal geometry for crowned spur gears; (2) methods for their generation; and (3) tooth contact analysis (TCA) computer programs for the analysis of meshing and bearing contact on the crowned spur gears. The method developed for synthesis is used for the determination of the optimal geometry for crowned pinion surface and is directed to reduce the sensitivity of the gears to misalignment, localize the bearing contact, and guarantee the favorable shape and low level of the transmission errors. A new method for the generation of the crowned pinion surface has been proposed. This method is based on application of the tool with a surface of revolution that slightly deviates from a regular cone surface. The tool can be used as a grinding wheel or as a shaver. The crowned pinion surface can also be generated by a generating plane whose motion is provided by an automatic grinding machine controlled by a computer. The TCA program simulates the meshing and bearing contact of the misaligned gears. The transmission errors are also determined.
Role of contact bonding on electronic transport in metal-carbon nanotube-metal systems
International Nuclear Information System (INIS)
Deretzis, I; La Magna, A
2006-01-01
We have investigated the effects of the interfacial bond arrangement on the electronic transport features of metal-nanotube-metal systems. The transport properties of finite, defect-free armchair and zigzag single-walled carbon nanotubes attached to Au(111) metallic contacts have been calculated by means of the non-equilibrium Green functional formalism with the tight-binding and the extended Hueckel Hamiltonians. Our calculations show that the electrode material is not the only factor which rules contact transparency. Indeed, for the same electrode, but changing nanotube helicities, we have observed an overall complex behaviour of the transmission spectra due to band mixing and interference. A comparison of the two models shows that the tight-binding approach fails to give a satisfactory representation of the transmission function when a more accurate description of the C-C and Au-C chemical bonds has to be considered. We have furthermore examined the effect of interface geometry variance on conduction and found that the contact-nanotube distance has a significant impact, while the contact-nanotube symmetry plays a marginal, yet evident role
Directory of Open Access Journals (Sweden)
Helmut Kloos
1998-01-01
Full Text Available This paper examines the results of spatial (microgeographical water contact/schistosomiasis studies in two African (Egyptian and Kenyan and one Brazilian communities. All three studies used traditional cartographic and statistical methods but one of them emploeyd also GIS (geographical information systems tools. The advantage of GIS and their potential role in schistosomiasis control are briefly described. The three cases revealed considerable variation in the spatial distribution of water contact, transmission parameters and infection levels at the household and individual levels. All studies showed considerable variation in the prevalence and intensity of infection between households. They also show a variable influence of distance on water contact behavior associated with type of activity, age, sex, socioeconomic level, perception of water quality, season and availability of water in the home. Water contact behavior and schistosomiasis were evaluated in the Brazilian village of Nova União within the context of water sharing between household and age/sex groups. Recommendations are made for further spatial studies on the transmission and control of schistosomiasis.
All optical OFDM transmission for passive optical networks
Kachare, Nitin; Ashik T., J.; Bai, K. Kalyani; Kumar, D. Sriram
2017-06-01
This paper demonstrates the idea of data transmission at a very higher rate (Tbits/s) through optical fibers in a passive optical network using the most efficient data transmission technique widely used in wireless communication that is orthogonal frequency division multiplexing. With an increase in internet users, data traffic has also increased significantly and the current dense wavelength division multiplexing (DWDM) systems may not support the next generation passive optical networks (PONs) requirements. The approach discussed in this paper allows to increase the downstream data rate per user and extend the standard single-mode fiber reach for future long-haul applications. All-optical OFDM is a promising solution for terabit per second capable single wavelength transmission, with high spectral efficiency and high tolerance to chromatic dispersion.
Social barriers to pathogen transmission in wild animal populations
Energy Technology Data Exchange (ETDEWEB)
Loehle, C.
1995-03-01
Diseases and pathogens are receiving increasing recognition as sources of mortality in animal populations. Immune system strength is clearly important in fending off pathogen attack. Physical barriers to pathogen entry are also important. Various individual behaviors are efficacious in reducing contact with diseases and pests. This paper focuses on a fourth mode of defense: social barriers to transmission. Various social behaviors have pathogen transmission consequences. Selective pressures on these social behaviors may therefore exist. Effects on pathogen transmission of mating strategies, social avoidance, group size, group isolation, and other behaviors are explored. It is concluded that many of these behaviors may have been affected by selection pressures to reduce transmission of pathogens. 84 refs., 1 tab.
Toward, Martin G. R.; Griffin, Michael J.
2011-12-01
The transmission of vibration through a seat depends on the impedance of the seat and the apparent mass of the seat occupant. This study was designed to determine how factors affecting the apparent mass of the body (age, gender, physical characteristics, backrest contact, and magnitude of vibration) affect seat transmissibility. The transmission of vertical vibration through a car seat was measured with 80 adults (41 males and 39 females aged 18-65) at frequencies between 0.6 and 20 Hz with two backrest conditions (no backrest and backrest), and with three magnitudes of random vibration (0.5, 1.0, and 1.5 m s -2 rms). Linear regression models were used to study the effects of subject physical characteristics (age, gender, and anthropometry) and features of their apparent mass (resonance frequency, apparent mass at resonance and at 12 Hz) on the measured seat transmissibility. The strongest predictor of both the frequency of the principal resonance in seat transmissibility and the seat transmissibility at resonance was subject age, with other factors having only marginal effects. The transmissibility of the seat at 12 Hz depended on subject age, body mass index, and gender. Although subject weight was strongly associated with apparent mass, weight was not strongly associated with seat transmissibility. The resonance frequency of the seat decreased with increases in the magnitude of the vibration excitation and increased when subjects made contact with the backrest. Inter-subject variability in the resonance frequency and transmissibility at resonance was less with greater vibration excitation, but was largely unaffected by backrest contact. A lumped parameter seat-person model showed that changes in seat transmissibility with age can be predicted from changes in apparent mass with age, and that the dynamic stiffness of the seat appeared to increase with increased loading so as to compensate for increases in subject apparent mass associated with increased sitting
Nonlinear Vibroimpact Characteristics of a Planetary Gear Transmission System
Directory of Open Access Journals (Sweden)
Jianxing Zhou
2016-01-01
Full Text Available In order to research the vibroimpact characteristics of a planetary gear transmission system under high speed and lightly loaded conditions, a new modeling method is proposed. In the modeling process, linear spring was used to simulate gear mesh elasticity under heavy load cases, and Hertz contact theory was used to calculate the contact force of gear pair under light load cases. Then, effects of the working conditions on the system vibroimpact characteristics are analyzed. The results show that, with input speed growing, the mesh force produced obvious fluctuations on the resonance frequencies of the sun gear and carrier torsion vibration, ring gear’s transverse vibration under the heavy load. Under light load condition, the collision vibration occurs in the gear pair; the changing trend of the contact force shows strongly nonlinear characteristics. The time of mesh-apart in gears pair decreases gradually as the load is increased; until it reaches collision vibration threshold value, the gear pair is no longer mesh-apart. With increasing of the input speed, the time of mesh-apart is decreased gradually; the fluctuation amplitude of contact force shows a linearly increasing trend. The study provides useful theoretical guideline for planetary gear transmission low-noise design.
Transmission : roadway to a competitive electricity market
Energy Technology Data Exchange (ETDEWEB)
Thon, S. [AltaLink L.P., AB (Canada)
2002-07-01
Having a variety of suppliers, marketers and retailers is the key to developing a successful electricity market which is more competitive on pricing, with less price volatility, more innovative customer products and higher levels of customer services. Some areas of Alberta are developing their own power markets with limited capacity to interact. These include Pincher Creek, Empress, Calgary, Edmonton, and Fort McMurray. It was noted that increasing transmission capacity is the key to ensuring a bigger and more competitive electricity market. Transmission constraints only encourage a small number of suppliers to control the market. The current cost of transmission capacity accounts for less than 5 per cent of an average residential customer's bill, but it plays a major role in providing more choice to competitive electricity suppliers. Developing more transmission capacity will create an even more competitive market that benefits both consumers and suppliers. Prices in Alberta have been very volatile in the past couple of years because of supply and demand issues, and there is a need to increase market liquidity. Alberta's Transmission Administrator is looking to expand the transmission network to alleviate constraints and to lower the cost of power generation, regardless of location. These expansions are not expected to affect customers' bills by more than 2 to 3 per cent. Such transmission concerns are being felt all over North America. The Federal Energy Regulatory Commission (FERC) in the United States also recognizes the link between transmission and creating a competitive electricity market.
Interference-Robust Transmission in Wireless Sensor Networks.
Han, Jin-Seok; Lee, Yong-Hwan
2016-11-14
Low-power wireless sensor networks (WSNs) operating in unlicensed spectrum bands may seriously suffer from interference from other coexisting radio systems, such as IEEE 802.11 wireless local area networks. In this paper, we consider the improvement of the transmission performance of low-power WSNs by adjusting the transmission rate and the payload size in response to the change of co-channel interference. We estimate the probability of transmission failure and the data throughput and then determine the payload size to maximize the throughput performance. We investigate that the transmission time maximizing the normalized throughput is not much affected by the transmission rate, but rather by the interference condition. We adjust the transmission rate and the transmission time in response to the change of the channel and interference condition, respectively. Finally, we verify the performance of the proposed scheme by computer simulation. The simulation results show that the proposed scheme significantly improves data throughput compared with conventional schemes while preserving energy efficiency even in the presence of interference.
Gerhardts, A; Hammer, T R; Balluff, C; Mucha, H; Hoefer, D
2012-03-01
Gastro-intestinal infections are widespread in the community and have considerable economic consequences. In this study, we followed chains of infection from a public toilet scenario, looking at infection risks by correlating the transmission of bacteria, fungi and viruses to our current knowledge of infectious doses. Transmission of Escherichia coli, Bacillus atrophaeus spores, Candida albicans and bacteriophage MS2 from hands to surfaces was examined in a transmission model, that is toilet brush, door handle to water tap. The load of viable pathogens was significantly reduced during transfer from hands to objects. Nevertheless, it was shown that pathogens were successfully transferred to other people in contagious doses by contact with contaminated surfaces. Our results suggest that infection risks are mainly dependent on current infectious doses of pathogens. For enteritic viruses or bacteria, for example Norovirus or EHEC, only a few particles or cells are sufficient for infection in public lavatories, thus bearing a high risk of infection for other persons. However, there seems to be only a low probability of becoming infected with pathogens that have a high infectious dose whilst sharing the same bathroom. The transmission model for micro-organisms enables a risk assessment of gastro-intestinal infections on the basis of a practical approach. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.
Pneumonic Plague Transmission, Moramanga, Madagascar, 2015.
Ramasindrazana, Beza; Andrianaivoarimanana, Voahangy; Rakotondramanga, Jean Marius; Birdsell, Dawn N; Ratsitorahina, Maherisoa; Rajerison, Minoarisoa
2017-03-01
During a pneumonic plague outbreak in Moramanga, Madagascar, we identified 4 confirmed, 1 presumptive, and 9 suspected plague case-patients. Human-to-human transmission among close contacts was high (reproductive number 1.44) and the case fatality rate was 71%. Phylogenetic analysis showed that the Yersinia pestis isolates belonged to group q3, different from the previous outbreak.
Effect of the one-child policy on influenza transmission in China: a stochastic transmission model.
Directory of Open Access Journals (Sweden)
Fengchen Liu
Full Text Available BACKGROUND: China's one-child-per-couple policy, introduced in 1979, led to profound demographic changes for nearly a quarter of the world's population. Several decades later, the consequences include decreased fertility rates, population aging, decreased household sizes, changes in family structure, and imbalanced sex ratios. The epidemiology of communicable diseases may have been affected by these changes since the transmission dynamics of infectious diseases depend on demographic characteristics of the population. Of particular interest is influenza because China and Southeast Asia lie at the center of a global transmission network of influenza. Moreover, changes in household structure may affect influenza transmission. Is it possible that the pronounced demographic changes that have occurred in China have affected influenza transmission? METHODS AND FINDINGS: To address this question, we developed a continuous-time, stochastic, individual-based simulation model for influenza transmission. With this model, we simulated 30 years of influenza transmission and compared influenza transmission rates in populations with and without the one-child policy control. We found that the average annual attack rate is reduced by 6.08% (SD 2.21% in the presence of the one-child policy compared to a population in which no demographic changes occurred. There was no discernible difference in the secondary attack rate, -0.15% (SD 1.85%, between the populations with and without a one-child policy. We also forecasted influenza transmission over a ten-year time period in a population with a two-child policy under a hypothesis that a two-child-per-couple policy will be carried out in 2015, and found a negligible difference in the average annual attack rate compared to the population with the one-child policy. CONCLUSIONS: This study found that the average annual attack rate is slightly lowered in a population with a one-child policy, which may have resulted from a
Multiple mechanisms of transmission of the Caribbean coral disease white plague
Clemens, E.; Brandt, M. E.
2015-12-01
White plague is one of the most devastating coral diseases in the Caribbean, and yet important aspects of its epidemiology, including how the disease transmits, remain unknown. This study tested potential mechanisms and rates of transmission of white plague in a laboratory setting. Transmission mechanisms including the transport of water, contact with macroalgae, and predation via corallivorous worms and snails were tested on the host species Orbicella annularis. Two of the tested mechanisms were shown to transmit disease: water transport and the corallivorous snail Coralliophila abbreviata. Between these transmission mechanisms, transport of water between a diseased coral and a healthy coral resulted in disease incidence significantly more frequently in exposed healthy corals. Transmission via water transport also occurred more quickly and was associated with higher rates of tissue loss (up to 3.5 cm d-1) than with the corallivorous snail treatment. In addition, water that was in contact with diseased corals but was filtered with a 0.22-μm filter prior to being introduced to apparently healthy corals also resulted in the transmission of disease signs, but at a much lower rate than when water was not filtered. This study has provided important information on the transmission potential of Caribbean white plague disease and highlights the need for a greater understanding of how these processes operate in the natural environment.
Dynamic investigation of a locomotive with effect of gear transmissions under tractive conditions
Chen, Zaigang; Zhai, Wanming; Wang, Kaiyun
2017-11-01
Locomotive is used to drag trailers to move or supply the braking forces to slow the running speed of a train. The electromagnetic torque of the motor is always transmitted by the gear transmission system to the wheelset for generation of the tractive or braking forces at the wheel-rail contact interface. Consequently, gear transmission system is significant for power delivery of a locomotive. This paper develops a comprehensive locomotive-track vertical-longitudinal coupled dynamics model with dynamic effect of gear transmissions. This dynamics model enables considering the coupling interactions between the gear transmission motion, the vertical and the longitudinal motions of the vehicle, and the vertical vibration of the track structure. In this study, some complicated dynamic excitations, such as the gear time-varying mesh stiffness, nonlinear gear tooth backlash, the nonlinear wheel-rail normal contact force and creep force, and the rail vertical geometrical irregularity, are considered. Then, the dynamic responses of the locomotive under the tractive conditions are demonstrated by numerical simulations based on the established dynamics model and by experimental test. The developed dynamics model is validated by the good agreement between the experimental and the theoretical results. The calculated results reveal that the gear transmission system has strong dynamic interactions with the wheel-rail contact interface including both the vertical and the longitudinal motions, and it has negligible effect on the vibrations of the bogie frame and carbody.
On Ni/Au Alloyed Contacts to Mg-Doped GaN
Sarkar, Biplab; Reddy, Pramod; Klump, Andrew; Kaess, Felix; Rounds, Robert; Kirste, Ronny; Mita, Seiji; Kohn, Erhard; Collazo, Ramon; Sitar, Zlatko
2018-01-01
Ni/Au contacts to p-GaN were studied as a function of free hole concentration in GaN using planar transmission line measurement structures. All contacts showed a nonlinear behavior, which became stronger for lower doping concentrations. Electrical and structural analysis indicated that the current conduction between the contact and the p-GaN was through localized nano-sized clusters. Thus, the non-linear contact behavior can be well explained using the alloyed contact model. Two contributions to the contact resistance were identified: the spreading resistance in the semiconductor developed by the current crowding around the electrically active clusters, and diode-type behavior at the interface of the electrically active clusters with the semiconductor. Hence, the equivalent Ni/Au contact model consists of a diode and a resistor in series for each active cluster. The reduced barrier height observed in the measurements is thought to be generated by the extraction of Ga from the crystalline surface and localized formation of the Au:Ga phase. The alloyed contact analyses presented in this work are in good agreement with some of the commonly observed behavior of similar contacts described in the literature.
Realistic-contact-induced enhancement of rectifying in carbon-nanotube/graphene-nanoribbon junctions
International Nuclear Information System (INIS)
Zhang, Xiang-Hua; Li, Xiao-Fei; Wang, Ling-Ling; Xu, Liang; Luo, Kai-Wu
2014-01-01
Carbon-nanotube/graphene-nanoribbon junctions were recently fabricated by the controllable etching of single-walled carbon-nanotubes [Wei et al., Nat. Commun. 4, 1374 (2013)] and their electronic transport properties were studied here. First principles results reveal that the transmission function of the junctions show a heavy dependence on the shape of contacts, but rectifying is an inherent property which is insensitive to the details of contacts. Interestingly, the rectifying ratio is largely enhanced in the junction with a realistic contact and the enhancement is insensitive to the details of contact structures. The stability of rectifying suggests a significant feasibility to manufacture realistic all-carbon rectifiers in nanoelectronics
Safety of Transmission in Railway Applications
Directory of Open Access Journals (Sweden)
Maria Franekova
2003-01-01
Full Text Available The paper deals with the problems of data security in safety - related transmission systems defined within railway process. It is intent on summary of treats and security tools against them within closed and open security systems. In details is analysed possibility of using channel coding techniques and cryptography mechanisms, which are defined according to norms EN 50159. For chosen security mechanisms are deal mathematical apparatus of probability of undetected error determination for channel decoders, relations for determination decipher encoder's complexity and error probability of cryptography code word.
Probability of ternary fission of 93Nb andnat Ag nuclei induced by 0.8-1.8 GeV photons
International Nuclear Information System (INIS)
Lima, D.A. de; Milomen, W.C.C.; Tavares, O.A.P.
1989-01-01
The yields of ternary fission of 93 Nb and nat Ag nuclei induced by bremsstrahlung photons of 0.8, 1.0, 1.4 and 1.8 GeV end-point energies have been measured by using the 2 Π-forward geometry with thick target metal foils in contact with makrofol polycarbonate sheets as fission-track detectors. Absolute mean cross sections per photon in the range 0.8-1.8 GeV have been obtained as 0.3 ± 0.3 μb and 0.5 ± μb, respectively, for 93 Nb and nat Ag nuclei. These correspond to a probability of ternary fission of approx. 10 -5 for both nuclei. Results are discussed and compared with previous ternary fission data obtained for nuclei of A [pt
Naive Probability: Model-based Estimates of Unique Events
2014-05-04
of inference. Argument and Computation, 1–17, iFirst. Khemlani, S., & Johnson-Laird, P.N. (2012b). Theories of the syllogism: A meta -analysis...is the probability that… 1 space tourism will achieve widespread popularity in the next 50 years? advances in material science will lead to the... governments dedicate more resources to contacting extra-terrestrials? 8 the United States adopts an open border policy of universal acceptance? English is
Geometry, mechanics and transmissivity of rock fractures
International Nuclear Information System (INIS)
Lanaro, F.
2001-04-01
This thesis work investigates methods and tools for characterising, testing and modelling the behaviour of rock fractures. Using a 3D-laser-scanning technique, the topography of the surfaces and their position with respect to one another are measured. From the fracture topography, fracture roughness, angularity and aperture are quantified; the major features used for characterisation. The standard deviations for the asperity heights, surface slopes and aperture are determined. These statistical parameters usually increase/decrease according to power laws of the sampling size, and sometimes reach a sill beyond which they become constant. Also the number of contact spots with a certain area decreases according to a power-law function of the area. These power-law relations reveal the self affine fractal nature of roughness and aperture. Roughness is 'persistent' while aperture varies between 'persistent' and 'anti-persistent' probably depending on the degree of match of the fracture walls. The fractal models for roughness, aperture and contact area are used to develop a constitutive model, based on contact mechanics, for describing the fracture normal and shear deformability. The experimental testing results of normal deformability are simulated well by the model whereas fracture shear deformability is not as well modelled. The model predicts well fracture dilation but is too stiff compared to rock samples. A mathematical description of the aperture pattern during shearing is also formulated. The mean value and covariance of the aperture in shearing is calculated and verifies reported observations. The aperture map of samples is inserted in a numerical program for flow calculation. The 'integral transform method' is used for solving the Reynolds' equation; it transforms the fracture transmissivity pattern into a frequency-based function. This closely resembles the power laws that describe fractals. This function can be described directly from the fractal properties of
Age replacement policy based on imperfect repair with random probability
International Nuclear Information System (INIS)
Lim, J.H.; Qu, Jian; Zuo, Ming J.
2016-01-01
In most of literatures of age replacement policy, failures before planned replacement age can be either minimally repaired or perfectly repaired based on the types of failures, cost for repairs and so on. In this paper, we propose age replacement policy based on imperfect repair with random probability. The proposed policy incorporates the case that such intermittent failure can be either minimally repaired or perfectly repaired with random probabilities. The mathematical formulas of the expected cost rate per unit time are derived for both the infinite-horizon case and the one-replacement-cycle case. For each case, we show that the optimal replacement age exists and is finite. - Highlights: • We propose a new age replacement policy with random probability of perfect repair. • We develop the expected cost per unit time. • We discuss the optimal age for replacement minimizing the expected cost rate.
Alternative approaches to transmission investment
Energy Technology Data Exchange (ETDEWEB)
Thon, S. [AltaLink Management Ltd., Calgary, AB (Canada)
2004-07-01
AltaLink is Canada's first stand-alone power transmission company, serving all major centres in Alberta and 85 per cent of Alberta's population. It has more than $1 billion in assets, 11,500 km of transmission lines and 300 substations. It was noted that there has not been any significant investment in power transmission in Alberta for the past 20 years, partly because transmission assets have a very long lifespan. The new role of the power grid is to ensure reliability, safety, efficiency, market effectiveness and supply diversity. The benefits and costs of AltaLink's 500 kV North-South upgrade project were outlined. It was noted that a healthy transmission system is the basis for economic growth throughout the province and for the development of Alberta's resource base. The transmission policy in Alberta endorses that all consumers pay postage stamp tariffs. It also promotes a proactive plan for transmission projects, the time to maximum rate (TMR) in limited cases only, a congestion-free grid under normal conditions, the financial commitment of generators, specific time limits on permitting processes, and regional interconnections to benefit all customers. tabs., figs.
Modes of transmission of influenza B virus in households.
Directory of Open Access Journals (Sweden)
Benjamin J Cowling
Full Text Available While influenza A and B viruses can be transmitted via respiratory droplets, the importance of small droplet nuclei "aerosols" in transmission is controversial.In Hong Kong and Bangkok, in 2008-11, subjects were recruited from outpatient clinics if they had recent onset of acute respiratory illness and none of their household contacts were ill. Following a positive rapid influenza diagnostic test result, subjects were randomly allocated to one of three household-based interventions: hand hygiene, hand hygiene plus face masks, and a control group. Index cases plus their household contacts were followed for 7-10 days to identify secondary infections by reverse transcription polymerase chain reaction (RT-PCR testing of respiratory specimens. Index cases with RT-PCR-confirmed influenza B were included in the present analyses. We used a mathematical model to make inferences on the modes of transmission, facilitated by apparent differences in clinical presentation of secondary infections resulting from aerosol transmission. We estimated that approximately 37% and 26% of influenza B virus transmission was via the aerosol mode in households in Hong Kong and Bangkok, respectively. In the fitted model, influenza B virus infections were associated with a 56%-72% risk of fever plus cough if infected via aerosol route, and a 23%-31% risk of fever plus cough if infected via the other two modes of transmission.Aerosol transmission may be an important mode of spread of influenza B virus. The point estimates of aerosol transmission were slightly lower for influenza B virus compared to previously published estimates for influenza A virus in both Hong Kong and Bangkok. Caution should be taken in interpreting these findings because of the multiple assumptions inherent in the model, including that there is limited biological evidence to date supporting a difference in the clinical features of influenza B virus infection by different modes.
Mead, Daniel G; Howerth, Elizabeth W; Murphy, Molly D; Gray, Elmer W; Noblet, Raymond; Stallknecht, David E
2004-01-01
The transmission routes of Vesicular stomatitis New Jersey virus (VSNJV), a causative agent of vesicular stomatitis, an Office International des Epizooties List-A disease, are not completely understood. Epidemiological and entomological studies conducted during the sporadic epidemics in the western United States have identified potential virus transmission routes involving insect vectors and animal-to-animal contact. In the present study we experimentally tested the previously proposed transmission routes which were primarily based on field observations. Results obtained provide strong evidence for the following: (1) hematophagous insects acquire VSNJV by unconventional routes while blood feeding on livestock, (2) clinical course of VSNJV infection in livestock following transmission by an infected insect is related to insect bite site, (3) infection of livestock via insect bite can result in multiple transmission possibilities, including animal-to-animal contact. Taken together, these data significantly add to our understanding of the transmission routes of a causative agent of one of the oldest known infectious diseases of livestock, for which the details have remained largely unknown despite decades of research.
Models to capture the potential for disease transmission in domestic sheep flocks.
Schley, David; Whittle, Sophie; Taylor, Michael; Kiss, Istvan Zoltan
2012-09-15
Successful control of livestock diseases requires an understanding of how they spread amongst animals and between premises. Mathematical models can offer important insight into the dynamics of disease, especially when built upon experimental and/or field data. Here the dynamics of a range of epidemiological models are explored in order to determine which models perform best in capturing real-world heterogeneities at sufficient resolution. Individual based network models are considered together with one- and two-class compartmental models, for which the final epidemic size is calculated as a function of the probability of disease transmission occurring during a given physical contact between two individuals. For numerical results the special cases of a viral disease with a fast recovery rate (foot-and-mouth disease) and a bacterial disease with a slow recovery rate (brucellosis) amongst sheep are considered. Quantitative results from observational studies of physical contact amongst domestic sheep are applied and results from the differently structured flocks (ewes with newborn lambs, ewes with nearly weaned lambs and ewes only) compared. These indicate that the breeding cycle leads to significant changes in the expected basic reproduction ratio of diseases. The observed heterogeneity of contacts amongst animals is best captured by full network simulations, although simple compartmental models describe the key features of an outbreak but, as expected, often overestimate the speed of an outbreak. Here the weights of contacts are heterogeneous, with many low weight links. However, due to the well-connected nature of the networks, this has little effect and differences between models remain small. These results indicate that simple compartmental models can be a useful tool for modelling real-world flocks; their applicability will be greater still for more homogeneously mixed livestock, which could be promoted by higher intensity farming practices. Copyright © 2012
Strategy evolution driven by switching probabilities in structured multi-agent systems
Zhang, Jianlei; Chen, Zengqiang; Li, Zhiqi
2017-10-01
Evolutionary mechanism driving the commonly seen cooperation among unrelated individuals is puzzling. Related models for evolutionary games on graphs traditionally assume that players imitate their successful neighbours with higher benefits. Notably, an implicit assumption here is that players are always able to acquire the required pay-off information. To relax this restrictive assumption, a contact-based model has been proposed, where switching probabilities between strategies drive the strategy evolution. However, the explicit and quantified relation between a player's switching probability for her strategies and the number of her neighbours remains unknown. This is especially a key point in heterogeneously structured system, where players may differ in the numbers of their neighbours. Focusing on this, here we present an augmented model by introducing an attenuation coefficient and evaluate its influence on the evolution dynamics. Results show that the individual influence on others is negatively correlated with the contact numbers specified by the network topologies. Results further provide the conditions under which the coexisting strategies can be calculated analytically.
Power Transmission by Optical Fibers for Component Inherent Communication
Directory of Open Access Journals (Sweden)
Michael Dumke
2010-02-01
Full Text Available The use of optical fibers for power transmission has been investigated intensely. An optically powered device combined with optical data transfer offers several advantages compared to systems using electrical connections. Optical transmission systems consist of a light source, a transmission medium and a light receiver. The overall system performance depends on the efficiency of opto-electronic converter devices, temperature and illumination dependent losses, attenuation of the transmission medium and coupling between transmitter and fiber. This paper will summarize the state of the art for optically powered systems and will discuss reasons for negative influences on efficiency. Furthermore, an outlook on power transmission by the use of a new technology for creating polymer optical fibers (POF via micro dispensing will be given. This technology is capable to decrease coupling losses by direct contacting of opto-electronic devices.
Schwensen, Jakob F; Menné, Torkil; Johansen, Jeanne D
2014-12-01
The diagnosis of combined allergic and irritant contact dermatitis is an accepted subdiagnosis for hand dermatitis, and it is often considered in a patient with contact dermatitis, a positive and relevant patch test result, and wet work exposure. We therefore hypothesize that it is arbitrary for wet work exposure to be taken into consideration in a patient with newly diagnosed relevant contact allergy. Furthermore, an overestimation of the diagnosis will probably occur if the criteria for wet work exposure are applied correctly, as many occupations have an element of wet work. To find the statistically expected number of combined allergic and irritant contact dermatitis cases in 1000 patients, and to evaluate the diagnostic criteria for the diagnosis. One thousand consecutive patients with occupational contact dermatitis from a hospital unit in Denmark were assessed. The expected number of cases with the diagnosis of combined allergic and irritant contact dermatitis was 0.33%, as compared with the observed number of 6.4%. Females occupied in wet occupations were often diagnosed with combined allergic and irritant contact dermatitis (p contact dermatitis should be used critically to avoid misclassification, and possible criteria for the diagnosis are proposed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Electronic transmission through p-n and n-p-n junctions of graphene
Energy Technology Data Exchange (ETDEWEB)
Setare, M R [Department of Science of Bijar, University of Kurdistan, Bijar (Iran, Islamic Republic of); Jahani, D, E-mail: rezakord@ipm.co, E-mail: Dariush110@gmail.co [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of)
2010-06-23
In this paper, we first evaluate the electronic transmission of Dirac fermions into a p-n junction of gapped graphene and show that the final result depends on the sign of the refractive index, n. We also, by considering the appropriate wavefunctions in the region of the electrostatic potential, show that both transmission and the reflection probability turn out to be positive and less than unity instead of the negative transmission and higher than unity reflection coefficient commonly referred to as the Klein paradox. We then obtain the transmission probability corresponding to a special p-n junction for which there exists a region in which the low energy excitations of graphene acquire a finite mass and, interestingly, find that in this case the transmission is independent of the index of refraction, in contrast with the corresponding result for gapped graphene. We then discuss the validity of the solutions reported in some of the papers cited in this work which, considering the Buettiker formula, turn out to lead to the wrong results for conductivity.
Transmissions in vehicles 2010
Energy Technology Data Exchange (ETDEWEB)
NONE
2010-07-01
method (R.A. Lloyd); (18) Trends of market and technology for agricultural machinery from the view of a vehicle manufacturer (H. Reiter); (19) Shifting comfort improvement on a powershift transmission using objective driveability evaluation (G. Stein); (20) Development trends on construction machinery drive trains (H. Beck); (21) Electrification and hybridisation of powertrains for off-highway machines (M. Mohr); (22) Infinitely variable PTO transmission - Development and test results of an IV-PTO transmission (R. Gugel); (23) Transmission for tractors - requirements, technical solutions and development trends (K. Grad); (24) New hydrostatic-mechanical powersplit CVT-transmission for construction machines (W. Rebholz); (25) AMT today and for the future (M. Hochrein); (26) Efficiency-optimized manual transmission featuring high performance density and excellent shift comfort (J. Patzner); (27) reduction of the gear-rattle noise level of automotive transmissions using innovative gear lubricants (A. Baumann); (28) AWD differential (B.-R. Hoehn); (28) Road-lab-math strategy and implementation in thedevelopment of manual transmission systems (T. Hahne); (29) Fluorescence-based investigations into the contact of wet-disc clutches - Optical investigations into the flat friction contact of multi-disc clutches (N. Weber); (30) The real test drive on the powertrain testbed of maneuver based training (F. Illmeier); (31) Experience of AUTOSAR-compliant development of a power-shift-transmission-control and outlook to future standards including ISO 26262 and EAST-ADL2 - Standards supporting development efficiency (G. Stempfer); (32) The impact of peripheral component on gear development concerning investigation of comfort relevant manoeuvres (A. Albers); (33) Comfort and dynamics of manual gearshifts - definition and experience at the simulator with real-time models for synchronizer and powertrain (U. Schreiber); (34) The eClutch - A new world for manual transmissions (P. Kelly); (35
Boveé, Lian; Whelan, Jane; Sonder, Gerard J. B.; van Dam, Alje P.; van den Hoek, Anneke
2012-01-01
Background: Internationally, guidelines to prevent secondary transmission of Shigella infection vary widely. Cases, their contacts with diarrhoea, and those in certain occupational groups are frequently excluded from work, school, or daycare. In the Netherlands, all contacts attending pre-school
Vector independent transmission of the vector-borne bluetongue virus.
van der Sluijs, Mirjam Tineke Willemijn; de Smit, Abraham J; Moormann, Rob J M
2016-01-01
Bluetongue is an economically important disease of ruminants. The causative agent, Bluetongue virus (BTV), is mainly transmitted by insect vectors. This review focuses on vector-free BTV transmission, and its epizootic and economic consequences. Vector-free transmission can either be vertical, from dam to fetus, or horizontal via direct contract. For several BTV-serotypes, vertical (transplacental) transmission has been described, resulting in severe congenital malformations. Transplacental transmission had been mainly associated with live vaccine strains. Yet, the European BTV-8 strain demonstrated a high incidence of transplacental transmission in natural circumstances. The relevance of transplacental transmission for the epizootiology is considered limited, especially in enzootic areas. However, transplacental transmission can have a substantial economic impact due to the loss of progeny. Inactivated vaccines have demonstrated to prevent transplacental transmission. Vector-free horizontal transmission has also been demonstrated. Since direct horizontal transmission requires close contact of animals, it is considered only relevant for within-farm spreading of BTV. The genetic determinants which enable vector-free transmission are present in virus strains circulating in the field. More research into the genetic changes which enable vector-free transmission is essential to better evaluate the risks associated with outbreaks of new BTV serotypes and to design more appropriate control measures.
High Dk piggyback contact lens system for contact lens-intolerant keratoconus patients.
Sengor, Tomris; Kurna, Sevda Aydin; Aki, Suat; Ozkurt, Yelda
2011-01-01
The aim of the study was to examine the clinical success of high Dk (oxygen permeability) piggyback contact lens (PBCL) systems for the correction of contact lens intolerant keratoconus patients. Sixteen patients (29 eyes) who were not able to wear gas-permeable rigid lenses were included in this study. Hyper Dk silicone hydrogel (oxygen transmissibility or Dk/t = 150 units) and fluorosilicone methacrylate copolymer (Dk/t = 100 units) lenses were chosen as the PBCL systems. The clinical examinations included visual acuity and corneal observation by biomicroscopy, keratometer reading, and fluorescein staining before and after fitting the PBCL system. INDICATIONS FOR USING PBCL SYSTEM WERE: lens stabilization and comfort, improving comfort, and adding protection to the cone. Visual acuities increased significantly in all of the patients compared with spectacles (P = 0). Improvement in visual acuity compared with rigid lenses alone was recorded in 89.7% of eyes and no alteration of the visual acuity was observed in 10.3% of the eyes. Wearing time of PBCL systems for most of the patients was limited time (mean 6 months, range 3-12 months); thereafter they tolerated rigid lenses alone except for 2 patients. The PBCL system is a safe and effective method to provide centering and corneal protection against mechanical trauma by the rigid lenses for keratoconus patients and may increase contact lens tolerance.
Marx, Sebastian; Lauenborg, Bo; Kern, Jami R
2018-02-06
To evaluate the tolerability of and subject and investigator satisfaction with delefilcon A (DAILIES TOTAL1 ® ) daily disposable contact lenses in first-time contact lens wearers. This European multicenter, open-label, single-arm, two-week trial enrolled first-time contact lens wearers and fitted them with delefilcon A contact lenses. Assessments were made at dispensing and at Weeks 1 and 2. Subject-reported outcomes included comfort, quality of vision, convenience, and intent to purchase, which were ranked by agreement responses. Investigator-reported outcomes included slit-lamp biomicroscopy findings and lens fit satisfaction. Ninety-two subjects were included in the per protocol dataset. Mean scores at Weeks 1 and 2 for subject-reported quality of vision and ocular comfort were significantly higher with delefilcon A contact lenses than with the subjects' habitual spectacles during the day, at the end of the day, and overall (all p ≤ 0.02). Ninety-one percent of subjects reported that their study lenses were more comfortable than expected, 98% agreed that they were convenient to use, and 92% were interested in purchasing the lenses (all p disposable contact lenses. Copyright © 2017. Published by Elsevier Ltd.
The Communication System using One Communication Line during a Physical Contact
平田, 隆幸; 大場, 公隆
2009-01-01
The communication system during a physical contact for swarm robots was modified. An algorithm for the contact communication system using one communication line was proposed. Although we don't aim to make the perfect communication system free from a miss in data transmission, the success rate of communication is an important factor for the design of communication system. We tested the performance of of our modified communication system. The success rate of communication was considerably impro...
Directory of Open Access Journals (Sweden)
Mikaël Boullé
2016-11-01
Full Text Available Cell-to-cell spread of HIV, a directed mode of viral transmission, has been observed to be more rapid than cell-free infection. However, a mechanism for earlier onset of viral gene expression in cell-to-cell spread was previously uncharacterized. Here we used time-lapse microscopy combined with automated image analysis to quantify the timing of the onset of HIV gene expression in a fluorescent reporter cell line, as well as single cell staining for infection over time in primary cells. We compared cell-to-cell spread of HIV to cell-free infection, and limited both types of transmission to a two-hour window to minimize differences due to virus transit time to the cell. The mean time to detectable onset of viral gene expression in cell-to-cell spread was accelerated by 19% in the reporter cell line and by 35% in peripheral blood mononuclear cells relative to cell-free HIV infection. Neither factors secreted by infected cells, nor contact with infected cells in the absence of transmission, detectably changed onset. We recapitulated the earlier onset by infecting with multiple cell-free viruses per cell. Surprisingly, the acceleration in onset of viral gene expression was not explained by cooperativity between infecting virions. Instead, more rapid onset was consistent with a model where the fastest expressing virus out of the infecting virus pool sets the time for infection independently of the other co-infecting viruses.
The probability of traffic accidents associated with the transport of radioactive wastes
International Nuclear Information System (INIS)
James, I.A.
1986-01-01
This report evaluates the probability of a container impact during transit between generating and disposal sites. Probabilities per route mile are combined with the characteristics of the transport systems described in previous reports, to allow a comparison of different disposal options to be made. (author)
The significance of oxygen during contact lens wear.
Papas, Eric B
2014-12-01
In order to establish the relevance of oxygen to contemporary contact lens practice, a review of the literature was conducted. The results indicate that there are a number of processes occurring in the normal healthy eye where oxygen is required and which are potentially affected by the presence of a contact lens. These activities appear to take place at all corneal levels, as well as at the limbus. Evidence from laboratory, clinical and modelling studies indicates that what constitutes normal oxygenation (normoxia) depends on, among other things, the physiological system under consideration, corneal location and the state of eye closure. This diversity is reflected in the wide range of minimum lens oxygen transmissibility (Dk/t) requirements that are present in a literature. Copyright © 2014 British Contact Lens Association. Published by Elsevier Ltd. All rights reserved.
Richgels, Katherine L. D.; Russell, Robin E.; Bron, Gebbiena; Rocke, Tonie E.
2016-01-01
Sylvatic plague, caused by the bacterium Yersinia pestis, is periodically responsible for large die-offs in rodent populations that can spillover and cause human mortalities. In the western US, prairie dog populations experience nearly 100% mortality during plague outbreaks, suggesting that multiple transmission pathways combine to amplify plague dynamics. Several alternate pathways in addition to flea vectors have been proposed, such as transmission via direct contact with bodily fluids or inhalation of infectious droplets, consumption of carcasses, and environmental sources of plague bacteria, such as contaminated soil. However, evidence supporting the ability of these proposed alternate pathways to trigger large-scale epizootics remains elusive. Here we present a short review of potential plague transmission pathways and use an ordinary differential equation model to assess the contribution of each pathway to resulting plague dynamics in black-tailed prairie dogs (Cynomys ludovicianus) and their fleas (Oropsylla hirsuta). Using our model, we found little evidence to suggest that soil contamination was capable of producing plague epizootics in prairie dogs. However, in the absence of flea transmission, direct transmission, i.e., contact with bodily fluids or inhalation of infectious droplets, could produce enzootic dynamics, and transmission via contact with or consumption of carcasses could produce epizootics. This suggests that these pathways warrant further investigation.
Kifle, Yimer Wasihun; Goeyvaerts, Nele; Van Kerckhove, Kim; Willem, Lander; Kucharski, Adam; Faes, Christel; Leirs, Herwig; Hens, Niel; Beutels, Philippe
2015-01-01
Many human infectious diseases originate from animals or are transmitted through animal vectors. We aimed to identify factors that are predictive of ownership and touching of animals, assess whether animal ownership influences social contact behavior, and estimate the probability of a major zoonotic outbreak should a transmissible influenza-like pathogen be present in animals, all in the setting of a densely populated European country. A diary-based social contact survey (n = 1768) was conducted in Flanders, Belgium, from September 2010 until February 2011. Many participants touched pets (46%), poultry (2%) or livestock (2%) on a randomly assigned day, and a large proportion of participants owned such animals (51%, 15% and 5%, respectively). Logistic regression models indicated that larger households are more likely to own an animal and, unsurprisingly, that animal owners are more likely to touch animals. We observed a significant effect of age on animal ownership and touching. The total number of social contacts during a randomly assigned day was modeled using weighted-negative binomial regression. Apart from age, household size and day type (weekend versus weekday and regular versus holiday period), animal ownership was positively associated with the total number of social contacts during the weekend. Assuming that animal ownership and/or touching are at-risk events, we demonstrate a method to estimate the outbreak potential of zoonoses. We show that in Belgium animal-human interactions involving young children (0-9 years) and adults (25-54 years) have the highest potential to cause a major zoonotic outbreak.
Public transportation and tuberculosis transmission in a high incidence setting.
Zamudio, Carlos; Krapp, Fiorella; Choi, Howard W; Shah, Lena; Ciampi, Antonio; Gotuzzo, Eduardo; Heymann, Jody; Seas, Carlos; Brewer, Timothy F
2015-01-01
Tuberculosis (TB) transmission may occur with exposure to an infectious contact often in the setting of household environments, but extra-domiciliary transmission also may happen. We evaluated if using buses and/or minibuses as public transportation was associated with acquiring TB in a high incidence urban district in Lima, Peru. Newly diagnosed TB cases with no history of previous treatment and community controls were recruited from August to December 2008 for a case-control study. Crude and adjusted odd ratios (OR) and 95% confidence intervals (CI) were calculated using logistic regression to study the association between bus/minibus use and TB risk. One hundred forty TB cases and 80 controls were included. The overall use of buses/minibuses was 44.9%; 53.3% (72/135) among cases and 30.4% (24/79) among controls [OR: 3.50, (95% CI: 1.60-7.64)]. In the TB group, 25.7% (36/140) of subjects reported having had a recent household TB contact, and 13% (18/139) reported having had a workplace TB contact; corresponding figures for controls were 3.8% (3/80) and 4.1% (3/73), respectively[OR: 8.88 (95% CI: 2.64-29.92), and OR: 3.89 (95% CI: 1.10-13.70)]. In multivariate analyses, age, household income, household contact and using buses/minibuses to commute to work were independently associated with TB [OR for bus/minibus use: 11.8 (95% CI: 1.45-96.07)]. Bus/minibus use to commute to work is associated with TB risk in this high-incidence, urban population in Lima, Peru. Measures should be implemented to prevent TB transmission through this exposure.
Contact mechanics: contact area and interfacial separation from small contact to full contact
International Nuclear Information System (INIS)
Yang, C; Persson, B N J
2008-01-01
We present a molecular dynamics study of the contact between a rigid solid with a randomly rough surface and an elastic block with a flat surface. The numerical calculations mainly focus on the contact area and the interfacial separation from small contact (low load) to full contact (high load). For a small load the contact area varies linearly with the load and the interfacial separation depends logarithmically on the load. For a high load the contact area approaches the nominal contact area (i.e. complete contact), and the interfacial separation approaches zero. The numerical results have been compared with analytical theory and experimental results. They are in good agreement with each other. The present findings may be very important for soft solids, e.g. rubber, or for very smooth surfaces, where complete contact can be reached at moderately high loads without plastic deformation of the solids
Patterns of measles transmission among airplane travelers.
Edelson, Paul J
2012-09-01
With advanced air handling systems on modern aircraft and the high level of measles immunity in many countries, measles infection in air travelers may be considered a low-risk event. However, introduction of measles into countries where transmission has been controlled or eliminated can have substantial consequences both for the use of public health resources and for those still susceptible. In an effort to balance the relatively low likelihood of disease transmission among largely immune travelers and the risk to the public health of the occurrence of secondary cases resulting from importations, criteria in the United States for contact investigations for measles exposures consider contacts to be those passengers who are seated within 2 rows of the index case. However, recent work has shown that cabin air flow may not be as reliable a barrier to the spread of measles virus as previously believed. Along with these new studies, several reports have described measles developing after travel in passengers seated some distance from the index case. To understand better the potential for measles virus to spread on an airplane, reports of apparent secondary cases occurring in co-travelers of passengers with infectious cases of measles were reviewed. Medline™ was searched for articles in all languages from 1946 to week 1 of March 2012, using the search terms "measles [human] or rubeola" and ("aircraft" or "airplane" or "aeroplane" or "aviation" or "travel" or "traveler" or "traveller"); 45 citations were returned. Embase™ was searched from 1988 to week 11 2012, using the same search strategy; 95 citations were returned. Papers were included in this review if they reported secondary cases of measles occurring in persons traveling on an airplane on which a person or persons with measles also flew, and which included the seating location of both the index case(s) and the secondary case(s) on the plane. Nine reports, including 13 index cases and 23 apparent secondary cases
A method for estimating failure rates for low probability events arising in PSA
International Nuclear Information System (INIS)
Thorne, M.C.; Williams, M.M.R.
1995-01-01
The authors develop a method for predicting failure rates and failure probabilities per event when, over a given test period or number of demands, no failures have occurred. A Bayesian approach is adopted to calculate a posterior probability distribution for the failure rate or failure probability per event subsequent to the test period. This posterior is then used to estimate effective failure rates or probabilities over a subsequent period of time or number of demands. In special circumstances, the authors results reduce to the well-known rules of thumb, viz: 1/N and 1/T, where N is the number of demands during the test period for no failures and T is the test period for no failures. However, the authors are able to give strict conditions on the validity of these rules of thumb and to improve on them when necessary
Pereira Oliveira, Graziele; Tavares Silva Fernandes, André; Lopes de Assis, Felipe; Augusto Alves, Pedro; Moreira Franco Luiz, Ana Paula; Barcelos Figueiredo, Leandra; Costa de Almeida, Cláudia Maria; Pires Ferreira Travassos, Carlos Eurico; de Souza Trindade, Giliane; Santos Abrahão, Jônatas; Geessien Kroon, Erna
2014-01-01
Bovine vaccinia (BV) is an emerging zoonosis caused by the Vaccinia virus (VACV), genus Orthopoxvirus (OPV), Poxviridae family. In general, human cases are related to direct contact with sick cattle but there is a lack of information about human-to-human transmission of VACV during BV outbreaks. In this study, we epidemiologically and molecularly show a case of VACV transmission between humans in São Francisco de Itabapoana County, Rio de Janeiro state. Our group collected samples from the patients, a 49-year-old patient and his son. Our results showed that patients had developed anti-OPV IgG or IgM antibodies and presented neutralizing antibodies against OPV. The VACV isolates displayed high identity (99.9%) and were grouped in the same phylogenetic tree branch. Our data indicate that human-to-human VACV transmission occurred during a BV outbreak, raising new questions about the risk factors of the VACV transmission chain. PMID:24615135
Polymer-interaction driven diffusionof eyeshadow in soft contact lenses.
Tavazzi, Silvia; Rossi, Alessandra; Picarazzi, Sara; Ascagni, Miriam; Farris, Stefano; Borghesi, Alessandro
2017-10-01
Soft contact lenses used for the correction of ametropia are often made of hydrogel and silicone-hydrogel materials. Since they are placed directly on the surface of the eye and they are hydrated by tears, eye cosmetics can compromise the lens performance and, even worse, can be transported from an external environment to the ocular surface through the contact lens. The diffusion of the dye component of a purple eyeshadow in soft contact lenses of different materials is here evaluated. Diffusivity is found to be typically higher in silicone-hydrogels than in hydrogels. In hydrogels, diffusivity is greater in the case of lower oxygen transmissibility. Despite differences between materials, absorbed mass of dye is much larger (10-100 times) than the expected mass by simple hydration and swelling of the contact lens. The most contaminated materials are also resistant to cleaning solutions. The results indicate that, notwithstanding the complexity of contact lens networks, diffusion of dye is found to follow Fick's law and it is driven by polymer-dye interaction, which governs lens hydration and swelling. Copyright © 2017 British Contact Lens Association. Published by Elsevier Ltd. All rights reserved.
Transparent back contacts for P3HT:PCBM bulk heterojunction solar cells
International Nuclear Information System (INIS)
Sendova-Vassileva, M; Dikov, H; Popkirov, G; Lazarova, E; Vitanov, P; Gancheva, V; Grancharov, G; Tsocheva, D; Mokreva, P
2014-01-01
A new combination of layers functioning as a transparent contact is proposed and tested in real solar cells. The contacts consist of TiO 2 layers and thin metal layers (Ag, Cu) and are deposited by magnetron sputtering. The optical transmission and electrical conductivity of the transparent contact layers (TCL) are measured. The TCLs are applied as back contacts in bulk heterojunction polymer solar cells deposited on ITO covered glass and consisting of the following layers: ITO/PEDOT:PSS/P3HT:PCBM/back contact. The organic layers are deposited by spin-coating. For comparison, the same bulk heterojunction polymer solar cells are prepared with a sputtered Ag back contact. The first results show a dependence of the current-voltage parameters of the studied solar cells on the thickness of the different component layers of the transparent back contacts. There is a balance that has to be observed between the electrical characteristics of the contacts and their optical transparency. Future plans involve their inclusion as intermediate contacts in tandem organic solar cells.
Wei, Cynthia; Zhu, Meifang; Petroll, W. Matthew; Robertson, Danielle M.
2014-01-01
Purpose. To establish a rabbit model of infectious Pseudomonas aeruginosa keratitis using ultrahigh oxygen transmissible rigid lenses and characterize the frequency and severity of infection when compared to a non–oxygen transmissible lens material. Methods. Rabbits were fit with rigid lenses composed of ultrahigh and non–oxygen transmissible materials. Prior to wear, lenses were inoculated with an invasive corneal isolate of P. aeruginosa stably conjugated to green fluorescent protein (GFP). Corneas were examined before and after lens wear using a modified Heidelberg Rostock Tomograph in vivo confocal microscope. Viable bacteria adherent to unworn and worn lenses were assessed by standard plate counts. The presence of P. aeruginosa-GFP and myeloperoxidase-labeled neutrophils in infected corneal tissue was evaluated using laser scanning confocal microscopy. Results. The frequency and severity of infectious keratitis was significantly greater with inoculated ultrahigh oxygen transmissible lenses. Infection severity was associated with increasing neutrophil infiltration and in severe cases, corneal melting. In vivo confocal microscopic analysis of control corneas following lens wear confirmed that hypoxic lens wear was associated with mechanical surface damage, whereas no ocular surface damage was evident in the high-oxygen lens group. Conclusions. These data indicate that in the absence of adequate tear clearance, the presence of P. aeruginosa trapped under the lens overrides the protective effects of oxygen on surface epithelial cells. These findings also suggest that alternative pathophysiological mechanisms exist whereby changes under the lens in the absence of frank hypoxic damage result in P. aeruginosa infection in the otherwise healthy corneal epithelium. PMID:25125601
Directory of Open Access Journals (Sweden)
Lin Sheng-Chou
2011-01-01
Full Text Available Abstract This article presents the performance analysis of multiple-input/multiple-output (MIMO systems with quadrature amplitude modulation (QAM transmission in the presence of cochannel interference (CCI in nonfading and flat Rayleigh fading environments. The use of optimum transmission (OT and maximum ratio transmission (MRT is considered and compared. In addition to determining precise results for the performance of QAM in the presence of CCI, it is our another aim in this article to examine the validity of the Gaussian interference model in the MRT-based systems. Nyquist pulse shaping and the effects of cross-channel intersymbol interference produced by CCI due to random symbol of the interfering signals are considered in the precise interference model. The error probability for each fading channel is estimated fast and accurately using Gauss quadrature rules which can approximate the probability density function (pdf of the output residual interference. The results of this article indicate that Gaussian interference model may overestimate the effects of interference, particularly, for high-order MRT-based MIMO systems over fading channels. In addition, OT cannot always outperform MRT due to the significant noise enhancement when OT intends to cancel CCI, depending on the combination of the antennas at the transmitter and the receiver, number of interference and the statistical characteristics of the channel.
Optimal Multiuser Zero Forcing with Per-Antenna Power Constraints for Network MIMO Coordination
Directory of Open Access Journals (Sweden)
Kaviani Saeed
2011-01-01
Full Text Available We consider a multicell multiple-input multiple-output (MIMO coordinated downlink transmission, also known as network MIMO, under per-antenna power constraints. We investigate a simple multiuser zero-forcing (ZF linear precoding technique known as block diagonalization (BD for network MIMO. The optimal form of BD with per-antenna power constraints is proposed. It involves a novel approach of optimizing the precoding matrices over the entire null space of other users' transmissions. An iterative gradient descent method is derived by solving the dual of the throughput maximization problem, which finds the optimal precoding matrices globally and efficiently. The comprehensive simulations illustrate several network MIMO coordination advantages when the optimal BD scheme is used. Its achievable throughput is compared with the capacity region obtained through the recently established duality concept under per-antenna power constraints.
Longitudinal assessment of anti-PGL-I serology in contacts of leprosy patients in Bangladesh.
Richardus, Renate A; van der Zwet, Konrad; van Hooij, Anouk; Wilson, Louis; Oskam, Linda; Faber, Roel; van den Eeden, Susan J F; Pahan, David; Alam, Khorshed; Richardus, Jan Hendrik; Geluk, Annemieke
2017-12-01
Despite elimination efforts, the number of Mycobacterium leprae (M. leprae) infected individuals who develop leprosy, is still substantial. Solid evidence exists that individuals living in close proximity to patients are at increased risk to develop leprosy. Early diagnosis of leprosy in endemic areas requires field-friendly tests that identify individuals at risk of developing the disease before clinical manifestation. Such assays will simultaneously contribute to reduction of current diagnostic delay as well as transmission. Antibody (Ab) levels directed against the M.leprae-specific phenolic glycolipid I (PGL-I) represents a surrogate marker for bacterial load. However, it is insufficiently defined whether anti-PGL-I antibodies can be utilized as prognostic biomarkers for disease in contacts. Particularly, in Bangladesh, where paucibacillary (PB) patients form the majority of leprosy cases, anti-PGL-I serology is an inadequate method for leprosy screening in contacts as a directive for prophylactic treatment. Between 2002 and 2009, fingerstick blood from leprosy patients' contacts without clinical signs of disease from a field-trial in Bangladesh was collected on filter paper at three time points covering six years of follow-up per person. Analysis of anti-PGL-I Ab levels for 25 contacts who developed leprosy during follow-up and 199 contacts who were not diagnosed with leprosy, was performed by ELISA after elution of bloodspots from filter paper. Anti-PGL-I Ab levels at intake did not significantly differ between contacts who developed leprosy during the study and those who remained free of disease. Moreover, anti-PGL-I serology was not prognostic in this population as no significant correlation was identified between anti-PGL-I Ab levels at intake and the onset of leprosy. In this highly endemic population in Bangladesh, no association was observed between anti-PGL-I Ab levels and onset of disease, urging the need for an extended, more specific biomarker
Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks
Directory of Open Access Journals (Sweden)
Xiaowei Wang
2017-10-01
Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.
Lack of prion transmission by sexual or parental routes in experimentally infected hamsters.
Morales, Rodrigo; Pritzkow, Sandra; Hu, Ping Ping; Duran-Aniotz, Claudia; Soto, Claudio
2013-01-01
Prion diseases are a group of neurodegenerative disorders affecting humans as well as captive and wild animals. The mechanisms and routes governing the natural spread of prions are not completely understood and several hypotheses have been proposed. In this study, we analyzed the effect of gender in prion incubation period, as well as the possibility of prion transmission by sexual and parental contact using 263K infected hamsters as a model. Our results show that males have significantly longer incubation periods compared with females when exposed to the same quantity of infectious material. Importantly, no evidence of sexual or parental prion transmission was found, even 500 d after sexual contact or birth, respectively. Western blotting and PMCA were unable to detect sub-clinical levels of PrP(Sc) in experimental subjects, suggesting a complete absence of prion transmission by these routes. Our results show that sexual and parental transmission of prions does not occur in this model. It remains to be studied whether this conclusion is valid also for other prion strains and species.
Maximal network reliability for a stochastic power transmission network
International Nuclear Information System (INIS)
Lin, Yi-Kuei; Yeh, Cheng-Ta
2011-01-01
Many studies regarded a power transmission network as a binary-state network and constructed it with several arcs and vertices to evaluate network reliability. In practice, the power transmission network should be stochastic because each arc (transmission line) combined with several physical lines is multistate. Network reliability is the probability that the network can transmit d units of electric power from a power plant (source) to a high voltage substation at a specific area (sink). This study focuses on searching for the optimal transmission line assignment to the power transmission network such that network reliability is maximized. A genetic algorithm based method integrating the minimal paths and the Recursive Sum of Disjoint Products is developed to solve this assignment problem. A real power transmission network is adopted to demonstrate the computational efficiency of the proposed method while comparing with the random solution generation approach.
Smart-phone based computational microscopy using multi-frame contact imaging on a fiber-optic array.
Navruz, Isa; Coskun, Ahmet F; Wong, Justin; Mohammad, Saqib; Tseng, Derek; Nagi, Richie; Phillips, Stephen; Ozcan, Aydogan
2013-10-21
We demonstrate a cellphone based contact microscopy platform, termed Contact Scope, which can image highly dense or connected samples in transmission mode. Weighing approximately 76 grams, this portable and compact microscope is installed on the existing camera unit of a cellphone using an opto-mechanical add-on, where planar samples of interest are placed in contact with the top facet of a tapered fiber-optic array. This glass-based tapered fiber array has ~9 fold higher density of fiber optic cables on its top facet compared to the bottom one and is illuminated by an incoherent light source, e.g., a simple light-emitting-diode (LED). The transmitted light pattern through the object is then sampled by this array of fiber optic cables, delivering a transmission image of the sample onto the other side of the taper, with ~3× magnification in each direction. This magnified image of the object, located at the bottom facet of the fiber array, is then projected onto the CMOS image sensor of the cellphone using two lenses. While keeping the sample and the cellphone camera at a fixed position, the fiber-optic array is then manually rotated with discrete angular increments of e.g., 1-2 degrees. At each angular position of the fiber-optic array, contact images are captured using the cellphone camera, creating a sequence of transmission images for the same sample. These multi-frame images are digitally fused together based on a shift-and-add algorithm through a custom-developed Android application running on the smart-phone, providing the final microscopic image of the sample, visualized through the screen of the phone. This final computation step improves the resolution and also removes spatial artefacts that arise due to non-uniform sampling of the transmission intensity at the fiber optic array surface. We validated the performance of this cellphone based Contact Scope by imaging resolution test charts and blood smears.
Service Time Analysis for Secondary Packet Transmission with Adaptive Modulation
Wang, Wen-Jing; Usman, Muneer; Yang, Hong-Chuan; Alouini, Mohamed-Slim
2017-01-01
Cognitive radio communications can opportunistically access underutilized spectrum for emerging wireless applications. With interweave cognitive implementation, secondary user transmits only if primary user does not occupy the channel and waits for transmission otherwise. Therefore, secondary packet transmission involves both transmission time and waiting time. The resulting extended delivery time (EDT) is critical to the throughput analysis of secondary system. In this paper, we study the EDT of secondary packet transmission with adaptive modulation under interweave implementation to facilitate the delay and throughput analysis of such cognitive radio system. In particular, we propose an analytical framework to derive the probability density functions of EDT considering random-length transmission and waiting slots. We also present selected numerical results to illustrate the mathematical formulations and to verify our analytical approach.
Service Time Analysis for Secondary Packet Transmission with Adaptive Modulation
Wang, Wen-Jing
2017-05-12
Cognitive radio communications can opportunistically access underutilized spectrum for emerging wireless applications. With interweave cognitive implementation, secondary user transmits only if primary user does not occupy the channel and waits for transmission otherwise. Therefore, secondary packet transmission involves both transmission time and waiting time. The resulting extended delivery time (EDT) is critical to the throughput analysis of secondary system. In this paper, we study the EDT of secondary packet transmission with adaptive modulation under interweave implementation to facilitate the delay and throughput analysis of such cognitive radio system. In particular, we propose an analytical framework to derive the probability density functions of EDT considering random-length transmission and waiting slots. We also present selected numerical results to illustrate the mathematical formulations and to verify our analytical approach.
transmission of amoebiasis at some selected areas of kano ...
African Journals Online (AJOL)
DR. AMINU
Amoebiasis is a protozoan infection caused by. Entamoeba histolytica and causes amoebic colitus and ... contacts, the primary mode of transmission is through faecal contamination of drinking water and foods. (Ravdin ... the cysts and subsequently contaminated food. (Cheesbrough, 1998). This study was carried out on.
Multiply gapped density of states in a normal metal in contact with a superconductor
Energy Technology Data Exchange (ETDEWEB)
Reutlinger, Johannes; Belzig, Wolfgang [Department of Physics, University of Konstanz, 78457 Konstanz (Germany); Nazarov, Yuli V. [Kavli Institute of Nanoscience Delft, Delft University of Technology, 2628 CJ Delft (Netherlands); Glazman, Leonid I. [Department of Physics, Yale University, New Haven CT 06511-8499 (United States)
2012-07-01
The spectral properties of a normal metal adjacent to a superconductor are strongly dependent on the characteristic mesoscopic energy scale - the Thouless energy E{sub Th} - and the strength of the connection. In this work, we predict that the local density of states (LDOS), besides the well know minigap {proportional_to}E{sub Th}, can exhibit a multiple gap structure, which strongly depends on the type of the contact. For ballistic contacts we calculate these secondary gaps analytically in the framework of quantum circuit theory of mesoscopic transport. The secondary gaps are absent in the case of tunnel contacts. In the general case the equations are solved numerically for more realistic contacts, like for example diffusive connectors or dirty interfaces, which are characterized by continuous distributions of transmission eigenvalues between 0 and 1. We find that the gap vanishes in these cases, but the density of states is still suppressed around the superconducting gap edge. Distribution functions with a stronger weight at higher transmissions can be modeled through asymmetric ballistic double junctions, which even exhibit multiple gaps. Such spectral signatures are fundamental to disordered nanoscopic conductors and experimentally accessible.
Energy Technology Data Exchange (ETDEWEB)
Vieira, Isabela Sales; Camargo, Ivan Marques de Toledo [Universidade de Brasilia (UnB), DF (Brazil)
2008-07-01
Since the separation between the purchase and sale of electric energy and contracts for access and use of transmission systems, in 1999, when the first Annual Allowed Revenue of the transmission concessionaires was established, to the last Annual Revenue readjustment, in 2007, the revenue of the basic transmission grid more than quadruplicated. The growth of the Allowed Annual Revenue of the main transmission grid has raised questions about the excessive growth of the transmission system. However, despite the significant evolution of the basic transmission grid in the last years, it can be observed that since 2003 the growth curve of the Annual Allowed Revenue moved away from the transmission system growth curve. Between years 2000 and 2007, while the transmission system grew in average 4% per year, the average tax of growth of the Allowed Annual Revenue was superior 20% per year. Two facts contributed for this behavior - the great growth of IGP-M index, mainly between years 2002 and 2003, and the great difference between the Annual Allowed Revenue for the transmission installations existing in 1999 and the Maximum Annual Revenue for the new transmission installations, connected to the transmission grid since then. (author)
Sexual transmission of hepatitis C Transmissão sexual da hepatite C
Directory of Open Access Journals (Sweden)
Norma de Paula Cavalheiro
2007-10-01
Full Text Available It is generally agreed that the hepatitis C virus (HCV can be efficiently transmitted parenterally, although data on viral transmission by sexual or non-sexual intrafamilial contact are conflicting. Since data collection began in 1989, the first study dealt with the risk of sexual transmission among multiple sex partners. Other investigations followed, emphasizing that risk increases in specific groups such as patients co-infected with HIV and HBV, sex workers, homosexuals, illicit drug users and patients attended at sexually transmittable disease clinics. The question arises as to what might be the risk for monogamous heterosexuals in the general population, in which one of the partners has HCV? The literature provides overall rates that vary from zero to 27%; however, most studies affirm that the chances of sexual transmission are low or almost null, with rates for this mode fluctuating from zero to 3%. Intrafamilial transmission is strongly considered but inconclusive, since when mentioning transmission between sex partners within the same household, specific situations also should be considered, such as the sharing of personal hygiene items, like razorblades, toothbrushes, nail clippers and manicure pliers, which are important risk factors in HCV transmission. In this review, we discuss the hypotheses of sexual and/or intrafamilial transmission.A eficiência da transmissão parenteral da hepatite C é consenso, porém dados na literatura sobre transmissão sexual e intrafamiliar são conflitantes. Data de 1989 o primeiro trabalho que relaciona o risco de transmissão sexual a múltiplos parceiros sexuais, na seqüência, outros estudos também reforçam que os riscos aumentam em populações específicas como co-infectados HIV, HBV, profissionais do sexo, homossexuais, usuários de drogas ilícitas e populações de clínicas de doenças sexualmente transmissíveis. Agora, na população geral qual seria o risco para casais monog
Hossain, Mian B
2005-09-01
With a population of over 131 million and a fertility rate of 29.9 per 1000, population growth constitutes a primary threat to continued economic growth and development in Bangladesh. One strategy that has been used to cease further increases in fertility in Bangladesh involves using family planning outreach workers who travel throughout rural and urban areas educating women regarding contraceptive alternatives. This study uses a longitudinal database to assess the impact of family planning outreach workers' contact upon contraceptive switching and upon the risk of an unintended pregnancy. Using longitudinal data on contraceptive use from the Operations Research Project (ORP) of the International Centre for Diarrhoeal Disease Research (ICDDR,B) in Bangladesh, multiple decrement life table analysis and multilevel, discrete-time competing risk hazards models were used to estimate the cumulative probabilities of switching to an alternative form of contraceptive use after a woman engaged in a discussion with an outreach worker. After controlling for the effects of socio-demographic and economic characteristics, the analysis revealed that family planning outreach workers' contact with women significantly decreases the risk of transitioning to the non-use of contraceptives. This contact also reduces the risk of an unintended pregnancy. Family planning workers' contact with women is associated with the increased risk of a woman switching from one modern method to another modern method. The study results indicate that side-effects and other method-related reasons are the two primary reasons for contraceptive discontinuation in rural Bangladesh.
Shot Noise Suppression in a Quantum Point Contact with Short Channel Length
International Nuclear Information System (INIS)
Jeong, Heejun
2015-01-01
An experimental study on the current shot noise of a quantum point contact with short channel length is reported. The experimentally measured maximum energy level spacing between the ground and the first excited state of the device reached up to 7.5 meV, probably due to the hard wall confinement by using shallow electron gas and sharp point contact geometry. The two-dimensional non-equilibrium shot noise contour map shows noise suppression characteristics in a wide range of bias voltage. Fano factor analysis indicates spin-polarized transport through a short quantum point contact. (paper)
Effect of annealing temperature on the contact properties of Ni/V/4H-SiC structure
Directory of Open Access Journals (Sweden)
Chong-Chong Dai
2014-04-01
Full Text Available A sandwich structure of Ni/V/4H-SiC was prepared and annealed at different temperatures from 650 °C to 1050 °C. The electrical properties and microstructures were characterized by transmission line method, X-ray diffraction, Raman spectroscopy and transmission electron microscopy. A low specific contact resistance of 3.3 × 10-5 Ω·cm2 was obtained when the Ni/V contact was annealed at 1050 °C for 2 min. It was found that the silicide changed from Ni3Si to Ni2Si with increasing annealing temperature, while the vanadium compounds appeared at 950 °C and their concentration increased at higher annealing temperature. A schematic diagram was proposed to explain the ohmic contact mechanism of Ni/V/4H-SiC structure.
Probability theory for 3-layer remote sensing in ideal gas law environment.
Ben-David, Avishai; Davidson, Charles E
2013-08-26
We extend the probability model for 3-layer radiative transfer [Opt. Express 20, 10004 (2012)] to ideal gas conditions where a correlation exists between transmission and temperature of each of the 3 layers. The effect on the probability density function for the at-sensor radiances is surprisingly small, and thus the added complexity of addressing the correlation can be avoided. The small overall effect is due to (a) small perturbations by the correlation on variance population parameters and (b) cancellation of perturbation terms that appear with opposite signs in the model moment expressions.
Tabassum, Hina
2014-07-01
This paper presents a novel framework to derive the statistics of the interference considering dedicated and shared spectrum access for uplink transmission in two-tier small cell networks such as the macrocell-femtocell networks. The framework exploits the distance distributions from geometric probability theory to characterize the uplink interference while considering a traditional grid-model set-up for macrocells along with the randomly deployed femtocells. The derived expressions capture the impact of path-loss, composite shadowing and fading, uniform and non-uniform traffic loads, spatial distribution of femtocells, and partial and full spectral reuse among femtocells. Considering dedicated spectrum access, first, we derive the statistics of co-tier interference incurred at both femtocell and macrocell base stations (BSs) from a single interferer by approximating generalized- K composite fading distribution with the tractable Gamma distribution. We then derive the distribution of the number of interferers considering partial spectral reuse and moment generating function (MGF) of the cumulative interference for both partial and full spectral reuse scenarios. Next, we derive the statistics of the cross-tier interference at both femtocell and macrocell BSs considering shared spectrum access. Finally, we utilize the derived expressions to analyze the capacity in both dedicated and shared spectrum access scenarios. The derived expressions are validated by the Monte Carlo simulations. Numerical results are generated to assess the feasibility of shared and dedicated spectrum access in femtocells under varying traffic load and spectral reuse scenarios. © 2014 IEEE.
Directory of Open Access Journals (Sweden)
Wenjun Wang
2016-03-01
Full Text Available Background. Hepatitis B virus (HBV infections are perinatally transmitted from chronically infected mothers. Supplemental antiviral therapy during late pregnancy with lamivudine (LAM, telbivudine (LdT, or tenofovir (TDF can substantially reduce perinatal HBV transmission compared to postnatal immunoprophylaxis (IP alone. However, the cost-effectiveness of these measures is not clear. Aim. This study evaluated the cost-effectiveness from a societal perspective of supplemental antiviral agents for preventing perinatal HBV transmission in mothers with high viral load (>6 log10 copies/mL. Methods. A systematic review and network meta-analysis were performed for the risk of perinatal HBV transmission with antiviral therapies. A decision analysis was conducted to evaluate the clinical and economic outcomes in China of four competing strategies: postnatal IP alone (strategy IP, or in combination with perinatal LAM (strategy LAM + IP, LdT (strategy LdT + IP, or TDF (strategy TDF + IP. Antiviral treatments were administered from week 28 of gestation to 4 weeks after birth. Outcomes included treatment-related costs, number of infections, and quality-adjusted life years (QALYs. One- and two-way sensitivity analyses were performed to identify influential clinical and cost-related variables. Probabilistic sensitivity analyses were used to estimate the probabilities of being cost-effective for each strategy. Results. LdT + IP and TDF + IP averted the most infections and HBV-related deaths, and gained the most QALYs. IP and TDF + IP were dominated as they resulted in less or equal QALYs with higher associated costs. LdT + IP had an incremental $2,891 per QALY gained (95% CI [$932–$20,372] compared to LAM + IP (GDP per capita for China in 2013 was $6,800. One-way sensitivity analyses showed that the cost-effectiveness of LdT + IP was only sensitive to the relative risk of HBV transmission comparing LdT + IP with LAM + IP. Probabilistic sensitivity analyses
Transmission intensity and malaria vector population structure in ...
African Journals Online (AJOL)
The entomological inoculation rate (EIR) was estimated at 0.51 infectious bites per person per year. This EIR was considered to be relatively low, indicating that malaria transmission in this area is low. Variability in mosquito blood meal shows availability of variety of preferred blood meal choices and impact of other factors ...
Transmission of fast molecular ions through thin foils
International Nuclear Information System (INIS)
Pietsch, W.J.; Gemmell, D.S.; Cooney, P.J.; Kanter, E.P.; Kurath, D.; Ratkowski, A.J.; Vager, Z.; Zabransky, B.J.
1979-01-01
New results on the transmission of fast molecular ions through thin foils are presented and a mechanism for the transmission process is proposed. The main feature of the postulated mechanism is that a finite fraction of the incident molecular beam does not undergo a strong Coulomb explosion while traversing the foil. Because the emerging fragments are at large internuclear separations, there is an enhanced probability for the formation of bound, long-range, excited electronic states following electron capture at the rear surface of the target
International Nuclear Information System (INIS)
Hildmann, Christian
2016-01-01
In Germany and in Europe it is due to the ''Energiewende'' necessary to transmit more electrical energy with existing overhead transmission lines. One possible technical solution to reach this aim is the use of high temperature low sag conductors (HTLS-conductors). Compared to the common Aluminium Conductor Steel Reinforced (ACSR), HTLS-conductors have higher rated currents and rated temperatures. Thus the electrical connections for HTLS-conductors are stressed to higher temperatures too. These components are most important for the safe and reliable operation of an overhead transmission line. Besides other connection technologies, hexagonal compression connections with ordinary transmission line conductors have proven themselves since decades. From the literature, mostly empirical studies with electrical tests for compression connections are known. The electrical contact behaviour, i.e. the quality of the electrical contact after assembly, of these connections has been investigated insufficiently. This work presents and enhances an electrical model of compression connections, so that the electrical contact behaviour can be determined more accurate. Based on this, principal considerations on the current distribution in the compression connection and its influence on the connection resistance are presented. As a result from the theoretical and the experimental work, recommendations for the design of hexagonal compression connections for transmission line conductors were developed. Furthermore it is known from the functional principle of compression type connections, that the electrical contact behaviour can be influenced from their form fit, force fit and cold welding. In particular the forces in compression connections have been calculated up to now by approximation. The known analytical calculations simplify the geometry and material behaviour and do not consider the correct mechanical load during assembly. For these reasons the joining process
Minimizing Detection Probability Routing in Ad Hoc Networks Using Directional Antennas
Directory of Open Access Journals (Sweden)
Towsley Don
2009-01-01
Full Text Available In a hostile environment, it is important for a transmitter to make its wireless transmission invisible to adversaries because an adversary can detect the transmitter if the received power at its antennas is strong enough. This paper defines a detection probability model to compute the level of a transmitter being detected by a detection system at arbitrary location around the transmitter. Our study proves that the probability of detecting a directional antenna is much lower than that of detecting an omnidirectional antenna if both the directional and omnidirectional antennas provide the same Effective Isotropic Radiated Power (EIRP in the direction of the receiver. We propose a Minimizing Detection Probability (MinDP routing algorithm to find a secure routing path in ad hoc networks where nodes employ directional antennas to transmit data to decrease the probability of being detected by adversaries. Our study shows that the MinDP routing algorithm can reduce the total detection probability of deliveries from the source to the destination by over 74%.
Survival and compound nucleus probability of super heavy element Z = 117
Energy Technology Data Exchange (ETDEWEB)
Manjunatha, H.C. [Government College for Women, Department of Physics, Kolar, Karnataka (India); Sridhar, K.N. [Government First grade College, Department of Physics, Kolar, Karnataka (India)
2017-05-15
As a part of a systematic study for predicting the most suitable projectile-target combinations for heavy-ion fusion experiments in the synthesis of {sup 289-297}Ts, we have calculated the transmission probability (T{sub l}), compound nucleus formation probabilities (P{sub CN}) and survival probability (P{sub sur}) of possible projectile-target combinations. We have also studied the fusion cross section, survival cross section and fission cross sections for different projectile-target combination of {sup 289-297}Ts. These theoretical parameters are required before the synthesis of the super heavy element. The calculated probabilities and cross sections show that the production of isotopes of the super heavy element with Z = 117 is strongly dependent on the reaction systems. The most probable reactions to synthetize the super heavy nuclei {sup 289-297}Ts are worked out and listed explicitly. We have also studied the variation of P{sub CN} and P{sub sur} with the mass number of projectile and target nuclei. This work is useful in the synthesis of the super heavy element Z = 117. (orig.)
Imaging electron flow from collimating contacts in graphene
Bhandari, S.; Lee, G. H.; Watanabe, K.; Taniguchi, T.; Kim, P.; Westervelt, R. M.
2018-04-01
The ballistic motion of electrons in graphene opens exciting opportunities for electron-optic devices based on collimated electron beams. We form a collimating contact in a hBN-encapsulated graphene hall bar by adding zigzag contacts on either side of an electron emitter that absorb stray electrons; collimation can be turned off by floating the zig-zag contacts. The electron beam is imaged using a liquid-He cooled scanning gate microscope (SGM). The tip deflects electrons as they pass from the collimating contact to a receiving contact on the opposite side of the channel, and an image of electron flow can be made by displaying the change in transmission as the tip is raster scanned across the sample. The angular half width Δθ of the electron beam is found by applying a perpendicular magnetic field B that bends electron paths into cyclotron orbits. The images reveal that the electron flow from the collimating contact drops quickly at B = 0.05 T when the electron orbits miss the receiving contact. The flow for the non-collimating case persists longer, up to B = 0.19 T, due to the broader range of entry angles. Ray-tracing simulations agree well with the experimental images. By fitting the fields B at which the magnitude of electron flow drops in the experimental SGM images, we find Δθ = 9° for electron flow from the collimating contact, compared with Δθ = 54° for the non-collimating case.
Tuberculosis in a South African prison – a transmission modelling ...
African Journals Online (AJOL)
Background. Prisons are recognised internationally as institutions with very high tuberculosis (TB) burdens where transmission is predominantly determined by contact between infectious and susceptible prisoners. A recent South African court case described the conditions under which prisoners awaiting trial were kept.
2011-01-25
... SOCIAL SECURITY ADMINISTRATION [Docket No. SSA-2011-0009] Service Contract Inventory and... providing the Web site address (URL) for the Service Contract Inventory and the corresponding point of... Law 111-117. FOR FURTHER INFORMATION CONTACT: Dennis Wilhite, Director, Office of Budget Execution and...
International Nuclear Information System (INIS)
Kim, Gi-Woo; Kim, Ji-Sik
2014-01-01
This paper presents the result of a preliminary experimental study on the dynamic torsional response analysis of mechanoluminescent (ML) paint for potential development as a new type of non-contacting torque transducer. The torsional torque applied to a transmission shaft is measured by sensing the ML intensity emitting from an ML paint coating a transmission shaft. This study provides the fundamental knowledge for the development of new non-contacting torque sensing technology based on the ML intensity detection. The proposed measurement principle appears to offer potential applications in automotive torque measurement systems, even though the loading rate-dependent characteristics of the ML intensity needs to be examined further. (paper)
Kim, Gi-Woo; Kim, Ji-Sik
2014-01-01
This paper presents the result of a preliminary experimental study on the dynamic torsional response analysis of mechanoluminescent (ML) paint for potential development as a new type of non-contacting torque transducer. The torsional torque applied to a transmission shaft is measured by sensing the ML intensity emitting from an ML paint coating a transmission shaft. This study provides the fundamental knowledge for the development of new non-contacting torque sensing technology based on the ML intensity detection. The proposed measurement principle appears to offer potential applications in automotive torque measurement systems, even though the loading rate-dependent characteristics of the ML intensity needs to be examined further.
Transmission Scheduling and Routing Algorithms for Delay Tolerant Networks
Dudukovich, Rachel; Raible, Daniel E.
2016-01-01
The challenges of data processing, transmission scheduling and routing within a space network present a multi-criteria optimization problem. Long delays, intermittent connectivity, asymmetric data rates and potentially high error rates make traditional networking approaches unsuitable. The delay tolerant networking architecture and protocols attempt to mitigate many of these issues, yet transmission scheduling is largely manually configured and routes are determined by a static contact routing graph. A high level of variability exists among the requirements and environmental characteristics of different missions, some of which may allow for the use of more opportunistic routing methods. In all cases, resource allocation and constraints must be balanced with the optimization of data throughput and quality of service. Much work has been done researching routing techniques for terrestrial-based challenged networks in an attempt to optimize contact opportunities and resource usage. This paper examines several popular methods to determine their potential applicability to space networks.
Olive, Marie-Marie; Chevalier, Véronique; Grosbois, Vladimir; Tran, Annelise; Andriamandimby, Soa-Fy; Durand, Benoit; Ravalohery, Jean-Pierre; Andriamamonjy, Seta; Rakotomanana, Fanjasoa; Rogier, Christophe; Heraud, Jean-Michel
2016-07-01
Rift Valley fever (RVF) is a vector-borne disease affecting ruminants and humans. Madagascar was heavily affected by RVF in 2008-2009, with evidence of a large and heterogeneous spread of the disease. The identification of at-risk environments is essential to optimize the available resources by targeting RVF surveillance in Madagascar. Herein, the objectives of our study were: (i) to identify the environmental factors and areas favorable to RVF transmission to both cattle and human and (ii) to identify human behaviors favoring human infections in Malagasy contexts. First, we characterized the environments of Malagasy communes using a Multiple Factor Analysis (MFA). Then, we analyzed cattle and human serological data collected at national level using Generalized Linear Mixed Models, with the individual serological status (cattle or human) as the response, and MFA factors, as well as other potential risk factors (cattle density, human behavior) as explanatory variables. Cattle and human seroprevalence rates were positively associated to humid environments (p<0.001). Areas with high cattle density were at risk (p<0.01; OR = 2.6). Furthermore, our analysis showed that frequent contact with raw milk contributed to explain human infection (OR = 1.6). Finally, our study highlighted the eastern-coast, western and north-western parts as high-risk areas for RVF transmission in cattle. Our integrated approach analyzing environmental, cattle and human datasets allow us to bring new insight on RVF transmission patterns in Madagascar. The association between cattle seroprevalence, humid environments and high cattle density suggests that concomitant vectorial and direct transmissions are critical to maintain RVF enzootic transmission. Additionally, in the at-risk humid environment of the western, north-western and the eastern-coast areas, suitable to Culex and Anopheles mosquitoes, vectorial transmission probably occurs in both cattle and human. The relative contribution of
Directory of Open Access Journals (Sweden)
Marie-Marie Olive
2016-07-01
Full Text Available Rift Valley fever (RVF is a vector-borne disease affecting ruminants and humans. Madagascar was heavily affected by RVF in 2008-2009, with evidence of a large and heterogeneous spread of the disease. The identification of at-risk environments is essential to optimize the available resources by targeting RVF surveillance in Madagascar. Herein, the objectives of our study were: (i to identify the environmental factors and areas favorable to RVF transmission to both cattle and human and (ii to identify human behaviors favoring human infections in Malagasy contexts.First, we characterized the environments of Malagasy communes using a Multiple Factor Analysis (MFA. Then, we analyzed cattle and human serological data collected at national level using Generalized Linear Mixed Models, with the individual serological status (cattle or human as the response, and MFA factors, as well as other potential risk factors (cattle density, human behavior as explanatory variables. Cattle and human seroprevalence rates were positively associated to humid environments (p<0.001. Areas with high cattle density were at risk (p<0.01; OR = 2.6. Furthermore, our analysis showed that frequent contact with raw milk contributed to explain human infection (OR = 1.6. Finally, our study highlighted the eastern-coast, western and north-western parts as high-risk areas for RVF transmission in cattle.Our integrated approach analyzing environmental, cattle and human datasets allow us to bring new insight on RVF transmission patterns in Madagascar. The association between cattle seroprevalence, humid environments and high cattle density suggests that concomitant vectorial and direct transmissions are critical to maintain RVF enzootic transmission. Additionally, in the at-risk humid environment of the western, north-western and the eastern-coast areas, suitable to Culex and Anopheles mosquitoes, vectorial transmission probably occurs in both cattle and human. The relative contribution
Generalized Probability-Probability Plots
Mushkudiani, N.A.; Einmahl, J.H.J.
2004-01-01
We introduce generalized Probability-Probability (P-P) plots in order to study the one-sample goodness-of-fit problem and the two-sample problem, for real valued data.These plots, that are constructed by indexing with the class of closed intervals, globally preserve the properties of classical P-P
Optimal design of the gerotor (2-ellipses) for reducing maximum contact stress
Energy Technology Data Exchange (ETDEWEB)
Kwak, Hyo Seo; Li, Sheng Huan [Dept. of Mechanical Convergence Technology, Pusan National University, Busan (Korea, Republic of); Kim, Chul [School of Mechanical Design and Manufacturing, Busan Institute of Science and Technology, Busan (Korea, Republic of)
2016-12-15
The oil pump, which is used as lubricator of engines and auto transmission, supplies working oil to the rotating elements to prevent wear. The gerotor pump is used widely in the automobile industry. When wear occurs due to contact between an inner rotor and an outer rotor, the efficiency of the gerotor pump decreases rapidly, and elastic deformation from the contacts also causes vibration and noise. This paper reports the optimal design of a gerotor with a 2-ellipses combined lobe shape that reduces the maximum contact stress. An automatic program was developed to calculate Hertzian contact stress of the gerotor using the Matlab and the effect of the design parameter on the maximum contact stress was analyzed. In addition, the method of theoretical analysis for obtaining the contact stress was verified by performing the fluid-structural coupled analysis using the commercial software, Ansys, considering both the driving force of the inner rotor and the fluid pressure, which is generated by working oil.
Quantum Probabilities as Behavioral Probabilities
Directory of Open Access Journals (Sweden)
Vyacheslav I. Yukalov
2017-03-01
Full Text Available We demonstrate that behavioral probabilities of human decision makers share many common features with quantum probabilities. This does not imply that humans are some quantum objects, but just shows that the mathematics of quantum theory is applicable to the description of human decision making. The applicability of quantum rules for describing decision making is connected with the nontrivial process of making decisions in the case of composite prospects under uncertainty. Such a process involves deliberations of a decision maker when making a choice. In addition to the evaluation of the utilities of considered prospects, real decision makers also appreciate their respective attractiveness. Therefore, human choice is not based solely on the utility of prospects, but includes the necessity of resolving the utility-attraction duality. In order to justify that human consciousness really functions similarly to the rules of quantum theory, we develop an approach defining human behavioral probabilities as the probabilities determined by quantum rules. We show that quantum behavioral probabilities of humans do not merely explain qualitatively how human decisions are made, but they predict quantitative values of the behavioral probabilities. Analyzing a large set of empirical data, we find good quantitative agreement between theoretical predictions and observed experimental data.
On repeated corneal applanation with the Goldmann and two non-contact tonometers.
Almubrad, Turki M; Ogbuehi, Kelechi C
2010-03-01
Several authors believe it is necessary to randomise the order in which contact and non-contact tonometers are used in comparison studies. This study was carried out to investigate the effect of repeated applanation on the measured intraocular pressure. One set of measurements per session was made on each of three sessions (one session per day) with the Goldmann and two non-contact tonometers (Topcon CT80 and Keeler Pulsair EasyEye), in a pre-determined order, on one randomly selected eye of 120 subjects randomised to one of two groups. For session one, only the non-contact tonometers were used to assess the intraocular pressure of both groups. For session two, either non-contact or Goldmann tonometry was performed first and this order was reversed for session 3. Average intraocular pressures were compared between sessions to determine the presence or absence of effects on the intraocular pressure caused by prior repeated applanation with the Goldmann or either one (or both) of the non-contact tonometers. Prior applanation with a non-contact tonometer did not cause a significant (p > 0.05) reduction of the mean pressure measured with either non-contact tonometer. The mean pressure was slightly but significantly (p contact tonometers in both subject groups) when non-contact tonometry was performed after Goldmann tonometry. There was no significant difference (p > 0.05) between the pressures measured with the Goldmann tonometer prior to and subsequent to non-contact tonometry, in both subject groups. A small but statistically significant reduction in the intraocular pressure was found following applanation with the Goldmann tonometer but not with either one of two non-contact tonometers.
Probability Aggregates in Probability Answer Set Programming
Saad, Emad
2013-01-01
Probability answer set programming is a declarative programming that has been shown effective for representing and reasoning about a variety of probability reasoning tasks. However, the lack of probability aggregates, e.g. {\\em expected values}, in the language of disjunctive hybrid probability logic programs (DHPP) disallows the natural and concise representation of many interesting problems. In this paper, we extend DHPP to allow arbitrary probability aggregates. We introduce two types of p...
Cluster of Nipah virus infection, Kushtia District, Bangladesh, 2007.
Directory of Open Access Journals (Sweden)
Nusrat Homaira
Full Text Available OBJECTIVE: In March 2007, we investigated a cluster of Nipah encephalitis to identify risk factors for Nipah infection in Bangladesh. METHODS: We defined confirmed Nipah cases by the presence of IgM and IgG antibodies against Nipah virus in serum. Case-patients, who resided in the same village during the outbreak period but died before serum could be collected, were classified as probable cases. RESULTS: We identified three confirmed and five probable Nipah cases. There was a single index case. Five of the secondary cases came in close physical contact to the index case when she was ill. Case-patients were more likely to have physical contact with the index case (71% cases versus 0% controls, p = <0.001. The index case, on her third day of illness, and all the subsequent cases attended the same religious gathering. For three probable cases including the index case, we could not identify any known risk factors for Nipah infection such as physical contact with Nipah case-patients, consumption of raw date palm juice, or contact with sick animals or fruit bats. CONCLUSION: Though person-to-person transmission remains an important mode of transmission for Nipah infection, we could not confirm the source of infection for three of the probable Nipah case-patients. Continued surveillance and outbreak investigations will help better understand the transmission of Nipah virus and develop preventive strategies.
Schottky contacts to polar and nonpolar n-type GaN
Energy Technology Data Exchange (ETDEWEB)
Kim, Hogyoung [Hanbat National University, Daejeon (Korea, Republic of); Phark, Soohyon [Max-Planck-Institut fur Mikrostrukturphysik, Halle (Germany); Song, Keunman [Korea Advanced Nano Fab Center, Suwon (Korea, Republic of); Kim, Dongwook [Ewha Woman' s University, Seoul (Korea, Republic of)
2012-01-15
Using the current-voltage measurements, we observed the barrier heights of c-plane GaN in Pt and Au Schottky contacts to be higher than those of a-plane GaN. However, the barrier height of c-plane GaN was lower than that of a-plane GaN in the Ti Schottky contacts. The N/Ga ratio calculated by integrating the X-ray photoelectron spectroscopy (XPS) spectra of Ga 3d and N 1s core levels showed that c-plane GaN induced more Ga vacancies near the interface than a-plane GaN in the Ti Schottky contacts, reducing the effective barrier height through an enhancement of the tunneling probability.
Probability for human intake of an atom randomly released into ground, rivers, oceans and air
Energy Technology Data Exchange (ETDEWEB)
Cohen, B L
1984-08-01
Numerical estimates are developed for the probability of an atom randomly released in the top ground layers, in a river, or in the oceans to be ingested orally by a human, and for an atom emitted from an industrial source to be inhaled by a human. Estimates are obtained for both probability per year and for total eventual probability. Results vary considerably for different elements, but typical values for total probabilities are: ground, 3 X 10/sup -3/, oceans, 3 X 10/sup -4/; rivers, 1.7 x 10/sup -4/; and air, 5 X 10/sup -6/. Probabilities per year are typcially 1 X 10/sup -7/ for releases into the ground and 5 X 10/sup -8/ for releases into the oceans. These results indicate that for material with very long-lasting toxicity, it is important to include the pathways from the ground and from the oceans.
Silver antimony Ohmic contacts to moderately doped n-type germanium
Energy Technology Data Exchange (ETDEWEB)
Dumas, D. C. S.; Gallacher, K.; Millar, R.; Paul, D. J., E-mail: Douglas.Paul@glasgow.ac.uk [School of Engineering, University of Glasgow, Rankine Building, Oakfield Avenue, Glasgow G12 8LT (United Kingdom); MacLaren, I. [SUPA School of Physics and Astronomy, University of Glasgow, Kelvin Building, University Avenue, Glasgow G12 8QQ (United Kingdom); Myronov, M.; Leadley, D. R. [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)
2014-04-21
A self doping contact consisting of a silver/antimony alloy that produces an Ohmic contact to moderately doped n-type germanium (doped to a factor of four above the metal-insulator transition) has been investigated. An evaporation of a mixed alloy of Ag/Sb (99%/1%) onto n-Ge (N{sub D}=1×10{sup 18} cm{sup −3}) annealed at 400 °C produces an Ohmic contact with a measured specific contact resistivity of (1.1±0.2)×10{sup −5} Ω-cm{sup 2}. It is proposed that the Ohmic behaviour arises from an increased doping concentration at the Ge surface due to the preferential evaporation of Sb confirmed by transmission electron microscope analysis. It is suggested that the doping concentration has increased to a level where field emission will be the dominate conduction mechanism. This was deduced from the low temperature electrical characterisation of the contact, which exhibits Ohmic behaviour down to a temperature of 6.5 K.
Correlates of HCV seropositivity among familial contacts of HCV positive patients
Directory of Open Access Journals (Sweden)
Matera Antonio
2006-09-01
Full Text Available Abstract Background Determinants of intrafamilial HCV transmission are still being debated. The aim of this study is to investigate the correlates of HCV seropositivity among familial contacts of HCV positive patients in Italy. Methods A cross-sectional study was conducted with 175 HCV positive patients (index cases, recruited from Policlinico Gemelli in Rome as well as other hospitals in Central Italy between 1995 and 2000 (40% female, mean age 57 ± 15.2 years, and 259 familial contacts. Differences in proportions of qualitative variables were tested with non-parametric tests (χ2, Yates correction, Fisher exact test, and a p value Results Seropositivity for HCV was found in 8.9% of the contacts. From the univariate analysis, risk factors significantly associated to HCV positivity in the contacts were: intravenous drug addiction (p = 0.004 and intercourse with drug addicts (p = 0.005. The only variables associated significantly and independently to HCV seropositivity in patients' contacts were intercourse with drug addicts (OR = 19.28; 95% CI: 2.01 – 184.94, the retirement status from work (OR = 3.76; 95% CI: 1.17 – 11.98, the time of the relationship (OR = 1.06; 95% CI: 1.00 – 1.11 and tattoos (OR = 7.68; 95% CI: 1.00 – 60.20. Conclusion The present study confirms that having intercourse with a drug addict is the most significant risk factor for intrafamilial HCV transmission. The association with retirement status from work could be related to both a long-term relationship with an index case and past exposure to common risk factors.
Enfermedad de creutzfeldt-jakob en el Perú: reporte de once casos
Directory of Open Access Journals (Sweden)
Luis Torres-Ramírez
Full Text Available La enfermedad de Creutzfeldt-Jakob (ECJ es una enfermedad neurológica fatal producida por la isoforma patológica de la proteína priónica humana. Se reporta las características clínicas de seis casos de la forma esporádica de ECJ con diagnóstico definitivo por histopatología, y cinco casos con diagnóstico probable, en pacientes atendidos en el Instituto Nacional de Ciencias Neurológicas del Perú. La edad de inicio en los casos definitivos fue de 55,8 años y, en los probables, de 59,6 años, con predominio del sexo masculino. El tiempo de enfermedad fue de 8,8 meses. Se encontró un EEG típico en 50% de los casos definitivos y 80% de los probables. La proteína 14-3-3 en líquido cefalorraquídeo fue positiva en un caso probable y los hallazgos típicos en resonancia magnética se observaron en dos casos probables. Todos los casos cursaron con una evolución clínica típica de la enfermedad, y se considera el primer reporte de ECJ en el Perú
Directory of Open Access Journals (Sweden)
T. Déirdre Hollingsworth
2015-03-01
Full Text Available Many of the challenges which face modellers of directly transmitted pathogens also arise when modelling the epidemiology of pathogens with indirect transmission – whether through environmental stages, vectors, intermediate hosts or multiple hosts. In particular, understanding the roles of different hosts, how to measure contact and infection patterns, heterogeneities in contact rates, and the dynamics close to elimination are all relevant challenges, regardless of the mode of transmission. However, there remain a number of challenges that are specific and unique to modelling vector-borne diseases and macroparasites. Moreover, many of the neglected tropical diseases which are currently targeted for control and elimination are vector-borne, macroparasitic, or both, and so this article includes challenges which will assist in accelerating the control of these high-burden diseases. Here, we discuss the challenges of indirect measures of infection in humans, whether through vectors or transmission life stages and in estimating the contribution of different host groups to transmission. We also discuss the issues of “evolution-proof” interventions against vector-borne disease.
Hollingsworth, T Déirdre; Pulliam, Juliet R C; Funk, Sebastian; Truscott, James E; Isham, Valerie; Lloyd, Alun L
2015-03-01
Many of the challenges which face modellers of directly transmitted pathogens also arise when modelling the epidemiology of pathogens with indirect transmission--whether through environmental stages, vectors, intermediate hosts or multiple hosts. In particular, understanding the roles of different hosts, how to measure contact and infection patterns, heterogeneities in contact rates, and the dynamics close to elimination are all relevant challenges, regardless of the mode of transmission. However, there remain a number of challenges that are specific and unique to modelling vector-borne diseases and macroparasites. Moreover, many of the neglected tropical diseases which are currently targeted for control and elimination are vector-borne, macroparasitic, or both, and so this article includes challenges which will assist in accelerating the control of these high-burden diseases. Here, we discuss the challenges of indirect measures of infection in humans, whether through vectors or transmission life stages and in estimating the contribution of different host groups to transmission. We also discuss the issues of "evolution-proof" interventions against vector-borne disease. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Outage probability of dual-hop FSO fixed gain relay transmission systems
Zedini, Emna
2016-12-24
In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems in the presence of atmospheric turbulence as well as pointing errors. More specifically, an exact closed-form expression for the outage probability is presented in terms of the bivariate Fox\\'s H function that accounts for both heterodyne detection as well as intensity modulation with direct detection. At high signal-to-noise ratio (SNR) regime, we provide very tight asymptotic result for this performance metric in terms of simple elementary functions. By using dual-hop FSO relaying, we demonstrate a better system performance as compared to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.
Risk of tuberculosis transmission among healthcare workers.
Diel, Roland; Niemann, Stefan; Nienhaus, Albert
2018-04-01
Data from a prospective molecular-epidemiological study (1997-2015) of patients with culture-confirmed tuberculosis in Hamburg, Germany, were evaluated to assess the occupational risk of Mycobacterium tuberculosis complex transmission in a low-incidence setting. Isolates of M. tuberculosis complex were genotyped using IS6110 restriction fragment length polymorphism analysis. Results of structured questionnaires, geographical mapping and additional patient interviews were used for confirming epidemiological links. Out of the 2393 cases, 918 (38.4%) were classified into 224 clusters comprising 2-70 patients per cluster. Among the 918 cluster members, epidemiological links could be confirmed in 340 (37.0%) patients. In total, 55 (2.3%) patients were healthcare workers; 26 healthcare workers remained unclustered, but 29 healthcare workers belonged to cluster groups. Conventional contact tracing performed before genotyping to identify sources of the reported index cases detected only 73 (3.1%) patients. Logistic regression analysis confirmed work in the healthcare sector as strongest predictor for clustering of patients with verified epidemiological links (odds ratio (OR) 3.1, 95% CI 1.6-5.9), followed by alcoholism (OR 2.3, 95% CI 1.7-3.2) and sputum smear positivity (OR 1.8, 95% CI 1.4-2.3). Immigrants were more likely to be cluster nonmembers (OR 0.3, 95% CI 0.3-0.5). Recent transmission in Hamburg within the 19-year study period was found to be strongly associated with working in a healthcare facility. Although clusters also include many "imported" strains from abroad or regional highly prevalent M. tuberculosis strains with no evident epidemiological connection, routine molecular-epidemiological survey is indispensable to optimising and controlling the effectiveness of TB control strategies in German healthcare settings.
Modern contact investigation methods for enhancing tuberculosis control in Aboriginal communities
Directory of Open Access Journals (Sweden)
Victoria J. Cook
2012-05-01
Full Text Available The Aboriginal communities in Canada are challenged by a disproportionate burden of TB infection and disease. Contact investigation (CI guidelines exist but these strategies do not take into account the unique social structure of different populations. Because of the limitations of traditional CI, new approaches are under investigation and include the use of social network analysis, geographic information systems and genomics, in addition to the widespread use of genotyping to better understand TB transmission. Guidelines for the routine use of network methods and other novel methodologies for TB CI and outbreak investigation do not exist despite the gathering evidence that these approaches can positively impact TB control efforts, even in Aboriginal communities. The feasibility and efficacy of these novel approaches to CI in Aboriginal communities requires further investigation. The successful integration of these novel methodologies will require community involvement, capacity building and ongoing support at every level. The outcome will not only be the systematic collection, analysis, and interpretation of CI data in high-burden communities to assess transmission but the prioritization of contacts who are candidates for treatment of LTBI which will break the cycle of transmission. Ultimately, the measure of success will be a clear and sustained decline in TB incidence in Aboriginal communities.
Enns, Eva Andrea; Kao, Szu-Yu; Kozhimannil, Katy Backes; Kahn, Judith; Farris, Jill; Kulasingam, Shalini L
2017-10-01
Mathematical models are important tools for assessing prevention and management strategies for sexually transmitted infections. These models are usually developed for a single infection and require calibration to observed epidemiological trends in the infection of interest. Incorporating other outcomes of sexual behavior into the model, such as pregnancy, may better inform the calibration process. We developed a mathematical model of chlamydia transmission and pregnancy in Minnesota adolescents aged 15 to 19 years. We calibrated the model to statewide rates of reported chlamydia cases alone (chlamydia calibration) and in combination with pregnancy rates (dual calibration). We evaluated the impact of calibrating to different outcomes of sexual behavior on estimated input parameter values, predicted epidemiological outcomes, and predicted impact of chlamydia prevention interventions. The two calibration scenarios produced different estimates of the probability of condom use, the probability of chlamydia transmission per sex act, the proportion of asymptomatic infections, and the screening rate among men. These differences resulted in the dual calibration scenario predicting lower prevalence and incidence of chlamydia compared with calibrating to chlamydia cases alone. When evaluating the impact of a 10% increase in condom use, the dual calibration scenario predicted fewer infections averted over 5 years compared with chlamydia calibration alone [111 (6.8%) vs 158 (8.5%)]. While pregnancy and chlamydia in adolescents are often considered separately, both are outcomes of unprotected sexual activity. Incorporating both as calibration targets in a model of chlamydia transmission resulted in different parameter estimates, potentially impacting the intervention effectiveness predicted by the model.
Defining the sizes of airborne particles that mediate influenza transmission in ferrets.
Zhou, Jie; Wei, Jianjian; Choy, Ka-Tim; Sia, Sin Fun; Rowlands, Dewi K; Yu, Dan; Wu, Chung-Yi; Lindsley, William G; Cowling, Benjamin J; McDevitt, James; Peiris, Malik; Li, Yuguo; Yen, Hui-Ling
2018-03-06
Epidemics and pandemics of influenza are characterized by rapid global spread mediated by non-mutually exclusive transmission modes. The relative significance between contact, droplet, and airborne transmission is yet to be defined, a knowledge gap for implementing evidence-based infection control measures. We devised a transmission chamber that separates virus-laden particles by size and determined the particle sizes mediating transmission of influenza among ferrets through the air. Ferret-to-ferret transmission was mediated by airborne particles larger than 1.5 µm, consistent with the quantity and size of virus-laden particles released by the donors. Onward transmission by donors was most efficient before fever onset and may continue for 5 days after inoculation. Multiple virus gene segments enhanced the transmissibility of a swine influenza virus among ferrets by increasing the release of virus-laden particles into the air. We provide direct experimental evidence of influenza transmission via droplets and fine droplet nuclei, albeit at different efficiency. Copyright © 2018 the Author(s). Published by PNAS.
Transmission cost allocation based on power flow tracing considering reliability benefit
International Nuclear Information System (INIS)
Leepreechanon, N.; Singharerg, S.; Padungwech, W.; Nakawiro, W.; Eua-Arporn, B.; David, A.K.
2007-01-01
Power transmission networks must be able to accommodate the continuously growing demand for reliable and economical electricity. This paper presented a method to allocate transmission use and reliability cost to both generators and end-consumers. Although transmission cost allocation methods change depending on the local context of the electric power industry, there is a common principle that transmission line capacity should be properly allocated to accommodate actual power delivery with an adequate reliability margin. The method proposed in this paper allocates transmission embedded cost to both generators and loads in an equitable manner, incorporating probability indices to allocate transmission reliability margin among users in both supply and demand sides. The application of the proposed method was illustrated using Bialek's tracing method on a multiple-circuit, six-bus transmission system. Probabilistic indices known as the transmission internal reliability margin (TIRM) and transmission external reliability margin (TERM) decomposed from the transmission reliability margin (TRM) were introduced, making true cost of using overall transmission facilities. 6 refs., 11 tabs., 5 figs
Esbjörnsson, Joakim; Mild, Mattias; Audelin, Anne; Fonager, Jannik; Skar, Helena; Bruun Jørgensen, Louise; Liitsola, Kirsi; Björkman, Per; Bratt, Göran; Gisslén, Magnus; Sönnerborg, Anders; Nielsen, Claus; Medstrand, Patrik; Albert, Jan
2016-01-01
Increased knowledge about HIV-1 transmission dynamics in different transmission groups and geographical regions is fundamental for assessing and designing prevention efforts against HIV-1 spread. Since the first reported cases of HIV infection during the early 1980s, the HIV-1 epidemic in the Nordic countries has been dominated by HIV-1 subtype B and MSM transmission. HIV-1 pol sequences and clinical data of 51 per cent of all newly diagnosed HIV-1 infections in Sweden, Denmark, and Finland in the period 2000–2012 (N = 3,802) were analysed together with a large reference sequence dataset (N = 4,537) by trend analysis and phylogenetics. Analysis of the eight dominating subtypes and CRFs in the Nordic countries (A, B, C, D, G, CRF01_AE, CRF02_AG, and CRF06_cpx) showed that the subtype B proportion decreased while the CRF proportion increased over the study period. A majority (57 per cent) of the Nordic sequences formed transmission clusters, with evidence of mixing both geographically and between transmission groups. Detailed analyses showed multiple occasions of transmissions from MSM to heterosexuals and that active transmission clusters more often involved single than multiple Nordic countries. The strongest geographical link was between Denmark and Sweden. Finally, Denmark had a larger proportion of heterosexual domestic spread of HIV-1 subtype B (75 per cent) compared with Sweden (49 per cent) and Finland (57 per cent). We describe different HIV-1 transmission patterns between countries and transmission groups in a large geographical region. Our results may have implications for public health interventions in targeting HIV-1 transmission networks and identifying where to introduce such interventions. PMID:27774303
Directory of Open Access Journals (Sweden)
Guanyao Du
2015-01-01
Full Text Available This paper investigates the multiuser transmission network with an energy harvesting (EH cooperative relay, where a source transmits independent information to multiple destinations with the help of an energy constrained relay. The relay can harvest energy from the radio frequency (RF signals transmitted from the source, and it helps the multiuser transmission only by consuming the harvested energy. By adopting the time switching and the power splitting relay receiver architectures, we firstly propose two protocols, the time switching cooperative multiuser transmission (TSCMT protocol and the power splitting cooperative multiuser transmission (PSCMT protocol, to enable the simultaneous information processing and EH at the relay for the system. To evaluate the system performance, we theoretically analyze the system outage probability for the two proposed protocols and then derive explicit expressions for each of them, respectively. Numerical results are provided to demonstrate the accuracy of our analytical results and reveal that compared with traditional noncooperative scheme our proposed protocols are green solutions to offer reliable communication and lower system outage probability without consuming additional energy. In particular, for the same transmit power at the source, the PSCMT protocol is superior to the TSCMT protocol to obtain lower system outage probability.
Pagano, Nunziante; Campana, Giampaolo; Fiorini, Maurizio; Morelli, Raffaele
2017-06-01
Laser transmission welding is a suitable technology to join thin films of similar or dissimilar materials without any addition of chemical solvents or adhesives. This process represents a very important opportunity in the case of packaging applications (for example in food and pharmaceutical sectors) where the realisation of strong welds by avoiding the contact between the thermal source and the processed materials and, furthermore, without using any third material that could contaminate the contents, is reliable and relevant. The aim of this paper is to prove the feasibility of the laser transmission welding of polylactide to aluminium thin films by means of laser transmission welding through the use of a low power pulsed wave fibre laser. Laser joint samples were realised, analysed by optical microscopy to reveal possible defects and to evaluate the weld width and tested to measure the mechanical tensile strength. An accurate relationship between the joint quality and both the welding speed and the k-factor, which represents the delivered energy per unit length and affects the bonding mechanism at the interface, was determined. The achieved feasibility area is extremely narrow and possible only for the higher value of the average power. The joint tensile strength was proven to be in a proportional relationship with the effective bonded area and reached satisfactory values.
High frequency measurements of shot noise suppression in atomic-scale metal contacts
Wheeler, Patrick J.; Evans, Kenneth; Russom, Jeffrey; King, Nicholas; Natelson, Douglas
2009-03-01
Shot noise provides a means of assessing the number and transmission coefficients of transmitting channels in atomic- and molecular-scale junctions. Previous experiments at low temperatures in metal and semiconductor point contacts have demonstrated the expected suppression of shot noise when junction conductance is near an integer multiple of the conductance quantum, G0≡2e^2/h. Using high frequency techniques, we demonstrate the high speed acquisition of such data at room temperature in mechanical break junctions. In clean Au contacts conductance histograms with clear peaks at G0, 2G0, and 3G0 are acquired within hours, and histograms of simultaneous measurements of the shot noise show clear suppression at those conductance values. We describe the dependence of the noise on bias voltage and analyze the noise vs. conductance histograms in terms of a model that averages over transmission coefficients.
A simulation analysis to characterize the dynamics of vaccinating behaviour on contact networks.
Perisic, Ana; Bauch, Chris T
2009-05-28
Human behavior influences infectious disease transmission, and numerous "prevalence-behavior" models have analyzed this interplay. These previous analyses assumed homogeneously mixing populations without spatial or social structure. However, spatial and social heterogeneity are known to significantly impact transmission dynamics and are particularly relevant for certain diseases. Previous work has demonstrated that social contact structure can change the individual incentive to vaccinate, thus enabling eradication of a disease under a voluntary vaccination policy when the corresponding homogeneous mixing model predicts that eradication is impossible due to free rider effects. Here, we extend this work and characterize the range of possible behavior-prevalence dynamics on a network. We simulate transmission of a vaccine-preventable infection through a random, static contact network. Individuals choose whether or not to vaccinate on any given day according to perceived risks of vaccination and infection. We find three possible outcomes for behavior-prevalence dynamics on this type of network: small final number vaccinated and final epidemic size (due to rapid control through voluntary ring vaccination); large final number vaccinated and significant final epidemic size (due to imperfect voluntary ring vaccination), and little or no vaccination and large final epidemic size (corresponding to little or no voluntary ring vaccination). We also show that the social contact structure enables eradication under a broad range of assumptions, except when vaccine risk is sufficiently high, the disease risk is sufficiently low, or individuals vaccinate too late for the vaccine to be effective. For populations where infection can spread only through social contact network, relatively small differences in parameter values relating to perceived risk or vaccination behavior at the individual level can translate into large differences in population-level outcomes such as final size
A simulation analysis to characterize the dynamics of vaccinating behaviour on contact networks
Directory of Open Access Journals (Sweden)
Bauch Chris T
2009-05-01
Full Text Available Abstract Background Human behavior influences infectious disease transmission, and numerous "prevalence-behavior" models have analyzed this interplay. These previous analyses assumed homogeneously mixing populations without spatial or social structure. However, spatial and social heterogeneity are known to significantly impact transmission dynamics and are particularly relevant for certain diseases. Previous work has demonstrated that social contact structure can change the individual incentive to vaccinate, thus enabling eradication of a disease under a voluntary vaccination policy when the corresponding homogeneous mixing model predicts that eradication is impossible due to free rider effects. Here, we extend this work and characterize the range of possible behavior-prevalence dynamics on a network. Methods We simulate transmission of a vaccine-prevetable infection through a random, static contact network. Individuals choose whether or not to vaccinate on any given day according to perceived risks of vaccination and infection. Results We find three possible outcomes for behavior-prevalence dynamics on this type of network: small final number vaccinated and final epidemic size (due to rapid control through voluntary ring vaccination; large final number vaccinated and significant final epidemic size (due to imperfect voluntary ring vaccination, and little or no vaccination and large final epidemic size (corresponding to little or no voluntary ring vaccination. We also show that the social contact structure enables eradication under a broad range of assumptions, except when vaccine risk is sufficiently high, the disease risk is sufficiently low, or individuals vaccinate too late for the vaccine to be effective. Conclusion For populations where infection can spread only through social contact network, relatively small differences in parameter values relating to perceived risk or vaccination behavior at the individual level can translate into large
Ryan, Sadie J; Jones, James H; Dobson, Andrew P
2013-01-01
Catastrophic declines in African great ape populations due to disease outbreaks have been reported in recent years, yet we rarely hear of similar disease impacts for the more solitary Asian great apes, or for smaller primates. We used an age-structured model of different primate social systems to illustrate that interactions between social structure and demography create 'dynamic constraints' on the pathogens that can establish and persist in primate host species with different social systems. We showed that this varies by disease transmission mode. Sexually transmitted infections (STIs) require high rates of transmissibility to persist within a primate population. In particular, for a unimale social system, STIs require extremely high rates of transmissibility for persistence, and remain at extremely low prevalence in small primates, but this is less constrained in longer-lived, larger-bodied primates. In contrast, aerosol transmitted infections (ATIs) spread and persist at high prevalence in medium and large primates with moderate transmissibility;, establishment and persistence in small-bodied primates require higher relative rates of transmissibility. Intragroup contact structure - the social network - creates different constraints for different transmission modes, and our model underscores the importance of intragroup contacts on infection prior to intergroup movement in a structured population. When alpha males dominate sexual encounters, the resulting disease transmission dynamics differ from when social interactions are dominated by mother-infant grooming events, for example. This has important repercussions for pathogen spread across populations. Our framework reveals essential social and demographic characteristics of primates that predispose them to different disease risks that will be important for disease management and conservation planning for protected primate populations.
Modeling the Emergence of Contact Languages
Tria, Francesca; Servedio, Vito D.P.; Mufwene, Salikoko S.; Loreto, Vittorio
2015-01-01
Contact languages are born out of the non-trivial interaction of two (or more) parent languages. Nowadays, the enhanced possibility of mobility and communication allows for a strong mixing of languages and cultures, thus raising the issue of whether there are any pure languages or cultures that are unaffected by contact with others. As with bacteria or viruses in biological evolution, the evolution of languages is marked by horizontal transmission; but to date no reliable quantitative tools to investigate these phenomena have been available. An interesting and well documented example of contact language is the emergence of creole languages, which originated in the contacts of European colonists and slaves during the 17th and 18th centuries in exogenous plantation colonies of especially the Atlantic and Indian Ocean. Here, we focus on the emergence of creole languages to demonstrate a dynamical process that mimics the process of creole formation in American and Caribbean plantation ecologies. Inspired by the Naming Game (NG), our modeling scheme incorporates demographic information about the colonial population in the framework of a non-trivial interaction network including three populations: Europeans, Mulattos/Creoles, and Bozal slaves. We show how this sole information makes it possible to discriminate territories that produced modern creoles from those that did not, with a surprising accuracy. The generality of our approach provides valuable insights for further studies on the emergence of languages in contact ecologies as well as to test specific hypotheses about the peopling and the population structures of the relevant territories. We submit that these tools could be relevant to addressing problems related to contact phenomena in many cultural domains: e.g., emergence of dialects, language competition and hybridization, globalization phenomena. PMID:25875371
Photosynthesis-related infrared light transmission changes in spinach leaf segments
International Nuclear Information System (INIS)
Akimoto, T.
1985-01-01
The time courses of infrared light transmission changes and fluorescence induced by light in spinach leaf segments were measured. The illumination by red light exhibited a complex wave pattern. The transmission approached the baseline after repeating decreases and increases. Illumination by far-red light decreased the transmission. One of the differences between the two responses was the difference between the two amplitudes of the first increasing component. The component in the red light response was larger than the component in the far-red light response. The transmission decrease by far-red light is supposed to correspond to ''red drop.'' The transmission decrease by far-red light was suppressed by red light. This is due to an activation of a transmission-increasing component. This probably corresponds to ''enhancement.'' A proportional correlation existed between the intensity of far-red light and the minimum intensity of red light that suppressed the transmission decrease induced by far-red light. The component which made Peak D in the time course of fluorescence yield and the first increasing component in the transmission changes were suppressed by intense light
Optimizing link efficiency for gated DPCCH transmission on HSUPA
DEFF Research Database (Denmark)
Zarco, Carlos Ruben Delgado; Wigard, Jeroen; Kolding, T. E.
2007-01-01
consider the E-DCH performance degradation caused by gating on other radio procedures relying on the DPCCH, such as inner and outer loop power control. Our studies show that gating is beneficial for both for 2 and 10 ms transmission time intervals. The gains in terms of LE with a Vehicular A 30 kmph......To minimize the terminal's transmission power in bursty uplink traffic conditions, the evolved High-Speed Uplink Packet Access (HSUPA) concept in 3GPP WCDMA includes a feature known as Dedicated Physical Control Channel (DPCCH) gating. We present here a detailed link level study of gating from...... a link efficiency (LE) perspective; LE being expressed in bits per second per Watt. While the overall gain mechanisms of gating are well known, we show how special challenges related to discontinuous Enhanced Dedicated Channel (E-DCH) transmission can be addressed for high link and system performance. We...
The potential economic value of screening hospital admissions for Clostridium difficile.
Bartsch, S M; Curry, S R; Harrison, L H; Lee, B Y
2012-11-01
Asymptomatic Clostridium difficile carriage has a prevalence reported as high as 51-85 %; with up to 84 % of incident hospital-acquired infections linked to carriers. Accurately identifying carriers may limit the spread of Clostridium difficile. Since new technology adoption depends heavily on its economic value, we developed an analytic simulation model to determine the cost-effectiveness screening hospital admissions for Clostridium difficile from the hospital and third party payer perspectives. Isolation precautions were applied to patients testing positive, preventing transmission. Sensitivity analyses varied Clostridium difficile colonization rate, infection probability among secondary cases, contact isolation compliance, and screening cost. Screening was cost-effective (i.e., incremental cost-effectiveness ratio [ICER] ≤ $50,000/QALY) for every scenario tested; all ICER values were ≤ $256/QALY. Screening was economically dominant (i.e., saved costs and provided health benefits) with a ≥10.3 % colonization rate and ≥5.88 % infection probability when contact isolation compliance was ≥25 % (hospital perspective). Under some conditions screening led to cost savings per case averted (range, $53-272). Clostridium difficile screening, coupled with isolation precautions, may be a cost-effective intervention to hospitals and third party payers, based on prevalence. Limiting Clostridium difficile transmission can reduce the number of infections, thereby reducing its economic burden to the healthcare system.
Directory of Open Access Journals (Sweden)
Eroboghene H Otete
Full Text Available INTRODUCTION: Mathematical modelling of Clostridium difficile infection dynamics could contribute to the optimisation of strategies for its prevention and control. The objective of this systematic review was to summarise the available literature specifically identifying the quantitative parameters required for a compartmental mathematical model of Clostridium difficile transmission. METHODS: Six electronic healthcare databases were searched and all screening, data extraction and study quality assessments were undertaken in duplicate. Results were synthesised using a narrative approach. RESULTS: Fifty-four studies met the inclusion criteria. Reproduction numbers for hospital based epidemics were described in two studies with a range from 0.55 to 7. Two studies provided consistent data on incubation periods. For 62% of cases, symptoms occurred in less than 4 weeks (3-28 days after infection. Evidence on contact patterns was identified in four studies but with limited data reported for populating a mathematical model. Two studies, including one without clinically apparent donor-recipient pairs, provided information on serial intervals for household or ward contacts, showing transmission intervals of <1 week in ward based contacts compared to up to 2 months for household contacts. Eight studies reported recovery rates of between 75%-100% for patients who had been treated with either metronidazole or vancomycin. Forty-nine studies gave recurrence rates of between 3% and 49% but were limited by varying definitions of recurrence. No study was found which specifically reported force of infection or net reproduction numbers. CONCLUSIONS: There is currently scant literature overtly citing estimates of the parameters required to inform the quantitative modelling of Clostridium difficile transmission. Further high quality studies to investigate transmission parameters are required, including through review of published epidemiological studies where these
Directory of Open Access Journals (Sweden)
Amanda Tiffany
2017-06-01
Full Text Available Safely burying Ebola infected individuals is acknowledged to be important for controlling Ebola epidemics and was a major component of the 2013-2016 West Africa Ebola response. Yet, in order to understand the impact of safe burial programs it is necessary to elucidate the role of unsafe burials in sustaining chains of Ebola transmission and how the risk posed by activities surrounding unsafe burials, including care provided at home prior to death, vary with human behavior and geography.Interviews with next of kin and community members were carried out for unsafe burials in Sierra Leone, Liberia and Guinea, in six districts where the Red Cross was responsible for safe and dignified burials (SDB. Districts were randomly selected from a district-specific sampling frame comprised of villages and neighborhoods that had experienced cases of Ebola. An average of 2.58 secondary cases were potentially generated per unsafe burial and varied by district (range: 0-20. Contact before and after death was reported for 142 (46% contacts. Caregivers of a primary case were 2.63 to 5.92 times more likely to become EVD infected compared to those with post-mortem contact only. Using these estimates, the Red Cross SDB program potentially averted between 1,411 and 10,452 secondary EVD cases, reducing the epidemic by 4.9% to 36.5%.SDB is a fundamental control measure that limits community transmission of Ebola; however, for those individuals having contact before and after death, it was impossible to ascertain the exposure that caused their infection. The number of infections prevented through SDB is significant, yet greater impact would be achieved by early hospitalization of the primary case during acute illness.
High-Capacity Transmission Using High-Density Multicore Fiber
DEFF Research Database (Denmark)
Morioka, Toshio
2017-01-01
There have been intense research activities on SDM technologies including SDM fibers, MC-, MM-amplifiers, DEMUXs/DEMUXs with record-breaking transmission demonstrations up to 2 Pbit/s. 100 (20 dB) SDM gain, i.e. 10 Pbit/s per fiber will be a short-term goal in order for the new fibers to be consi......There have been intense research activities on SDM technologies including SDM fibers, MC-, MM-amplifiers, DEMUXs/DEMUXs with record-breaking transmission demonstrations up to 2 Pbit/s. 100 (20 dB) SDM gain, i.e. 10 Pbit/s per fiber will be a short-term goal in order for the new fibers...... to be considered for installation in the future systems although the far long term demand should be transporting 1 Ebit/s per fiber over 1000 km meaning Zbit/s-km. Cost effective network capability such as ADM and XC should also be investigated based on the new SDM schemes. In the 10-20 years time frame, we need...
Floyd F. Myron; Kimberly J. Shinew
1999-01-01
Drawing upon structural theory and social group perspectives, this study examined two propositions developed to explain the relationship between interracial contact and leisure preferences among African Americans and Whites. The first proposition stated that as interracial contact increases, the greater the probability of observing similarity in the leisure...
Replication and transmission of H9N2 influenza viruses in ferrets: evaluation of pandemic potential.
Directory of Open Access Journals (Sweden)
Hongquan Wan
2008-08-01
Full Text Available H9N2 avian influenza A viruses are endemic in poultry of many Eurasian countries and have caused repeated human infections in Asia since 1998. To evaluate the potential threat of H9N2 viruses to humans, we investigated the replication and transmission efficiency of H9N2 viruses in the ferret model. Five wild-type (WT H9N2 viruses, isolated from different avian species from 1988 through 2003, were tested in vivo and found to replicate in ferrets. However these viruses achieved mild peak viral titers in nasal washes when compared to those observed with a human H3N2 virus. Two of these H9N2 viruses transmitted to direct contact ferrets, however no aerosol transmission was detected in the virus displaying the most efficient direct contact transmission. A leucine (Leu residue at amino acid position 226 in the hemagglutinin (HA receptor-binding site (RBS, responsible for human virus-like receptor specificity, was found to be important for the transmission of the H9N2 viruses in ferrets. In addition, an H9N2 avian-human reassortant virus, which contains the surface glycoprotein genes from an H9N2 virus and the six internal genes of a human H3N2 virus, showed enhanced replication and efficient transmission to direct contacts. Although no aerosol transmission was observed, the virus replicated in multiple respiratory tissues and induced clinical signs similar to those observed with the parental human H3N2 virus. Our results suggest that the establishment and prevalence of H9N2 viruses in poultry pose a significant threat for humans.
Acceptance Probability (P a) Analysis for Process Validation Lifecycle Stages.
Alsmeyer, Daniel; Pazhayattil, Ajay; Chen, Shu; Munaretto, Francesco; Hye, Maksuda; Sanghvi, Pradeep
2016-04-01
This paper introduces an innovative statistical approach towards understanding how variation impacts the acceptance criteria of quality attributes. Because of more complex stage-wise acceptance criteria, traditional process capability measures are inadequate for general application in the pharmaceutical industry. The probability of acceptance concept provides a clear measure, derived from specific acceptance criteria for each quality attribute. In line with the 2011 FDA Guidance, this approach systematically evaluates data and scientifically establishes evidence that a process is capable of consistently delivering quality product. The probability of acceptance provides a direct and readily understandable indication of product risk. As with traditional capability indices, the acceptance probability approach assumes that underlying data distributions are normal. The computational solutions for dosage uniformity and dissolution acceptance criteria are readily applicable. For dosage uniformity, the expected AV range may be determined using the s lo and s hi values along with the worst case estimates of the mean. This approach permits a risk-based assessment of future batch performance of the critical quality attributes. The concept is also readily applicable to sterile/non sterile liquid dose products. Quality attributes such as deliverable volume and assay per spray have stage-wise acceptance that can be converted into an acceptance probability. Accepted statistical guidelines indicate processes with C pk > 1.33 as performing well within statistical control and those with C pk 1.33 is associated with a centered process that will statistically produce less than 63 defective units per million. This is equivalent to an acceptance probability of >99.99%.
Negative probability in the framework of combined probability
Burgin, Mark
2013-01-01
Negative probability has found diverse applications in theoretical physics. Thus, construction of sound and rigorous mathematical foundations for negative probability is important for physics. There are different axiomatizations of conventional probability. So, it is natural that negative probability also has different axiomatic frameworks. In the previous publications (Burgin, 2009; 2010), negative probability was mathematically formalized and rigorously interpreted in the context of extende...
Luk, Geraldine S. M.; Leung, Connie Y. H.; Sia, Sin Fun; Choy, Ka-Tim; Zhou, Jie; Ho, Candy C. K.; Cheung, Peter P. H.; Lee, Elaine F.; Wai, Chris K. L.; Li, Pamela C. H.; Ip, Sin-Ming; Poon, Leo L. M.; Lindsley, William G.
2015-01-01
ABSTRACT Poultry exposure is a major risk factor for human H7N9 zoonotic infections, for which the mode of transmission remains unclear. We studied the transmission of genetically related poultry and human H7N9 influenza viruses differing by four amino acids, including the host determinant PB2 residue 627. A/Silkie chicken/HK/1772/2014 (SCk1772) and A/HK/3263/14 (HK3263) replicated to comparable titers in chickens, with superior oropharyngeal over cloacal shedding; both viruses transmitted efficiently among chickens via direct contact but inefficiently via the airborne route. Interspecies transmission via the airborne route was observed for ferrets exposed to the SCk1772- or HK3263-infected chickens, while low numbers of copies of influenza viral genome were detected in the air, predominantly at particle sizes larger than 4 μm. In ferrets, the human isolate HK3263 replicated to higher titers and transmitted more efficiently via direct contact than SCk1772. We monitored “intrahost” and “interhost” adaptive changes at PB2 residue 627 during infection and transmission of the Sck1772 that carried E627 and HK3263 that carried V/K/E polymorphism at 60%, 20%, and 20%, respectively. For SCk1772, positive selection for K627 over E627 was observed in ferrets during the chicken-to-ferret or ferret-to-ferret transmission. For HK3263 that contained V/K/E polymorphism, mixed V627 and E627 genotypes were transmitted among chickens while either V627 or K627 was transmitted to ferrets with a narrow transmission bottleneck. Overall, our results suggest direct contact as the main mode for H7N9 transmission and identify the PB2-V627 genotype with uncompromised fitness and transmissibility in both avian and mammalian species. IMPORTANCE We studied the modes of H7N9 transmission, as this information is crucial for developing effective control measures for prevention. Using chicken (SCk1772) and human (HK3263) H7N9 isolates that differed by four amino acids, including the host
The transmission of fast molecular ions through thin foils
International Nuclear Information System (INIS)
Pietsch, W.J.; Gemmell, D.S.; Cooney, P.J.; Kanter, E.P.; Kurath, D.; Ratkowski, A.J.; Vager, Z.; Zabransky, B.J.
1980-01-01
We present new results on the transmission of fast molecular ions through thin foils and propose a mechanism for the transmission process. The main feature of the postulated mechanism is that a finite fraction of the incident molecular beam does not undergo a strong Coulomb explosion while traversing the foil. Because the emerging fragments are at large internuclear separations, there is an enhanced probability for the formation of bound, long-range, excited electronic states following electron capture at the rear surface of the target. (orig.)
Detecting emerging transmissibility of avian influenza virus in human households
Boven, M. van; Koopmans, M.; Du Ry van Beest Holle, M.; Meijer, Adam; Klinkenberg, D.; Donnelly, C.A.; Heesterbeek, J.A.P.
Accumulating infections of highly pathogenic H5N1 avian influenza in humans underlines the need to track the ability of these viruses to spread among humans. A human-transmissible avian influenza virus is expected to cause clusters of infections in humans living in close contact. Therefore,
Detecting emerging transmissibility of avian influenza virus in human households
Boven, van R.M.; Koopmans, M.; Du Ry Beest Holle, van M.; Meijer, A.; Klinkenberg, D.; Donnelly, C.; Heesterbeek, J.A.P.
2007-01-01
Accumulating infections of highly pathogenic H5N1 avian influenza in humans underlines the need to track the ability of these viruses to spread among humans. A human-transmissible avian influenza virus is expected to cause clusters of infections in humans living in close contact. Therefore,
Survival and compound nucleus probability of super heavy element Z = 117
International Nuclear Information System (INIS)
Manjunatha, H.C.; Sridhar, K.N.
2017-01-01
As a part of a systematic study for predicting the most suitable projectile-target combinations for heavy-ion fusion experiments in the synthesis of "2"8"9"-"2"9"7Ts, we have calculated the transmission probability (T_l), compound nucleus formation probabilities (P_C_N) and survival probability (P_s_u_r) of possible projectile-target combinations. We have also studied the fusion cross section, survival cross section and fission cross sections for different projectile-target combination of "2"8"9"-"2"9"7Ts. These theoretical parameters are required before the synthesis of the super heavy element. The calculated probabilities and cross sections show that the production of isotopes of the super heavy element with Z = 117 is strongly dependent on the reaction systems. The most probable reactions to synthetize the super heavy nuclei "2"8"9"-"2"9"7Ts are worked out and listed explicitly. We have also studied the variation of P_C_N and P_s_u_r with the mass number of projectile and target nuclei. This work is useful in the synthesis of the super heavy element Z = 117. (orig.)
System Reliability Evaluation of Data Transmission in Commercial Banks with Multiple Branches
Directory of Open Access Journals (Sweden)
Yi-Kuei Lin
2014-01-01
Full Text Available The main purpose of this paper is to assess the system reliability of electronic transaction data transmissions made by commercial banks in terms of stochastic flow network. System reliability is defined as the probability of demand satisfaction and it can be used to measure quality of service. In this paper, we study the system reliability of data transmission from the headquarters of a commercial bank to its multiple branches. The network structure of the bank and the probability of successful data transmission are obtained through the collection of real data. The system reliability, calculated using the minimal path method and the recursive sum of disjoint products algorithm, provides banking managers with a view to comprehend the current state of the entire system. Besides, the system reliability can be used not only as a measurement of quality of service, but also an improvement reference of the system by adopting sensitivity analysis.
Directory of Open Access Journals (Sweden)
Florent Ravaux
2017-06-01
Full Text Available To achieve low contact resistance between metal and III-V material, transmission-line-model (TLM structures of molybdenum (Mo were fabricated on indium phosphide (InP substrate on the top of an indium gallium arsenide (InGaAs layer grown by molecular beam epitaxy. The contact layer was prepared using a digital etch procedure before metal deposition. The contact resistivity was found to decrease significantly with the cleaning process. High Resolution Transmission & Scanning Electron Microscopy (HRTEM & HRSTEM investigations revealed that the surface roughness of treated samples was increased. Further analysis of the metal-semiconductor interface using Energy Electron Loss Spectroscopy (EELS showed that the amount of oxides (InxOy, GaxOy or AsxOy was significantly decreased for the etched samples. These results suggest that the low contact resistance obtained after digital etching is attributed to the combined effects of the induced surface roughness and oxides removal during the digital etch process.
CystiSim - An Agent-Based Model for Taenia solium Transmission and Control.
Braae, Uffe Christian; Devleesschauwer, Brecht; Gabriël, Sarah; Dorny, Pierre; Speybroeck, Niko; Magnussen, Pascal; Torgerson, Paul; Johansen, Maria Vang
2016-12-01
Taenia solium taeniosis/cysticercosis was declared eradicable by the International Task Force for Disease Eradication in 1993, but remains a neglected zoonosis. To assist in the attempt to regionally eliminate this parasite, we developed cystiSim, an agent-based model for T. solium transmission and control. The model was developed in R and available as an R package (http://cran.r-project.org/package=cystiSim). cystiSim was adapted to an observed setting using field data from Tanzania, but adaptable to other settings if necessary. The model description adheres to the Overview, Design concepts, and Details (ODD) protocol and consists of two entities-pigs and humans. Pigs acquire cysticercosis through the environment or by direct contact with a tapeworm carrier's faeces. Humans acquire taeniosis from slaughtered pigs proportional to their infection intensity. The model allows for evaluation of three interventions measures or combinations hereof: treatment of humans, treatment of pigs, and pig vaccination, and allows for customary coverage and efficacy settings. cystiSim is the first agent-based transmission model for T. solium and suggests that control using a strategy consisting of an intervention only targeting the porcine host is possible, but that coverage and efficacy must be high if elimination is the ultimate goal. Good coverage of the intervention is important, but can be compensated for by including an additional intervention targeting the human host. cystiSim shows that the scenarios combining interventions in both hosts, mass drug administration to humans, and vaccination and treatment of pigs, have a high probability of success if coverage of 75% can be maintained over at least a four year period. In comparison with an existing mathematical model for T. solium transmission, cystiSim also includes parasite maturation, host immunity, and environmental contamination. Adding these biological parameters to the model resulted in new insights in the potential
No Trend in the Intergenerational Transmission of Divorce
LI, JUI-CHUNG ALLEN; WU, LAWRENCE L.
2008-01-01
Previous studies on trends in the intergenerational transmission of divorce have produced mixed findings, with two studies (McLanahan and Bumpass 1988; Teachman 2002) reporting no trend in divorce transmission and one study (Wolfinger 1999) finding that divorce transmission has weakened substantially. Using a stratified Cox proportional hazard model, we analyze data from the National Survey of Families and Households and find no evidence for any trend in divorce transmission. To reconcile apparent differences in results, we note that the General Social Survey data used by Wolfinger lack information on marital duration, permitting analysis only for whether respondents have divorced by interview. As a result, an apparent decline in divorce transmission could be due to inadequate adjustments for the longer exposures to risk by earlier marriage cohorts, yielding a higher probability of divorce by interview for earlier cohorts relative to more recent cohorts even if divorce risks are identical across all marriage cohorts. We confirm this possibility by using a series of discrete-time hazard logistic regressions to investigate the sensitivity of estimates of trends in divorce transmission to different adjustments for exposure to risk. We conclude that there has been no trend in the intergenerational transmission of divorce. PMID:19110902
Directory of Open Access Journals (Sweden)
Diana Tilevik
2016-05-01
Full Text Available Background: The increasing prevalence of penicillin non-susceptible pneumococci (PNSP throughout the world threatens successful treatment of infections caused by this important bacterial pathogen. The rate at which PNSP clones spread in the community is thought to mainly be determined by two key determinants; the volume of penicillin use and the magnitude of the fitness cost in the absence of treatment. The aim of the study was to determine the impacts of penicillin consumption and fitness cost on pneumococcal transmission dynamics in a developed country setting. Methods: An individual-based network model based on real-life demographic data was constructed and applied in a developed country setting (Sweden. A population structure with transmission of carriage taking place within relevant mixing groups, i.e. families, day care groups, school classes, and other close contacts, was considered to properly assess the transmission dynamics for susceptible and PNSP clones. Several scenarios were simulated and model outcomes were statistically analysed. Results: Model simulations predicted that with an outpatient penicillin use corresponding to the sales in Sweden 2010 (118 recipes per 1,000 inhabitants per year, the magnitude of a fitness cost for resistance must be at least 5% to offset the advantage of penicillin resistance. Moreover, even if there is a fitness cost associated with penicillin resistance, a considerable reduction of penicillin usage appears to be required to significantly decrease the incidence of PNSP in a community. Conclusion: The frequency of PNSP clones is hard to reverse by simply reducing the penicillin consumption even if there is a biological cost associated with resistance. However, because penicillin usage does promote further spread of PNSP clones, it is important to keep down penicillin consumption considering future resistance problems.
Methyldibromoglutaronitrile in rinse-off products causes allergic contact dermatitis
DEFF Research Database (Denmark)
Jensen, C D; Johansen, J D; Menné, T
2004-01-01
BACKGROUND: The frequency of sensitivity to the cosmetic preservative methyldibromoglutaronitrile (MDBGN) has increased significantly in Europe. Most cases of allergic contact dermatitis from MDBGN are caused by leave-on cosmetic products. The risk of developing allergic contact dermatitis from...... series of MDBGN to determine their patch test threshold values. RESULTS: Seven presensitized individuals (37%) developed allergic contact dermatitis from the soap containing MDBGN. The mean dose of MDBGN per application was 2.2 micro g cm-2 and the reactions appeared between days 6 and 34. All nine...... rinse-off products has been less studied. OBJECTIVES: To investigate the allergic response elicited in presensitized individuals from exposure to a rinse-off product preserved with the maximum permitted level of MDBGN. METHODS: Nineteen contact allergic individuals and nine controls participated...
All-solid-state potassium-selective electrode using graphene as the solid contact
DEFF Research Database (Denmark)
Li, Fenghua; Ye, Junjin; Zhou, Min
2012-01-01
Graphene sheets are used for the first time to fabricate a new type of solid-contact ion-selective electrode (SC-ISE) as the intermediate layer between an ionophore-doped solvent polymeric membrane and a glassy carbon electrode. The new transducing layer was characterized by transmission electron...
Who's holding the baby? A prospective diary study of the contact patterns of mothers with an infant.
Campbell, Patricia Therese; McVernon, Jodie; Shrestha, Niraj; Nathan, Paula M; Geard, Nicholas
2017-09-20
forward in modelling infectious disease transmission. With infants spending most of their time in the company of their mother, contact patterns of mothers are a useful proxy measure of infant contact patterns. The age distribution of contacts made by infants estimated in this study may be used to supplement population-wide contact information commonly used in infectious disease transmission models.
Dynamics of Pertussis Transmission in the United States
Magpantay, F. M. G.; Rohani, P.
2015-01-01
Past patterns of infectious disease transmission set the stage on which modern epidemiologic dynamics are played out. Here, we present a comprehensive account of pertussis (whooping cough) transmission in the United States during the early vaccine era. We analyzed recently digitized weekly incidence records from Morbidity and Mortality Weekly Reports from 1938 to 1955, when the whole-cell pertussis vaccine was rolled out, and related them to contemporary patterns of transmission and resurgence documented in monthly incidence data from the National Notifiable Diseases Surveillance System. We found that, during the early vaccine era, pertussis epidemics in US states could be categorized as 1) annual, 2) initially annual and later multiennial, or 3) multiennial. States with predominantly annual cycles tended to have higher per capita birth rates, more household crowding, more children per family, and lower rates of school attendance than the states with multiennial cycles. Additionally, states that exhibited annual epidemics during 1938–1955 have had the highest recent (2001–2010) incidence, while those states that transitioned from annual cycles to multiennial cycles have had relatively low recent incidence. Our study provides an extensive picture of pertussis epidemiology in the United States dating back to the onset of vaccination, a back-story that could aid epidemiologists in understanding contemporary transmission patterns. PMID:26022662
On the 2-Row Rule for Infectious Disease Transmission on Aircraft.
Hertzberg, Vicki Stover; Weiss, Howard
With over two billion airline passengers annually, in-flight transmission of infectious diseases is an important global health concern. Many instances of in-flight transmission have been documented, but the relative influence of the many factors (see below) affecting in-flight transmission has not been quantified. Long-standing guidance by public health agencies is that the primary transmission risk associated with air travel for most respiratory infectious diseases is associated with sitting within two rows of an infectious passenger. The effect of proximity may be one of these factors. The aim of this study was to determine the risk of infection within and beyond the 2-row rule given by public health guidance. We searched the literature for reports of in-flight transmission of infection which included seat maps indicating where the infectious and infected passengers were seated. There is a ∼ 6% risk to passengers seated within the 2-rows of infected individual(s) and there is ∼ 2% risk to passengers seated beyond 2-rows from the infectious individual. Contact tracing limited to passengers within 2-rows of the infectious individual(s) could fail to detect other cases of infections. This has important consequences for assessing the spread of infectious diseases. Infection at a distance from the index case indicates other factors, such as airflow, movement of passenger/crew members, fomites and contacts between passengers in the departure gate before boarding, or after deplaning, are involved. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Chronic Wasting Disease: Transmission Mechanisms and the Possibility of Harvest Management
Potapov, Alex; Merrill, Evelyn; Pybus, Margo; Lewis, Mark A.
2016-01-01
We develop a model of CWD management by nonselective deer harvest, currently the most feasible approach available for managing CWD in wild populations. We use the model to explore the effects of 6 common harvest strategies on disease prevalence and to identify potential optimal harvest policies for reducing disease prevalence without population collapse. The model includes 4 deer categories (juveniles, adult females, younger adult males, older adult males) that may be harvested at different rates, a food-based carrying capacity, which influences juvenile survival but not adult reproduction or survival, and seasonal force of infection terms for each deer category under differing frequency-dependent transmission dynamics resulting from environmental and direct contact mechanisms. Numerical experiments show that the interval of transmission coefficients β where the disease can be controlled is generally narrow and efficiency of a harvest policy to reduce disease prevalence depends crucially on the details of the disease transmission mechanism, in particular on the intensity of disease transmission to juveniles and the potential differences in the behavior of older and younger males that influence contact rates. Optimal harvest policy to minimize disease prevalence for each of the assumed transmission mechanisms is shown to depend on harvest intensity. Across mechanisms, a harvest that focuses on antlered deer, without distinguishing between age classes reduces disease prevalence most consistently, whereas distinguishing between young and older antlered deer produces higher uncertainty in the harvest effects on disease prevalence. Our results show that, despite uncertainties, a modelling approach can determine classes of harvest strategy that are most likely to be effective in combatting CWD. PMID:26963921
Microbial adherence to cosmetic contact lenses.
Chan, Ka Yin; Cho, Pauline; Boost, Maureen
2014-08-01
To investigate whether cosmetic contact lenses (CCL) with surface pigments affect microbial adherence. Fifteen brands of CCL were purchased from optical, non-optical retail outlets, and via the Internet. A standardized rub-off test was performed on each CCL (five lenses per brand) to confirm the location of the pigments. The rub-off test comprised gentle rubbing on the surfaces of each CCL with wetted cotton buds for a maximum of 20 rubs per surface. A new set of CCL (five lenses per brand) were incubated in Pseudomonas aeruginosa overnight. Viable counts of adhered bacteria were determined by the number of colony-forming units (CFU) on agar media on each lens. The adherence of P. aeruginosa as well as Staphylococcus aureus and Serratia marcescens to three brands of CCL (A-C) (five lenses per brand) were also compared to their adherences on their clear counterparts. Only two of the 15 brands of CCL tested (brands B and C) had pigments that did not detach with the rub-off test. The remaining 13 brands of CCL all failed the rub-off test and these lenses showed higher P. aeruginosa adherence (8.7 × 10(5)-1.9 × 10(6) CFU/lens). Brands B and C lenses showed at least six times less bacterial adhesion than the other 13 brands. Compared to their clear counterparts, bacterial adherence to brands B and C lenses did not differ significantly, whereas brand A lenses showed significantly higher adherence. Surface pigments on CCL resulted in significantly higher bacterial adherence. Copyright © 2013 British Contact Lens Association. Published by Elsevier Ltd. All rights reserved.
Interplay Between Hiv/aids Epidemics and Demographic Structures Based on Sexual Contact Networks
Bai, Wen-Jie; Zhou, Tao; Wang, Bing-Hong
In this article, we propose a network spreading model for HIV epidemics, wherein each individual is represented by a node of the transmission network and the edges are the connections between individuals along which the infection may spread. The sexual activity of each individual, measured by its degree, is not homogeneous but obeys a power-law distribution. Due to the heterogeneity of activity, the infection can persistently exist at a very low prevalence, which has been observed in the real data but cannot be illuminated by previous models with homogeneous mixing hypothesis. The model displays a clear picture of hierarchical spread: In the early stage the infection is adhered to these high-risk persons, and then, diffuses toward low-risk population. Furthermore, we find that to reduce the risky behaviors is much more effective in the fight against HIV/AIDS rather than the antiretroviral drug therapies. The prediction results show that the development of epidemics can be roughly categorized into three patterns for different countries, and the pattern of a given country is mainly determined by the average sex-activity and transmission probability per sexual partner. In most cases, the effect of HIV epidemics on demographic structure is very small. However, for some extremely countries, like Botswana, the number of sex-active people can be depressed to nearly a half by AIDS.
Topological probability and connection strength induced activity in complex neural networks
International Nuclear Information System (INIS)
Du-Qu, Wei; Bo, Zhang; Dong-Yuan, Qiu; Xiao-Shu, Luo
2010-01-01
Recent experimental evidence suggests that some brain activities can be assigned to small-world networks. In this work, we investigate how the topological probability p and connection strength C affect the activities of discrete neural networks with small-world (SW) connections. Network elements are described by two-dimensional map neurons (2DMNs) with the values of parameters at which no activity occurs. It is found that when the value of p is smaller or larger, there are no active neurons in the network, no matter what the value of connection strength is; for a given appropriate connection strength, there is an intermediate range of topological probability where the activity of 2DMN network is induced and enhanced. On the other hand, for a given intermediate topological probability level, there exists an optimal value of connection strength such that the frequency of activity reaches its maximum. The possible mechanism behind the action of topological probability and connection strength is addressed based on the bifurcation method. Furthermore, the effects of noise and transmission delay on the activity of neural network are also studied. (general)
Directory of Open Access Journals (Sweden)
Janet Raboud
Full Text Available BACKGROUND: In the 2003 Toronto SARS outbreak, SARS-CoV was transmitted in hospitals despite adherence to infection control procedures. Considerable controversy resulted regarding which procedures and behaviours were associated with the greatest risk of SARS-CoV transmission. METHODS: A retrospective cohort study was conducted to identify risk factors for transmission of SARS-CoV during intubation from laboratory confirmed SARS patients to HCWs involved in their care. All SARS patients requiring intubation during the Toronto outbreak were identified. All HCWs who provided care to intubated SARS patients during treatment or transportation and who entered a patient room or had direct patient contact from 24 hours before to 4 hours after intubation were eligible for this study. Data was collected on patients by chart review and on HCWs by interviewer-administered questionnaire. Generalized estimating equation (GEE logistic regression models and classification and regression trees (CART were used to identify risk factors for SARS transmission. RESULTS: 45 laboratory-confirmed intubated SARS patients were identified. Of the 697 HCWs involved in their care, 624 (90% participated in the study. SARS-CoV was transmitted to 26 HCWs from 7 patients; 21 HCWs were infected by 3 patients. In multivariate GEE logistic regression models, presence in the room during fiberoptic intubation (OR = 2.79, p = .004 or ECG (OR = 3.52, p = .002, unprotected eye contact with secretions (OR = 7.34, p = .001, patient APACHE II score > or = 20 (OR = 17.05, p = .009 and patient Pa0(2/Fi0(2 ratio < or = 59 (OR = 8.65, p = .001 were associated with increased risk of transmission of SARS-CoV. In CART analyses, the four covariates which explained the greatest amount of variation in SARS-CoV transmission were covariates representing individual patients. CONCLUSION: Close contact with the airway of severely ill patients and failure of infection control practices to prevent exposure
An analytical theory of transmission line shielding
International Nuclear Information System (INIS)
Pettersson, Per
1993-01-01
The classical electrogeometric model of shielding failure flashovers on transmission lines is investigated by analytical methods. Most of the basic elements that has appeared in the literature on the subject have been incorporated and put into a comprehensive model. These elements are: tower top geometry, structure height above ground, line insulation, lateral slope of ground, probability distribution of lightning currents, ratio of striking distances to ground wire and earth relative to conductor, and probability distribution of lightning leader approach angle to ground. Departing from a basic idealistic case, the sensitivity of the model to variations in these parameters is studied. Numerical examples are given. 8 refs, 8 figs, 1 tab
Improving Single-Carbon-Nanotube-Electrode Contacts Using Molecular Electronics.
Krittayavathananon, Atiweena; Ngamchuea, Kamonwad; Li, Xiuting; Batchelor-McAuley, Christopher; Kätelhön, Enno; Chaisiwamongkhol, Korbua; Sawangphruk, Montree; Compton, Richard G
2017-08-17
We report the use of an electroactive species, acetaminophen, to modify the electrical connection between a carbon nanotube (CNT) and an electrode. By applying a potential across two electrodes, some of the CNTs in solution occasionally contact the electrified interface and bridge between two electrodes. By observing a single CNT contact between two microbands of an interdigitated Au electrode in the presence and absence of acetaminophen, the role of the molecular species at the electronic junction is revealed. As compared with the pure CNT, the current magnitude of the acetaminophen-modified CNTs significantly increases with the applied potentials, indicating that the molecule species improves the junction properties probably via redox shuttling.
Comparing methods to quantify experimental transmission of infectious agents
Velthuis, A.G.J.; Jong, de M.C.M.; Bree, de J.
2007-01-01
Transmission of an infectious agent can be quantified from experimental data using the transient-state (TS) algorithm. The TS algorithm is based on the stochastic SIR model and provides a time-dependent probability distribution over the number of infected individuals during an epidemic, with no need
mm-Wave Hybrid Photonic Wireless Links for Ultra-High Speed Wireless Transmissions
DEFF Research Database (Denmark)
Rommel, Simon; Vegas Olmos, Juan José; Tafur Monroy, Idelfonso
Hybrid photonic-wireless transmission schemes in the mm-wave frequency range are promising candidates to enable the multi-gigabit per second data communications required from wireless and mobile networks of the 5th and future generations. Large FCC spectrum allocations for wireless transmission...
Directory of Open Access Journals (Sweden)
Mirjam Kretzschmar
2010-06-01
Full Text Available BACKGROUND: Despite large-scale vaccination programmes, pertussis has remained endemic in all European countries and has been on the rise in many countries in the last decade. One of the reasons that have been discussed for the failure of vaccination to eliminate the disease is continued circulation of the pathogen Bordetella pertussis by mostly asymptomatic and mild infections in adolescents and adults. To understand the impact of asymptomatic and undiagnosed infection on the transmission dynamics of pertussis we analysed serological data from five European countries in combination with information about social contact patterns from five of those countries to estimate incidence and reproduction numbers. METHODS AND FINDINGS: We compared two different methods for estimating incidence from individual data on IgG pertussis toxin (PT titres. One method combines the cross-sectional surveys of titres with longitudinal information about the distribution of amplitude and decay rate of titres in a back-calculation approach. The second method uses age-dependent contact matrices and cross-sectional surveys of IgG PT titres to estimate a next generation matrix for pertussis transmission among age groups. The next generation approach allows for computation of basic reproduction numbers for five European countries. Our main findings are that the seroincidence of infections as estimated with the first method in all countries lies between 1% and 6% per annum with a peak in the adolescent age groups and a second lower peak in young adults. The incidence of infections as estimated by the second method lies slightly lower with ranges between 1% and 4% per annum. There is a remarkably good agreement of the results obtained with the two methods. The basic reproduction numbers are similar across countries at around 5.5. CONCLUSIONS: Vaccination with currently used vaccines cannot prevent continued circulation and reinfection with pertussis, but has shifted the bulk
Cathode-Control Alloying at an Au-ZnSe Nanowire Contact via in Situ Joule Heating
International Nuclear Information System (INIS)
Zeng Ya-Ping; Qu Bai-Hua; Yu Hong-Chun; Wang Yan-Guo
2012-01-01
Controllable interfacial alloying is achieved at a Au-ZnSe nanowire (M-S) contact via in situ Joule heating inside transmission electron microscopy (TEM). TEM inspection reveals that the Au electrode is locally molten at the M-S contact and the tip of the ZnSe nanowire is covered by the Au melting. Experimental evidences confirm that the alloying at the reversely biased M-S contact is due to the high resistance of the Schottky barrier at this M-S contact, coincident to cathode-control mode. Consequently, in situ Joule heating can be an effective method to improve the performance of nanoelectronics based on a metal-semiconductor-metal nanostructure. (cross-disciplinary physics and related areas of science and technology)
DEFF Research Database (Denmark)
Uttenthal, Åse; Høyer, M.J.; Grøndahl, C.
2006-01-01
This study investigates the transmission of bovine viral diarrhoea virus (BVDV) 1f from a persistently infected (PI) lesser Malayan mousedeer to two bovine calves. Different contact routes to two calves were analysed: 1) aerosol contact between two adjacent pens without physical contact; 2) indir...... mousedeer BVD virus in the E2 region (420 nucleotides) through 4 generations showed only 7 mutations, which were maintained from mother to offspring....
Comparison of PPD test in household contacts of smear-positive and -negative tuberculosis (TB
Directory of Open Access Journals (Sweden)
Zohreh Azarkar
2015-01-01
Conclusions: The most important way to prevent TB is omission of the disease transmission sources (TB patients by anti-TB treatment. Extensive studies are needed to ensure that contacts of patients with pulmonary TB are identified and appropriately screened.
Bárcena, J; Morales, M; Vázquez, B; Boga, J A; Parra, F; Lucientes, J; Pagès-Manté, A; Sánchez-Vizcaíno, J M; Blasco, R; Torres, J M
2000-02-01
We have developed a new strategy for immunization of wild rabbit populations against myxomatosis and rabbit hemorrhagic disease (RHD) that uses recombinant viruses based on a naturally attenuated field strain of myxoma virus (MV). The recombinant viruses expressed the RHDV major capsid protein (VP60) including a linear epitope tag from the transmissible gastroenteritis virus (TGEV) nucleoprotein. Following inoculation, the recombinant viruses induced specific antibody responses against MV, RHDV, and the TGEV tag. Immunization of wild rabbits by the subcutaneous and oral routes conferred protection against virulent RHDV and MV challenges. The recombinant viruses showed a limited horizontal transmission capacity, either by direct contact or in a flea-mediated process, promoting immunization of contact uninoculated animals.
Dong, Jian; Jin, Yanli; Dong, He; Liu, Jiawei; Ye, Senbin
2018-06-14
The profile, apparent contact angle (ACA), contact angle hysteresis (CAH) and wetting state transmission energy barrier (WSTEB) are important static and dynamic properties of a large volume droplet on the hierarchical surface. Understanding them can provide us with important insights to functional surfaces and promote the application in corresponding areas. In this paper, we established three theoretical models (Model 1, Model 2 and Model 3) and corresponding numerical methods, which were obtained by the free energy minimization and the nonlinear optimization algorithm, to predict the profile, ACA, CAH and WSTEB of a large volume droplet on the horizontal regular dual-rough surface. In consideration of the gravity, the energy barrier on the contact circle, the dual heterogenous structures and their roughness on the surface, the models are more universal and accurate than previous models. It showed that the predictions of the models were in good agreement with the results from the experiment or literature. The models are promising to become novel design approaches of functional surfaces, which are frequently applied in microfluidic chips, water self-catchment system and dropwise condensation heat transfer system.
Huddleston, Lisa L.; Roeder, William; Merceret, Francis J.
2010-01-01
A technique has been developed to calculate the probability that any nearby lightning stroke is within any radius of any point of interest. In practice, this provides the probability that a nearby lightning stroke was within a key distance of a facility, rather than the error ellipses centered on the stroke. This process takes the current bivariate Gaussian distribution of probability density provided by the current lightning location error ellipse for the most likely location of a lightning stroke and integrates it to get the probability that the stroke is inside any specified radius. This new facility-centric technique will be much more useful to the space launch customers and may supersede the lightning error ellipse approach discussed in [5], [6].
International Nuclear Information System (INIS)
Sahlstedt, E.; Karhu, J.
2014-07-01
Samples of fracture fillings were collected from 26 bedrock fractures at Olkiluoto. Special attention was paid to fractures having low transmissivities of <1E-8 m 2 /s. The chemical composition and the C and O isotopic composition of the fracture filling calcite were analysed. In addition, fluid inclusions were studied and microthermometric measurements conducted on fracture filling calcite. The most common minor element in calcite fillings was Mn, having concentrations up to 3.4 wt-%. The δ13C values had a wide range, from -13.0 to 14.5 per mille, and the δ18O values a narrower range, from -13.4 to -7.3 per mille. The δ18O values of late-stage calcite appear to be independent of the transmissivity of the fractures, ranging from -11.2 to -7.3 per mille over a T range from 3E -6 to 1.6E -1 1 m 2 /s. The δ13C values of late-stage calcite appear to have more variation at high transmissivities of >1E-8 m 2 /s. Unusually low and high δ13C values in late-stage calcite fillings occur in the upper ∼ 400 m of the bedrock and are probably related to microbial reduction processes, at near surface (<60 m) conditions to oxidation of organic matter resulting in low δ13C values and at ∼ 55-400 m to methanogenesis, causing high δ 13C values. A relatively low spread in the δ 13C values of late-stage calcite precipitates in low transmissivity (<1E-8 m 2 /s) fractures is most likely caused by stable conditions in the areas of low conductivity in the bedrock, reflecting slow dissolution/reprecipitation of older carbonate fillings. Fluid inclusion data indicate variation in fracture water types from high temperature, ∼ 200 deg C, low salinity fluid with < 4 wt-% of NaCl eq to low temperature, <100 deg C, high salinity fluid with 17-29 wt-% of NaCl eq . The high temperature fluid is associated with Group 5 calcite fillings and the low temperature fluid with Group 3 calcite. The composition of fluids related to Group 4 calcite falls roughly between the compositions
Contact angles on a soft solid: from Young's law to Neumann's law.
Marchand, Antonin; Das, Siddhartha; Snoeijer, Jacco H; Andreotti, Bruno
2012-12-07
The contact angle that a liquid drop makes on a soft substrate does not obey the classical Young's relation, since the solid is deformed elastically by the action of the capillary forces. The finite elasticity of the solid also renders the contact angles differently from those predicted by Neumann's law, which applies when the drop is floating on another liquid. Here, we derive an elastocapillary model for contact angles on a soft solid by coupling a mean-field model for the molecular interactions to elasticity. We demonstrate that the limit of a vanishing elastic modulus yields Neumann's law or a variation thereof, depending on the force transmission in the solid surface layer. The change in contact angle from the rigid limit to the soft limit appears when the length scale defined by the ratio of surface tension to elastic modulus γ/E reaches the range of molecular interactions.
Stochastic modeling for river pollution of Sungai Perlis
International Nuclear Information System (INIS)
Yunus, Nurul Izzaty Mohd.; Rahman, Haliza Abd.; Bahar, Arifah
2015-01-01
River pollution has been recognized as a contributor to a wide range of health problems and disorders in human. It can pose health dangers to humans who come into contact with it, either directly or indirectly. Therefore, it is most important to measure the concentration of Biochemical Oxygen Demand (BOD) as a water quality parameter since the parameter has long been the basic means for determining the degree of water pollution in rivers. In this study, BOD is used as a parameter to estimate the water quality at Sungai Perlis. It has been observed that Sungai Perlis is polluted due to lack of management and improper use of resources. Therefore, it is of importance to model the Sungai Perlis water quality in order to describe and predict the water quality systems. The BOD concentration secondary data set is used which was extracted from the Drainage and Irrigation Department Perlis State website. The first order differential equation from Streeter – Phelps model was utilized as a deterministic model. Then, the model was developed into a stochastic model. Results from this study shows that the stochastic model is more adequate to describe and predict the BOD concentration and the water quality systems in Sungai Perlis by having smaller value of mean squared error (MSE)
Stochastic modeling for river pollution of Sungai Perlis
Energy Technology Data Exchange (ETDEWEB)
Yunus, Nurul Izzaty Mohd.; Rahman, Haliza Abd. [Department of Mathematical Sciences, Faculty of Science, Universiti Teknologi Malaysia,81310 Johor Bahru, Johor (Malaysia); Bahar, Arifah [UTM-Centre of Industrial and Applied Mathematics (UTM-CIAM) Universiti Teknologi Malaysia, 81310 Johor Bahru, Johor (Malaysia)
2015-02-03
River pollution has been recognized as a contributor to a wide range of health problems and disorders in human. It can pose health dangers to humans who come into contact with it, either directly or indirectly. Therefore, it is most important to measure the concentration of Biochemical Oxygen Demand (BOD) as a water quality parameter since the parameter has long been the basic means for determining the degree of water pollution in rivers. In this study, BOD is used as a parameter to estimate the water quality at Sungai Perlis. It has been observed that Sungai Perlis is polluted due to lack of management and improper use of resources. Therefore, it is of importance to model the Sungai Perlis water quality in order to describe and predict the water quality systems. The BOD concentration secondary data set is used which was extracted from the Drainage and Irrigation Department Perlis State website. The first order differential equation from Streeter – Phelps model was utilized as a deterministic model. Then, the model was developed into a stochastic model. Results from this study shows that the stochastic model is more adequate to describe and predict the BOD concentration and the water quality systems in Sungai Perlis by having smaller value of mean squared error (MSE)
Almaguer-Leyva, Martín; Mendoza-Flores, Lidia; Medina-Torres, Ana Gabriela; Salinas-Caballero, Ana Gabriela; Vidaña-Amaro, Jose Antonio; Garza-Gonzalez, Elvira; Camacho-Ortiz, Adrián
2013-11-01
Hand hygiene (HH) is the single most important intervention for preventing hospital-acquired infections. Contact precautions are a series of actions that infection control units take to reduce the transmission of nosocomial pathogens. We conducted an observational study of HH compliance. Observations were stratified as opportunities in patients under contact precautions and in the general hospital population. Trained infection control personnel performed all direct evaluations. A total of 3,270 opportunities were recorded. HH compliance was statistically higher in patients on contact precautions than in the overall population (70.3% vs 60.4%; P = .0001). Critical care areas had higher HH compliance when patients were isolated by contact precautions. Medical wards were statistically lower in HH when patients were under contact precautions. Respiratory technicians had the highest HH compliance in both overall performance and in patients under contact precautions. Medical students had a lower HH compliance in both evaluations (P Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.
Money and transmission of bacteria.
Gedik, Habip; Voss, Timothy A; Voss, Andreas
2013-08-28
Money is one of the most frequently passed items in the world. The aim of this study was to ascertain the survival status of bacteria including Staphylococcus aureus, Escherichia coli, and Vancomycin- Resistant Enterococci (VRE) on banknotes from different countries and the transmission of bacteria to people who come in contact with the banknotes. The survival rate was highest for the Romanian Leu yielding all three microorganisms used after both three and six hours of drying. Furthermore, the Leu was the only banknote to yield VRE after one day of drying. Other currencies either enabled the survival of Extended-Spectrum Beta-Lactamases (ESBL) and VRE (e.g. Euro), but not of MRSA, or the other way round (e.g. US Dollar). While a variety of factors such as community hygiene levels, people's behaviour, and antimicrobial resistance rates at community level obviously have influence on the transmission of resistant microorganisms, the type of banknote-paper may be an additional variable to consider.
Mossoun, Arsène; Calvignac-Spencer, Sébastien; Anoh, Augustin E; Pauly, Maude S; Driscoll, Daniel A; Michel, Adam O; Nazaire, Lavry Grah; Pfister, Stefan; Sabwe, Pascale; Thiesen, Ulla; Vogler, Barbara R; Wiersma, Lidewij; Muyembe-Tamfum, Jean-Jacques; Karhemere, Stomy; Akoua-Koffi, Chantal; Couacy-Hymann, Emmanuel; Fruth, Barbara; Wittig, Roman M; Leendertz, Fabian H; Schubert, Grit
2017-05-15
Simian T-lymphotropic virus 1 (STLV-1) enters human populations through contact with nonhuman primate (NHP) bushmeat. We tested whether differences in the extent of contact with STLV-1-infected NHP bushmeat foster regional differences in prevalence of human T-lymphotropic virus 1 (HTLV-1). Using serological and PCR assays, we screened humans and NHPs at two Sub-Saharan African sites where subsistence hunting was expected to be less (Taï region, Côte d'Ivoire [CIV]) or more (Bandundu region, Democratic Republic of the Congo [DRC]) developed. Only 0.7% of human participants were infected with HTLV-1 in CIV ( n = 574), and 1.3% of humans were infected in DRC ( n = 302). Two of the Ivorian human virus sequences were closely related to simian counterparts, indicating ongoing zoonotic transmission. Multivariate analysis of human demographic parameters and behavior confirmed that participants from CIV were less often exposed to NHPs than participants from DRC through direct contact, e.g., butchering. At the same time, numbers of STLV-1-infected NHPs were higher in CIV (39%; n = 111) than in DRC (23%; n = 39). We conclude that similar ultimate risks of zoonotic STLV-1 transmission-defined as the product of prevalence in local NHP and human rates of contact to fresh NHP carcasses-contribute to the observed comparable rates of HTLV-1 infection in humans in CIV and DRC. We found that young adult men and mature women are most likely exposed to NHPs at both sites. In view of the continued difficulties in controlling zoonotic disease outbreaks, the identification of such groups at high risk of NHP exposure may guide future prevention efforts. IMPORTANCE Multiple studies report a high risk for zoonotic transmission of blood-borne pathogens like retroviruses through contact with NHPs, and this risk seems to be particularly high in tropical Africa. Here, we reveal high levels of exposure to NHP bushmeat in two regions of Western and Central tropical Africa. We provide evidence
Shiryaev, A N
1996-01-01
This book contains a systematic treatment of probability from the ground up, starting with intuitive ideas and gradually developing more sophisticated subjects, such as random walks, martingales, Markov chains, ergodic theory, weak convergence of probability measures, stationary stochastic processes, and the Kalman-Bucy filter Many examples are discussed in detail, and there are a large number of exercises The book is accessible to advanced undergraduates and can be used as a text for self-study This new edition contains substantial revisions and updated references The reader will find a deeper study of topics such as the distance between probability measures, metrization of weak convergence, and contiguity of probability measures Proofs for a number of some important results which were merely stated in the first edition have been added The author included new material on the probability of large deviations, and on the central limit theorem for sums of dependent random variables
CystiSim – An Agent-Based Model for Taenia solium Transmission and Control
Gabriël, Sarah; Dorny, Pierre; Speybroeck, Niko; Magnussen, Pascal; Torgerson, Paul; Johansen, Maria Vang
2016-01-01
Taenia solium taeniosis/cysticercosis was declared eradicable by the International Task Force for Disease Eradication in 1993, but remains a neglected zoonosis. To assist in the attempt to regionally eliminate this parasite, we developed cystiSim, an agent-based model for T. solium transmission and control. The model was developed in R and available as an R package (http://cran.r-project.org/package=cystiSim). cystiSim was adapted to an observed setting using field data from Tanzania, but adaptable to other settings if necessary. The model description adheres to the Overview, Design concepts, and Details (ODD) protocol and consists of two entities—pigs and humans. Pigs acquire cysticercosis through the environment or by direct contact with a tapeworm carrier's faeces. Humans acquire taeniosis from slaughtered pigs proportional to their infection intensity. The model allows for evaluation of three interventions measures or combinations hereof: treatment of humans, treatment of pigs, and pig vaccination, and allows for customary coverage and efficacy settings. cystiSim is the first agent-based transmission model for T. solium and suggests that control using a strategy consisting of an intervention only targeting the porcine host is possible, but that coverage and efficacy must be high if elimination is the ultimate goal. Good coverage of the intervention is important, but can be compensated for by including an additional intervention targeting the human host. cystiSim shows that the scenarios combining interventions in both hosts, mass drug administration to humans, and vaccination and treatment of pigs, have a high probability of success if coverage of 75% can be maintained over at least a four year period. In comparison with an existing mathematical model for T. solium transmission, cystiSim also includes parasite maturation, host immunity, and environmental contamination. Adding these biological parameters to the model resulted in new insights in the potential
Courey, Karim; Wright, Clara; Asfour, Shihab; Bayliss, Jon; Ludwig, Larry
2008-01-01
Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that has a currently unknown probability associated with it. Due to contact resistance, electrical shorts may not occur at lower voltage levels. In this experiment, we study the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From this data, we can estimate the probability of an electrical short, as a function of voltage, given that a free tin whisker has bridged two adjacent exposed electrical conductors. In addition, three tin whiskers grown from the same Space Shuttle Orbiter card guide used in the aforementioned experiment were cross sectioned and studied using a focused ion beam (FIB).
Wireless Energy and Information Transmission in FSO and RF-FSO Links
Makki, Behrooz
2017-09-22
We propose and analyze a wireless energy and information transmission scheme in free-space optical (FSO) links. The results are presented for both quasi-static and fast-fading conditions. We derive closed-form expressions for throughput, outage probability and optimal power allocation optimizing the system throughput/outage probability. Finally, we complement the FSO link with an additional radio frequency (RF) link to create a hybrid RF-FSO system and reduce the system outage probability. The results show that joint implementation of the RF and FSO links leads to considerable performance improvement, compared to the cases with only FSO-based communication.
Patterns of between-farm contacts via professionals in Sweden.
Olofsson, Emelie; Nöremark, Maria; Lewerin, Susanna Sternberg
2014-11-04
Infectious diseases of livestock have negative consequences for animal production as well as animal health and welfare and can be transmitted between farms via direct (live animal movements) as well as indirect (via physical vectors such as, people, transport vehicles and fomites) contacts. The objective of the study was to examine the travel patterns of professionals visiting Swedish farms (veterinarians, milk tanker drivers, artificial inseminators, maintenance technicians and livestock hauliers). This was done by obtaining records of the farms visited by a sample of professionals in the above categories in one week in January, one week in April, one week in July and one week in October in the Swedish counties Västerbotten, Södermanland, Västergötland and Skåne. There were twelve participating organisations, and data was provided for one to three individuals/vehicles/veterinary practices per professional category and per geographic region (except for dairy service technicians and livestock hauliers who did not provide data from all regions). There was a trend towards larger areas covered and smaller number of farms visited per week in the north, but exceptions occurred and there were regional variations. Generally, the greatest areas were travelled by milk tankers and livestock hauliers, and the profession travelling over the smallest areas tended to be the veterinarians. Milk tankers visited most farms per week, one milk tanker could visit between 23 and 90 farms per week and travel over areas between 717 km² and 23,512 km² per week. Valuable insight into the travel patterns of Swedish professionals has emerged although the implications of the study largely concern highly infectious diseases. Movement of live animals pose the greatest risk for the spread of infectious animal diseases; however indirect contacts are important for many diseases. The results of this study indicate that in Sweden a highly contagious disease might spread over a large area in
Dynamic modeling and analysis of sexually transmitted diseases on heterogeneous networks
Li, Shuping; Jin, Zhen
2015-06-01
Considering homosexual contacts and heterosexual contacts in the course of sexual contacts, double degrees which describe the numbers of homosexual contacts and heterosexual contacts are introduced, correlation coefficients about degrees based on the joint probability distribution are given, and an SIS mean-field model about sexually transmitted diseases is presented when degrees are uncorrelated. The basic reproduction number of diseases is studied by the method of next generation matrix. Results show that, when homosexual contacts and heterosexual contacts all exist, once the disease is epidemic in the interior of male (female) population which is caused by male (female) homosexual transmissions, or the disease is epidemic between the two species which is caused by heterosexual transmissions, the disease must be epidemic in the whole population. Numerical simulations confirm the theoretical results.
Hoffmann, Nadine; Duft, Denis; Kiselev, Alexei; Leisner, Thomas
2013-04-01
The contact freezing of supercooled cloud droplets is one of the potentially important and the least investigated heterogeneous mechanism of ice formation in the tropospheric clouds [1]. On the time scales of cloud lifetime the freezing of supercooled water droplets via contact mechanism may occur at higher temperature compared to the same IN immersed in the droplet. However, the laboratory experiments of contact freezing are very challenging due to the number of factors affecting the probability of ice formation. In our experiment we study single water droplets freely levitated in the laminar flow of mineral dust particles acting as the contact freezing nuclei. By repeating the freezing experiment sufficient number of times we are able to reproduce statistical freezing behavior of large ensembles of supercooled droplets and measure the average rate of freezing events. We show that the rate of freezing at given temperature is governed only by the rate of droplet -particle collision and by the properties of the contact ice nuclei. In this contribution we investigate the relationship between the freezing probability and the size of mineral dust particle (represented by illite) and show that their IN efficiency scales with the particle size. Based on this observation, we discuss the similarity between the freezing of supercooled water droplets in immersion and contact modes and possible mechanisms of apparent enhancement of the contact freezing efficiency. [1] - K.C. Young, The role of contact nucleation in ice phase initiation in clouds, Journal of the Atmospheric Sciences 31, 1974
Les deux paramètres de base de la transmission
2013-01-01
La dynamique de la transmission de personne à personne qui inclut donc la transmission vectorielle peut être résumée par deux principaux paramètres : le taux de reproduction et l’intervalle sériel ou intergénérationnel (Anderson, May, 1991). 1. Le taux de reproduction Le taux de reproduction de base (R0 : nombre moyen de cas secondaires résultant, au sein d’une population susceptible et au niveau de laquelle aucune mesure de lutte n’est appliquée, du contact avec un sujet infectieux). Pour de...
A Nurse Communication Manager reduces the number of non‑relevant contacts
DEFF Research Database (Denmark)
Wright, Nana Keir; Seested Nielsen, Nina; Lauersen, Jannie
2015-01-01
Objective The aim of this study was to reduce interruptions in nursing practice by exploring the effects on the number of nonrelevant contacts received by the nursing staff after implementation of a Nurse Communication Manager. Design The study was designed as a pre/post interventional study. All...... in the surgical department. Interventions During the daytime a Nurse Communication Manager handled all incoming contacts irrespective of whether they were in person or by telephone. When the Nurse Communication Manager was not available and during the evening, night and weekends, telephone contacts were managed...... by an electronic Call Centre guiding the call to the care teams. Main outcome measure(s) The main outcome measures were the number of non-relevant contacts aimed at the nursing staff. Results Results showed a significant reduction in non-relevant contacts to the nursing staff from a mean of 80 contacts per day (SD...
International Nuclear Information System (INIS)
Tubbs, D.W.
1979-01-01
This report presents results of one of the geomorphological and hydrological studies that have been conducted for the release scenario analysis of the Waste Isolation Safety Assessment Program (WISAP). Three general topics are considered: (1) determination of rates of denudation, (2) estimation of the probability of flooding due to each of several causes, and (3) evaluation of other surface processes that should be considered in the release scenario analysis. The third general topic was ultimately narrowed to the possible effects of landsliding. Rates of erosion are expressed as centimeters per 100 years, except that the original units are retained in figures taken from other sources. Probabilities are also expressed per 100 years
Failure frequencies and probabilities applicable to BWR and PWR piping
International Nuclear Information System (INIS)
Bush, S.H.; Chockie, A.D.
1996-03-01
This report deals with failure probabilities and failure frequencies of nuclear plant piping and the failure frequencies of flanges and bellows. Piping failure probabilities are derived from Piping Reliability Analysis Including Seismic Events (PRAISE) computer code calculations based on fatigue and intergranular stress corrosion as failure mechanisms. Values for both failure probabilities and failure frequencies are cited from several sources to yield a better evaluation of the spread in mean and median values as well as the widths of the uncertainty bands. A general conclusion is that the numbers from WASH-1400 often used in PRAs are unduly conservative. Failure frequencies for both leaks and large breaks tend to be higher than would be calculated using the failure probabilities, primarily because the frequencies are based on a relatively small number of operating years. Also, failure probabilities are substantially lower because of the probability distributions used in PRAISE calculations. A general conclusion is that large LOCA probability values calculated using PRAISE will be quite small, on the order of less than 1E-8 per year (<1E-8/year). The values in this report should be recognized as having inherent limitations and should be considered as estimates and not absolute values. 24 refs 24 refs
Formation of a contact binary star system
International Nuclear Information System (INIS)
Mullen, E.F.F.
1974-01-01
The process of forming a contact binary star system is investigated in the light of current knowledge of the W Ursae Majoris type eclipsing binaries and the current rotational braking theories for contracting stars. A preliminary stage of mass transfer is proposed and studied through the use of a computer program which calculates evolutionary model sequences. The detailed development of both stars is followed in these calculations, and findings regarding the internal structure of the star which is receiving the mass are presented. Relaxation of the mass-gaining star is also studied; for these stars of low mass and essentially zero age, the star eventually settles to a state very similar to a zero-age main sequence star of the new mass. A contact system was formed through these calculations; it exhibits the general properties of a W Ursae Majoris system. The initial masses selected for the calculation were 1.29 M/sub solar mass/ and 0.56 M/sub solar mass/. An initial mass transfer rate of about 10 -10 solar masses per year gradually increased to about 10 -8 solar masses per year. After about 2.5 x 10 7 years, the less massive star filled its Roche lobe and an initial contact system was obtained. The final masses were 1.01359 M/sub solar mass/ and 0.83641 M/sub solar mass/. The internal structure of the secondary component is considerably different from that of a main sequence star of the same mass
Allergic contact dermatitis to fragrance: a review.
Scheinman, P L
1996-06-01
Allergy to fragrance is the most common cause of cosmetic contact dermatitis and therefore constitutes a significant clinical problem. The widespread use of fragranced materials in skin care and household products is probably the most important reason for the high incidence of fragrance sensitization. This report will summarize the history of fragrance, review how to detect and evaluate fragrance allergy, discuss the problems inherent in patch testing with the fragrance mix and its constituents, describe systemic contact dermatitis from ingestion of certain flavors, and give suggestions for fragrance-sensitive patients. The use of fragrance mix in patch testing has been invaluable in detecting fragrance allergy. Continued investigation into positive patch test responses to fragrance in scented products is essential in helping to identify new fragrance allergens. Additionally, more cooperation is necessary between industry and dermatologists in assisting patients to avoid proven allergens.
Tooth contact analysis of spur gears. Part 1-SAM analysis of standard gears
Directory of Open Access Journals (Sweden)
Creţu Spiridon
2017-01-01
Full Text Available The involute gears are sensitive to the misalignment of their axes which determines transmission errors and perturbations of pressures distributions along the tooth flank. The concentrated contacts in gears are no longer as Hertz type. A semi-analytical method was developed to find the contact area, pressures distribution and depth stresses state. The matrix of initial separations is found analytically for standard and non-standard spur gears. The presence of misalignment as well as the flank crowning and flank end relief are included in the numerical analysis process.
Crabb, Helen Kathleen; Allen, Joanne Lee; Devlin, Joanne Maree; Firestone, Simon Matthew; Stevenson, Mark Anthony; Gilkerson, James Rudkin
2018-05-01
To better understand factors influencing infectious agent dispersal within a livestock population information is needed on the nature and frequency of contacts between farm enterprises. This study uses social network analysis to describe the contact network within a vertically integrated broiler poultry enterprise to identify the potential horizontal and vertical transmission pathways for Salmonella spp. Nodes (farms, sheds, production facilities) were identified and the daily movement of commodities (eggs, birds, feed, litter) and people between nodes were extracted from routinely kept farm records. Three time periods were examined in detail, 1- and 8- and 17-weeks of the production cycle and contact networks were described for all movements, and by commodity and production type. All nodes were linked by at least one movement during the study period but network density was low indicating that all potential pathways between nodes did not exist. Salmonella spp. transmission via vertical or horizontal pathways can only occur along directed pathways when those pathways are present. Only two locations (breeder or feed nodes) were identified where the transmission of a single Salmonella spp. clone could theoretically percolate through the network to the broiler or processing nodes. Only the feed transmission pathway directly connected all parts of the network. Copyright © 2017 Elsevier Ltd. All rights reserved.
On the probability of extinction of the Haiti cholera epidemic
Bertuzzo, Enrico; Finger, Flavio; Mari, Lorenzo; Gatto, Marino; Rinaldo, Andrea
2014-05-01
Nearly 3 years after its appearance in Haiti, cholera has already exacted more than 8,200 deaths and 670,000 reported cases and it is feared to become endemic. However, no clear evidence of a stable environmental reservoir of pathogenic Vibrio cholerae, the infective agent of the disease, has emerged so far, suggesting that the transmission cycle of the disease is being maintained by bacteria freshly shed by infected individuals. Thus in principle cholera could possibly be eradicated from Haiti. Here, we develop a framework for the estimation of the probability of extinction of the epidemic based on current epidemiological dynamics and health-care practice. Cholera spreading is modelled by an individual-based spatially-explicit stochastic model that accounts for the dynamics of susceptible, infected and recovered individuals hosted in different local communities connected through hydrologic and human mobility networks. Our results indicate that the probability that the epidemic goes extinct before the end of 2016 is of the order of 1%. This low probability of extinction highlights the need for more targeted and effective interventions to possibly stop cholera in Haiti.
A birth cohort analysis of dental contact among elderly Americans.
Wolinsky, F D; Arnold, C L
1989-01-01
We applied standard cohort and multiple regression techniques to data on the dental utilization rates of 129,191 elderly individuals taken from the 1972, 1973, 1976, 1977, 1980, and 1981 Health Interview Surveys. The results indicate that the marked variation in dental contact rates is a reflection of cohort succession, and not a function of aging per se. Older cohorts having lower dental contact rates are being replaced by younger cohorts having higher dental contact rates. The dental contact rates of the individual birth cohorts themselves are quite stable over time. The results also indicate that economic barriers (especially liquid assets) have become more important than ever before, especially for the oldest-old. These findings have important implications for public policy about the oral health and health care of elderly Americans. PMID:2783297
Ohmic contacts on n-type β-Ga2O3 using AZO/Ti/Au
Directory of Open Access Journals (Sweden)
Patrick H. Carey IV
2017-09-01
Full Text Available AZO interlayers between n-Ga2O3 and Ti/Au metallization significantly enhance Ohmic contact formation after annealing at ≥ 300°C. Without the presence of the AZO, similar anneals produce only rectifying current-voltage characteristics. Transmission Line Measurements of the Au/Ti/AZO/Ga2O3 stacks showed the specific contact resistance and transfer resistance decreased sharply from as-deposited values with annealing. The minimum contact resistance and specific contact resistance of 0.42 Ω-mm and 2.82 × 10-5 Ω-cm2 were achieved after a relatively low temperature 400°C annealing. The conduction band offset between AZO and Ga2O3 is 0.79 eV and provides a favorable pathway for improved electron transport across this interface.
Ohmic contacts on n-type β-Ga2O3 using AZO/Ti/Au
Carey, Patrick H.; Yang, Jiancheng; Ren, F.; Hays, David C.; Pearton, S. J.; Jang, Soohwan; Kuramata, Akito; Kravchenko, Ivan I.
2017-09-01
AZO interlayers between n-Ga2O3 and Ti/Au metallization significantly enhance Ohmic contact formation after annealing at ≥ 30 0°C. Without the presence of the AZO, similar anneals produce only rectifying current-voltage characteristics. Transmission Line Measurements of the Au/Ti/AZO/Ga2O3 stacks showed the specific contact resistance and transfer resistance decreased sharply from as-deposited values with annealing. The minimum contact resistance and specific contact resistance of 0.42 Ω-mm and 2.82 × 10-5 Ω-cm2 were achieved after a relatively low temperature 40 0°C annealing. The conduction band offset between AZO and Ga2O3 is 0.79 eV and provides a favorable pathway for improved electron transport across this interface.
1992-10-01
correction of ametropia never has been a subject of major approximately a 1% incidence per year for corneal ulcers concern in the past. For various...corneal ulcers than other contact lens users. Unfortunately, k. A central clinical data registry for each military their statistics are based on cases...worrisome statistic , when one considers that most are easier to remove, although caution must be used to aircrew are males. All of the military services
Improvements in or relating to data transmission in radiographic apparatus
International Nuclear Information System (INIS)
Fairbairn, I.A.
1980-01-01
In conventional tomography, the source and detector are rotated about the patient axis through angles which are usually less than 360 0 and hence conventional data transmission via cables is possible. However, greater speed of examination can be obtained if the rotation extends through many revolutions thus allowing a high rotational velocity to be obtained before the examination commences. In such an apparatus, the data transmission is performed by encoding an AC signal which can then be transmitted by a series of slip rings and brushes. Suitable codes for AC transmission are discussed. The problems of good contact between brushes and slip rings at high speed are discussed and it is shown that, by choosing a suitable AC code and its associated electrical circuits, spurious signals are eliminated. (U.K.)
Mori, Ryosuke; Matsuya, Yusuke; Yoshii, Yuji; Date, Hiroyuki
2018-05-01
DNA double-strand breaks (DSBs) are thought to be the main cause of cell death after irradiation. In this study, we estimated the probability distribution of the number of DSBs per cell nucleus by considering the DNA amount in a cell nucleus (which depends on the cell cycle) and the statistical variation in the energy imparted to the cell nucleus by X-ray irradiation. The probability estimation of DSB induction was made following these procedures: (i) making use of the Chinese Hamster Ovary (CHO)-K1 cell line as the target example, the amounts of DNA per nucleus in the logarithmic and the plateau phases of the growth curve were measured by flow cytometry with propidium iodide (PI) dyeing; (ii) the probability distribution of the DSB number per cell nucleus for each phase after irradiation with 1.0 Gy of 200 kVp X-rays was measured by means of γ-H2AX immunofluorescent staining; (iii) the distribution of the cell-specific energy deposition via secondary electrons produced by the incident X-rays was calculated by WLTrack (in-house Monte Carlo code); (iv) according to a mathematical model for estimating the DSB number per nucleus, we deduced the induction probability density of DSBs based on the measured DNA amount (depending on the cell cycle) and the calculated dose per nucleus. The model exhibited DSB induction probabilities in good agreement with the experimental results for the two phases, suggesting that the DNA amount (depending on the cell cycle) and the statistical variation in the local energy deposition are essential for estimating the DSB induction probability after X-ray exposure.
Dynamics of tuberculosis transmission with exogenous reinfections and endogenous reactivation
Khajanchi, Subhas; Das, Dhiraj Kumar; Kar, Tapan Kumar
2018-05-01
We propose and analyze a mathematical model for tuberculosis (TB) transmission to study the role of exogenous reinfection and endogenous reactivation. The model exhibits two equilibria: a disease free and an endemic equilibria. We observe that the TB model exhibits transcritical bifurcation when basic reproduction number R0 = 1. Our results demonstrate that the disease transmission rate β and exogenous reinfection rate α plays an important role to change the qualitative dynamics of TB. The disease transmission rate β give rises to the possibility of backward bifurcation for R0 < 1, and hence the existence of multiple endemic equilibria one of which is stable and another one is unstable. Our analysis suggests that R0 < 1 may not be sufficient to completely eliminate the disease. We also investigate that our TB transmission model undergoes Hopf-bifurcation with respect to the contact rate β and the exogenous reinfection rate α. We conducted some numerical simulations to support our analytical findings.