Role of wild-type p53 in apoptotic and non-apoptotic cell death induced by X-irradiation and heat treatment in p53-mutated mouse M10 cells

International Nuclear Information System (INIS)

Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio

2010-01-01

The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)

p53 functions as a cell cycle control protein in osteosarcomas.

OpenAIRE

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-01-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

p53 functions as a cell cycle control protein in osteosarcomas.

Science.gov (United States)

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-11-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

p53 functions as a cell cycle control protein in osteosarcomas.

Science.gov (United States)

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-01-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

International Nuclear Information System (INIS)

Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

2005-01-01

Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

Science.gov (United States)

2003-01-01

Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

A Biomimic Reconstituted High-Density-Lipoprotein-Based Drug and p53 Gene Co-delivery System for Effective Antiangiogenesis Therapy of Bladder Cancer

Science.gov (United States)

Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao

2015-07-01

A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.

Gene expression patterns associated with p53 status in breast cancer

International Nuclear Information System (INIS)

Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

2006-01-01

Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

Effect of p53 genotype on gene expression profiles in murine liver

International Nuclear Information System (INIS)

Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

2008-01-01

The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

The p53 gene with emphasis on its paralogues in mosquitoes

Directory of Open Access Journals (Sweden)

Tien-Huang Chen

2017-12-01

Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

Science.gov (United States)

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Delayed expression of apoptosis in X-irradiated human leukemic MOLT-4 cells transfected with mutant p53

International Nuclear Information System (INIS)

Nakano, Hisako; Yonekawa, Hiromichi; Shinohara, Kunio

2003-01-01

The effects of X-rays on cell survival, apoptosis, and long-term response in the development of cell death as measured by the dye exclusion test were studied in human leukemic MOLT-4 cells (p53 wild-type) stably transfected with a mutant p53 cDNA expression vector. Cell survival, as determined from colony-forming ability, was increased in an expression level dependent manner, but the increase was partial even with the highest-expressing clone (B3). This contrasts with the prior observation that cell death and apoptosis in B3 are completely inhibited at 24 h after irradiation with 1.8 Gy of X-rays. The examination of B3 cells incubated for longer than 24 h after X-irradiation showed a delay in the induction of cell death and apoptosis. Western blot analysis revealed that the time required to reach the highest level of wild-type p53 protein in B3 was longer than the time in MOLT-4 and that the p53 may be stabilized by the phosphorylation at Ser-15. These results suggest that the introduction of mutant p53 into MOLT-4 merely delays the development of apoptosis, during which the cells could repair the damage induced by X-rays, and results in the partial increase in cell survival. (author)

Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

Directory of Open Access Journals (Sweden)

Christian Bressy

2017-06-01

Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

International Nuclear Information System (INIS)

Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

2006-01-01

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

Energy Technology Data Exchange (ETDEWEB)

Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

2006-02-22

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

Directory of Open Access Journals (Sweden)

Rejane Mattar

2004-01-01

Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

p53 tumor suppressor gene: significance in neoplasia - a review

International Nuclear Information System (INIS)

Alam, J.M.

2000-01-01

p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

International Nuclear Information System (INIS)

Wei Tang; Powell, Simon N.

1996-01-01

Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

Stimulation of autophagy by the p53 target gene Sestrin2.

Science.gov (United States)

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

International Nuclear Information System (INIS)

Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

1995-01-01

G1/S arrest. Cell cycle checkpoint arrest in response to 4 or 8 Gy X-rays was measured without caffeine and with 0.5 and 2mM caffeine. In (+/+) cells, G1/S and G2/M arrest was seen and there was no demonstrable impact of caffeine at either dose on either checkpoint. By contrast (-/-) cells showed a clear reduction (50%) of the size of G2/M arrest at 0.5mM caffeine and complete override at 2mM caffeine. These data imply that cells which lack p53, are sensitized by low-dose caffeine and their G2/M checkpoint is altered, seen by the different effects of caffeine upon G2/M override. Tumor cells which do and do not have functional p53 have also been evaluated. Preliminary data suggest a similar conclusion can be drawn. MCF-7 cells transfected with control plasmid or plasmids containing the gene for HPV-E6 protein also show sensitization with low dose caffeine only in cells which have E6. Conclusions: The greater caffeine-induced radiosensitization in p53(-) cells suggests that p53, already shown to control the G1/S checkpoint, may also influence aspects of G2/M arrest. These data indicate an opportunity for therapeutic gain by combining DNA damaging agents with compounds that disrupt G2/M arrest in tumors lacking functional p53. The role of p53 in G2/M transition remains to be defined

Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

International Nuclear Information System (INIS)

Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

2014-01-01

Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

Science.gov (United States)

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

Energy Technology Data Exchange (ETDEWEB)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4�

Ultrasonic destruction of albumin microbubbles enhances gene transfection and expression in cardiac myocytes.

Science.gov (United States)

Wang, Guo-zhong; Liu, Jing-hua; Lü, Shu-zheng; Lü, Yun; Guo, Cheng-jun; Zhao, Dong-hui; Fang, Dong-ping; He, Dong-fang; Zhou, Yuan; Ge, Chang-jiang

2011-05-01

It has been proven that ultrasonic destruction of microbubbles can enhance gene transfection efficiency into the noncardiac cells, but there are few reports about cardiac myocytes. Moreover, the exact mechanisms are not yet clear; whether the characteristic of microbubbles can affect the gene transfection efficiency or not is still controversial. This study was designed to investigate whether the ultrasound destruction of gene-loaded microbubbles could enhance the plasmids carried reporter gene transfection in primary cultured myocardial cell, and evaluate the effects of microbubbles characteristics on the transgene expression in cardiac myocytes. The β-galactosidase plasmids attached to the two types of microbubbles, air-contained sonicated dextrose albumin (ASDA) and perfluoropropane-exposed sonicated dextrose albumin (PESDA) were prepared. The gene transfection into cardiac myocytes was performed in vitro by naked plasmids, ultrasound exposure, ultrasonic destruction of gene-loaded microbubbles and calcium phosphate precipitation, and then the gene expression and cell viability were analyzed. The ultrasonic destruction of gene-loaded microbubbles enhanced gene expression in cardiac myocytes compared with naked plasmid transfection ((51.95 ± 2.41) U/g or (29.28 ± 3.65) U/g vs. (0.84 ± 0.21) U/g, P ASDA ((51.95 ± 2.41) U/g vs. (29.28 ± 3.65) U/g, P < 0.05). Ultrasonic destruction of microbubbles during calcium phosphate precipitation gene transfection enhanced β-galactosidase activity nearly 8-fold compared with calcium phosphate precipitation gene transfection alone ((111.35 ± 11.21) U/g protein vs. (14.13 ± 2.58) U/g protein, P < 0.01). Even 6 hours after calcium phosphate precipitation gene transfection, ultrasound-mediated microbubbles destruction resulted in more intense gene expression ((35.63 ± 7.65) U/g vs. (14.13 ± 2.58) U/g, P < 0.05). Ultrasonic destruction of microbubbles might be a promising method for the delivery of non-viral DNA into

Experimental Model of Gene Transfection in Healthy Canine Myocardium: Perspectives of Gene Therapy for Ischemic Heart Disease

Directory of Open Access Journals (Sweden)

Renato A. K. Kalil

2002-09-01

Full Text Available OBJECTIVE: To assess the transfection of the gene that encodes green fluorescent protein (GFP through direct intramyocardial injection. METHODS: The pREGFP plasmid vector was used. The EGFP gene was inserted downstream from the constitutive promoter of the Rous sarcoma virus. Five male dogs were used (mean weight 13.5 kg, in which 0.5 mL of saline solution (n=1 or 0.5 mL of plasmid solution containing 0.5 µg of pREGFP/dog (n=4 were injected into the myocardium of the left ventricular lateral wall. The dogs were euthanized 1 week later, and cardiac biopsies were obtained. RESULTS: Fluorescence microscopy showed differences between the cells transfected and not transfected with pREGFP plasmid. Mild fluorescence was observed in the cardiac fibers that received saline solution; however, the myocardial cells transfected with pREGFP had overt EGFP expression. CONCLUSION: Transfection with the EGFP gene in healthy canine myocardium was effective. The reproduction of this efficacy using vascular endothelial growth factor (VEGF instead of EGFP aims at developing gene therapy for ischemic heart disease.

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

Science.gov (United States)

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Overexpression of p53 activated by small activating RNA suppresses the growth of human prostate cancer cells

Directory of Open Access Journals (Sweden)

Ge Q

2016-01-01

Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate

Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

Directory of Open Access Journals (Sweden)

Simon Leuchs

Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Inducement of radionuclides targeting therapy by gene transfection

International Nuclear Information System (INIS)

Luo Quanyong

2001-01-01

The author presents an overview of gene transfection methods to genetically induce tumor cells to express enhanced levels of cell surface antigens and receptors to intake radiolabeled antibody and peptide targeting and thus increase their therapeutic effect in radiotherapy. The current research include inducement of radioimmunotherapy through CEA gene transfection, inducement of iodine-131 therapy by sodium iodide symporter gene transfection and inducement of MIBG therapy by noradrenaline transporter gene transfection. These studies raise the prospect that gene-therapy techniques could be used to enable the treatment of a wide range of tumors with radiopharmaceuticals of established clinical acceptability

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

Energy Technology Data Exchange (ETDEWEB)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.

Science.gov (United States)

Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K

2017-01-01

The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.

Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.

Directory of Open Access Journals (Sweden)

Anup K Kundu

Full Text Available The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line.The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency.Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent.This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.

Isolation and characterization of DUSP11, a novel p53 target gene

DEFF Research Database (Denmark)

Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

2009-01-01

target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

International Nuclear Information System (INIS)

Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

2007-01-01

We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

A importância do gene p53 na carcinogênese humana The importance of the p53 gene in human carcinogenesis

Directory of Open Access Journals (Sweden)

Agnes C. Fett-Conte

2002-04-01

Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.

HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

Science.gov (United States)

Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

2018-03-01

HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Polymorphism at codon 36 of the p53 gene.

Science.gov (United States)

Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

1994-01-01

A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

International Nuclear Information System (INIS)

Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

2011-01-01

Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

Energy Technology Data Exchange (ETDEWEB)

Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

2011-11-04

Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

OTUD5 regulates p53 stability by deubiquitinating p53.

Directory of Open Access Journals (Sweden)

Judong Luo

Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

Science.gov (United States)

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

Science.gov (United States)

Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

2013-01-01

Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Results Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. Conclusion This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods. PMID:23799175

Non-viral transfection methods optimized for gene delivery to a lung cancer cell line.

Science.gov (United States)

Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

2013-04-01

Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods.

Multi-lipofection efficiently transfected genes into astrocytes in primary culture.

Science.gov (United States)

Wu, B Y; Liu, R Y; So, K L; Yu, A C

2000-10-30

This study demonstrated that liposome-mediated transfection - lipofection - is suitable for delivering genes into astrocytes. By repeatedly lipofecting the same astrocyte cultures, a process we call multi-lipofection, the transfection efficiency of the beta-galactosidase (beta-gal) gene was improved from 2.6+/-0.6 to 17. 4+/-1.1%. This is the highest efficiency ever reported in gene-transfer with Lipofectin(R) in a primary culture of mouse cerebral cortical astrocytes. Furthermore, multi-lipofection did not cause observable disturbance to astrocytes as indicated by insignificant changes in the glial fibrillary acidic protein content in the cultures. In order to demonstrate that the transfected gene achieved a physiologically relevant expression level, a plasmid containing the pEF-hsp70 protein gene was lipofected into astrocytes. This produced colonies of astrocytes showing an increased resistance to heat-induced cell death. A similar experiment was performed with the glial-derived neurotrophic factor (GDNF) gene. Control astrocytes had no detectable GDNF. In the transfected astrocytes, the GDNF protein could be identified intracellularly by immunocytochemistry. Western blot analysis revealed, as compared to astrocytes with one lipofection, a 2.9-fold increase of GDNF with four lipofections. GDNF remained detectable in astrocytes 2 weeks after four lipofections. Thus, multi-lipofection provides a mild and efficient means of delivering foreign genes into astrocytes in a primary culture, making astrocytes good candidate vehicle cells for gene/cell therapy in the CNS.

Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

Science.gov (United States)

Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

2005-04-01

The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

International Nuclear Information System (INIS)

Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

2001-01-01

Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Alterations in tumour suppressor gene p53 in human gliomas from ...

Indian Academy of Sciences (India)

Unknown

Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

International Nuclear Information System (INIS)

Irshad, S.; Nawaz, T.

2008-01-01

Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells

International Nuclear Information System (INIS)

Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.

2003-01-01

The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC

Status and advances of p53-gene therapy and radiotherapy in malignant tumor

International Nuclear Information System (INIS)

Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

2006-01-01

Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

OpenAIRE

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

Science.gov (United States)

Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

2011-12-01

Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

Enhanced transfection by antioxidative polymeric gene carrier that reduces polyplex-mediated cellular oxidative stress.

Science.gov (United States)

Lee, Min Sang; Kim, Nak Won; Lee, Kyuri; Kim, Hongtae; Jeong, Ji Hoon

2013-06-01

To test the hypothesis in which polyplex-induced oxidative stress may affect overall transfection efficiency, an antioxidative transfection system minimizing cellular oxidative stress was designed for enhanced transfection. An amphiphilic copolymer (PEI-PLGA) was synthesized and used as a micelle-type gene carrier containing hydrophobic antioxidant, α-tocopherol. Cellular oxidative stress and the change of mitochondrial membrane potential after transfection was measured by using a fluorescent probe (H₂DCFDA) and lipophilic cationic probe (JC-1), respectively. Transfection efficiency was determined by measuring a reporter gene (luciferase) expression level. The initial transfection study with conventional PEI/plasmid DNA polyplex showed significant generation of reactive oxygen species (ROS). The PEI-PLGA copolymer successfully carried out the simultaneous delivery of α-tocopherol and plasmid DNA (PEI-PLGA/Toco/pDNA polyplex) into cells, resulting in a significant reduction in cellular ROS generation after transfection and helped to maintain the mitochondrial membrane potential (ΔΨ). In addition, the transfection efficiency was dramatically increased using the antioxidative transfection system. This work showed that oxidative stress would be one of the important factors that should be considered in designing non-viral gene carriers and suggested a possible way to reduce the carrier-mediated oxidative stress, which consequently leads to enhanced transfection.

The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

Directory of Open Access Journals (Sweden)

Daniel Menendez

2011-03-01

Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

Gene Transfection Method Using Atmospheric Pressure Dielectric-Barrier Discharge Plasmas

Science.gov (United States)

Sasaki, Shota; Kanzaki, Makoto; Kaneko, Toshiro

2013-09-01

Gene transfection which is the process of deliberately introducing nucleic acids into cells is expected to play an important role in medical treatment because the process is necessary for gene therapy and creation of induced pluripotent stem (iPS) cells. However, the conventional transfection methods have some problems, so we focus attention on promising transfection methods by atmospheric pressure dielectric-barrier discharge (AP-DBD) plasmas. AP-DBD He plasmas are irradiated to the living cell covered with genes. Preliminarily, we use fluorescent dye YOYO-1 instead of the genes and use LIVE/DEAD Stain for cell viability test, and we analyze the transfection efficiency and cell viability under the various conditions. It is clarified that the transfection efficiency is strongly dependence on the plasma irradiation time and cell viability rates is high rates (>90%) regardless of long plasma irradiation time. These results suggest that ROS (Reactive Oxygen Species) and electric field generated by the plasma affect the gene transfection. In addition to this (the plasma irradiation time) dependency, we now investigate the effect of the plasma irradiation under the various conditions.

Repeated Gene Transfection Impairs the Engraftment of Transplanted Porcine Neonatal Pancreatic Cells

Directory of Open Access Journals (Sweden)

Min Koo Seo

2011-02-01

Full Text Available BackgroundPreviously, we reported that neonatal porcine pancreatic cells transfected with hepatocyte growth factor (HGF gene in an Epstein-Barr virus (EBV-based plasmid (pEBVHGF showed improved proliferation and differentiation compared to those of the control. In this study, we examined if pancreatic cells transfected repeatedly with pEBVHGF can be successfully grafted to control blood glucose in a diabetes mouse model.MethodsNeonatal porcine pancreatic cells were cultured as a monolayer and were transfected with pEBVHGF every other day for a total of three transfections. The transfected pancreatic cells were re-aggregated and transplanted into kidney capsules of diabetic nude mice or normal nude mice. Blood glucose level and body weight were measured every other day after transplantation. The engraftment of the transplanted cells and differentiation into beta cells were assessed using immunohistochemistry.ResultsRe-aggregation of the pancreatic cells before transplantation improved engraftment of the cells and facilitated neovascularization of the graft. Right before transplantation, pancreatic cells that were transfected with pEBVHGF and then re-aggregated showed ductal cell marker expression. However, ductal cells disappeared and the cells underwent fibrosis in a diabetes mouse model two to five weeks after transplantation; these mice also did not show controlled blood glucose levels. Furthermore, pancreatic cells transplanted into nude mice with normal blood glucose showed poor graft survival regardless of the type of transfected plasmid (pCEP4, pHGF, or pEBVHGF.ConclusionFor clinical application of transfected neonatal porcine pancreatic cells, further studies are required to develop methods of overcoming the damage for the cells caused by repeated transfection and to re-aggregate them into islet-like structures.

Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

Energy Technology Data Exchange (ETDEWEB)

Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

2012-07-13

Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

TAF6delta controls apoptosis and gene expression in the absence of p53.

Directory of Open Access Journals (Sweden)

Emmanuelle Wilhelm

Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

Depletion of 4-hydroxynonenal in hGSTA4-transfected HLE B-3 cells results in profound changes in gene expression

International Nuclear Information System (INIS)

Patrick, Brad; Li Jie; Jeyabal, Prince V.S.; Reddy, Prasada M.R.V.; Yang Yusong; Sharma, Rajendra; Sinha, Mala; Luxon, Bruce; Zimniak, Piotr; Awasthi, Sanjay; Awasthi, Yogesh C.

2005-01-01

Previously, we have shown that overexpression of 4-hydroxy-2-nonenal (HNE)-detoxifying enzyme glutathione S-transferase A4-4 (hGSTA4-4) in human lens epithelial cells (HLE B-3) leads to pro-carcinogenic phenotypic transformation of these cells [R. Sharma, et al. Eur. J. Biochem. 271 (2004) 1960-1701]. We now demonstrate that hGSTA4-transfection also causes a profound change in the expression of genes involved in cell adhesion, cell cycle control, proliferation, cell growth, and apoptosis, which is consistent with phenotypic changes of the transformed cells. The expression of p53, p21, p16, fibronectin 1, laminin γ1, connexin 43, Fas, integrin α6, TGFα, and c-jun was down-regulated, while the expression of protein kinase C beta II (PKCβII), c-myc, cyclin-dependent kinase 2 (CDK2), and TGFβ was up-regulated in transfected cells. These results demonstrate that HNE serves as a crucial signaling molecule and, by modulating the expression of genes, can influence cellular functions

Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

International Nuclear Information System (INIS)

Tong, Ying; Smith, M.A.; Tucker, S.B.

1997-01-01

Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

OpenAIRE

Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

2013-01-01

Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize deliver...

Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres

International Nuclear Information System (INIS)

Ji, Qing; Hao, Xinbao; Meng, Yang; Zhang, Min; DeSano, Jeffrey; Fan, Daiming; Xu, Liang

2008-01-01

MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be

Amiloride-enhanced gene transfection of octa-arginine functionalized calcium phosphate nanoparticles.

Directory of Open Access Journals (Sweden)

Juan Ramón Vanegas Sáenz

Full Text Available Nanoparticles represent promising gene delivery systems in biomedicine to facilitate prolonged gene expression with low toxicity compared to viral vectors. Specifically, nanoparticles of calcium phosphate (nCaP, the main inorganic component of human bone, exhibit high biocompatibility and good biodegradability and have been reported to have high affinity for protein or DNA, having thus been used as gene transfer vectors. On the other hand, Octa-arginine (R8, which has a high permeability to cell membrane, has been reported to improve intracellular delivery systems. Here, we present an optimized method for nCaP-mediated gene delivery using an octa-arginine (R8-functionalized nCaP vector containing a marker or functional gene construct. nCaP particle size was between 220-580 nm in diameter and all R8-functionalized nCaPs carried a positive charge. R8 concentration significantly improved nCaP transfection efficiency with high cell compatibility in human mesenchymal stem cells (hMSC and human osteoblasts (hOB in particular, suggesting nCaPs as a good option for non-viral vector gene delivery. Furthermore, pre-treatment with different endocytosis inhibitors identified that the endocytic pathway differed among cell lines and functionalized nanoparticles, with amiloride increasing transfection efficiency of R8-functionalized nCaPs in hMSC and hOB.

Activities of wildtype and mutant p53 in suppression of homologous recombination as measured by a retroviral vector system

International Nuclear Information System (INIS)

Lu Xiongbin; Lozano, Guillermina; Donehower, Lawrence A.

2003-01-01

DNA repair of double strand breaks, interstrand DNA cross-links, and other types of DNA damage utilizes the processes of homologous recombination and non-homologous end joining to repair the damage. Aberrant homologous recombination is likely to be responsible for a significant fraction of chromosomal deletions, duplications, and translocations that are observed in cancer cells. To facilitate measurement of homologous recombination frequencies in normal cells, mutant cells, and cancer cells, we have developed a high titer retroviral vector containing tandem repeats of mutant versions of a GFP-Zeocin resistance fusion gene and an intact neomycin resistance marker. Recombination between the tandem repeats regenerates a functional GFP-Zeo R marker that can be easily scored. This retroviral vector was used to assess homologous recombination frequencies in human cancer cells and rodent fibroblasts with differing dosages of wild type or mutant p53. Absence of wild type p53 stimulated spontaneous and ionizing radiation-induced homologous recombination, confirming previous studies. Moreover, p53 +/- mouse fibroblasts show elevated levels of homologous recombination compared to their p53 +/+ counterparts following retroviral vector infection, indicating that p53 is haploinsufficient for suppression of homologous recombination. Transfection of vector-containing p53 null Saos-2 cells with various human cancer-associated p53 mutants revealed that these altered p53 proteins retain some recombination suppression function despite being totally inactive for transcriptional transactivation. The retroviral vector utilized in these studies may be useful in performing recombination assays on a wide array of cell types, including those not readily transfected by normal vectors

Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation

International Nuclear Information System (INIS)

Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY

1996-01-01

Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)

Transcriptional regulation of the p73 gene, a member of the p53 family, by early growth response-1 (Egr-1)

International Nuclear Information System (INIS)

Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong

2007-01-01

To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression

Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status

International Nuclear Information System (INIS)

Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki

2004-01-01

We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)

The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

International Nuclear Information System (INIS)

Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

2010-01-01

To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

Science.gov (United States)

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

International Nuclear Information System (INIS)

Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

2009-01-01

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

Energy Technology Data Exchange (ETDEWEB)

Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

2009-09-04

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

Science.gov (United States)

Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

2012-06-01

Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

Ultrasound-mediated vascular gene transfection by cavitation of endothelial-targeted cationic microbubbles.

Science.gov (United States)

Xie, Aris; Belcik, Todd; Qi, Yue; Morgan, Terry K; Champaneri, Shivam A; Taylor, Sarah; Davidson, Brian P; Zhao, Yan; Klibanov, Alexander L; Kuliszewski, Michael A; Leong-Poi, Howard; Ammi, Azzdine; Lindner, Jonathan R

2012-12-01

Ultrasound-mediated gene delivery can be amplified by acoustic disruption of microbubble carriers that undergo cavitation. We hypothesized that endothelial targeting of microbubbles bearing cDNA is feasible and, through optimizing proximity to the vessel wall, increases the efficacy of gene transfection. Contrast ultrasound-mediated gene delivery is a promising approach for site-specific gene therapy, although there are concerns with the reproducibility of this technique and the safety when using high-power ultrasound. Cationic lipid-shelled decafluorobutane microbubbles bearing a targeting moiety were prepared and compared with nontargeted microbubbles. Microbubble targeting efficiency to endothelial adhesion molecules (P-selectin or intercellular adhesion molecule [ICAM]-1) was tested using in vitro flow chamber studies, intravital microscopy of tumor necrosis factor-alpha (TNF-α)-stimulated murine cremaster muscle, and targeted contrast ultrasound imaging of P-selectin in a model of murine limb ischemia. Ultrasound-mediated transfection of luciferase reporter plasmid charge coupled to microbubbles in the post-ischemic hindlimb muscle was assessed by in vivo optical imaging. Charge coupling of cDNA to the microbubble surface was not influenced by the presence of targeting ligand, and did not alter the cavitation properties of cationic microbubbles. In flow chamber studies, surface conjugation of cDNA did not affect attachment of targeted microbubbles at microvascular shear stresses (0.6 and 1.5 dyne/cm(2)). Attachment in vivo was also not affected by cDNA according to intravital microscopy observations of venular adhesion of ICAM-1-targeted microbubbles and by ultrasound molecular imaging of P-selectin-targeted microbubbles in the post-ischemic hindlimb in mice. Transfection at the site of high acoustic pressures (1.0 and 1.8 MPa) was similar for control and P-selectin-targeted microbubbles but was associated with vascular rupture and hemorrhage. At 0.6 MPa

Rat embryo cells immortalized with transfected oncogenes are transformed by gamma irradiation.

Science.gov (United States)

Endlich, B; Salavati, R; Sullivan, T; Ling, C C

1992-12-01

Cesium-137 gamma rays were used to transform rat embryo cells (REC) which were first transfected with activated c-myc or c-Ha-ras oncogenes to produce immortal cell lines (REC:myc and REC:ras). When exposed to 6 Gy of 137Cs gamma rays, some cells became morphologically transformed with focus formation frequencies of approximately 3 x 10(-4) for REC:myc and approximately 1 x 10(-4) for REC:ras, respectively. Cells isolated from foci of gamma-ray-transformed REC:myc (REC:myc:gamma) formed anchorage-independent colonies and were tumorigenic in nude mice, but foci from gamma-ray-transformed REC:ras (REC:ras:gamma) did not exhibit either of these criteria of transformation. Similar to the results with gamma irradiation, we observed a sequence-dependent phenomenon when myc and ras were transfected into REC, one at a time. REC immortalized by ras transfection were not converted to a tumorigenic phenotype by secondary transfection with myc, but REC transfected with myc were very susceptible to transformation by subsequent ras transfection. This suggests that myc-immortalized cells are more permissive to transformation via secondary treatments. In sequentially transfected REC, myc expression was high whether it was transfected first or second, whereas ras expression was highest when the ras gene was transfected secondarily into myc-containing REC. Molecular analysis of REC:ras:gamma transformants showed no alterations in structure of the transfected ras or of the endogenous ras, myc, p53, or fos genes. The expression of ras and p53 was increased in some isolates of REC:ras:gamma, but myc and fos expression were not affected. Similarly, REC:myc:gamma transformants did not demonstrate rearrangement or amplification of the transfected or the endogenous myc genes, or of the potentially cooperating Ha-, Ki-, or N-ras genes. Northern hybridization analysis revealed increased expression of N-ras in two isolates, REC:myc:gamma 33 and gamma 41, but no alterations in the expression

p53 in differentiation of thyroid cancer

International Nuclear Information System (INIS)

Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

1993-01-01

P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

Mutant p53 protein localized in the cytoplasm inhibits autophagy.

Science.gov (United States)

Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

2008-10-01

The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

Science.gov (United States)

Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

2016-04-01

P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

Science.gov (United States)

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

BRCA1 Expression is an Important Biomarker for Chemosensitivity: Suppression of BRCA1 Increases the Apoptosis via Up-regulation of p53 and p21 During Cisplatin Treatment in Ovarian Cancer Cells

Directory of Open Access Journals (Sweden)

Ikuo Konishi

2006-01-01

Full Text Available BRCA1 is a tumor suppressor which plays a crucial role in the repair of DNA double-strand breaks, and its abnormality is responsible for hereditary ovarian cancer syndrome. It has recently been reported that reduced expression of BRCA1 is also common in sporadic ovarian carcinoma via its promoter hypermethylation, and that ovarian carcinoma patients negative for BRCA1 expression showed favorable prognosis. To address if BRCA1 expression plays a role in the chemotherapeutic response, we analyzed the effect of BRCA1 suppression on the sensitivity to cisplatin and paclitaxel in ovarian cancer cells. Specific siRNA for BRCA1 gene was transfected into 3 ovarian cancer cell lines with various p53 status. Reduced expression of BRCA1 by transfection of BRCA1-siRNA resulted in a 5.3-fold increase in sensitivity to cisplatin in p53-wild A2780 cells, but not in p53-mutated A2780/CDDP and p53-deleted SKOV3 cells. Regarding the sensitivity to paclitaxel, BRCA1 suppression caused no significant changes in all the 3 cell lines. For ionizing radiation sensitivity, BRCA1 suppression also showed a significant higher sensitivity in A2780 cells. Growth curve and cell cycle analyses showed no signifi cant differences between BRCA1-siRNA-transfected A2780 cells and control cells. However, cisplatin treatment under suppression of BRCA1 showed a significantly increased apoptosis along with up-regulation of p53 and p21 in A2780 cells. Accordingly, reduced expression of BRCA1 enhances the cisplatin sensitivity and apoptosis via up-regulation of p53 and p21, but does not affect the paclitaxel sensitivity. Expression of BRCA1 might be an important biomarker for cisplatin resistance in ovarian carcinoma.

Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

International Nuclear Information System (INIS)

Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

2008-01-01

Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

Science.gov (United States)

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Ultrasound-mediated interferon β gene transfection inhibits growth of malignant melanoma

International Nuclear Information System (INIS)

Yamaguchi, Kazuki; Feril, Loreto B.; Tachibana, Katsuro; Takahashi, Akira; Matsuo, Miki; Endo, Hitomi; Harada, Yoshimi; Nakayama, Juichiro

2011-01-01

Highlights: → Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-β genes both in vitro and in vivo. → Ultrasound-mediated IFN-β transfection inhibited proliferation of melanoma cells in vitro. → Ultrasound-mediated IFN-β transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon β (IFN-β) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-β in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-β genes mixed with microbubbles. Successful sonotransfection with IFN-β gene in vitro was confirmed by ELISA, which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-β gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.

Membrane fusion inducers, chloroquine and spermidine increase lipoplex-mediated gene transfection

International Nuclear Information System (INIS)

Wong-Baeza, Carlos; Bustos, Israel; Serna, Manuel; Tescucano, Alonso; Alcantara-Farfan, Veronica; Ibanez, Miguel; Montanez, Cecilia; Wong, Carlos; Baeza, Isabel

2010-01-01

Gene transfection into mammalian cells can be achieved with viral and non-viral vectors. Non-viral vectors, such as cationic lipids that form lipoplexes with DNA, are safer and more stable than viral vectors, but their transfection efficiencies are lower. Here we describe that the simultaneous treatment with a membrane fusion inducer (chlorpromazine or procainamide) plus the lysosomotropic agent chloroquine increases lipoplex-mediated gene transfection in human (HEK293 and C-33 A) and rat (PC12) cell lines (up to 9.2-fold), as well as in situ in BALB/c mice spleens and livers (up to 6-fold); and that the polyamine spermidine increases lipoplex-mediated gene transfection and expression in cell cultures. The use of these four drugs provides a novel, safe and relatively inexpensive way to considerably increase lipoplex-mediated gene transfection efficiency.

Effect of albumin and dextrose concentration on ultrasound and microbubble mediated gene transfection in vivo.

Science.gov (United States)

Browning, Richard J; Mulvana, Helen; Tang, Meng-Xing; Hajnal, Jo V; Wells, Dominic J; Eckersley, Robert J

2012-06-01

Ultrasound and microbubble mediated gene transfection has great potential for site-selective, safe gene delivery. Albumin-based microbubbles have shown the greatest transfection efficiency but have not been optimised specifically for this purpose. Additionally, few studies have highlighted desirable properties for transfection specific microbubbles. In this article, microbubbles were made with 2% or 5% (w/v) albumin and 20% or 40% (w/v) dextrose solutions, yielding four distinct bubble types. These were acoustically characterised and their efficiency in transfecting a luciferase plasmid (pGL4.13) into female, CD1 mice myocardia was measured. For either albumin concentration, increasing the dextrose concentration increased scattering, attenuation and resistance to ultrasound, resulting in significantly increased transfection. A significant interaction was noted between albumin and dextrose; 2% albumin bubbles made with 20% dextrose showed the least transfection but the most transfection with 40% dextrose. This trend was seen for both nonlinear scattering and attenuation behaviour but not for resistance to ultrasound or total scatter. We have determined that the attenuation behaviour is an important microbubble characteristic for effective gene transfection using ultrasound. Microbubble behaviour can also be simply controlled by altering the initial ingredients used during manufacture. Copyright © 2012 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

Directory of Open Access Journals (Sweden)

Jeyran eShahbazi

2013-05-01

Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

Directory of Open Access Journals (Sweden)

Alfredo Ribeiro-Silva

2003-06-01

Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

Directory of Open Access Journals (Sweden)

Jennifer M. Smith

2007-12-01

Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

Dose selenomethionine have radio-protective effect on cell lines with wild type p53?

International Nuclear Information System (INIS)

Tsuji, K.; Hagihira, T.; Ohnishi, K.; Ohnishi, T.; Matsumoto, H.

2003-01-01

Full text: Selenium compounds are known to have cancer preventive effects. It is reported recently that selenium in the form of selenomethionine (SeMet) can protect cells with wild type p53 from UV-induced cell killing by activating the DNA repair mechanism of p53 tumor suppressor protein via redox factor Ref1 by reducing p53 cysteine residue 275 and 277. In contrast, SeMet has no protective effect on UV-induced cell killing in p53-null cells. If SeMet also has protective effect in cells with wild type p53 on cell killing by photon irradiation, SeMet can be used as normal tissue radio-protector. We examined the effect of SeMet on cell killing by X-ray irradiation in several cell lines with different p53 status at exponentially growing phase. Cell lines used in this experiment were as follows: H1299/neo; human lung cancer cell line of p53 null type tranfected with control vector with no p53, H1299/wp53; wild type p53 transfected counterpart. A172/neo; human glioblastoma cell line with wild type p53, A172/mp53-248; mp53-248 (248-mutant, ARG >TRP) transfected counterpart. SAS/neo; human tongue cancer cell line with wild type p53, and SAS/mp53-248; mp53-248 transfected counterpart. Cells were subcultured at monolayer in D-MEM containing 10% FBS. Survivals of the cells were determined by colony forming ability. Ten-MV linac X-ray was used to irradiate the cells. Exponentially growing cells were incubated with 20μM of SeMet for 15 hours before irradiation. After 24 hours exposure of SeMet, cells were incubated up to two weeks in growth medium for colony formation. Twenty-four hours exposure of 20μM of SeMet had no cytotoxicity on these cell lines. SeMet had no modification effect on cell killing by photon irradiation in H1299/neo, H1299/wp53, SAS/neo, SAS/mp53-248, and A172/mp53-248. On the other hand, SeMet sensitized A172/neo in radiation cell killing. The effects of p53 on interaction of SeMet and photon irradiation differ according to cell lines

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

Science.gov (United States)

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

The Transcriptional Landscape of p53 Signalling Pathway

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2017-06-01

Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

Targeting the p53 Pathway in Ewing Sarcoma

Science.gov (United States)

Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

2011-01-01

The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.

Science.gov (United States)

Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete

2018-06-11

CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.

p53 and the pathogenesis of skin cancer

International Nuclear Information System (INIS)

Benjamin, Cara L.; Ananthaswamy, Honnavara N.

2007-01-01

The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

Science.gov (United States)

Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

2018-03-01

Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.

Size effect on transfection and cytotoxicity of nanoscale plasmid DNA/polyethyleneimine complexes for aerosol gene delivery

Energy Technology Data Exchange (ETDEWEB)

Hoon Byeon, Jeong, E-mail: jbyeon@purdue.edu [Department of Chemistry, Purdue University, West Lafayette, Indiana 47907 (United States); Kim, Jang-Woo, E-mail: jwkim@hoseo.edu [Department of Digital Display Engineering, Hoseo University, Asan 336-795 (Korea, Republic of)

2014-02-03

Nanoscale plasmid DNA (pDNA)/polyethyleneimine (PEI) complexes were fabricated in the aerosol state using a nebulization system consisting of a collison atomizer and a cool-walled diffusion dryer. The aerosol fabricated nanoscale complexes were collected and employed to determine fundamental properties of the complexes, such as size, structure, surface charge, and in vitro gene transfection efficiency and cytotoxicity. The results showed that mass ratio between pDNA and PEI should be optimized to enhance gene transfection efficiency without a significant loss of cell viability. These findings may support practical advancements in the field of nonviral gene delivery.

Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors

International Nuclear Information System (INIS)

Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.

2010-01-01

Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)

The Synergistic Effect between Electrical and Chemical Factors in Plasma Gene/Molecule-Transfection

Science.gov (United States)

Jinno, Masafumi

2016-09-01

This study has been done to know what kind of factors in plasma and processes on cells promote plasma gene/molecule transfection. We have discovered a new plasma source using a microcapillary electrode which enables high transfection efficiency and high cell survivability simultaneously. However, the mechanism of the transfection by plasma was not clear. To clarify the transfection mechanisms by micro plasma, we focused on the effects of electrical (current, charge, field, etc.) and chemical (radicals, RONS, etc.) factors generated by the micro plasma and evaluated the contribution weight of three groups of the effects and processes, i.e. electrical, chemical and biochemical ones. At first, the necessity of the electrical factors was estimated by the laser produced plasma (LPP). Mouse L-929 fibroblast cell was cultured on a 96-well plate or 12-well micro slide chamber. Plasmids pCX-EGFP in Tris-EDTA buffer was dropped on the cells and they were exposed to the capillary discharge plasma (CDP) or the LPP. In the case of the CDP, the plasma was generated between the tip of the capillary electrode and the cells so that both electrical and chemical factors were supplied to the cells. In this setup, about 20% of average transfection efficiency was obtained. In the case of the LPP, the plasma was generated apart from the cells so that electrical factors were not supplied to the cells. In this setup, no transfection was observed. These results show that the electrical factors are necessary for the plasma gene transfection. Next, the necessity of the chemical factors was estimated the effect of catalase to remove H2O2 in CDP. The transfection efficiency decreased to 0.4 by scavenging H2O2 with catalase. However, only the solution of H2O2 caused no gene transfection in cells. These results shows that H2O2 is important species to cause gene/molecule transfection but still needs a synergistic effect with electrical or other chemical factors. This work was partly supported by

The expanding universe of p53 targets.

Science.gov (United States)

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

The effects of human TSH receptor gene transfection on iodide uptake and thyroid-specific gene expression in poorly differentiated thyroid carcinoma cell line

International Nuclear Information System (INIS)

Hou Shasha; Wang Hui; Feng Fang; Lin Ning; Fu Hongliang; Du Xueliang; Wu Jingchuan

2011-01-01

Objective: To investigate the changes of iodide uptake and the expression of thyroid-specific genes in poorly differentiated follicular thyroid carcinoma (FTC) cells after transfection of human TSH receptor (hTSHR) gene in vitro. Methods: The recombinant eukaryotic expression plasmid PcDNA3.1/hTSHR-cDNA was transformed into DH 5a bacterial for amplification and then the recombinant plasmid was extracted. The recombinant was identified with PCR amplifying, restriction enzyme digestion analysis and DNA sequencing. The recombinant plasmid pcDNA3.1/hTSHR was transfected into FTC-133 cell line by lipofectin method in vitro. Immunofluorescence, iodide uptake studies and real time-PCR were applied to detect target protein expression. Statistical analysis was performed with t-test using SPSS 13.0 software. Results: Kpn I and Xba I restriction enzyme digestion, PCR amplifying and DNA sequencing confirmed that pcDNA3.1/hTSHR was successfully constructed. After transfection of the recombinant plasmid pcDNA3.1/hTSHR-cDNA and the stimulation of hTSH, the tumor cells displayed the expression of hTSHR protein at cell surface and cytoplasm. The iodine uptake in pcDNA3.1/hTSHR transfected cells was 2.9 times higher than that of control(pcDNA3.1(+) transfected cells) group(t = 28.63, P<0.01). The expression of TSHR, NIS, TPO and Tg (mRNA levels) in pcDNA3.1/hTSHR transfected cells were also significantly elevated by 1.74 (t =5.959, P<0.01), 7.2 (t =3.807, P<0.05), 2.88 (t=4.769, P<0.01) and 2.67 times (t=6.388, P<0.01) respectively compared to those of the control group. Conclusion: The study demonstrates that iodide uptake may be reactivated by hTSHR receptor gene transfection in poorly differentiated FTC cell. (authors)

Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

Science.gov (United States)

Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

2015-09-01

Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

Mannosylated Chitosan Nanoparticles Based Macrophage-Targeting Gene Delivery System Enhanced Cellular Uptake and Improved Transfection Efficiency.

Science.gov (United States)

Peng, Yixing; Yao, Wenjun; Wang, Bo; Zong, Li

2015-04-01

Gene transfer mediated by mannosylated chitosan (MCS) is a safe and promising approach for gene and vaccine delivery. MCS nanoparticles based gene delivery system showed high in vivo delivery efficiency and elicited strong immune responses in mice. However, little knowledge about the cell binding, transfection efficiency and intracellular trafficking of MCS nanoparticles had been acquired. In this study, using gastrin-releasing peptide as a model plasmid (pGRP), the binding of MCS/pGRP nanoparticles to macrophages and the intracellular trafficking of MCS/pGRP nanoparticles in macrophages were investigated. MCS-mediated transfection efficiency in macrophages was also evaluated using pGL-3 as a reporter gene. The results showed that the binding and transfection efficiency of MCS nanoparticles in macrophages was higher than that of CS, which was attributed to the interaction between mannose ligands in MCS and mannose receptors on the surface of macrophages. Observation with a confocal laser scanning microscope indicated the cellular uptake of MCS/pGRP nanoparticles were more than that of CS/pGRP nanoparticles in macrophages. MCS/pGRP nanoparticles were taken up by macrophages and most of them were entrapped in endosomal/lysosomal compartments. After the nanoparticles escaping from endosomal/lysosomal compartments, naked pGRP entered the nucleus, and a few MCS might enter the nucleus in terms of nanoparticles. Overall, MCS has the potential to be an excellent macrophage-targeting gene delivery carrier.

p53 downregulates the Fanconi anaemia DNA repair pathway.

Science.gov (United States)

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

p53 and PTEN/MMAC1/TEP1 gene therapy of human prostate PC-3 carcinoma xenograft, using transferrin-facilitated lipofection gene delivery strategy.

Science.gov (United States)

Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan

2002-04-10

We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.

Pharmaceutical studies for gene therapy: expression of human Cu, Zn-superoxide dismutase gene transfected by lipofection in rat skin fibroblasts.

Science.gov (United States)

Nishiguchi, K; Ishida, K; Nakajima, M; Maeda, T; Komada, F; Iwakawa, S; Tanigawara, Y; Okumura, K

1996-08-01

To evaluate whether lipofection using Lipofectin is suitable for delivering foreign genes into skin fibroblasts as target cells, we performed experiments using human superoxide dismutase (hSOD) and neomycin-resistance (Neo) genes as models in rat skin fibroblasts (FR and primary cells) in vitro. The amounts of DNA used in the lipofection procedure significantly affected the transfection efficiencies, and the optimal amounts were determined for all cells used. However, the efficiencies in rat skin fibroblasts were about 20-fold higher than that in rat lung epithelial-like cells (L2 cells). The differences in plasmid vectors (pRc/RSV-SOD and pRc/CMV-SOD) hardly affected the transfection efficiencies. The amounts of Lipofectin significantly affected the transfection efficiencies, and the optimal amounts were determined for both types of skin fibroblasts. However, cytotoxic effects in both skin fibroblasts were observed with high doses of Lipofectin. On the other hand, with optimal amounts of DNA and Lipofectin, the reporter gene (NeoT) introduced into cells was mainly integrated into the host cell chromosome. Western blot analysis showed the continuous expression of hSOD protein for at least 45 d in skin fibroblasts transfected with the expression plasmid for hSOD by Lipofectin under the optimal conditions, and the cellular SOD activity fluctuated in parallel with the expression of hSOD protein. Differences in the type of cells also affected the expression of hSOD. These results indicate that it is necessary to set up optimal conditions for transfection using Lipofectin for each cell type, and that transfection with Lipofectin under optimal conditions may be an efficient method for introduction of foreign genes into skin fibroblasts for use as a clinical delivery system of therapeutic protein.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

Science.gov (United States)

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

International Nuclear Information System (INIS)

Ding, Li; Huang, Yong; Du, Qian; Dong, Feng; Zhao, Xiaomin; Zhang, Wenlong; Xu, Xingang; Tong, Dewen

2014-01-01

Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressed cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

Science.gov (United States)

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

Super p53 for Treatment of Ovarian Cancer

Science.gov (United States)

2017-09-01

position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public...a lead construct. Technical skills gained in the proposal include cell culture , transfections, microscopy, apoptosis assays, transcriptional assays...experiments complete 100% (DOD) Specific Aim 2: Deliver super p53 DNA with advanced polymeric systems alone and in combination with CPTX first in vitro

Transformation and radiosensitivity of human diploid skin fibroblasts transfected with SV40 T-antigen mutants defective in RB and P53 binding domains

International Nuclear Information System (INIS)

LingNah Su; Little, J.B.

1992-01-01

A series of human diploid fibroblast cell clones were developed by DNA transfection with either wild-type SV40 T-antigen (SV40T) or T-antigen mutants defective in its various functional domains. Cell clones expressing the wild-type SV40 T were significantly radioresistant as compared with clones transfected with the neo gene only (D o 192 ± 13 vs 127 ± 19). This radioresistance persisted in post-crisis, immortalized cell lines. A series of mutants with point or deletion mutations within each functionally active domain of SV40 T were also examined for their ability to alter radiosensitivity and induce morphological transformation. Cell clones transfected with T-antigen mutants defective in nuclear localization or origin binding showed increased radioresistance similar to clones transfected with wild-type T-antigen, and expressed morphological changes characteristic of SV40 T-transfected cells. (author)

p53 Gene (NY-CO-13 Levels in Patients with Chronic Myeloid Leukemia: The Role of Imatinib and Nilotinib

Directory of Open Access Journals (Sweden)

Hayder M. Al-kuraishy

2018-01-01

Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.

Improving ultrasound gene transfection efficiency by controlling ultrasound excitation of microbubbles

Science.gov (United States)

Fan, Z.; Chen, D.; Deng, C.X.

2013-01-01

Ultrasound application in the presence of microbubbles has shown great potential for non-viral gene transfection via transient disruption of cell membrane (sonoporation). However, improvement of its efficiency has largely relied on empirical approaches without consistent and translatable results. The goal of this study is to develop a rational strategy based on new results obtained using novel experimental techniques and analysis to improve sonoporation gene transfection. We conducted experiments using targeted microbubbles that were attached to cell membrane to facilitate sonoporation. We quantified the dynamic activities of microbubbles exposed to pulsed ultrasound and the resulting sonoporation outcome and identified distinct regimes of characteristic microbubble behaviors: stable cavitation, coalescence and translation, and inertial cavitation. We found that inertial cavitation generated the highest rate of membrane poration. By establishing direct correlation of ultrasound-induced bubble activities with intracellular uptake and pore size, we designed a ramped pulse exposure scheme for optimizing microbubble excitation to improve sonoporation gene transfection. We implemented a novel sonoporation gene transfection system using an aqueous two phase system (ATPS) for efficient use of reagents and high throughput operation. Using plasmid coding for the green fluorescence protein (GFP), we achieved a sonoporation transfection efficiency in rate aortic smooth muscle cells (RASMCs) of 6.9% ± 2.2% (n = 9), comparable with lipofection (7.5% ± 0.8%, n = 9). Our results reveal characteristic microbubble behaviors responsible for sonoporation and demonstrated a rational strategy to improve sonoporation gene transfection. PMID:23770009

Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

Directory of Open Access Journals (Sweden)

Villiard Éric

2007-09-01

Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Zhihong CHEN

2011-10-01

Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

Bladder-like graphical representation of p53 gene alterations in some human cancers

International Nuclear Information System (INIS)

Helal, N.L.; Dorrah, M.; LI, C.

2005-01-01

the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

Science.gov (United States)

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

NARCIS (Netherlands)

Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

1993-01-01

Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

One pyrimidine dimer inactivates expression of a transfected gene in xeroderma pigmentosum cells

International Nuclear Information System (INIS)

Protic-Sabljic, M.; Kraemer, K.H.

1985-01-01

The authors have developed a host cell reactivation assay of DNA repair utilizing UV-treated plasmid vectors. The assay primarily reflects cellular repair of transcriptional activity of damaged DNA measured indirectly as enzyme activity of the transfected genes. They studied three plasmids (pSV2cat, 5020 base pairs; pSV2catSVgpt, 7268 base pairs; and pRSVcat, 5027 base pairs) with different sizes and promoters carrying the bacterial cat gene (CAT, chloramphenicol acetyltransferase) in a construction that permits cat expression in human cells. All human simian virus 40-transformed cells studied expressed high levels of the transfected cat gene. UV treatment of the plasmids prior to transfection resulted in differential decrease in CAT activity in different cell lines. With pSV2catSVgpt, UV inactivation of CAT expression was greater in the xeroderma pigmentosum group A and D lines than in the other human cell lines tested. The D 0 of the CAT inactivation curve was 50 J X m-2 for pSV2cat and for pRSVcat in the xeroderma pigmentosum group A cells. The similarity of the D0 data in the xeroderma pigmentosum group A cells for three plasmids of different size and promoters implies they all have similar UV-inactivation target size. UV-induced pyrimidine dimer formation in the plasmids was quantified by assay of the number of UV-induced T4 endonuclease V-sensitive sites. In the most sensitive xeroderma pigmentosum cells, with all three plasmids, one UV-induced pyrimidine dimer inactivates a target of about 2 kilobases, close to the size of the putative CAT mRNA

The genetic alteration of p53 in esophageal cancer

Energy Technology Data Exchange (ETDEWEB)

Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

1996-01-01

Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

Transcriptome profiling identifies genes and pathways deregulated upon floxuridine treatment in colorectal cancer cells harboring GOF mutant p53

Directory of Open Access Journals (Sweden)

Arindam Datta

2016-06-01

Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.

A Dual Role of P53 in Regulating Colistin-Induced Autophagy in PC-12 Cells

Directory of Open Access Journals (Sweden)

Ziyin Lu

2017-10-01

Full Text Available This study aimed to investigate the mechanism of p53 in regulating colistin-induced autophagy in PC-12 cells. Importantly, cells were treated with 125 μg/ml colistin for 12 and 24 h after transfection with p53 siRNA or recombinant plasmid. The hallmarks of autophagy and apoptosis were examined by real-time PCR and western blot, fluorescence/immunofluorescence microscopy, and electron microscopy. The results showed that silencing of p53 leads to down-regulation of Atg5 and beclin1 for 12 h while up-regulation at 24 h and up-regulation of p62 noted. The ratio of LC3-II/I and autophagic vacuoles were significantly increased at 24 h, but autophagy flux was blocked. The cleavage of caspase3 and PARP (poly ADP-ribose polymerase were enhanced, while PC-12-sip53 cells exposed to 3-MA showed down-regulation of apoptosis. By contrast, the expression of autophagy-related genes and protein reduced in p53 overexpressing cells following a time dependent manner. Meanwhile, there was an increase in the expression of activated caspase3 and PARP, condensed and fragmented nuclei were evident. Conclusively, the data supported that silencing of p53 promotes impaired autophagy, which acts as a pro-apoptotic induction factor in PC-12 cells treated with colistin for 24 h, and overexpression of p53 inhibits autophagy and accelerates apoptosis. Hence, it has been suggested that p53 could not act as a neuro-protective target in colistin-induced neurotoxicity.

Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

Science.gov (United States)

Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

2008-07-01

We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

Improving ultrasound gene transfection efficiency by controlling ultrasound excitation of microbubbles.

Science.gov (United States)

Fan, Z; Chen, D; Deng, C X

2013-09-28

Ultrasound application in the presence of microbubbles has shown great potential for non-viral gene transfection via transient disruption of cell membrane (sonoporation). However, improvement of its efficiency has largely relied on empirical approaches without consistent and translatable results. The goal of this study is to develop a rational strategy based on new results obtained using novel experimental techniques and analysis to improve sonoporation gene transfection. In this study, we conducted experiments using targeted microbubbles that were attached to cell membrane to facilitate sonoporation. We quantified the dynamic activities of microbubbles exposed to pulsed ultrasound and the resulting sonoporation outcome, and identified distinct regimes of characteristic microbubble behaviors: stable cavitation, coalescence and translation, and inertial cavitation. We found that inertial cavitation generated the highest rate of membrane poration. By establishing direct correlation of ultrasound-induced bubble activities with intracellular uptake and pore size, we designed a ramped pulse exposure scheme for optimizing microbubble excitation to improve sonoporation gene transfection. We implemented a novel sonoporation gene transfection system using an aqueous two phase system (ATPS) for efficient use of reagents and high throughput operation. Using plasmids coding for the green fluorescence protein (GFP), we achieved a sonoporation transfection efficiency in rate aortic smooth muscle cells (RASMCs) of 6.9%±2.2% (n=9), comparable with lipofection (7.5%±0.8%, n=9). Our results reveal characteristic microbubble behaviors responsible for sonoporation and demonstrated a rational strategy to improve sonoporation gene transfection. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid detection of single nucleotide mutation in p53 gene based on ...

Indian Academy of Sciences (India)

mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

Chemical Variations on the p53 Reactivation Theme

Directory of Open Access Journals (Sweden)

Carlos J. A. Ribeiro

2016-05-01

Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

International Nuclear Information System (INIS)

Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

2008-01-01

This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

Structure relationship of cationic lipids on gene transfection mediated by cationic liposomes.

Science.gov (United States)

Paecharoenchai, Orapan; Niyomtham, Nattisa; Apirakaramwong, Auayporn; Ngawhirunpat, Tanasait; Rojanarata, Theerasak; Yingyongnarongkul, Boon-ek; Opanasopit, Praneet

2012-12-01

The aim of this study was to investigate the transfection efficiency of cationic liposomes formulated with phosphatidylcholine (PC) and novel synthesized diethanolamine-based cationic lipids at a molar ratio of 5:1 in comparison with Lipofectamine™ 2000. Factors affecting transfection efficiency and cell viability, including the chemical structure of the cationic lipids, such as different amine head group (diamine and polyamine; and non-spermine and spermine) and acyl chain lengths (C14, C16, and C18) and the weight ratio of liposomes to DNA were evaluated on a human cervical carcinoma cell line (HeLa cells) using the pDNA encoding green fluorescent protein (pEGFP-C2). Characterizations of these lipoplexes in terms of size and charge measurement and agarose gel electrophoresis were performed. The results from this study revealed that almost no transfection was observed in the liposome formulations composed of cationic lipids with a non-spermine head group. In addition, the transfection efficiency of these cationic liposomes was in the following order: spermine-C14 > spermine-C16 > spermine-C18. The highest transfection efficiency was observed in the formulation of spermine-C14 liposomes at a weight ratio of 25; furthermore, this formulation was safe for use in vitro. In conclusion, cationic liposomes containing spermine head groups demonstrated promising potential as gene carriers.

Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

Directory of Open Access Journals (Sweden)

Rashid Mir

2016-01-01

Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

p53 Acetylation: Regulation and Consequences

International Nuclear Information System (INIS)

Reed, Sara M.; Quelle, Dawn E.

2014-01-01

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

p53 Acetylation: Regulation and Consequences

Energy Technology Data Exchange (ETDEWEB)

Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

2014-12-23

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

NARCIS (Netherlands)

Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

1996-01-01

Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

CLCA2 as a p53-Inducible Senescence Mediator

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2012-02-01

Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

Science.gov (United States)

Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

2015-12-01

Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

International Nuclear Information System (INIS)

Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

2009-01-01

A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?

International Nuclear Information System (INIS)

Blackburn, Anneke C; Jerry, D Joseph

2002-01-01

The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer

The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

Directory of Open Access Journals (Sweden)

Krzysztof Puszynski

2014-12-01

Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

Battle Against Cancer: An Everlasting Saga of p53

Directory of Open Access Journals (Sweden)

Qian Hao

2014-12-01

Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer

International Nuclear Information System (INIS)

Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong

2009-01-01

Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their

Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

Science.gov (United States)

White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

2014-08-01

The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

A novel radiation-induced p53 mutation is not implicated in radiation resistance via a dominant-negative effect.

Directory of Open Access Journals (Sweden)

Yunguang Sun

Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.

Connection between cell phone use, p53 gene expression in different zones of glioblastoma multiforme and survival prognoses

Directory of Open Access Journals (Sweden)

Reza Akhavan-Sigari

2014-08-01

Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

Science.gov (United States)

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy

International Nuclear Information System (INIS)

Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.

1996-01-01

cellular phenotypes, including the radioresistant phenotype. Pre-clinical studies suggest that these phenotypes may be reversed using adenovirus-mediated gene therapy or pharmacologic strategies designed to re-institute WTp53 protein function. Our analysis of the published data strongly argues for the use offunctional assays for the determination of WTp53 protein function in studies which attempt to correlate normal and tumour tissue radioresponse with p53 genotype, or p53 protein expression

Expression of p53 Target Genes in the Early Phase of Long-Term Potentiation in the Rat Hippocampal CA1 Area

Directory of Open Access Journals (Sweden)

Vladimir O. Pustylnyak

2015-01-01

Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.

Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

International Nuclear Information System (INIS)

Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

1997-01-01

Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

Molecular biologic study about the non-small cell lung carcinoma (2) : p53 gene alteration in non-small cell lung carcinoma

International Nuclear Information System (INIS)

Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee

1996-12-01

The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs

Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

International Nuclear Information System (INIS)

Zhang, Y.; Woloschak, G.E.

1997-01-01

This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed

Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

Science.gov (United States)

Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

2012-04-01

Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

DEFF Research Database (Denmark)

Savelyeva, I.; Dobbelstein, M.

2011-01-01

to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

Towards gene therapy based on femtosecond optical transfection

Science.gov (United States)

Antkowiak, M.; Torres-Mapa, M. L.; McGinty, J.; Chahine, M.; Bugeon, L.; Rose, A.; Finn, A.; Moleirinho, S.; Okuse, K.; Dallman, M.; French, P.; Harding, S. E.; Reynolds, P.; Gunn-Moore, F.; Dholakia, K.

2012-06-01

Gene therapy poses a great promise in treatment and prevention of a variety of diseases. However, crucial to studying and the development of this therapeutic approach is a reliable and efficient technique of gene and drug delivery into primary cell types. These cells, freshly derived from an organ or tissue, mimic more closely the in vivo state and present more physiologically relevant information compared to cultured cell lines. However, primary cells are known to be difficult to transfect and are typically transfected using viral methods, which are not only questionable in the context of an in vivo application but rely on time consuming vector construction and may also result in cell de-differentiation and loss of functionality. At the same time, well established non-viral methods do not guarantee satisfactory efficiency and viability. Recently, optical laser mediated poration of cell membrane has received interest as a viable gene and drug delivery technique. It has been shown to deliver a variety of biomolecules and genes into cultured mammalian cells; however, its applicability to primary cells remains to be proven. We demonstrate how optical transfection can be an enabling technique in research areas, such as neuropathic pain, neurodegenerative diseases, heart failure and immune or inflammatory-related diseases. Several primary cell types are used in this study, namely cardiomyocytes, dendritic cells, and neurons. We present our recent progress in optimizing this technique's efficiency and post-treatment cell viability for these types of cells and discuss future directions towards in vivo applications.

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

Directory of Open Access Journals (Sweden)

Zanatta Daniela B

2010-06-01

Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

International Nuclear Information System (INIS)

Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E

2010-01-01

Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19

Effects of molecular size and chemical factor on plasma gene transfection

Science.gov (United States)

Ikeda, Yoshihisa; Motomura, Hideki; Kido, Yugo; Satoh, Susumu; Jinno, Masafumi

2016-07-01

In order to clarify the mechanism of plasma gene transfection, the relationship between transfection efficiency and transferred molecular size was investigated. Molecules with low molecular mass (less than 50 kDa; dye or dye-labeled oligonucleotide) and high molecular mass (more than 1 MDa; plasmid DNA or fragment of plasmid DNA) were transferred to L-929 cells. It was found that the transfection efficiency decreases with increasing in transferred molecular size and also depends on the tertiary structure of transferred molecules. Moreover, it was suggested the transfection mechanism is different between the molecules with low (less than 50 kDa) and high molecular mass (higher than 1 MDa). For the amount of gene transfection after plasma irradiation, which is comparable to that during plasma irradiation, it is shown that H2O2 molecules are the main contributor. The transfection efficiency decreased to 0.40 ± 0.22 upon scavenging the H2O2 generated by plasma irradiation using the catalase. On the other hand, when the H2O2 solution is dropped into the cell suspension without plasma irradiation, the transfection efficiency is almost 0%. In these results, it is also suggested that there is a synergetic effect of H2O2 with electrical factors or other reactive species generated by plasma irradiation.

Stabilizing in vitro ultrasound-mediated gene transfection by regulating cavitation.

Science.gov (United States)

Lo, Chia-Wen; Desjouy, Cyril; Chen, Shing-Ru; Lee, Jyun-Lin; Inserra, Claude; Béra, Jean-Christophe; Chen, Wen-Shiang

2014-03-01

It is well known that acoustic cavitation can facilitate the inward transport of genetic materials across cell membranes (sonoporation). However, partially due to the unstationary behavior of the initiation and leveling of cavitation, the sonoporation effect is usually unstable, especially in low intensity conditions. A system which is able to regulate the cavitation level during sonication by modulating the applied acoustic intensity with a feedback loop is implemented and its effect on in vitro gene transfection is tested. The regulated system provided better time stability and reproducibility of the cavitation levels than the unregulated conditions. Cultured hepatoma cells (BNL) mixed with 10 μg luciferase plasmids are exposed to 1-MHz pulsed ultrasound with or without cavitation regulation, and the gene transfection efficiency and cell viability are subsequently assessed. Experimental results show that for all exposure intensities (low, medium, and high), stable and intensity dependent, although not higher, gene expression could be achieved in the regulated cavitation system than the unregulated conditions. The cavitation regulation system provides a better control of cavitation and its bioeffect which are crucial important for clinical applications of ultrasound-mediated gene transfection. Copyright © 2013 Elsevier B.V. All rights reserved.

40 Years of Research Put p53 in Translation

Science.gov (United States)

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

The role of p53 molecule in radiation and hyperthermic therapies

International Nuclear Information System (INIS)

Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

2003-01-01

In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

Reverse Transfection Using Gold Nanoparticles

Science.gov (United States)

Yamada, Shigeru; Fujita, Satoshi; Uchimura, Eiichiro; Miyake, Masato; Miyake, Jun

Reverse transfection from a solid surface has the potential to deliver genes into various types of cell and tissue more effectively than conventional methods of transfection. We present a method for reverse transfection using a gold colloid (GC) as a nanoscaffold by generating nanoclusters of the DNA/reagentcomplex on a glass surface, which could then be used for the regulation of the particle size of the complex and delivery of DNA into nuclei. With this method, we have found that the conjugation of gold nanoparticles (20 nm in particle size) to the pEGFP-N1/Jet-PEI complex resulted in an increase in the intensity of fluorescence of enhanced green fluorescent protein (EGFP) (based on the efficiency of transfection) from human mesenchymal stem cells (hMSCs), as compared with the control without GC. In this manner, we constructed a method for reverse transfection using GC to deliver genes into the cells effectively.

Cationic nanoparticles with quaternary ammonium-functionalized PLGA–PEG-based copolymers for potent gene transfection

Energy Technology Data Exchange (ETDEWEB)

Wang, Yan-Hsung [Kaohsiung Medical University, School of Dentistry, College of Dental Medicine (China); Fu, Yin-Chih [Kaohsiung Medical University, Graduate Institute of Medicine, College of Medicine (China); Chiu, Hui-Chi [Kaohsiung Medical University, Department of Medicinal and Applied Chemistry, College of Life Science (China); Wang, Chau-Zen [Kaohsiung Medical University, Department of Physiology, College of Medicine (China); Lo, Shao-Ping [Kaohsiung Medical University, Department of Medicinal and Applied Chemistry, College of Life Science (China); Ho, Mei-Ling [Kaohsiung Medical University, Department of Physiology, College of Medicine (China); Liu, Po-Len [Kaohsiung Medical University, Department of Respiratory Therapy, College of Medicine (China); Wang, Chih-Kuang, E-mail: ckwang@kmu.edu.tw [Kaohsiung Medical University, Department of Medicinal and Applied Chemistry, College of Life Science (China)

2013-11-15

The objective of the present work was to develop new cationic nanoparticles (cNPs) with amphiphilic cationic copolymers for the delivery of plasmid DNA (pDNA). Cationic copolymers were built on the synthesis of quaternary ammonium salt compounds from diethylenetriamine (DETA) to include the positively charged head group and amphiphilic multi-grafts. PLGA-phe-PEG-qDETA (PPD), phe-PEG-qDETA-PLGA (PDP), and PLGA-phe-PEG-qDETA-PLGA (PPDP) cationic copolymers were created by this moiety of DETA quaternary ammonium, heterobifunctional polyethylene glycol (COOH-PEG-NH{sub 2}), phenylalanine (phe), and poly(lactic-co-glycolic acid) (PLGA). These new cNPs were prepared by the water miscible solvent displacement method. They exhibit good pDNA binding ability, as shown in a retardation assay that occurred at a particle size of ∼217 nm. The zeta potential was approximately +21 mV when the cNP concentration was 25 mg/ml. The new cNPs also have a better buffering capacity than PLGA NPs. However, the pDNA binding ability was demonstrated starting at a weight ratio of approximately 6.25 cNPs/pDNA. Gene transfection results showed that these cNPs had transfection effects similar to those of Lipofectamine 2000 in 293T cells. Furthermore, cNPs can also transfect human adipose-derived stem cells. The results indicate that the newly developed cNP is a promising candidate for a novel gene delivery vehicle.

Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

Science.gov (United States)

Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

1997-05-01

To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

Spontaneous gene transfection of human bone cells using 3D mineralized alginate-chitosan macrocapsules.

Science.gov (United States)

Green, David W; Kim, Eun-Jung; Jung, Han-Sung

2015-09-01

The effectiveness of nonviral gene therapy remains uncertain because of low transfection efficiencies and high toxicities compared with viral-based strategies. We describe a simple system for transient transfection of continuous human cell lines, with low toxicity, using mineral-coated chitosan and alginate capsules. As proof-of-concept, we demonstrate transfection of Saos-2 and MG63 human osteosarcoma continuous cell lines with gfp, LacZ reporter genes, and a Sox-9 carrying plasmid, to illustrate expression of a functional gene with therapeutic relevance. We show that continuous cell lines transfect with significant efficiency of up to 65% possibly through the interplay between chitosan and DNA complexation and calcium/phosphate-induced translocation into cells entrapped within the 3D polysaccharide based environment, as evidenced by an absence of transfection in unmineralized and chitosan-free capsules. We demonstrated that our transfection system was equally effective at transfection of primary human bone marrow stromal cells. To illustrate, the Sox-9, DNA plasmid was spontaneously expressed in primary human bone marrow stromal cells at 7 days with up to 90% efficiency in two repeats. Mineralized polysaccharide macrocapsules are gene delivery vehicles with a number of biological and practical advantages. They are highly efficient at self-transfecting primary bone cells, with programmable spatial and temporal delivery prospects, premineralized bone-like environments, and have no cytotoxic effects, as compared with many other nonviral systems. © 2015 Wiley Periodicals, Inc.

The prognostic value of p53 mutation in pediatric marrow hypoplasia

Directory of Open Access Journals (Sweden)

Sharaf Alzahraa EA

2011-06-01

Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.

Enhancement of DNA-transfection frequency by X-rays

Energy Technology Data Exchange (ETDEWEB)

Iwamoto, Ryota; Fushimi, Kazuo; Hiraki, Yoshio; Namba, Masayoshi [Okayama University Medical School (Japan). Institute of Cellular and Molecular Biology

1997-02-01

This study was conducted to evaluate the frequency of DNA transfection into human cells following X-ray irradiation. We transfected plasmid DNA (pSV2neo) into human cells, HeLa and PA-1, by either calcium phosphate precipitation or the lipofection method immediately after irradiating the cells with various doses of X-rays. The transfection frequency was evaluated by counting the number of G418-resistant colonies. When circular plasmid DNA was used, irradiation up to a dose of 2 Gy dose-dependently increased the transfection frequency, which reached a maximum of 5 to 10-fold that of the control unirradiated cells. When linear plasmid DNA was used, the transfection frequency was 2 times higher than that of circular DNA. All five of the clones that were randomly chosen expressed the transfected neo gene. In addition, the pSV2neo gene was randomly integrated into the genomic DNA of each clone. These findings indicate that X-ray treatment can facilitate foreign DNA transfer into human cells and that radiation-induced DNA breaks may promote the insertion of foreign DNA into host DNA. The enhancement of DNA transfection with X-rays may be instrumental in practicing gene therapy. (author)

Enhancement of DNA-transfection frequency by X-rays

International Nuclear Information System (INIS)

Iwamoto, Ryota; Fushimi, Kazuo; Hiraki, Yoshio; Namba, Masayoshi

1997-01-01

This study was conducted to evaluate the frequency of DNA transfection into human cells following X-ray irradiation. We transfected plasmid DNA (pSV2neo) into human cells, HeLa and PA-1, by either calcium phosphate precipitation or the lipofection method immediately after irradiating the cells with various doses of X-rays. The transfection frequency was evaluated by counting the number of G418-resistant colonies. When circular plasmid DNA was used, irradiation up to a dose of 2 Gy dose-dependently increased the transfection frequency, which reached a maximum of 5 to 10-fold that of the control unirradiated cells. When linear plasmid DNA was used, the transfection frequency was 2 times higher than that of circular DNA. All five of the clones that were randomly chosen expressed the transfected neo gene. In addition, the pSV2neo gene was randomly integrated into the genomic DNA of each clone. These findings indicate that X-ray treatment can facilitate foreign DNA transfer into human cells and that radiation-induced DNA breaks may promote the insertion of foreign DNA into host DNA. The enhancement of DNA transfection with X-rays may be instrumental in practicing gene therapy. (author)

Friend or Foe: MicroRNAs in the p53 network.

Science.gov (United States)

Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

2018-04-10

The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

Lipoplex morphologies and their influences on transfection efficiency in gene delivery.

Science.gov (United States)

Ma, Baichao; Zhang, Shubiao; Jiang, Huiming; Zhao, Budiao; Lv, Hongtao

2007-11-20

Cationic lipid-mediated gene transfer is widely used for their advantages over viral gene transfer because it is non-immunogenic, easy to produce and not oncogenic. The main drawback of the application of cationic lipids is their low transfection efficiency. Many reports about transfection efficiency of cationic lipids have been published in recent years. In this review, the current status and prospects for transfection efficiency of different morphologies of lipoplexes are discussed. High transfection activity will be acquired for H(C)(II) structure when membrane fusion is dominant, but when serum is present L(C)(alpha) lipoplexes show great superiority for their inhibition dissociation by serum during lipoplexes transporting. Increasing DOPE often gains high activity for the H(C)(II) structure promoted by DOPE. High lipofection will be gained from large lipoplexes when endocytosis is dominant, because large particles facilitate membrane contact and fusion. We suggest morphologies of lipoplex should be characterized at two levels, lipoplex size and self-assemble structures of lipoplexes, and understanding these would be very important for scientists to prepare novel cationic lipids and design novel formulations with high transfection efficiency.

Tissue Engineering Using Transfected Growth-Factor Genes

Science.gov (United States)

Madry, Henning; Langer, Robert S.; Freed, Lisa E.; Trippel, Stephen; Vunjak-Novakovic, Gordana

2005-01-01

A method of growing bioengineered tissues includes, as a major component, the use of mammalian cells that have been transfected with genes for secretion of regulator and growth-factor substances. In a typical application, one either seeds the cells onto an artificial matrix made of a synthetic or natural biocompatible material, or else one cultures the cells until they secrete a desired amount of an extracellular matrix. If such a bioengineered tissue construct is to be used for surgical replacement of injured tissue, then the cells should preferably be the patient s own cells or, if not, at least cells matched to the patient s cells according to a human-leucocyteantigen (HLA) test. The bioengineered tissue construct is typically implanted in the patient's injured natural tissue, wherein the growth-factor genes enhance metabolic functions that promote the in vitro development of functional tissue constructs and their integration with native tissues. If the matrix is biodegradable, then one of the results of metabolism could be absorption of the matrix and replacement of the matrix with tissue formed at least partly by the transfected cells. The method was developed for articular chondrocytes but can (at least in principle) be extended to a variety of cell types and biocompatible matrix materials, including ones that have been exploited in prior tissue-engineering methods. Examples of cell types include chondrocytes, hepatocytes, islet cells, nerve cells, muscle cells, other organ cells, bone- and cartilage-forming cells, epithelial and endothelial cells, connective- tissue stem cells, mesodermal stem cells, and cells of the liver and the pancreas. Cells can be obtained from cell-line cultures, biopsies, and tissue banks. Genes, molecules, or nucleic acids that secrete factors that influence the growth of cells, the production of extracellular matrix material, and other cell functions can be inserted in cells by any of a variety of standard transfection techniques.

Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

NARCIS (Netherlands)

Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

Science.gov (United States)

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

Mitofusin-2 is a novel direct target of p53

International Nuclear Information System (INIS)

Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

2010-01-01

Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

Single histidine residue in head-group region is sufficient to impart remarkable gene transfection properties to cationic lipids: evidence for histidine-mediated membrane fusion at acidic pH.

Science.gov (United States)

Kumar, V V; Pichon, C; Refregiers, M; Guerin, B; Midoux, P; Chaudhuri, A

2003-08-01

Presence of endosome-disrupting multiple histidine functionalities in the molecular architecture of cationic polymers, such as polylysine, has previously been demonstrated to significantly enhance their in vitro gene delivery efficiencies. Towards harnessing improved transfection property through covalent grafting of endosome-disrupting single histidine functionality in the molecular structure of cationic lipids, herein, we report on the design, the synthesis and the transfection efficiency of two novel nonglycerol-based histidylated cationic amphiphiles. We found that L-histidine-(N,N-di-n-hexadecylamine)ethylamide (lipid 1) and L-histidine-(N,N-di-n-hexadecylamine,-N-methyl)ethylamide (lipid 2) in combination with cholesterol gave efficient transfections into various cell lines. The transfection efficiency of Chol/lipid 1 lipoplexes into HepG2 cells was two order of magnitude higher than that of FuGENE(TM)6 and DC-Chol lipoplexes, whereas it was similar into A549, 293T7 and HeLa cells. A better efficiency was obtained with Chol/lipid 2 lipoplexes when using the cytosolic luciferase expression vector (pT7Luc) under the control of the bacterial T7 promoter. Membrane fusion activity measurements using fluorescence resonance energy transfer (FRET) technique showed that the histidine head-groups of Chol/lipid 1 liposomes mediated membrane fusion in the pH range 5-7. In addition, the transgene expression results using the T7Luc expression vector convincingly support the endosome-disrupting role of the presently described mono-histidylated cationic transfection lipids and the release of DNA into the cytosol. We conclude that covalent grafting of a single histidine amino acid residue to suitable twin-chain hydrophobic compounds is able to impart remarkable transfection properties on the resulting mono-histidylated cationic amphiphile, presumably via the endosome-disrupting characteristics of the histidine functionalities.

Highly Effective Gene Transfection In Vivo by Alkylated Polyethylenimine

Directory of Open Access Journals (Sweden)

Jennifer A. Fortune

2011-01-01

Full Text Available We mechanistically explored the effect of increased hydrophobicity of the polycation on the efficacy and specificity of gene delivery in mice. N-Alkylated linear PEIs with varying alkyl chain lengths and extent of substitution were synthesized and characterized by biophysical methods. Their in vivo transfection efficiency, specificity, and biodistribution were investigated. N-Ethylation improves the in vivo efficacy of gene expression in the mouse lung 26-fold relative to the parent polycation and more than quadruples the ratio of expression in the lung to that in all other organs. N-Propyl-PEI was the best performer in the liver and heart (581- and 3.5-fold enhancements, resp. while N-octyl-PEI improved expression in the kidneys over the parent polymer 221-fold. As these enhancements in gene expression occur without changing the plasmid biodistribution, alkylation does not alter the cellular uptake but rather enhances transfection subsequent to cellular uptake.

NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

Directory of Open Access Journals (Sweden)

Labhart Paul

2007-05-01

Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

Expression of Androgen Receptor Is Negatively Regulated By p53

Directory of Open Access Journals (Sweden)

Fatouma Alimirah

2007-12-01

Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

International Nuclear Information System (INIS)

Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko

2015-01-01

Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

The sustained-release behavior and in vitro and in vivo transfection of pEGFP-loaded core-shell-structured chitosan-based composite particles

Directory of Open Access Journals (Sweden)

Wang Y

2014-10-01

Full Text Available Yun Wang,1 Fu-xing Lin,2 Yu Zhao,1 Mo-zhen Wang,2 Xue-wu Ge,2 Zheng-xing Gong,1 Dan-dan Bao,1 Yu-fang Gu1 1Department of Plastic Surgery, First Affiliated Hospital of Anhui Medical University, 2CAS Key Laboratory of Soft Matter Chemistry, Department of Polymer Science and Engineering, University of Science and Technology of China, Hefei, Anhui, People’s Republic of China Abstract: Novel submicron core-shell-structured chitosan-based composite particles ­encapsulated with enhanced green fluorescent protein plasmids (pEGFP were prepared by complex coacervation method. The core was pEGFP-loaded thiolated N-alkylated chitosan (TACS and the shell was pH- and temperature-responsive hydroxybutyl chitosan (HBC. pEGFP-loaded TACS-HBC composite particles were spherical, and had a mean diameter of approximately 120 nm, as measured by transmission electron microscopy and particle size analyzer. pEGFP showed sustained release in vitro for >15 days. Furthermore, in vitro transfection in human embryonic kidney 293T and human cervix epithelial cells, and in vivo transfection in mice skeletal muscle of loaded pEGFP, were investigated. Results showed that the expression of loaded pEGFP, both in vitro and in vivo, was slow but could be sustained over a long period. pEGFP expression in mice skeletal muscle was sustained for >60 days. This work indicates that these submicron core-shell-structured chitosan-based composite particles could potentially be used as a gene vector for in vivo controlled gene transfection. Keywords: gene therapy, gene transfection, hydroxybutyl chitosan, thiolated N-alkylated chitosan, pEGFP, complex coacervation

Molecular mechanism of X-ray-induced p53-dependent apoptosis

Energy Technology Data Exchange (ETDEWEB)

Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

1999-03-01

Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

Science.gov (United States)

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

Estudo do polimorfismo genético no gene p53 (códon 72 em câncer colorretal Role of the genetic polymorphism of p53 (codon 72 gene in colorectal cancer

Directory of Open Access Journals (Sweden)

Jacqueline Miranda de Lima

2006-03-01

Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

Science.gov (United States)

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

International Nuclear Information System (INIS)

Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

1994-01-01

Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

P53 Gene Mutagenesis in Breast Cancer

National Research Council Canada - National Science Library

Sommer, Steve S

2005-01-01

.... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

Cancerous hyper-mutagenesis in p53 genes is possibly associated with transcriptional bypass of DNA lesions

International Nuclear Information System (INIS)

Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.

2002-01-01

The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

Science.gov (United States)

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

2012-04-05

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

International Nuclear Information System (INIS)

Ohnishi, Takeo

1997-01-01

I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

Rigid aromatic linking moiety in cationic lipids for enhanced gene transfection efficiency.

Science.gov (United States)

Wang, Bing; Zhao, Rui-Mo; Zhang, Ji; Liu, Yan-Hong; Huang, Zheng; Yu, Qing-Ying; Yu, Xiao-Qi

2017-08-18

Although numerous cationic lipids have been developed as non-viral gene vectors, the structure-activity relationship (SAR) of these materials remains unclear and needs further investigation. In this work, a series of lysine-derived cationic lipids containing linkages with different rigidity were designed and synthesized. SAR studies showed that lipids with rigid aromatic linkage could promote the formation of tight liposomes and enhance DNA condensation, which is essential for the gene delivery process. These lipids could give much higher transfection efficiency than those containing more flexible aliphatic linkage in various cell lines. Moreover, the rigid aromatic linkage also affords the material higher serum tolerance ability. Flow cytometry assay revealed that the target lipids have good cellular uptake, while confocal microscopy observation showed weaker endosome escape than Lipofectamine 2000. To solve such problem and further increase the transfection efficiency, some lysosomotropic reagents were used to improve the endosome escape of lipoplex. As expected, higher transfection efficiency than Lipofectamine 2000 could be obtained via this strategy. Cytotoxicity assay showed that these lipids have lower toxicity in various cell lines than Lipofectamine 2000, suggesting their potential for further application. This work demonstrates that a rigid aromatic linkage might distinctly improve the gene transfection abilities of cationic lipids and affords information to construct safe and efficient gene vector towards practical application. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

Science.gov (United States)

Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

2009-06-17

P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

Transfection mediated by pH-sensitive sugar-based gemini surfactants; potential for in vivo gene therapy applications

NARCIS (Netherlands)

Wasungu, Luc; Scarzello, Marco; van Dam, Gooitzen; Molema, Grietje; Wagenaar, Anno; Engberts, Jan B. F. N.; Hoekstra, Dick

In this study, the in vitro and in vivo transfection capacity of novel pH-sensitive sugar-based gemini surfactants was investigated. In an aqueous environment at physiological pH, these compounds form bilayer vesicles, but they undergo a lamellar-to-micellar phase transition in the endosomal pH

PAF53 is essential in mammalian cells: CRISPR/Cas9 fails to eliminate PAF53 expression.

Science.gov (United States)

Rothblum, Lawrence I; Rothblum, Katrina; Chang, Eugenie

2017-05-15

When mammalian cells are nutrient and/or growth factor deprived, exposed to inhibitors of protein synthesis, stressed by heat shock or grown to confluence, rDNA transcription is essentially shut off. Various mechanisms are available to accomplish this downshift in ribosome biogenesis. Muramatsu's laboratory (Hanada et al., 1996) first demonstrated that mammalian PAF53 was essential for specific rDNA transcription and that PAF53 levels were regulated in response to growth factors. While S. cerevisae A49, the homologue of vertebrate PAF53, is not essential for viability (Liljelund et al., 1992), deletion of yA49 results in colonies that grow at 6% of the wild type rate at 25°C. Experiments described by Wang et al. (2015) identified PAF53 as a gene "essential for optimal proliferation". However, they did not discriminate genes essential for viability. Hence, in order to resolve this question, we designed a series of experiments to determine if PAF53 was essential for cell survival. We set out to delete the gene product from mammalian cells using CRISPR/CAS9 technology. Human 293 cells were transfected with lentiCRISPR v2 carrying genes for various sgRNA that targeted PAF53. In some experiments, the cells were cotransfected in parallel with plasmids encoding FLAG-tagged mouse PAF53. After treating the transfected cells with puromycin (to select for the lentiCRISPR backbone), cells were cloned and analyzed by western blots for PAF53 expression. Genomic DNA was amplified across the "CRISPRd" exon, cloned and sequenced to identify mutated PAF53 genes. We obtained cell lines in which the endogenous PAF53 gene was "knocked out" only when we rescued with FLAG-PAF53. DNA sequencing demonstrated that in the absence of ectopic PAF53 expression, cells demonstrated unique means of surviving; including recombination or the utilization of alternative reading frames. We never observed a clone in which one PAF53 gene is expressed, unless there was also ectopic expression In the

Bacteriophage Mediates Efficient Gene Transfer in Combination with Conventional Transfection Reagents.

Science.gov (United States)

Donnelly, Amanda; Yata, Teerapong; Bentayebi, Kaoutar; Suwan, Keittisak; Hajitou, Amin

2015-12-08

The development of commercially available transfection reagents for gene transfer applications has revolutionized the field of molecular biology and scientific research. However, the challenge remains in ensuring that they are efficient, safe, reproducible and cost effective. Bacteriophage (phage)-based viral vectors have the potential to be utilized for general gene transfer applications within research and industry. Yet, they require adaptations in order to enable them to efficiently enter cells and overcome mammalian cellular barriers, as they infect bacteria only; furthermore, limited progress has been made at increasing their efficiency. The production of a novel hybrid nanocomplex system consisting of two different nanomaterial systems, phage vectors and conventional transfection reagents, could overcome these limitations. Here we demonstrate that the combination of cationic lipids, cationic polymers or calcium phosphate with M13 bacteriophage-derived vectors, engineered to carry a mammalian transgene cassette, resulted in increased cellular attachment, entry and improved transgene expression in human cells. Moreover, addition of a targeting ligand into the nanocomplex system, through genetic engineering of the phage capsid further increased gene expression and was effective in a stable cell line generation application. Overall, this new hybrid nanocomplex system (i) provides enhanced phage-mediated gene transfer; (ii) is applicable for laboratory transfection processes and (iii) shows promise within industry for large-scale gene transfer applications.

The sustained-release behavior and in vitro and in vivo transfection of pEGFP-loaded core-shell-structured chitosan-based composite particles

Science.gov (United States)

Wang, Yun; Lin, Fu-xing; Zhao, Yu; Wang, Mo-zhen; Ge, Xue-wu; Gong, Zheng-xing; Bao, Dan-dan; Gu, Yu-fang

2014-01-01

Novel submicron core-shell-structured chitosan-based composite particles encapsulated with enhanced green fluorescent protein plasmids (pEGFP) were prepared by complex coacervation method. The core was pEGFP-loaded thiolated N-alkylated chitosan (TACS) and the shell was pH- and temperature-responsive hydroxybutyl chitosan (HBC). pEGFP-loaded TACS-HBC composite particles were spherical, and had a mean diameter of approximately 120 nm, as measured by transmission electron microscopy and particle size analyzer. pEGFP showed sustained release in vitro for >15 days. Furthermore, in vitro transfection in human embryonic kidney 293T and human cervix epithelial cells, and in vivo transfection in mice skeletal muscle of loaded pEGFP, were investigated. Results showed that the expression of loaded pEGFP, both in vitro and in vivo, was slow but could be sustained over a long period. pEGFP expression in mice skeletal muscle was sustained for >60 days. This work indicates that these submicron core-shell-structured chitosan-based composite particles could potentially be used as a gene vector for in vivo controlled gene transfection. PMID:25364253

Immunohistochemical analysis of P53 protein in odontogenic cysts

Science.gov (United States)

Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

2010-01-01

The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

Gene expression profiles in primary duodenal chick cells following transfection with avian influenza virus H5 DNA plasmid encapsulated in silver nanoparticles

Directory of Open Access Journals (Sweden)

Jazayeri SD

2013-02-01

Full Text Available Seyed Davoud Jazayeri,1 Aini Ideris,1,2 Kamyar Shameli,3 Hassan Moeini,1 Abdul Rahman Omar1,21Institute of Bioscience, 2Faculty of Veterinary Medicine, 3Faculty of Science, Universiti Putra Malaysia, Serdang, Selangor, MalaysiaAbstract: In order to develop a systemically administered safe and effective nonviral gene delivery system against avian influenza virus (AIV that induced cytokine expression, the hemagglutinin (H5 gene of AIV, A/Ck/Malaysia/5858/04 (H5N1 and green fluorescent protein were cloned into a coexpression vector pIRES (pIREGFP-H5 and formulated using green synthesis of silver nanoparticles (AgNPs with poly(ethylene glycol and transfected into primary duodenal cells taken from 18-day-old specific-pathogen-free chick embryos. The AgNPs were prepared using moderated temperature and characterized for particle size, surface charge, ultraviolet-visible spectra, DNA loading, and stability. AgNPs and AgNP-pIREGFP-H5 were prepared in the size range of 13.9 nm and 25 nm with a positive charge of +78 ± 0.6 mV and +40 ± 6.2 mV, respectively. AgNPs with a positive surface charge could encapsulate pIREGFP-H5 efficiently. The ultraviolet-visible spectra for AgNP-pIREGFP-H5 treated with DNase I showed that the AgNPs were able to encapsulate pIREGFP-H5 efficiently. Polymerase chain reaction showed that AgNP-pIREGFP-H5 entered into primary duodenal cells rapidly, as early as one hour after transfection. Green fluorescent protein expression was observed after 36 hours, peaked at 48 hours, and remained stable for up to 60 hours. In addition, green fluorescent protein expression generally increased with increasing DNA concentration and time. Cells were transfected using Lipocurax in vitro transfection reagent as a positive control. A multiplex quantitative mRNA gene expression assay in the transfected primary duodenal cells via the transfection reagent and AgNPs with pIREGFP-H5 revealed expression of interleukin (IL-18, IL-15, and IL-12�

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

Directory of Open Access Journals (Sweden)

Rolletschek Alexandra

2009-06-01

Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

Plasmid DNA transfection using magnetite cationic liposomes for construction of multilayered gene-engineered cell sheet.

Science.gov (United States)

Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki

2008-05-01

Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.

Thymocyte apoptosis induced by p53-dependent and independent pathways

International Nuclear Information System (INIS)

Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

1993-01-01

The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

Alterations of tumor suppressor genes (Rb, p16, p27 and p53) and an increased FDG uptake in lung cancer

International Nuclear Information System (INIS)

Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo

2003-01-01

The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)

Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

Directory of Open Access Journals (Sweden)

Monica M Horvath

2007-07-01

Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells

Directory of Open Access Journals (Sweden)

Nikolett Sándor

2015-10-01

Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.

Transferrin-facilitated lipofection gene delivery strategy: characterization of the transfection complexes and intracellular trafficking.

Science.gov (United States)

Joshee, Nirmal; Bastola, Dhundy R; Cheng, Pi-Wan

2002-11-01

We previously showed that mixing transferrin with a cationic liposome prior to the addition of DNA, greatly enhanced the lipofection efficiency. Here, we report characterization of the transfection complexes in formulations prepared with transferrin, lipofectin, and DNA (pCMVlacZ) in various formulations. DNA in all the formulations that contain lipofectin was resistant to DNase I treatment. Transfection experiments performed in Panc 1 cells showed that the standard formulation, which was prepared by adding DNA to a mixture of transferrin and lipofectin, yielded highest transfection efficiency. There was no apparent difference in zeta potential among these formulations, but the most efficient formulation contained complexes with a mean diameter of three to four times that of liposome and the complexes in other gene delivery formulations. Transmission electron microscopic examination of the standard transfection complexes formulated using gold-labeled transferrin showed extended circular DNA decorated with transferrin as compared to extensively condensed DNA found in lipofectin-DNA complexes and heterogeneous structures in other formulations. By confocal microscopy, DNA and transferrin were found to colocalize at the perinuclear space and in the nucleus, suggesting cotransportation intracellularly, including nuclear transport. We propose that transferrin enhances the transfection efficiency of the standard lipofection formulation by preventing DNA condensation, and facilitating endocytosis and nuclear targeting.

Acceleration of gene transfection efficiency in neuroblastoma cells through polyethyleneimine/poly(methyl methacrylate core-shell magnetic nanoparticles

Directory of Open Access Journals (Sweden)

Tencomnao T

2012-06-01

Full Text Available Tewin Tencomnao,1,* Kewalin Klangthong,2,* Nuttaporn Pimpha,3 Saowaluk Chaleawlert-umpon,3 Somsak Saesoo,3 Noppawan Woramongkolchai,3 Nattika Saengkrit,31Center for Excellence in Omics-Nano Medical Technology Development Project, 2Graduate Program in Clinical Biochemistry and Molecular Medicine, Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, 3National Nanotechnology Center, National Science and Technology Development Agency, Pathumthani, Thailand*Both authors contributed equally to this workBackground: The purpose of this study was to demonstrate the potential of magnetic poly(methyl methacrylate (PMMA core/polyethyleneimine (PEI shell (mag-PEI nanoparticles, which possess high saturation magnetization for gene delivery. By using mag-PEI nanoparticles as a gene carrier, this study focused on evaluation of transfection efficiency under magnetic induction. The potential role of this newly synthesized nanosphere for therapeutic delivery of the tryptophan hydroxylase-2 (TPH-2 gene was also investigated in cultured neuronal LAN-5 cells.Methods: The mag-PEI nanoparticles were prepared by one-step emulsifier-free emulsion polymerization, generating highly loaded and monodispersed magnetic polymeric nanoparticles bearing an amine group. The physicochemical properties of the mag-PEI nanoparticles and DNA-bound mag-PEI nanoparticles were investigated using the gel retardation assay, atomic force microscopy, and zeta size measurements. The gene transfection efficiencies of mag-PEI nanoparticles were evaluated at different transfection times. Confocal laser scanning microscopy confirmed intracellular uptake of the magnetoplex. The optimal conditions for transfection of TPH-2 were selected for therapeutic gene transfection. We isolated the TPH-2 gene from the total RNA of the human medulla oblongata and cloned it into an expression vector. The plasmid containing TPH-2 was subsequently bound onto the

In vitro studies of magnetically enhanced transfection in COS-7 cells

International Nuclear Information System (INIS)

Ang, D.; Tay, C.Y.; Tan, L.P.; Preiser, P.R.; Ramanujan, R.V.

2011-01-01

In the magnetically enhanced gene delivery technique, DNA complexed with polymer coated aggregated magnetic nanoparticles (AMNPs) is used for effecting transfection. The aim of this study is to examine the relationship between transfection efficiency and the physical characteristics of the polymer coated AMNPs. In vitro studies of transfection efficiency in COS-7 cells were carried out using pEGFP-N1 and pMIR-REPORT complexed polyethylenimine (PEI) coated iron oxide magnetic nanoparticles. PEI coated AMNPs (PEI-AMNPs) with average individual particle diameters in the range of 8 nm to 30 nm were studied and characterized by transmission electron microscopy, vibrating sample magnetometry, X-ray diffractometry, thermal gravimetric analysis and photon correlation spectroscopy methods. PEI-A8MNP and PEI-A30MNP yielded higher transfection efficiency compared to commercial polyMAG particles as well as PEI of equivalent molar ratio of nitrogen/phosphorous (N/P ratio). The transfection efficiency was related to the physical characteristics of the PEI-AMNPs and its complexes: transfection efficiency was strongly positively correlated with saturation magnetization (Ms) and susceptibility (χ), strongly negatively correlated with N/P ratio, moderately positively correlated to zeta potential and moderately negatively correlated to hydrodynamic diameter of the complex. PEI-A8MNP and PEI-A30MNP possessing higher Ms, χ, lower N/P ratio and smaller complex size exhibited higher transfection efficiency compared to PEI-A16MNP which have weaker magnetic properties, higher N/P ratio and larger complex size. We have demonstrated that optimization of the physical properties of PEI-AMNPs is needed to maximize transfection efficiency. - Research highlights: →The transfection efficiency in magnetically enhanced gene delivery was studied. →Transfection efficiency was strongly positively correlated to magnetic properties. →Transfection efficiency was strongly negatively correlated with

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

Science.gov (United States)

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

Regulation of p53 tetramerization and nuclear export by ARC.

Science.gov (United States)

Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

2007-12-26

Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

International Nuclear Information System (INIS)

Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

2000-01-01

The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53δ, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53δ cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of undifferentiated

The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

Energy Technology Data Exchange (ETDEWEB)

Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura [Kyoto Univ. (Japan). Radiation Biology Center; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

2000-09-01

The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53{delta}, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53{delta} cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of

Aberrations of the p53 pathway components p53, MDM2 and CDKN2A appear independent in diffuse large B cell lymphoma

DEFF Research Database (Denmark)

Møller, Michael Boe; Ino, Y; Gerdes, A M

1999-01-01

The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...

P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

Directory of Open Access Journals (Sweden)

Ivan Raimondi

Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

The expanding regulatory universe of p53 in gastrointestinal cancer.

Science.gov (United States)

Fesler, Andrew; Zhang, Ning; Ju, Jingfang

2016-01-01

Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

Platelet-derived growth factor (PDGF)-signaling mediates radiation-induced apoptosis in human prostate cancer cells with loss of p53 function

International Nuclear Information System (INIS)

Kim, Harold E.; Han, Sue J.; Kasza, Thomas; Han, Richard; Choi, Hyeong-Seon; Palmer, Kenneth C.; Kim, Hyeong-Reh C.

1997-01-01

Platelet-derived growth factor (PDGF) signals a diversity of cellular responses in vitro, including cell proliferation, survival, transformation, and chemotaxis. PDGF functions as a 'competence factor' to induce a set of early response genes expressed in G 1 including p21 WAF1/CIP1 , a functional mediator of the tumor suppressor gene p53 in G 1 /S checkpoint. For PDGF-stimulated cells to progress beyond G 1 and transit the cell cycle completely, progression factors in serum such as insulin and IGF-1 are required. We have recently shown a novel role of PDGF in inducing apoptosis in growth-arrested murine fibroblasts. The PDGF-induced apoptosis is rescued by insulin, suggesting that G 1 /S checkpoint is a critical determinant for PDGF-induced apoptosis. Because recent studies suggest that radiation-induced signal transduction pathways interact with growth factor-mediated signaling pathways, we have investigated whether activation of the PDGF-signaling facilitates the radiation-induced apoptosis in the absence of functional p53. For this study we have used the 125-IL cell line, a mutant p53-containing, highly metastatic, and hormone-unresponsive human prostate carcinoma cell line. PDGF signaling is constitutively activated by transfection with a p28 v-sis expression vector, which was previously shown to activate PDGF α- and β- receptors. Although the basal level of p21 WAF1/CIP1 expression and radiation-induced apoptosis were not detectable in control 125-IL cells as would be predicted in mutant p53-containing cells, activation of PDGF-signaling induced expression of p21 WAF1/CIP1 and radiation-induced apoptosis. Our study suggests that the level of 'competence' growth factors including PDGF may be one of the critical determinants for radiation-induced apoptosis, especially in cells with loss of p53 function at the site of radiotherapy in vivo

A dynamic P53-MDM2 model with time delay

Energy Technology Data Exchange (ETDEWEB)

Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

2006-11-15

Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

A dynamic P53-MDM2 model with time delay

International Nuclear Information System (INIS)

Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

2006-01-01

Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

Tumor suppressor p53 biology, its role in radioresponse and the analysis of p53 mutation/expression among Filipino breast cancers

International Nuclear Information System (INIS)

Deocaris, Custer C.

2004-01-01

Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death

Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

Directory of Open Access Journals (Sweden)

Kristina Kirschner

2015-03-01

Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.