Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Directory of Open Access Journals (Sweden)
Rashid Mir
2016-01-01
Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.
Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice
International Nuclear Information System (INIS)
Zhang, Y.; Woloschak, G.E.
1997-01-01
This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
p53 in differentiation of thyroid cancer
International Nuclear Information System (INIS)
Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.
1993-01-01
P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)
Effect of p53 genotype on gene expression profiles in murine liver
International Nuclear Information System (INIS)
Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.
2008-01-01
The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs
DEFF Research Database (Denmark)
Silveira, Cássia G T; Oliveira, Fábio M; Valera, Elvis T
2009-01-01
Myelodysplastic syndrome (MDS) is a rare hematological malignancy in children. It was performed FISH analysis in 19 pediatric MDS patients to investigate deletions involving the PPARgamma and TP53 genes. Significant losses in the PPARgamma gene and deletions in the tumor suppressor gene TP53 were...
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation
International Nuclear Information System (INIS)
Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY
1996-01-01
Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy
Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer
International Nuclear Information System (INIS)
Irshad, S.; Nawaz, T.
2008-01-01
Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)
Directory of Open Access Journals (Sweden)
Rejane Mattar
2004-01-01
Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea
Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba
2016-02-01
Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
International Nuclear Information System (INIS)
Tierney, L.A.; Johnson, N.F.; Lechner, J.F.
1994-01-01
Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
DELETION AND 5'CPG ISLAND METHYLATION OF p15 GENE IN BRAIN GLIOMA
Institute of Scientific and Technical Information of China (English)
无
2000-01-01
Objective: To investigate the abnormality of p15 gene in brain glioma and the correlation of it with occurrence or malignant progression of brain glioma. Methods: Deletion and 5'CPG island methylation of p15 gene were detected by the methods of PCR and PCR-based methylation in 56 cases of brain glioma. Results: Out of 43 cases of high grade glioma, 14 cases were found to have homozygous deletion of p15E1, while none of the 13 cases of low grade glioma was found to have deletion of p15E1 (P<0.05). Methylation of 5'CPG Island of p15 gene was found only in four cases of glioma. Conclusion: Abnormality of p15 gene may involved in the occurrence and malignant progression of brain glioma. Homozygous deletion of gene is the major mechanism of inactivation for p15 gene in brain glioma.
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.
Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna
2018-03-01
Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.
The genetic alteration of p53 in esophageal cancer
Energy Technology Data Exchange (ETDEWEB)
Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-01-01
Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.
Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K
2018-01-01
Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
International Nuclear Information System (INIS)
Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira
2007-01-01
p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain
Directory of Open Access Journals (Sweden)
Zhihong CHEN
2011-10-01
Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
p53 tumor suppressor gene: significance in neoplasia - a review
International Nuclear Information System (INIS)
Alam, J.M.
2000-01-01
p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
DEFF Research Database (Denmark)
Honoré, Bent; Buus, Søren; Claësson, Mogens H
2008-01-01
ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two-dimensiona......ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two...... alpha type 3, transforming acidic coiled-coil containing protein 3, mitochondrial ornithine aminotransferase and epidermal fatty acid binding protein and down-regulation of adenylosuccinate synthetase, tubulin beta-3 chain, a 25 kDa actin fragment, proteasome subunit beta type 9, cofilin-1 and glia...
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
p53 as the focus of gene therapy: past, present and future.
Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani
2018-01-15
Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
Alterations in the K-ras and p53 genes in rat lung tumors
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others
1997-06-01
Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Allelic deletions of cell growth regulators during progression of bladder cancer
DEFF Research Database (Denmark)
Primdahl, H; von der Maase, H; Christensen, M
2000-01-01
Cell growth regulators include proteins of the p53 pathway encoded by the genes CDKN2A (p16, p14arf), MDM2, TP53, and CDKN1A (p21) as well as proteins encoded by genes like RB1, E2F, and MYCL. In the present study we investigated allelic deletions of all these genes in each recurrent bladder tumor...... difference in the numbers of gene loci hit by deletions muscle-invasive versus noninvasive tumors (P = 0.0000002), with the genes most often hit by deletions in muscle-invasive tumors being TP53, RB1, and MYCL. A number of novel findings were made. Losses of MYCL and RB1 alleles were more pronounced...... that a characteristic difference between recurrent noninvasive and recurrent progressing bladder tumors is loss of cell cycle-regulatory genes in the latter group....
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma
International Nuclear Information System (INIS)
Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.
2014-01-01
Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.
1987-01-01
Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase)], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions
Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.
Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi
2018-04-19
Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.
Menin and p53 have non-synergistic effects on tumorigenesis in mice
International Nuclear Information System (INIS)
Loffler, Kelly A; Mould, Arne W; Waring, Paul M; Hayward, Nicholas K; Kay, Graham F
2012-01-01
While it is now more than a decade since the first description of the gene mutation underlying the tumour predisposition syndrome multiple endocrine neoplasia type 1 (MEN1), the mechanism by which its protein product menin acts to prevent development of tumours is still poorly understood. We undertook a genetic experiment to assess whether menin synergises with p53. Mice carrying various combinations of Men1 and Trp53 mutations were generated then survival and pathology assessed. While homozygous loss of Trp53 in mice resulted in early onset, aggressive tumours and profoundly reduced lifespan, heterozygous loss of either Trp53 or Men1 caused later onset disease, with a spectrum of tumours characteristic of each tumour suppressor gene. Loss of one copy of Men1 in animals also lacking both alleles of Trp53 did not exacerbate phenotype, based on survival, animal weight or sites of pathology, compared to Trp53 deletion alone. Dual heterozygous deletion of Men1 and Trp53 resulted in a small reduction in lifespan compared to the individual mutations, without new tumour sites. In the adrenal, we observed development of cortical tumours in dual heterozygous animals, as we have previously seen in Men1 +/− animals, and there was loss of heterozygosity at the Men1 allele in these tumours. Median number of pathology observations per animal was increased in dual heterozygous animals compared with heterozygous loss of Trp53 alone. Simultaneous heterozygous deletion of Men1 in animals with either heterozygous or homozygous deletion of Trp53 did not result in formation of tumours at any new sites, implying additive rather than synergistic effects of these pathways. Mice that were Men1 +/− in addition to Trp53 +/− had tumours in endocrine as well as other sites, implying that increase in total tumour burden, at sites typically associated with either Men1 or Trp53 loss, contributed to the slight decrease in survival in Men1 +/− : Trp53 +/− animals in comparison with their
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
Directory of Open Access Journals (Sweden)
Agnes C. Fett-Conte
2002-04-01
Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
International Nuclear Information System (INIS)
Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying
2007-01-01
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
Polymorphism at codon 36 of the p53 gene.
Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A
1994-01-01
A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A
2009-05-01
Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53
Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.
Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens
2005-04-01
The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Alterations in tumour suppressor gene p53 in human gliomas from ...
Indian Academy of Sciences (India)
Unknown
Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.
Regulation of Metabolic Activity by p53
Directory of Open Access Journals (Sweden)
Jessica Flöter
2017-05-01
Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.
Directory of Open Access Journals (Sweden)
Guerra-Júnior Gil
2010-06-01
Full Text Available Abstract Background Congenital adrenal hyperplasia due to 21-hydroxylase deficiency is caused by deletions, large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes for putative serine/threonine Kinase RP, complement C4, steroid 21-hydroxylase CYP21 tenascin TNX, normally, in a duplicated cluster known as RCCX module. The CYP21 extra copy is a pseudogene (CYP21A1P. In Brazil, 30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles. Such alleles are considered to result from unequal crossovers within the bimodular C4/CYP21 locus. Depending on the localization of recombination breakpoint, different alleles can be generated conferring the locus high degree of allelic variability. The purpose of the study was to investigate the variability of deleted alleles in patients with 21-hydroxylase deficiency. Methods We used different techniques to investigate the variability of 30-kb deletion alleles in patients with 21-hydroxylase deficiency. Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR and MLPA analyses followed by sequencing to refine the location of recombination breakpoints. Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. Results An allele carrying a CYP21A1P/A2 chimeric gene was found unusually associated to a C4B/C4A Taq I 6.4-kb fragment, generally associated to C4B and CYP21A1P deletions. A novel haplotype bearing both p.P34L and p.H62L, novel and rare mutations, respectively, was identified in exon 1, however p.P30L, the most frequent pseudogene-derived mutation in this exon, was absent. Four unrelated patients showed this haplotype. Absence of p.P34L in CYP21A1P of normal controls indicated that it is not derived from pseudogene. In addition, the combination of different
Status and advances of p53-gene therapy and radiotherapy in malignant tumor
International Nuclear Information System (INIS)
Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong
2006-01-01
Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...
Multigene deletions in lung adenocarcinomas from irradiated and control mice
International Nuclear Information System (INIS)
Zhang, Y.; Woloschak, G.E.
1996-01-01
K-ras codon 12 point mutations mRb and p53 gene deletions were examined in tissues from 120 normal lungs and lung adenocarcinomas that were Formalin-treated and paraffin-embedded 25 years ago. The results showed that 12 of 60 (20%) lung adenocarcinomas had mRb deletions. All lung adenocarcinomas that were initially found bearing deleted mRb had p53 deletions (15 of 15; 100%). A significantly higher mutation frequency for K-ras codon 12 point mutations was also found in the lung adenocarcinomas from mice exposed to 24 once-weekly neutron irradiation (10 of 10; 100%) compared with those exposed to 24 or 60 once-weekly γ-ray doses (5 of 10; 50%). The data suggested that p53 and K-ras gene alterations were two contributory factors responsible for the increased incidence of lung adenocarcinoma in B6CF 1 male mice exposed to protracted neutron radiation
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing
2011-12-01
Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and
Lozano-Santos, Carol; García-Vela, José A; Pérez-Sanz, Nuria; Nova-Gurumeta, Sara; Fernandez-Cuevas, Belen; Gomez-Lozano, Natalia; Sánchez-Beato, Margarita; Sanchez-Godoy, Pedro; Bueno, José Luis; Garcia-Marco, José A
2017-04-01
The prognostic impact of biallelic ATM abnormalities (ATM mutation and concurrent 11q deletion) remains unknown. We studied ATM, BIRC3, SF3B1, and NOTCH1 genes in 118 treatment-naïve CLL patients at diagnosis. Patients with biallelic ATM alteration had a similar time to first treatment (TTFT) and shorter overall survival (OS) compared with patients with isolated 11q deletion and shorter TTFT and OS when compared to patients with wild-type ATM. Furthermore, biallelic ATM alteration (HR: 6.4; p ≤ 0.007) was significantly associated with an increased risk of death similar to p53 deletion (HR: 6.1; p ≤ 0.004), superior to 11q deletion alone (HR: 2.8; p ≤ 0.022) and independent of other significant parameters such as age, advanced clinical stage, and complex karyotype. Our results suggest the identification of ATM mutations in CLL patients with 11q deletion at diagnosis is clinically relevant and predicts disease progression, poor response to the treatment, and reduced OS independent of other molecular prognostic factors.
The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Andrew Fesler
2016-04-01
Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer
Directory of Open Access Journals (Sweden)
Wen-Cheng Chung
2017-11-01
Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.
Directory of Open Access Journals (Sweden)
Peiyuan Jia
Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.
Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick
2003-08-01
Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its
Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki
2004-01-01
We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)
International Nuclear Information System (INIS)
Yue-Hua Wang; De-jie Chen; Tie-Nan Yi
2010-01-01
To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Changes in protein expression in p53 deleted spontaneous thymic lymphomas
DEFF Research Database (Denmark)
Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm
2004-01-01
with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Multiple Patterns of FHIT Gene Homozygous Deletion in Egyptian Breast Cancer Patients
International Nuclear Information System (INIS)
Ismail, H.M.S.; Zakhary, N.I.; Medhat, A.M.; Karim, A.M.
2011-01-01
Fragile histidine triad (FHIT) gene encodes a putative tumour suppressor protein. Loss of Fhit protein in cancer is attributed to different genetic alterations that affect the FHIT gene structure. In this study, we investigated the pattern of homozygous deletion that target the FHIT gene exons 3 to 9 genomic structure in Egyptian breast cancer patients. We have found that 65% (40 out of 62) of the cases exhibited homozygous deletion in at least one FHIT exon. The incidence of homozygous deletion was not associated with patients clinico pathological parameters including patients age, tumour grade, tumour type, and lymph node involvement. Using correlation analysis, we have observed a strong correlation between homozygous deletions of exon 3 and exon 4 (P<0.0001). Deletions in exon 5 were positively correlated with deletions in exon 7 (P<0.0001), Exon 8 (P<0.027), and exon 9 (P=0.04). Additionally, a strong correlation was observed between exons 8 and exon 9 (P<0.0001).We conclude that FHIT gene exons are homozygously deleted at high frequency in Egyptian women population diagnosed with breast cancer. Three different patterns of homozygous deletion were observed in this population indicating different mechanisms of targeting FHIT gene genomic structure.
Deletion of GOLGA2P3Y but not GOLGA2P2Y is a risk factor for oligozoospermia.
Sen, Sanjukta; Agarwal, Rupesh; Ambulkar, Prafulla; Hinduja, Indira; Zaveri, Kusum; Gokral, Jyotsna; Pal, Asoke; Modi, Deepak
2016-02-01
The AZFc locus on the human Y chromosome harbours several multicopy genes, some of which are required for spermatogenesis. It is believed that deletion of one or more copies of these genes is a cause of infertility in some men. GOLGA2LY is one of the genes in the AZFc locus and it exists in two copies, GOLGA2P2Y and GOLGA2P3Y. The involvement of GOLGA2LY gene copy deletions in male infertility, however, is unknown. This study aimed to investigate the association of deletions of GOLGA2P2Y and GOLGA2P3Y gene copies with male infertility and with sperm concentration and motility. The frequency of GOLGA2P3Y deletion was significantly higher in oligozoospermic men compared with normozoospermic men (7.7% versus 1.2%; P = 0.0001), whereas the frequency of GOLGA2P2Y deletion was comparable between oligozoospermic and normozoospermic men (10.3% versus 11.3%). The deletion of GOLGA2P3Y but not GOLGA2P2Y was significantly higher (P = 0.03) in men with gr/gr rearrangements, indicating that GOLGA2P3Y deletions increase the susceptibility of men with gr/gr rearrangements to oligozoospermia. Furthermore, men with GOLGA2P3Y deletion had reduced sperm concentration and motility compared with men without deletion or with deletion of GOLGA2P2Y. These findings indicate GOLGA2P3Y gene copy may be candidate AZFc gene for male infertility. Copyright © 2015 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio
2005-01-01
Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells
Directory of Open Access Journals (Sweden)
Xiaoli Li
2018-02-01
Full Text Available Summary: Overactive p53 has been proposed as an important pathophysiological factor for bone marrow failure syndromes, including Fanconi anemia (FA. Here, we report a p53-dependent effect on hematopoietic stem and progenitor cell (HSPC proliferation in mice deficient for the FA gene Fanca. Deletion of p53 in Fanca−/− mice leads to replicative exhaustion of the hematopoietic stem cell (HSC in transplant recipients. Using Fanca−/− HSCs expressing the separation-of-function mutant p53515C transgene, which selectively impairs the p53 function in apoptosis but keeps its cell-cycle checkpoint activities intact, we show that the p53 cell-cycle function is specifically required for the regulation of Fanca−/− HSC proliferation. Our results demonstrate that p53 plays a compensatory role in preventing FA HSCs from replicative exhaustion and suggest a cautious approach to manipulating p53 signaling as a therapeutic utility in FA. : In this article, Pang and colleagues demonstrate a p53-dependent HSPC proliferation regulation in mice deficient for the Fanca gene in the Fanconi anemia (FA pathway. They show that the p53 cell-cycle function is specifically required for the regulation of FA HSC proliferation. These results suggest that overactive p53 may represent a compensatory checkpoint mechanism for FA HSC proliferation. Keywords: p53, bone marrow failure, Fanconi anemia, hematopoietic stem and progenitor cells, apoptosis, cell cycle, proliferation
Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G
2000-03-01
Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine
International Nuclear Information System (INIS)
Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R
2008-01-01
p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.
2012-01-01
During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
Conditional inactivation of PDCD2 induces p53 activation and cell cycle arrest
Directory of Open Access Journals (Sweden)
Celine J. Granier
2014-08-01
Full Text Available PDCD2 (programmed cell death domain 2 is a highly conserved, zinc finger MYND domain-containing protein essential for normal development in the fly, zebrafish and mouse. The molecular functions and cellular activities of PDCD2 remain unclear. In order to better understand the functions of PDCD2 in mammalian development, we have examined PDCD2 activity in mouse blastocyst embryos, as well as in mouse embryonic stem cells (ESCs and embryonic fibroblasts (MEFs. We have studied mice bearing a targeted PDCD2 locus functioning as a null allele through a splicing gene trap, or as a conditional knockout, by deletion of exon2 containing the MYND domain. Tamoxifen-induced knockout of PDCD2 in MEFs, as well as in ESCs, leads to defects in progression from the G1 to the S phase of cell cycle, associated with increased levels of p53 protein and p53 target genes. G1 prolongation in ESCs was not associated with induction of differentiation. Loss of entry into S phase of the cell cycle and marked induction of nuclear p53 were also observed in PDCD2 knockout blastocysts. These results demonstrate a unique role for PDCD2 in regulating the cell cycle and p53 activation during early embryonic development of the mouse.
Directory of Open Access Journals (Sweden)
Alfredo Ribeiro-Silva
2003-06-01
Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human
Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.
Yeung, S J; Pan, J; Lee, M-H
2008-12-01
Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.
International Nuclear Information System (INIS)
Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.
2002-01-01
The aim of this prospective trial was to evaluate the feasibility and outcome of breast conservation therapy for patients with locally advanced breast cancer after neoadjuvant chemotherapy. We studied also the value of p53 and MDR1 as predictors to neoadjuvant chemotherapy. Patients and methods: Bet ween August 1997 and May 2000, 58 patients with locally advanced breast carcinoma (stages IlIA and lllB) completed treatment consisting of 5 fluorouracil 600 mg/m 2 , epirubicin 60 mg/m 2 and cyclophosphamide 600 mg/m 2 (FEC) administered intravenously, at intervals of 3 weeks. The number of cycles of chemotherapy given depended on the clinical tumor response. Surgery (local excision if sufficiently down staged, or mastectomy if not, both with axillary dissection) was performed. Surgery was followed by radiation therapy and 4 more cycles of FEC chemotherapy as an adjuvant therapy. P53 and MDR1 were assessed in the initial tissue biopsy by means of reverse transcriptase-mediated polymerase chain reaction (RT-PCR). p53 and MDR1 findings were correlated with treatment response and linkage between p53 function and cellular response was assessed by terminal deoxynucleotidyl transferase-mediated nick end labeling assay. Results: The overall response (CR+PR) was 87.9%, with a clinical complete response rate of 29.3%. Six patients had a pathological complete response and 10 patients had only minimal residual disease. Median followup from the start of chemotherapy was 24 months (range 6 to 40). Twenty two patients (43%) underwent BCS with actuarial 3-year disease-free and overall survival of 58% and 75% respectively. Cosmetic results were good to excellent in 77.2% of the patients. Modified radical mastectomy was done in 29/51 (56.9%) patients with actuarial 3 year disease-free and overall survival of 60% and 78% respectively.In 13 out of 58 patients (22.4%), p53 mutations could be identified, including eight point mutations, three minor deletions and two complex deletions
Directory of Open Access Journals (Sweden)
Jennifer M. Smith
2007-12-01
Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
Directory of Open Access Journals (Sweden)
Anirban Chakraborty
Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
P53 suppresses expression of the 14-3-3gamma oncogene
Directory of Open Access Journals (Sweden)
Qi Wenqing
2011-08-01
Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.
Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors
International Nuclear Information System (INIS)
Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.
2010-01-01
Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)
Directory of Open Access Journals (Sweden)
Paolo Prontera
2017-09-01
Full Text Available Moyamoya angiopathy (MA is a rare cerebrovascular disorder characterised by the progressive occlusion of the internal carotid artery. Its aetiology is uncertain, but a genetic background seems likely, given the high MA familial rate. To investigate the aetiology of craniosynostosis and juvenile moyamoya in a 14-year-old male patient, we performed an array-comparative genomic hybridisation revealing a de novo interstitial deletion of 8.5 Mb in chromosome region 1p32p31. The deletion involved 34 protein coding genes, including NF1A, whose haploinsufficiency is indicated as being mainly responsible for the 1p32-p31 chromosome deletion syndrome phenotype (OMIM 613735. Our patient also has a deleted FOXD3 of the FOX gene family of transcription factors, which plays an important role in neural crest cell growth and differentiation. As the murine FOXD3−/− model shows craniofacial anomalies and abnormal common carotid artery morphology, it can be hypothesised that FOXD3 is involved in the pathogenesis of the craniofacial and vascular defects observed in our patient. In support of our assumption, we found in the literature another patient with a syndromic form of MA who had a deletion involving another FOX gene (FOXC1. In addition to describing the clinical history of our patient, we have reviewed all of the available literature concerning other patients with a 1p32p31 deletion, including cases from the Decipher database, and we have also reviewed the genetic disorders associated with MA, which is a useful guide for the diagnosis of syndromic form of MA.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
International Nuclear Information System (INIS)
Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang
2007-01-01
Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is
Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan
2002-04-10
We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.
Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J
2014-06-01
Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Directory of Open Access Journals (Sweden)
Natália Duarte Linhares
Full Text Available Abstract Deletion-induced hemizygosity may unmask deleterious autosomal recessive variants and be a cause of the phenotypic variability observed in microdeletion syndromes. We performed complete exome sequencing (WES analysis to examine this possibility in a patient with 1p13.2 microdeletion. Since the patient displayed clinical features suggestive of Noonan Syndrome (NS, we also used WES to rule out the presence of pathogenic variants in any of the genes associated with the different types of NS. We concluded that the clinical findings could be attributed solely to the 1p13.2 haploinsufficiency. Retrospective analysis of other nine reported patients with 1p13.2 microdeletions showed that six of them also presented some characteristics of NS. In all these cases, the deleted segment included the NRAS gene. Gain-of-function mutations of NRAS gene are causally related to NS type 6. Thus, it is conceivable that NRAS haploinsufficiency and gain-of-function mutations may have similar clinical consequences. The same phenomenon has been described for two other genes belonging to the Ras/MAPK pathway: MAP2K2 and SHOC2. In conclusion, we here report genotype-phenotype correlations in patients with chromosome 1p13.2 microdeletions and we propose that NRAS may be a critical gene for the NS characteristics in the patients.
Directory of Open Access Journals (Sweden)
Hayder M. Al-kuraishy
2018-01-01
Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.
Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer
Directory of Open Access Journals (Sweden)
Villiard Éric
2007-09-01
Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However
Bladder-like graphical representation of p53 gene alterations in some human cancers
International Nuclear Information System (INIS)
Helal, N.L.; Dorrah, M.; LI, C.
2005-01-01
the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.
1993-01-01
Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the
Directory of Open Access Journals (Sweden)
Alicia Blaker-Lee
2012-11-01
Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs, intellectual disability disorder (IDD and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV. The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed ‘dosage sensors’, which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development – impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa and kinesin family member 22 (kif22 genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.
Directory of Open Access Journals (Sweden)
Arindam Datta
2016-06-01
Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.
TTY2 genes deletions as genetic risk factor of male infertility.
Shaveisi-Zadeh, F; Alibakhshi, R; Asgari, R; Rostami-Far, Z; Bakhtiari, M; Abdi, H; Movafagh, A; Mirfakhraie, R
2017-02-28
Y chromosome has a number of genes that are expressed in testis and have a role in spermatogenesis. TTY2L12A and TTY2L2A are the members of testis transcript Y2 (TTY2) that are Y linked multi-copy gene families, located on Yp11 and Yq11 loci respectively. The aim of this study was to investigate frequency of TTY2L12A and TTY2L2A deletions in azoospermic patients compared with fertile males. This study was performed on 45 infertile males with idiopathic azoospermia without any AZF micro deletions (group A), 33 infertile males with azoospermia which do not screened for AZF micro deletions (group B) and 65 fertile males (group C), from October 2013 to April 2015 in west of Iran. Polymerase chain reaction (PCR) method was used for detection of TTY2L12A and TTY2L2A gene deletions in studied groups. No deletions were detected in normal fertile males of group C. 1 out of 45 azoospermic males of group A (2.22%) and 3 out of 33 azoospermic males of group B (9.09%) had TTY2L2A deletion (p= 0.409 and p= 0.036 respectively), also 1 out of 45 azoospermic males of group A (2.22%) and 4 out of 33 azoospermic males of group B (12.12%) had TTY2L12A deletion (p= 0.409 and p= 0.011 respectively). None of azoospermic males in Group A and B had deletions in both genes. Our data showed significant correlation between non-obstructive azoospermia and TTY2L12A and TTY2L2A deletions. Thus, it seems that TTY2L12A and TTY2L2A deletions can consider as one of the genetic risk factors for non-obstructive azoospermia.
International Nuclear Information System (INIS)
Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang
2006-01-01
The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)
Rapid detection of single nucleotide mutation in p53 gene based on ...
Indian Academy of Sciences (India)
mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.
Kashofer, Karl; Regauer, Sigrid
2017-08-01
This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.
Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete
2018-06-11
CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2015-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Directory of Open Access Journals (Sweden)
Manujendra N Saha
Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.
1996-01-01
Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.
Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M
2015-12-01
Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.
Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun
2010-01-01
A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072
Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression
International Nuclear Information System (INIS)
Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo
2009-01-01
A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.
Directory of Open Access Journals (Sweden)
Krzysztof Puszynski
2014-12-01
Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer
International Nuclear Information System (INIS)
Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong
2009-01-01
Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their
Chen, Chih-Ping; Lee, Meng-Ju; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Chen, Yu-Ting; Lee, Meng-Shan; Wang, Wayseen
2013-10-25
We present prenatal diagnosis of de novo proximal interstitial deletion of chromosome 4p (4p15.2→p14) and molecular cytogenetic characterization of the deletion using uncultured amniocytes. We review the phenotypic abnormalities of previously reported patients with similar proximal interstitial 4p deletions, and we discuss the functions of the genes of RBPJ, CCKAR, STIM2, PCDH7 and ARAP2 that are deleted within this region. © 2013.
White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M
2014-08-01
The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the
International Nuclear Information System (INIS)
Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong
2008-01-01
Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)
[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].
Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G
2012-01-01
In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.
Directory of Open Access Journals (Sweden)
Reza Akhavan-Sigari
2014-08-01
Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy
International Nuclear Information System (INIS)
Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.
1996-01-01
cellular phenotypes, including the radioresistant phenotype. Pre-clinical studies suggest that these phenotypes may be reversed using adenovirus-mediated gene therapy or pharmacologic strategies designed to re-institute WTp53 protein function. Our analysis of the published data strongly argues for the use offunctional assays for the determination of WTp53 protein function in studies which attempt to correlate normal and tumour tissue radioresponse with p53 genotype, or p53 protein expression
Directory of Open Access Journals (Sweden)
Vladimir O. Pustylnyak
2015-01-01
Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.
A strong deletion bias in nonallelic gene conversion.
Directory of Open Access Journals (Sweden)
Raquel Assis
Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.
International Nuclear Information System (INIS)
Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.
1997-01-01
Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis
International Nuclear Information System (INIS)
Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee
1996-12-01
The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs
Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao
2015-07-01
A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
Dysfunctional p53 deletion mutants in cell lines derived from Hodgkin's lymphoma
DEFF Research Database (Denmark)
Feuerborn, Alexander; Moritz, Constanze; von Bonin, Frederike
2006-01-01
Classical Hodgkin's lymphoma (cHL) is a distinct malignancy of the immune system. Despite the progress made in the understanding of the pathology of cHL, the transforming events remain to be elucidated. It has been proposed that mutations in the TP53 gene in biopsy material as well as cell lines ...
International Nuclear Information System (INIS)
Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun
2007-01-01
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
Energy Technology Data Exchange (ETDEWEB)
Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
Directory of Open Access Journals (Sweden)
Zanatta Daniela B
2010-06-01
Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet
International Nuclear Information System (INIS)
Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E
2010-01-01
Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-11-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D
2012-09-01
We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.
The prognostic value of p53 mutation in pediatric marrow hypoplasia
Directory of Open Access Journals (Sweden)
Sharaf Alzahraa EA
2011-06-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Harrison David J
2007-11-01
Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of
Homozygous deletion of the α- and β1-interferon genes in human leukemia and derived cell lines
International Nuclear Information System (INIS)
Diaz, M.O.; Ziemin, S.; Le Beau, M.M.; Pitha, P.; Smith, S.D.; Chilcote, R.R.; Rowley, J.D.
1988-01-01
The loss of bands p21-22 from one chromosome 9 homologue as a consequence of a deletion of the short arm [del(9p)], unbalanced translocation, or monosomy 9 is frequently observed in the malignant cells of patients with lymphoid neoplasias, including acute lymphoblastic leukemia and non-Hodgkin lymphoma. The α- and β 1 -interferon genes have been assigned to this chromosome region (9p21-22). The authors now present evidence of the homozygous deletion of the interferon genes in neoplastic hematopoietic cell lines and primary leukemia cells in the presence or absence of chromosomal deletions that are detectable at the level of the light microscope. In these cell lines, the deletion of the interferon genes is accompanied by a deficiency of 5'-methylthioadenosine phosphorylase, an enzyme of purine metabolism. These homozygous deletions may be associated with the loss of a tumor-suppressor gene that is involved in the development of these neoplasias. The relevant genes may be either the interferon genes themselves or a gene that has a tumor-suppressor function and is closely linked to them
Novo-Filho, Gil M; Montenegro, Marília M; Zanardo, Évelin A; Dutra, Roberta L; Dias, Alexandre T; Piazzon, Flavia B; Costa, Taís V M M; Nascimento, Amom M; Honjo, Rachel S; Kim, Chong A; Kulikowski, Leslie D
2016-01-01
The most prevalent structural variations in the human genome are copy number variations (CNVs), which appear predominantly in the subtelomeric regions. Variable sizes of 4p/4q CNVs have been associated with several different psychiatric findings and developmental disability (DD). We analyzed 105 patients with congenital anomalies (CA) and developmental and/or intellectual disabilities (DD/ID) using MLPA subtelomeric specific kits (P036 /P070) and 4 of them using microarrays. We found abnormal subtelomeric CNVs in 15 patients (14.3%), including 8 patients with subtelomeric deletions at 4p/4q (53.3%). Additional genomic changes were observed at 1p36, 2q37.3, 5p15.3, 5q35.3, 8p23.3, 13q11, 14q32.3, 15q11.2, and Xq28/Yq12. This indicates the prevalence of independent deletions at 4p/4q, involving PIGG, TRIML2, and FRG1. Furthermore, we identified 15 genes with changes in copy number that contribute to neurological development and/or function, among them CRMP1, SORCS2, SLC25A4, and HELT. Our results highlight the association of genes with changes in copy number at 4p and 4q subtelomeric regions and the DD phenotype. Cytogenomic characterization of additional cases with distal deletions should help clarifying the role of subtelomeric CNVs in neurological diseases. © 2016 S. Karger AG, Basel.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...
Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu
1998-01-01
The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.
Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S
p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector
Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing
2017-01-01
Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.
Directory of Open Access Journals (Sweden)
Yitao Wang
2017-03-01
Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.
Directory of Open Access Journals (Sweden)
Ritch Robert
2004-06-01
Full Text Available Abstract Background Thirty-nine patients have been described with deletions involving chromosome 6p25. However, relatively few of these deletions have had molecular characterization. Common phenotypes of 6p25 deletion syndrome patients include hydrocephalus, hearing loss, and ocular, craniofacial, skeletal, cardiac, and renal malformations. Molecular characterization of deletions can identify genes that are responsible for these phenotypes. Methods We report the clinical phenotype of seven patients with terminal deletions of chromosome 6p25 and compare them to previously reported patients. Molecular characterization of the deletions was performed using polymorphic marker analysis to determine the extents of the deletions in these seven 6p25 deletion syndrome patients. Results Our results, and previous data, show that ocular dysgenesis and hearing impairment are the two most highly penetrant phenotypes of the 6p25 deletion syndrome. While deletion of the forkhead box C1 gene (FOXC1 probably underlies the ocular dysgenesis, no gene in this region is known to be involved in hearing impairment. Conclusions Ocular dysgenesis and hearing impairment are the two most common phenotypes of 6p25 deletion syndrome. We conclude that a locus for dominant hearing loss is present at 6p25 and that this locus is restricted to a region distal to D6S1617. Molecular characterization of more 6p25 deletion patients will aid in refinement of this locus and the identification of a gene involved in dominant hearing loss.
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
RBPJ is disrupted in a case of proximal 4p deletion syndrome with epilepsy.
Nakayama, Tojo; Saitsu, Hirotomo; Endo, Wakaba; Kikuchi, Atsuo; Uematsu, Mitsugu; Haginoya, Kazuhiro; Hino-fukuyo, Naomi; Kobayashi, Tomoko; Iwasaki, Masaki; Tominaga, Teiji; Kure, Shigeo; Matsumoto, Naomichi
2014-06-01
Proximal 4p deletion syndrome is characterized clinically by mental retardation, minor dysmorphic facial features, and is occasionally complicated with epilepsy. More than 20 cases of proximal 4p deletion syndrome have been reported, but the causative gene(s) remain elusive. We describe here a 2-year-old female patient with a common manifestation of proximal 4p deletion syndrome and infantile epileptic encephalopathy possessing a de novo balanced translocation t(4;13)(p15.2;q12.13). The patient was diagnosed as infantile spasms at 9 months of age. She presented with dysmorphic facial features and global developmental delay, compatible with proximal 4p deletion syndrome. Using fluorescence in situ hybridization, we determined the translocation breakpoint at 4p15.2 to be within RBPJ. RBPJ is a transcription factor in the Notch/RBPJ signaling pathway, playing a crucial role in the developing human brain, and particularly telencephalon development. Our findings, combined with those of previous studies, strongly suggest that RBPJ is causative for proximal 4p deletion syndrome and epilepsy in this case. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi
2015-09-01
For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation
Directory of Open Access Journals (Sweden)
Labhart Paul
2007-05-01
Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer
International Nuclear Information System (INIS)
Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko
2015-01-01
Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong
2010-11-01
Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.
Directory of Open Access Journals (Sweden)
Jacqueline Miranda de Lima
2006-03-01
Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the
P53, K-RAS, β-CATENIN, C-KIT and BAK mutations in the lung cancer of Chinese and Japanese patients
International Nuclear Information System (INIS)
Shuo Xing; Nobotoshi Nawa; Kazuhiro Tanabe; Tadashi Hongyo; Li- Ya Li; Jing-Tian Tang; Mitsunori Ohta
2005-01-01
Seventeen Chinese (Beijing) and 24 Japanese (Osaka) lung cancer cases were analyzed for mutations of p53, K-ras, β-catenin, c-kit and bak genes by PCR-SSCP analysis followed by direct sequencing. Significantly higher mutation frequency of p53 gene, one of key genes for radiation sensitivity, was found in Chinese cases (11/17; 64.7 %) than Japanese cases (8/24; 33.3 %) (p< O.O5). Fourteen of the 16 mutations found in the Chinese cases were transitions at exon 4,5 and intron 4. In the Japanese cases, of the total of 11 mutations, 5 were transitions and 5 were transversions and one was deletion. Six β-catenin mutations were found in 6 Chinese cases (35.3 % ) at codon 53 and 58, and 4 were found in 3 Japanese cases (12.5 %). C-kit mutations were detected in 5 Chinese cases (29.4 %), while no mutations were found in Japanese cases (p< O.O5). No K-ras mutation was found in both Chinese and Japanese cases. For the first time, we report on bak mutation in human lung cancer in Chinese (2/17; 11.8% ) and Japanese cases (2/24; 8.3% ). C-kit and bak genes are also definitive factors to radiosensitivity. These data thus suggest that there were apparent differences in frequency and/or mutational types of p53, β-catenin and c-kit? genes between Chinese and Japanese cases. The differences can be attributed to factors such as lifestyles including smoking and racial and/or environmental factors, and also to the prediction of the response to radiotherapy. (author)
Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri
2011-07-01
There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.
P53 Gene Mutagenesis in Breast Cancer
National Research Council Canada - National Science Library
Sommer, Steve S
2005-01-01
.... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...
International Nuclear Information System (INIS)
Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.
2002-01-01
The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
International Nuclear Information System (INIS)
Ohnishi, Takeo
1997-01-01
I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Dong, Zhiyong; Zheng, Longzhi; Liu, Weimin; Wang, Cunchuan
2018-01-01
The relationship between TP53 codon 72 Pro/Arg gene polymorphism and colorectal cancer risk in Asians is still controversial, and this bioinformatics analysis and meta-analysis was performed to assess the associations. The association studies were identified from PubMed, and eligible reports were included. RevMan 5.3.1 software, Oncolnc, cBioPortal, and Oncomine online tools were used for statistical analysis. A random/fixed effects model was used in meta-analysis. The data were reported as risk ratios or mean differences with corresponding 95% CI. We confirmed that TP53 was associated with colorectal cancer, the alteration frequency of TP53 was 53% mutation and 7% deep deletion, and TP53 mRNA expression was different in different types of colorectal cancer based on The Cancer Genome Atlas database. Then, 18 studies were included that examine the association of TP53 codon 72 gene polymorphism with colorectal cancer risk in Asians. The meta-analysis indicated that TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asian population, but Arg/Arg genotype was not (Pro allele: odds ratios [OR]=1.20, 95% CI: 1.06 to 1.35, P =0.003; Pro/Pro genotype: OR=1.39, 95% CI: 1.15 to 1.69, P =0.0007; Arg/Arg genotype: OR=0.86, 95% CI: 0.74 to 1.00, P =0.05). Interestingly, in the meta-analysis of the controls from the population-based studies, we found that TP53 codon 72 Pro/Arg gene polymorphism was associated with colorectal cancer risk (Pro allele: OR=1.33, 95% CI: 1.15 to 1.55, P =0.0002; Pro/Pro genotype: OR=1.61, 95% CI: 1.28 to 2.02, P colorectal cancer, but the different value levels of mRNA expression were not associated with survival rate of colon and rectal cancer. TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asians.
Directory of Open Access Journals (Sweden)
Hong Wei Yang
2001-01-01
Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.
Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam
2015-01-21
Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Directory of Open Access Journals (Sweden)
Edwards Jeremy
2003-07-01
Full Text Available Abstract Background The identification of known mutations in a cell population is important for clinical applications and basic cancer research. In this work an immobilized form of the polymerase chain reaction, referred to as polony technology, was used to detect mutations as well as gene deletions, resulting in loss of heterozygosity (LOH, in cancer cell lines. Specifically, the mutational hotspots in p53, namely codons 175, 245, 248, 249, 273, and 282, and K-ras2, codons 12, 13 and 61, were genotyped in the pancreatic cell line, Panc-1. In addition LOH analysis was also performed for these same two genes in Panc-1 by quantifying the relative gene copy number of p53 and K-ras2. Results Using polony technology, Panc-1 was determined to possess only one copy of p53, which possessed a mutation in codon 273, and two copies of K-ras2, one wildtype and one with a mutation in codon 12. To further demonstrate the general approach of this method, polonies were also used to detect K-ras2 mutations in the pancreatic cell lines, AsPc-1 and CAPAN-1. Conclusions In conclusion, we have developed an assay that can detect mutations in hotspots of p53 and K-ras2 as well as diagnose LOH in these same genes.
Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage
Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.
2018-01-01
Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532
International Nuclear Information System (INIS)
Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo
2003-01-01
The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.
Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon
2017-09-19
Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
DEFF Research Database (Denmark)
Møller, Michael Boe; Ino, Y; Gerdes, A M
1999-01-01
The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
Wang, Li; Miao, Kourong; Fan, Lei; Xu, Ji; Wu, Hanxin; Li, Jianyong; Xu, Wei
2016-04-01
To investigate the effectiveness and safety of reduced intensity conditioning allogeneic hematopoietic stem cell transplantation (RIC allo-HSCT) in ultra high risk chronic lymphocytic leukemia (CLL) patients with the deletion of p53 to deepen the understanding of allo-HSCT in the treatment of CLL. In this retrospective study, a total of 4 ultra high risk CLL patients with the deletion of p53 in our center between July 2012 and Jan 2014 were enrolled. The RIC regimen was administered and the hematopoietic reconstitution, transplantation related mortality (TRM), overall survival (OS), progress free survival (PFS) were evaluated. We registered 4 patients with the median age of 56 years (49-61 years), including 3 males and 1 female. The median mononuclear cells (MNC) and CD34(+) cells were 6.54 (2.85-14.7) × 10(8)/kg (recipient body weight) and 5.81 (2.85-7.79) × 10(6)/kg (recipient body weight), respectively. The median time of the neutrophil recovery was 11 days (range of 9-12 days), and the median time of the platelet recovery 5.5 days (range of 0-11 days). Three patients (75%) attained a full donor chimerism at day 28 after transplantation and one (25%) got a mixed chimerism of donor and recipient. During the follow-up at a median time of 26.5 months (range of 21-39 months), 2 (50%) patients developed acute graft versus host disease (aGVHD) grade I and 2 (50%) patients got CMV infection. One patient got herpes zoster virus and EB virus infections. No transplantation related mortality was found in the 4 patients. One patient who was in partial response status progressed 5 months after transplantation, and the other 3 patients remained in durable remission after allo-HSCT. These results suggested that RIC allo-HSCT showed durable remission, good tolerance and acceptable toxicity, which could be a better option for the treatment of ultra high risk CLL patients with the deletion of p53 and was worth to be investigated and applied widely in future.
What is the best frontline therapy for patients with CLL and 17p deletion?
Badoux, Xavier C; Keating, Michael J; Wierda, William G
2011-03-01
Chronic lymphocytic leukemia (CLL) is a lymphoproliferative disease with significant variation in disease progression, response to therapy, and survival outcome. Deletions of 17p or mutations of TP53 have been identified as one of the poorest prognostic factors, being predictive of short time for disease progression, lack of response to therapy, short response duration, and short overall survival. The treatment of patients with CLL has improved significantly with the development of chemoimmunotherapy, but this benefit was not pronounced in patients with 17p deletion. We compare various treatment strategies used in these patients, including FCR-like chemoimmunotherapy, alemtuzumab, other antibody combinations, or novel targeted therapies with promising results. Allogeneic stem cell transplantation offers the possibility for long-term disease control in these patients and should be considered early in younger, transplant-eligible patients. The current state of therapy is far from optimal and resources should be applied to studying therapeutic options for patients who have CLL with loss of p53 function.
A dynamic P53-MDM2 model with time delay
Energy Technology Data Exchange (ETDEWEB)
Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com
2006-11-15
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.
A dynamic P53-MDM2 model with time delay
International Nuclear Information System (INIS)
Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.
2006-01-01
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
Clinical comparison of overlapping deletions of 19p13.3.
Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A
2013-05-01
We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.
Flipsen-ten Berg, Klara; van Hasselt, Peter M; Eleveld, Marc J; van der Wijst, Suzanne E; Hol, Frans A; de Vroede, Monique A M; Beemer, Frits A; Hochstenbach, P F Ron; Poot, Martin
2007-11-01
The Wolf-Hirschhorn syndrome (WHS (MIM 194190)), which is characterized by growth delay, mental retardation, epilepsy, facial dysmorphisms, and midline fusion defects, shows extensive phenotypic variability. Several of the proposed mutational and epigenetic mechanisms in this and other chromosomal deletion syndromes fail to explain the observed phenotypic variability. To explain the complex phenotype of a patient with WHS and features reminiscent of Wolfram syndrome (WFS (MIM 222300)), we performed extensive clinical evaluation and classical and molecular cytogenetic (GTG banding, FISH and array-CGH) and WFS1 gene mutation analyses. We detected an 8.3 Mb terminal deletion and an adjacent 2.6 Mb inverted duplication in the short arm of chromosome 4, which encompasses a gene associated with WFS (WFS1). In addition, a nonsense mutation in exon 8 of the WFS1 gene was found on the structurally normal chromosome 4. The combination of the 4p deletion with the WFS1 point mutation explains the complex phenotype presented by our patient. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletions represents an additional explanation for the phenotypic variability observed in chromosomal deletion disorders.
Phylogenetic analysis of human Tp53 gene using computational ...
African Journals Online (AJOL)
The TP53 gene encoding p53 protein is involved in regulating a series of pathways. New discoveries about the function and control of p53 are still in progress and it is hoped to develop better therapeutics and diagnostics by exploiting this system. Evolutionary studies are of prime importance in the field of biological ...
International Nuclear Information System (INIS)
Lu Xiongbin; Lozano, Guillermina; Donehower, Lawrence A.
2003-01-01
DNA repair of double strand breaks, interstrand DNA cross-links, and other types of DNA damage utilizes the processes of homologous recombination and non-homologous end joining to repair the damage. Aberrant homologous recombination is likely to be responsible for a significant fraction of chromosomal deletions, duplications, and translocations that are observed in cancer cells. To facilitate measurement of homologous recombination frequencies in normal cells, mutant cells, and cancer cells, we have developed a high titer retroviral vector containing tandem repeats of mutant versions of a GFP-Zeocin resistance fusion gene and an intact neomycin resistance marker. Recombination between the tandem repeats regenerates a functional GFP-Zeo R marker that can be easily scored. This retroviral vector was used to assess homologous recombination frequencies in human cancer cells and rodent fibroblasts with differing dosages of wild type or mutant p53. Absence of wild type p53 stimulated spontaneous and ionizing radiation-induced homologous recombination, confirming previous studies. Moreover, p53 +/- mouse fibroblasts show elevated levels of homologous recombination compared to their p53 +/+ counterparts following retroviral vector infection, indicating that p53 is haploinsufficient for suppression of homologous recombination. Transfection of vector-containing p53 null Saos-2 cells with various human cancer-associated p53 mutants revealed that these altered p53 proteins retain some recombination suppression function despite being totally inactive for transcriptional transactivation. The retroviral vector utilized in these studies may be useful in performing recombination assays on a wide array of cell types, including those not readily transfected by normal vectors
Characterization of five partial deletions of the factor VIII gene
International Nuclear Information System (INIS)
Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.
1987-01-01
Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes
Directory of Open Access Journals (Sweden)
Tao Lu
2017-01-01
Full Text Available Tp53, a stress response gene, is involved in diverse cell death pathways and its activation is implicated in the pathogenesis of Parkinson's disease. However, whether the neuronal Tp53 protein plays a direct role in regulating dopaminergic (DA neuronal cell death or neuronal terminal damage in different neurotoxicant models is unknown. In our recent studies, in contrast to the global inhibition of Tp53 function by pharmacological inhibitors and in traditional Tp53 knock-out mice, we examined the effects of DA-specific Tp53 gene deletion after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and methamphetamine exposure. Our data suggests that the Tp53 gene might be involved in both neuronal apoptosis and neuronal terminal damage caused by different neurotoxicants. Additional results from other studies also suggest that as a master regulator of many pathways that regulate apoptosis and synaptic terminal damage, it is possible that Tp53 may function as a signaling hub to integrate different signaling pathways to mediate distinctive target pathways. Tp53 protein as a signaling hub might be able to evaluate the microenvironment of neurons, assess the forms and severities of injury incurred, and determine whether apoptotic cell death or neuronal terminal degeneration occurs. Identification of the precise mechanisms activated in distinct neuronal damage caused by different forms and severities of injuries might allow for development of specific Tp53 inhibitors or ways to modulate distinct downstream target pathways involved.
International Nuclear Information System (INIS)
Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.
2006-01-01
The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)
An N-terminal Region of Mot-2 Binds to p53 In Vitro
Directory of Open Access Journals (Sweden)
Sunil C. Kaul
2001-01-01
Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.
Influence of X-ray on the P53 gene in human peripheral blood lymphocytes
International Nuclear Information System (INIS)
Jin Wenwei; Cai Ting
2002-01-01
Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation
Molecular Dynamic Simulation Insights into the Normal State and Restoration of p53 Function
Directory of Open Access Journals (Sweden)
Jianzhong Chen
2012-08-01
Full Text Available As a tumor suppressor protein, p53 plays a crucial role in the cell cycle and in cancer prevention. Almost 50 percent of all human malignant tumors are closely related to a deletion or mutation in p53. The activity of p53 is inhibited by over-active celluar antagonists, especially by the over-expression of the negative regulators MDM2 and MDMX. Protein-protein interactions, or post-translational modifications of the C-terminal negative regulatory domain of p53, also regulate its tumor suppressor activity. Restoration of p53 function through peptide and small molecular inhibitors has become a promising strategy for novel anti-cancer drug design and development. Molecular dynamics simulations have been extensively applied to investigate the conformation changes of p53 induced by protein-protein interactions and protein-ligand interactions, including peptide and small molecular inhibitors. This review focuses on the latest MD simulation research, to provide an overview of the current understanding of interactions between p53 and its partners at an atomic level.
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
Energy Technology Data Exchange (ETDEWEB)
Bova, G.S.; Pin, S.S.; Isaacs, W.B. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)]|[Brady Urological Institute, Baltimore, MD (United States)] [and others
1996-07-01
Numerous studies have implicated the short arm of chromosome 8 as the site of one or more tumor suppressor genes inactivated in carcinogenesis of the prostate, colon, lung, and liver. Previously, we identified a homozygous deletion on chromosome 8p22 in a metastatic prostate cancer. To map this homozygous deletion physically, long-range restriction mapping was performed using yeast artificial chromosomes (YACs) spanning approximately 2 Mb of chromosome band 8p22. Subcloned genomic DNA and cDNA probes isolated by hybrid capture from these YACs were mapped in relation to one another, reinforcing map integrity. Mapped single-copy probes from the region were then applied to DNA isolated from a metastatic prostate cancer containing a chromosome 8p22 homozygous deletion and indicated that its deletion spans 730-970 kb. Candidate genes PRLTS (PDGF-receptor {beta}-like tumor suppressor) and CTSB (cathepsin B) are located outside the region of homozygous deletion. Genethon marker D8S549 is located approximately at the center of this region of homozygous deletion. Two new microsatellite polymorphisms, D8S1991 and D8S1992, also located within the region of homozygous deletion on chromosome 8p22, are described. Physical mapping places cosmid CI8-2644 telomeric to MSR (macrophage scavenger receptor), the reverse of a previously published map, altering the interpretation of published deletion studies. This work should prove helpful in the identification of candidate tumor suppressor genes in this region. 47 refs., 5 figs., 1 tab.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Refinement of the critical 2p25.3 deletion region
DEFF Research Database (Denmark)
De Rocker, Nina; Vergult, Sarah; Koolen, David
2015-01-01
PURPOSE: Submicroscopic deletions of chromosome band 2p25.3 are associated with intellectual disability and/or central obesity. Although MYT1L is believed to be a critical gene responsible for intellectual disability, so far no unequivocal data have confirmed this hypothesis. METHODS: In this study...
Directory of Open Access Journals (Sweden)
Karine Michaud
Full Text Available To study the presence of 9p deletion and p16, cyclin D1 and Myc expression and their respective diagnostic and prognostic interest in oligodendrogliomas.We analyzed a retrospective series of 40 consecutive anaplastic oligodendrogliomas (OIII from a single institution and compared them to a control series of 10 low grade oligodendrogliomas (OII. Automated FISH analysis of chromosome 9p status and immunohistochemistry for p16, cyclin D1 and Myc was performed for all cases and correlated with clinical and histological data, event free survival (EFS and overall survival (OS.Chromosome 9p deletion was observed in 55% of OIII (22/40 but not in OII. Deletion was highly correlated to EFS (median = 29 versus 53 months, p<0.0001 and OS (median = 48 versus 83 months, p<0.0001 in both the total cohort and the OIII population. In 9p non-deleted oligodendrogliomas, p16 hyperexpression correlated with a shorter OS (p = 0.02 in OII and p = 0.0001 in OIII whereas lack of p16 expression was correlated to a shorter EFS and OS in 9p deleted OIII (p = 0.001 and p = 0.0002 respectively. Expression of Cyclin D1 was significantly higher in OIII (median expression 45% versus 14% for OII, p = 0.0006 and was correlated with MIB-1 expression (p<0.0001, vascular proliferation (p = 0.002, tumor necrosis (p = 0.04 and a shorter EFS in the total cohort (p = 0.05. Hyperexpression of Myc was correlated to grade (median expression 27% in OII versus 35% in OIII, p = 0.03, and to a shorter EFS in 9p non-deleted OIII (p = 0.01.Chromosome 9p deletion identifies a subset of OIII with significantly worse prognosis. The combination of 9p status and p16 expression level identifies two distinct OIII populations with divergent prognosis. Hyperexpression of Bcl1 and Myc appears highly linked to anaplasia but the prognostic value is unclear and should be investigated further.
A case of 18p deletion syndrome after blepharoplasty
Directory of Open Access Journals (Sweden)
Xu LJ
2017-01-01
Full Text Available Li-juan Xu,1 Lv-xian Wu,2 Qing Yuan,3 Zhi-gang Lv,1 Xue-yan Jiang2 1Department of Opthalmology, 2Department of Pediatrics, 3Department of Clinical Laboratory, Jinhua Central Hospital, Jinhua, Zhejiang, People’s Republic of China Objective: The deletion of the short arm of chromosome 18 is thought to be one of the rare chromosomal aberrations. Here, we report a case to review this disease.Case report: The proband is a five-and-a-half-year-old girl who has had phenotypes manifested mainly by ptosis, broad face, broad neck with low posterior hairline, mental retardation, short stature, and other malformations. Chromosomal analysis for her mother showed a normal karyotype. Her father and younger brother were phenotypically normal.Result: Phenotypical features were quite similar throughout other cases and in accordance with the usual phenotype of del(18p suggested within the same cases and among the del(18p cases described. She underwent blepharoplasty, which improved her appearance.Conclusion: 18p deletion syndrome is diagnosed by gene analysis. Plastic surgeries for improving the appearance might be an option for these patients. Keywords: chromosome, deletion, blepharoplasty
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...
African Journals Online (AJOL)
The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...
Energy Technology Data Exchange (ETDEWEB)
McDonald, J.D.; Daneshvar, L.; Willert, J.R. [Univ. of California, San Franciso, CA (United States)] [and others
1994-09-01
Deletion mapping of a medulloblastoma tumor panel revealed loss of distal chromosome 17p13.3 sequences in tumors from 14 of 32 patients (44%). Of the 14 tumors showing loss of heterozygosity by restriction fragment length polymorphism analysis, 14 of 14 (100%) displayed loss of the telomeric marker p144-D6 (D17S34), while a probe for the ABR gene on 17p13.3 was lost in 7 of 8 (88%) informative cases. Using pulsed-field gel electrophoresis, we localized the polymorphic marker (VNTR-A) of the ABR gene locus to within 220 kb of the p144-D6 locus. A cosmid contig constructed in this region was used to demonstrate by fluorescence in situ hybridization that the ABR gene is oriented transcriptionally 5{prime} to 3{prime} toward the telomere. This report provides new physical mapping data for the ABR gene, which has not been previously shown to be deleted in medulloblastoma. These results provide further evidence for the existence of a second tumor suppressor gene distinct from p53 on distal chromosome 17p. 12 refs., 3 figs.
Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene
Directory of Open Access Journals (Sweden)
Nahed A Hussien
2014-01-01
Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.
Hormonal control of p53 and chemoprevention
International Nuclear Information System (INIS)
Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C
2002-01-01
Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer
Petit, P; Schmit, J; Van den Berghe, H; Fryns, J P
1996-07-01
We report here on phenotype-karyotype correlations in two patients with and without complete features of the WHS but sharing the lack of a specific cosmic probe (D4S96/D4Z1) from 4p16.3. These findings indicate that WHS is true a contiguous gene deletion syndrome in nature and expression.
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
Correlation between p53 expression and clinical-pathological characteristics of gastric cancer
Directory of Open Access Journals (Sweden)
Radovanović Dragče
2011-01-01
Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.
Directory of Open Access Journals (Sweden)
Luke A. Wiley
2011-07-01
We previously found that lenses lacking the Acvr1 gene, which encodes a bone morphogenetic protein (BMP receptor, had abnormal proliferation and cell death in epithelial and cortical fiber cells. We tested whether the tumor suppressor protein p53 (encoded by Trp53 affected this phenotype. Acvr1 conditional knockout (Acvr1CKO mouse fiber cells had increased numbers of nuclei that stained for p53 phosphorylated on serine 15, an indicator of p53 stabilization and activation. Deletion of Trp53 rescued the Acvr1CKO cell death phenotype in embryos and reduced Acvr1-dependent apoptosis in postnatal lenses. However, deletion of Trp53 alone increased the number of fiber cells that failed to withdraw from the cell cycle. Trp53CKO and Acvr1;Trp53DCKO (double conditional knockout, but not Acvr1CKO, lenses developed abnormal collections of cells at the posterior of the lens that resembled posterior subcapsular cataracts. Cells from human posterior subcapsular cataracts had morphological and molecular characteristics similar to the cells at the posterior of mouse lenses lacking Trp53. In Trp53CKO lenses, cells in the posterior plaques did not proliferate but, in Acvr1;Trp53DCKO lenses, many cells in the posterior plaques continued to proliferate, eventually forming vascularized tumor-like masses at the posterior of the lens. We conclude that p53 protects the lens against posterior subcapsular cataract formation by suppressing the proliferation of fiber cells and promoting the death of any fiber cells that enter the cell cycle. Acvr1 acts as a tumor suppressor in the lens. Enhancing p53 function in the lens could contribute to the prevention of steroid- and radiation-induced posterior subcapsular cataracts.
Stevens, Servi J C; Blom, Eveline W; Siegelaer, Ingrid T J; Smeets, Eric E J G L
2015-04-01
We identified an identical and recurrent 9.4-Mbp deletion at chromosome bands 2p11.2-2p12, which occurred de novo in two unrelated patients. It is flanked at the distal and proximal breakpoints by two homologous segmental duplications consisting of low copy repeat (LCR) blocks in direct orientation, which have >99% sequence identity. Despite the fact that the deletion was almost 10 Mbp in size, the patients showed a relatively mild clinical phenotype, that is, mild-to-moderate intellectual disability, a happy disposition, speech delay and delayed motor development. Their phenotype matches with that of previously described patients. The 2p11.2-2p12 deletion includes the REEP1 gene that is associated with spastic paraplegia and phenotypic features related to this are apparent in most 2p11.2-2p12 deletion patients, but not in all. Other hemizygous genes that may contribute to the clinical phenotype include LRRTM1 and CTNNA2. We propose a recurrent but rare 2p11.2-2p12 deletion syndrome based on (1) the identical, non-random localisation of the de novo deletion breakpoints in two unrelated patients and a patient from literature, (2) the patients' phenotypic similarity and their phenotypic overlap with other 2p deletions and (3) the presence of highly identical LCR blocks flanking both breakpoints, consistent with a non-allelic homologous recombination (NAHR)-mediated rearrangement.
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
Alterations of the TP53 Gene in Gastric and Esophageal Carcinogenesis
Directory of Open Access Journals (Sweden)
Marilanda Ferreira Bellini
2012-01-01
Full Text Available TP53 genes is one of more important tumor suppressor gene, which acts as a potent transcription factor with fundamental role in the maintenance of genetic stability. The development of esophageal and gastric cancers is a multistep process resulting in successive accumulation of genetic alterations that culminates in the malignant transformation. Thus, this study highlights the participation of the main genetic alterations of the TP53 gene in esophageal and gastric carcinogenesis. Among these changes, high frequency of TP53 mutations, loss of heterozygosity (LOH, overexpression of the p53 protein, and consequently loss of p53 function, which would be early events in esophageal and gastric cancers, as well as an important biomarker of the prognosis and treatment response. Furthermore, Single Nucleotide Polymorphisms (SNPs of TP53 have been implicated in the development and prognosis of several cancers, mainly TP53 codon 72 polymorphism whose role has been extensively studied in relation to susceptibility for esophageal and gastric cancer development.
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O
2011-08-01
The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.
Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients
Directory of Open Access Journals (Sweden)
Aziza Sbiti
2002-01-01
Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.
PAF53 is essential in mammalian cells: CRISPR/Cas9 fails to eliminate PAF53 expression.
Rothblum, Lawrence I; Rothblum, Katrina; Chang, Eugenie
2017-05-15
When mammalian cells are nutrient and/or growth factor deprived, exposed to inhibitors of protein synthesis, stressed by heat shock or grown to confluence, rDNA transcription is essentially shut off. Various mechanisms are available to accomplish this downshift in ribosome biogenesis. Muramatsu's laboratory (Hanada et al., 1996) first demonstrated that mammalian PAF53 was essential for specific rDNA transcription and that PAF53 levels were regulated in response to growth factors. While S. cerevisae A49, the homologue of vertebrate PAF53, is not essential for viability (Liljelund et al., 1992), deletion of yA49 results in colonies that grow at 6% of the wild type rate at 25°C. Experiments described by Wang et al. (2015) identified PAF53 as a gene "essential for optimal proliferation". However, they did not discriminate genes essential for viability. Hence, in order to resolve this question, we designed a series of experiments to determine if PAF53 was essential for cell survival. We set out to delete the gene product from mammalian cells using CRISPR/CAS9 technology. Human 293 cells were transfected with lentiCRISPR v2 carrying genes for various sgRNA that targeted PAF53. In some experiments, the cells were cotransfected in parallel with plasmids encoding FLAG-tagged mouse PAF53. After treating the transfected cells with puromycin (to select for the lentiCRISPR backbone), cells were cloned and analyzed by western blots for PAF53 expression. Genomic DNA was amplified across the "CRISPRd" exon, cloned and sequenced to identify mutated PAF53 genes. We obtained cell lines in which the endogenous PAF53 gene was "knocked out" only when we rescued with FLAG-PAF53. DNA sequencing demonstrated that in the absence of ectopic PAF53 expression, cells demonstrated unique means of surviving; including recombination or the utilization of alternative reading frames. We never observed a clone in which one PAF53 gene is expressed, unless there was also ectopic expression In the
P53 expression in prostatic cancer: an immunohistochemical study
International Nuclear Information System (INIS)
Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.
2011-01-01
Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
[Punish or cherish: p53, metabolism and tumor suppression].
Albagli, Olivier
2015-10-01
The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.
International Nuclear Information System (INIS)
Tierney, L.A.; Hahn, F.F.; Lechner, J.F.
1996-01-01
Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Comprehensive analysis of pathogenic deletion variants in Fanconi anemia genes.
Flynn, Elizabeth K; Kamat, Aparna; Lach, Francis P; Donovan, Frank X; Kimble, Danielle C; Narisu, Narisu; Sanborn, Erica; Boulad, Farid; Davies, Stella M; Gillio, Alfred P; Harris, Richard E; MacMillan, Margaret L; Wagner, John E; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A; Chandrasekharappa, Settara C
2014-11-01
Fanconi anemia (FA) is a rare recessive disease resulting from mutations in one of at least 16 different genes. Mutation types and phenotypic manifestations of FA are highly heterogeneous and influence the clinical management of the disease. We analyzed 202 FA families for large deletions, using high-resolution comparative genome hybridization arrays, single-nucleotide polymorphism arrays, and DNA sequencing. We found pathogenic deletions in 88 FANCA, seven FANCC, two FANCD2, and one FANCB families. We find 35% of FA families carry large deletions, accounting for 18% of all FA pathogenic variants. Cloning and sequencing across the deletion breakpoints revealed that 52 FANCA deletion ends, and one FANCC deletion end extended beyond the gene boundaries, potentially affecting neighboring genes with phenotypic consequences. Seventy-five percent of the FANCA deletions are Alu-Alu mediated, predominantly by AluY elements, and appear to be caused by nonallelic homologous recombination. Individual Alu hotspots were identified. Defining the haplotypes of four FANCA deletions shared by multiple families revealed that three share a common ancestry. Knowing the exact molecular changes that lead to the disease may be critical for a better understanding of the FA phenotype, and to gain insight into the mechanisms driving these pathogenic deletion variants. © 2014 WILEY PERIODICALS, INC.
Powari, Manish; Varma, Neelam; Varma, Subhash; Marwaha, Ram Kumar; Sandhu, Harpreet; Ganguly, Nirmal Kumar
2002-06-01
To characterize the phenotype of acute leukemia cases using flow cytometry, to detect mixed lineage cases and to use DNA index determination, including S-phase fraction (SPF) and p53 detection, to find if there was any correlation of SPF and p53 expression with outcome. Fifty-five cases of acute leukemia were enrolled in this study. A complete hemogram and routine bone marrow examination, including cytochemistry, was done. Mycloperoxidase-negative cases were evaluated on a flow cytometer using monoclonal antibodies. DNA indices were determined by flow cytometry in all cases, and p53 was detected immunohistochemically using the alkaline phosphatase/antialkaline phosphatase technique. Acute myeloblastic leukemia (AML) was diagnosed in 32 cases; acute lymphoblastic leukemia (ALL) was diagnosed in 18 (14 B lineage and 4 T line age). Four cases showed mixed lineage leukemia, and undifferentiated acute leukemia was diagnosed in one case. The mean/range of SPF for these groups were 3.76/0.33-6.91, 6.25/0.15-21.4, 2.89/0.35-10.64, 2.60/0.72-6.94 and 7.34, respectively. Aneuploidy was detected in two cases of B-lineage ALL and tetraploidy in a case of AML-M7, while all others were diploid p53. Was detected in 6 of 55 cases (10.90%). Follow-up was available for 24 patients. Five patients relapsed, and four had B-cell type ALL and were diploid and expressed no p53 gene. SPF% did not show any correlation with outcome. These data suggest that within acute leukemia subtypes, there is a wide variation in SPF. SPF does not seem to correlate with outcome. Immunophenotyping is essential to determine the lineage in myeloperoxidase-negative cases. It is perhaps the only way to diagnose mixed lineage leukemia and aberrant expression of markers presently. The p53 gene was detected less frequently. However, more studies are required from different centers with longer follow-up to evaluate prognostic significance.
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes
International Nuclear Information System (INIS)
Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.
2008-01-01
Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53
Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines
DEFF Research Database (Denmark)
Liu, Ying; Bodmer, Walter F
2006-01-01
A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...
Directory of Open Access Journals (Sweden)
Suzanne M Quartuccio
Full Text Available Epithelial ovarian cancer is the most lethal gynecological malignancy among US women. The etiology of this disease, although poorly understood, may involve the ovarian surface epithelium or the epithelium of the fallopian tube fimbriae as the progenitor cell. Disruptions in the transforming growth factor beta (TGFβ pathway and p53 are frequently found in chemotherapy-resistant serous ovarian tumors. Transgenic mice expressing a dominant negative form of Smad2 (Smad2DN, a downstream transcription factor of the TGFβ signaling pathway, targeted to tissues of the reproductive tract were created on a FVB background. These mice developed epithelium-lined inclusion cysts, a potential precursor lesion to ovarian cancer, which morphologically resembled oviductal epithelium but exhibited protein expression more closely resembling the ovarian surface epithelium. An additional genetic "hit" of p53 deletion was predicted to result in ovarian tumors. Tissue specific deletion of p53 in the ovaries and oviducts alone was attempted through intrabursal or intraoviductal injection of Cre-recombinase expressing adenovirus (AdCreGFP into p53 (flox/flox mice. Ovarian bursal cysts were detected in some mice 6 months after intrabursal injection. No pathological abnormalities were detected in mice with intraoviductal injections, which may be related to decreased infectivity of the oviductal epithelium with adenovirus as compared to the ovarian surface epithelium. Bitransgenic mice, expressing both the Smad2DN transgene and p53 (flox/flox, were then exposed to AdCreGFP in the bursa and oviductal lumen. These mice did not develop any additional phenotypes. Exposure to AdCreGFP is not an effective methodology for conditional deletion of floxed genes in oviductal epithelium and tissue specific promoters should be employed in future mouse models of the disease. In addition, a novel phenotype was observed in mice with high expression of the Smad2DN transgene as validated
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Contribution to the investigation of the p53 in vivo and in vitro trans-activation activity
International Nuclear Information System (INIS)
Meiller, A.
2004-03-01
Among the body's defence mechanisms, the programmed cellular death or apoptosis is an important safeguard way which allows the body to get rid of the injured cells before they acquire steady genetic modifications leading to an anarchistic multiplication. As p53 tumor suppressor gene plays a predominant role within this process, this research report first presents the p53 protein, its structure, its activities as a transcription factor, its modifications and the implications on its functional activities, its biological activities, and describes the p53 intracellular rate regulation and the use of this protein in radiology, particularly in 'in vivo' investigations on irradiated mice. It also presents the p53 family. Then, the author reports experimental investigations on possible other genes which could be trans-activated by p53. A gene is identified as a new target gene. She also demonstrates a new p53 activation path induced by another member of the p53 family, the p73 alpha protein
The rates and patterns of deletions in the human factor IX gene
Energy Technology Data Exchange (ETDEWEB)
Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))
1994-02-01
Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.
Directory of Open Access Journals (Sweden)
Paola De Feudis
2000-05-01
Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.
Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.
Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles
2006-10-16
The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.
Czech Academy of Sciences Publication Activity Database
Congur, G.; Plucnara, Medard; Erdem, A.; Fojta, Miroslav
2015-01-01
Roč. 27, č. 7 (2015), s. 1579-1586 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 Keywords : p53 Gene * Carbon nanotubes * Magnetic particles Subject RIV: BO - Biophysics Impact factor: 2.471, year: 2015
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-08-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.
Dong, Yuying; Wang, Jie; Dong, Fusheng; Wang, Xu; Zhang, Yinghuai
2012-07-01
To evaluate relationships between the alteration of p16 gene and the clinical status and prognosis of the patients with squamous cell carcinoma of the buccal mucosa. Thirty buccal cancers were included in the analysis. Deletion analysis was performed by PCR. Point mutation analysis was used by PCR-SSCP and direct sequencing. Methylation-specific PCR methods were adopted for the evaluation of p16 methylation. The correlation between alteration of p16 gene and clinicopathological factors buccal cancer was evaluated by Fisher's exact test. Kaplan-Meier and Cox regression were used to investigate the relationship between p16 alteration and survival time. The frequency of p16 alteration was 63.3% in buccal carcinomas. P16 deletion was associated significantly with tumor size (P = 0.01). P16 point mutation was associated significantly with differentiation (P = 0.006). P16 methylation was associated significantly with nodes metastasis (P = 0.027). The overall survival rate of 30 buccal carcinomas was 53.3%. The Log-rank test (P = 0.021) and univariate Cox regression analysis (P = 0.030) revealed that p16 methylation was significantly associated with the overall survival rate. Multivariate analysis showed that p16 deletion, p16 mutation, and p16 methylation were not statistically significant. The alterations of p16 gene may play a major role in malignancy and development and metastases of buccal carcinoma and may be an excellent marker of aggressive clinical behavior. P16 methylation has a prognostic value in buccal carcinoma but not an independent prognosis factor. P16 point mutation and p16 deletion have not prognostic significance in buccal carcinoma. © 2012 John Wiley & Sons A/S.
PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene
Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan
2009-01-01
Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…
Teye, Kwesi; Hamada, Takahiro; Krol, Rafal P; Numata, Sanae; Ishii, Norito; Matsuda, Mitsuhiro; Ohata, Chika; Furumura, Minao; Hashimoto, Takashi
2014-07-01
Peeling skin syndrome (PSS) is a rare autosomal recessive form of ichthyosis showing skin exfoliation. PSS is divided into acral and generalized PSS, and the latter is further classified into non-inflammatory type (PSS type A) and inflammatory type (PSS type B). PSS type B is now called peeling skin disease (PSD). Different loss-of-function mutations in the corneodesmosin (CDSN) gene have been reported to cause PSD. The aim of this study was to determine genetic basis of disease in a 14-year-old Japanese patient with PSD. Immunohistochemical study showed lack of corneodesmosin (CDSN) in the skin, and standard PCR for genomic DNA failed to amplify CDSN product, suggesting CDSN defect. Multiplex ligation-dependent probe amplification and genomic quantitative real-time PCR analyses detected large homozygous deletion of 59,184bp extending from 40.6kb upstream to 13.2kb downstream of CDSN, which included 6 genes (TCF19, CCHCR1, PSORS1C2, PSORS1C1, CDSN and C6orf15). The continuous gene lost did not result in additional clinical features. Inverted repeats with 85% similarity flanking the deletion breakpoint were considered to mediate the deletion by non-homologous end joining or fork stalling and template switching/microhomology-mediated break-induced replication. Parents were clinically unaffected and were heterozygote carriers of the same deletion, which was absent in 284 ethnically matched control alleles. We also developed simple PCR method, which is useful for detection of this deletion. Although 5 other genes were also deleted, homozygous deletion of CDSN was considered to be responsible for this PSD. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.
TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells
Directory of Open Access Journals (Sweden)
Nikolett Sándor
2015-10-01
Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Synergistic anti-tumor effects of nitroreductase mutants and p53
Directory of Open Access Journals (Sweden)
Mahboobeh Razmkhah
2014-01-01
Conclusion: Combination of T41L/F70A NTR with p53 may have more advantages for treatment of different types of cancers compared to the other NTRs and p53 alone. The present study results may open new windows for getting desired outcome in gene therapy of different types of cancer.
Rare deletions at 16p13.11 predispose to a diverse spectrum of sporadic epilepsy syndromes.
Heinzen, Erin L; Radtke, Rodney A; Urban, Thomas J; Cavalleri, Gianpiero L; Depondt, Chantal; Need, Anna C; Walley, Nicole M; Nicoletti, Paola; Ge, Dongliang; Catarino, Claudia B; Duncan, John S; Kasperaviciūte, Dalia; Tate, Sarah K; Caboclo, Luis O; Sander, Josemir W; Clayton, Lisa; Linney, Kristen N; Shianna, Kevin V; Gumbs, Curtis E; Smith, Jason; Cronin, Kenneth D; Maia, Jessica M; Doherty, Colin P; Pandolfo, Massimo; Leppert, David; Middleton, Lefkos T; Gibson, Rachel A; Johnson, Michael R; Matthews, Paul M; Hosford, David; Kälviäinen, Reetta; Eriksson, Kai; Kantanen, Anne-Mari; Dorn, Thomas; Hansen, Jörg; Krämer, Günter; Steinhoff, Bernhard J; Wieser, Heinz-Gregor; Zumsteg, Dominik; Ortega, Marcos; Wood, Nicholas W; Huxley-Jones, Julie; Mikati, Mohamad; Gallentine, William B; Husain, Aatif M; Buckley, Patrick G; Stallings, Ray L; Podgoreanu, Mihai V; Delanty, Norman; Sisodiya, Sanjay M; Goldstein, David B
2010-05-14
Deletions at 16p13.11 are associated with schizophrenia, mental retardation, and most recently idiopathic generalized epilepsy. To evaluate the role of 16p13.11 deletions, as well as other structural variation, in epilepsy disorders, we used genome-wide screens to identify copy number variation in 3812 patients with a diverse spectrum of epilepsy syndromes and in 1299 neurologically-normal controls. Large deletions (> 100 kb) at 16p13.11 were observed in 23 patients, whereas no control had a deletion greater than 16 kb. Patients, even those with identically sized 16p13.11 deletions, presented with highly variable epilepsy phenotypes. For a subset of patients with a 16p13.11 deletion, we show a consistent reduction of expression for included genes, suggesting that haploinsufficiency might contribute to pathogenicity. We also investigated another possible mechanism of pathogenicity by using hybridization-based capture and next-generation sequencing of the homologous chromosome for ten 16p13.11-deletion patients to look for unmasked recessive mutations. Follow-up genotyping of suggestive polymorphisms failed to identify any convincing recessive-acting mutations in the homologous interval corresponding to the deletion. The observation that two of the 16p13.11 deletions were larger than 2 Mb in size led us to screen for other large deletions. We found 12 additional genomic regions harboring deletions > 2 Mb in epilepsy patients, and none in controls. Additional evaluation is needed to characterize the role of these exceedingly large, non-locus-specific deletions in epilepsy. Collectively, these data implicate 16p13.11 and possibly other large deletions as risk factors for a wide range of epilepsy disorders, and they appear to point toward haploinsufficiency as a contributor to the pathogenicity of deletions. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Clinical and molecuar characterization of Brazilian patients with growth hormone gene deletions
Directory of Open Access Journals (Sweden)
I.J.P. Arnhold
1998-04-01
Full Text Available Genomic DNA from 23 patients with isolated growth hormone (GH deficiency (12 males and 11 females: heights -4.9 ± 1.4 SDS was screened for GH gene deletions by restriction endonuclease analysis of polymerase chain reaction amplification products. Three unrelated patients had typical features of severe GH deficiency and deletions (6.7 kb in two and 7.6 kb in one of the GH gene. The two patients with 6.7-kb deletions developed growth-attenuating anti-GH antibodies whereas the patient with the 7.6-kb deletion continued to grow with GH replacement therapy. Our finding that 3/23 (~13% Brazilian subjects had GH gene deletions agrees with previous studies of severe isolated GH deficiency subjects in other populations. Two of three subjects (67% with deletions developed blocking antibodies despite administration of exogenous GH at low doses. Interestingly, only 1/10 of cases with affected relatives or parental consanguinity had GH-1 gene deletions
p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.
Directory of Open Access Journals (Sweden)
Feng Yu
Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.
Directory of Open Access Journals (Sweden)
Danika Nadeen Senanayake
2015-03-01
Full Text Available We report three symptomatic children with profound biotinidase deficiency from Sri Lanka. All three children presented with typical clinical features of the disorder. The first is homozygous for a missense mutation in the BTD gene (c.98_104 del7insTCC; p.Cys33PhefsX36 that is commonly seen in the western countries, the second is homozygous for a novel missense mutation (p.Ala439Asp, and the third is the first reported instance of a contiguous gene deletion causing the enzyme deficiency. In addition, this latter finding exemplifies the importance of considering a deletion within the BTD gene for reconciling enzymatic activity with genotype, which can occur in asymptomatic children who are identified by newborn screening.
Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish
Directory of Open Access Journals (Sweden)
Seok-Hyung Kim
2013-07-01
Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.
Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma
International Nuclear Information System (INIS)
Frey, L. M.; Houben, R.; Brocker, E. B.
2011-01-01
Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.
Alves, Luis P S; Teixeira, Cícero S; Tirapelle, Evandro F; Donatti, Lucélia; Tadra-Sfeir, Michelle Z; Steffens, Maria B R; de Souza, Emanuel M; de Oliveira Pedrosa, Fabio; Chubatsu, Leda S; Müller-Santos, Marcelo
2016-01-01
Phasins are important proteins controlling poly-3-hydroxybutyrate (PHB) granules formation, their number into the cell and stability. The genome sequencing of the endophytic and diazotrophic bacterium Herbaspirillum seropedicae SmR1 revealed two homologous phasin genes. To verify the role of the phasins on PHB accumulation in the parental strain H. seropedicae SmR1, isogenic strains defective in the expression of phaP1, phaP2 or both genes were obtained by gene deletion and characterized in this work. Despite of the high sequence similarity between PhaP1 and PhaP2, PhaP1 is the major phasin in H. seropedicae, since its deletion reduced PHB accumulation by ≈50% in comparison to the parental and ΔphaP2. Upon deletion of phaP1, the expression of phaP2 was sixfold enhanced in the ΔphaP1 strain. The responsive backup expression of phaP2 partially rescued the ΔphaP1 mutant, maintaining about 50% of the parental PHB level. The double mutant ΔphaP1.2 did not accumulate PHB in any growth stage and showed a severe reduction of growth when glucose was the carbon source, a clear demonstration of negative impact in the fitness. The co-occurrence of phaP1 and phaP2 homologous in bacteria relatives of H. seropedicae, including other endophytes, indicates that the mechanism of phasin compensation by phaP2 expression may be operating in other organisms, showing that PHB metabolism is a key factor to adaptation and efficiency of endophytic bacteria.
CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.
He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu
2016-01-01
The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.
Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.
Suppiah, Aravind; Greenman, John
2013-08-07
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.
Cosson, Adrien; Chapiro, Elise; Belhouachi, Nabila; Cung, Hong-Anh; Keren, Boris; Damm, Frederik; Algrin, Caroline; Lefebvre, Christine; Fert-Ferrer, Sandra; Luquet, Isabelle; Gachard, Nathalie; Mugneret, Francine; Terre, Christine; Collonge-Rame, Marie-Agnes; Michaux, Lucienne; Rafdord-Weiss, Isabelle; Talmant, Pascaline; Veronese, Lauren; Nadal, Nathalie; Struski, Stephanie; Barin, Carole; Helias, Catherine; Lafage, Marina; Lippert, Eric; Auger, Nathalie; Eclache, Virginie; Roos-Weil, Damien; Leblond, Veronique; Settegrana, Catherine; Maloum, Karim; Davi, Frederic; Merle-Beral, Helene; Lesty, Claude; Nguyen-Khac, Florence
2014-08-01
Deletions of the long arm of chromosome 14 [del(14q)] are rare but recurrently observed in mature B-cell neoplasms, particularly in chronic lymphocytic leukemia (CLL). To further characterize this aberration, we studied 81 cases with del(14q): 54 of CLL and 27 of small lymphocytic lymphoma (SLL), the largest reported series to date. Using karyotype and fluorescence in situ hybridization (FISH), the most frequent additional abnormality was trisomy 12 (tri12), observed in 28/79 (35%) cases, followed by del13q14 (12/79, 15%), delTP53 (11/80, 14%) delATM (5/79, 6%), and del6q21 (3/76, 4%). IGHV genes were unmutated in 41/53 (77%) patients, with a high frequency of IGHV1-69 (21/52, 40%). NOTCH1 gene was mutated in 14/45 (31%) patients. There was no significant difference in cytogenetic and molecular abnormalities between CLL and SLL. Investigations using FISH and SNP-array demonstrated the heterogeneous size of the 14q deletions. However, a group with the same del(14)(q24.1q32.33) was identified in 48% of cases. In this group, tri12 (P = 0.004) and NOTCH1 mutations (P = 0.02) were significantly more frequent than in the other patients. In CLL patients with del(14q), median treatment-free survival (TFS) was 27 months. In conclusion, del(14q) is associated with tri12 and with pejorative prognostic factors: unmutated IGHV genes (with over-representation of the IGHV1-69 repertoire), NOTCH1 mutations, and a short TFS. © 2014 Wiley Periodicals, Inc.
Keitges, Elisabeth A; Pasion, Romela; Burnside, Rachel D; Mason, Carla; Gonzalez-Ruiz, Antonio; Dunn, Teresa; Masiello, Meredith; Gebbia, Joseph A; Fernandez, Carlos O; Risheg, Hiba
2013-07-01
Microdeletions of 8p23.1 are mediated by low copy repeats and can cause congenital diaphragmatic hernia (CDH) and cardiac defects. Within this region, point mutations of the GATA4 gene have been shown to cause cardiac defects. However, the cause of CDH in these deletions has been difficult to determine due to the paucity of mutations that result in CDH, the lack of smaller deletions to refine the region and the reduced penetrance of CDH in these large deletions. Mice deficient for one copy of the Gata4 gene have been described with CDH and heart defects suggesting mutations in Gata4 can cause the phenotype in mice. We report on the SNP microarray analysis on two fetuses with deletions of 8p23.1. The first had CDH and a ventricular septal defect (VSD) on ultrasonography and a family history of a maternal VSD. Microarray analysis detected a 127-kb deletion which included the GATA4 and NEIL2 genes which was inherited from the mother. The second fetus had an incomplete atrioventricular canal defect on ultrasonography. Microarray analysis showed a 315-kb deletion that included seven genes, GATA4, NEIL2, FDFT1, CTSB, DEFB136, DEFB135, and DEFB134. These results suggest that haploinsufficiency of the two genes in common within 8p23.1; GATA4 and NEIL2 can cause CDH and cardiac defects in humans. Copyright © 2013 Wiley Periodicals, Inc.
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Functional Significance of Mutant p53 in Breast Cancer
National Research Council Canada - National Science Library
O'Lear, Renee
2001-01-01
... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...
Directory of Open Access Journals (Sweden)
L.M. Massoni Neto
2007-08-01
Full Text Available Malignancy of pulmonary large cell carcinomas (LCC increases from classic LCC through LCC with neuroendocrine morphology (LCCNM to large cell neuroendocrine carcinomas (LCNEC. However, the histological classification has sometimes proved to be difficult. Because the malignancy of LCC is highly dependent on proteins with functions in the cell cycle, DNA repair, and apoptosis, p53 has been targeted as a potentially useful biological marker. p53 mutations in lung cancers have been shown to result in expression and protein expression also occurs in the absence of mutations. To validate the importance of both p53 protein expression (by immunostaining and p53 gene mutations in lung LCC (by PCR-single strand conformational polymorphism analysis of exons 5, 6, 7, and 8 and to study their relationships with clinical factors and sub-classification we investigated the correlation of p53 abnormalities in 15 patients with LCC (5 classic LCC, 5 LCNEC, and 5 LCCNM who had undergone resection with curative intent. Of these patients, 5/15 expressed p53 and none had mutant p53 sequences. There was a negative survival correlation with positive p53 immunostaining (P = 0.05. After adjustment for stage, age, gender, chemotherapy, radiotherapy, and histological subtypes by multivariate analysis, p53 expression had an independent impact on survival. The present study indicates that p53 assessment may provide an objective marker for the prognosis of LCC irrespective of morphological variants and suggests that p53 expression is important for outcome prediction in patients with the early stages of LCC. The results reported here should be considered to be initial results because tumors from only 15 patients were studied: 5 each from LCC, LCNEC and LCCNM. This was due to the rarity of these specific diseases.
cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer
International Nuclear Information System (INIS)
Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P
2009-01-01
Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
Seven gene deletions in seven days
DEFF Research Database (Denmark)
Ingemann Jensen, Sheila; Lennen, Rebecca; Herrgard, Markus
2015-01-01
Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering ...
Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E
2014-07-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.
Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T
1993-10-01
A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.
P63 gene mutations and human developmental syndromes.
Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van
2002-01-01
The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
Functional Significance of Mutant p53 in Breast Cancer
National Research Council Canada - National Science Library
O'Lear, Rene
2002-01-01
... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...
Directory of Open Access Journals (Sweden)
Luis Paulo Silveira Alves
2016-05-01
Full Text Available Phasins are important proteins controlling PHB granules formation, their number into the cell and stability. The genome sequencing of the endophytic and diazotrophic bacterium Herbaspirillum seropedicae SmR1 revealed two homologous phasin genes. To verify the role of the phasins on PHB accumulation in the parental strain H. seropedicae SmR1, isogenic strains defective in the expression of phaP1, phaP2 or both genes were obtained by gene deletion and characterized in this work. Despite of the high sequence similarity between PhaP1 and PhaP2, PhaP1 is the major phasin in H. seropedicae, since its deletion reduced PHB accumulation by ≈ 50 % in comparison to the parental and ΔphaP2. Upon deletion of phaP1, the expression of phaP2 was 6-fold enhanced in the ΔphaP1 strain. The responsive backup expression of phaP2 partially rescued the ΔphaP1 mutant, maintaining about 50% of the parental PHB level. The double mutant ΔphaP1.2 did not accumulate PHB in any growth stage and showed a severe reduction of growth when glucose was the carbon source, a clear demonstration of negative impact in the fitness. The co-occurrence of phaP1 and phaP2 homologous in bacteria relatives of H. seropedicae, including other endophytes, indicates that the mechanism of phasin compensation by phaP2 expression may be operating in other organisms, showing that PHB metabolism is a key factor to adaptation and efficiency of endophytic bacteria.
Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation
International Nuclear Information System (INIS)
Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli
2004-01-01
Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)
Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia
International Nuclear Information System (INIS)
Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina
2003-01-01
The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence
Molecular screening of pituitary adenomas for gene mutations and rearrangements
Energy Technology Data Exchange (ETDEWEB)
Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))
1993-07-01
Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.
Deletion of the MBII-85 snoRNA gene cluster in mice results in postnatal growth retardation.
Directory of Open Access Journals (Sweden)
Boris V Skryabin
2007-12-01
Full Text Available Prader-Willi syndrome (PWS [MIM 176270] is a neurogenetic disorder characterized by decreased fetal activity, muscular hypotonia, failure to thrive, short stature, obesity, mental retardation, and hypogonadotropic hypogonadism. It is caused by the loss of function of one or more imprinted, paternally expressed genes on the proximal long arm of chromosome 15. Several potential PWS mouse models involving the orthologous region on chromosome 7C exist. Based on the analysis of deletions in the mouse and gene expression in PWS patients with chromosomal translocations, a critical region (PWScr for neonatal lethality, failure to thrive, and growth retardation was narrowed to the locus containing a cluster of neuronally expressed MBII-85 small nucleolar RNA (snoRNA genes. Here, we report the deletion of PWScr. Mice carrying the maternally inherited allele (PWScr(m-/p+ are indistinguishable from wild-type littermates. All those with the paternally inherited allele (PWScr(m+/p- consistently display postnatal growth retardation, with about 15% postnatal lethality in C57BL/6, but not FVB/N crosses. This is the first example in a multicellular organism of genetic deletion of a C/D box snoRNA gene resulting in a pronounced phenotype.
9q22 Deletion - First Familial Case
Directory of Open Access Journals (Sweden)
Yamamoto Toshiyuki
2011-06-01
Full Text Available Abstract Background Only 29 cases of constitutional 9q22 deletions have been published and all have been sporadic. Most associate with Gorlin syndrome or nevoid basal cell carcinoma syndrome (NBCCS, MIM #109400 due to haploinsufficiency of the PTCH1 gene (MIM *601309. Methods and Results We report two mentally retarded female siblings and their cognitively normal father, all carrying a similar 5.3 Mb microdeletion at 9q22.2q22.32, detected by array CGH (244 K. The deletion does not involve the PTCH1 gene, but instead 30 other gene,s including the ROR2 gene (MIM *602337 which causing both brachydactyly type 1 (MIM #113000 and Robinow syndrome (MIM #268310, and the immunologically active SYK gene (MIM *600085. The deletion in the father was de novo and FISH analysis of blood lymphocytes did not suggest mosaicism. All three patients share similar mild dysmorphic features with downslanting palpebral fissures, narrow, high bridged nose with small nares, long, deeply grooved philtrum, ears with broad helix and uplifted lobuli, and small toenails. All have significant dysarthria and suffer from continuous middle ear and upper respiratory infections. The father also has a funnel chest and unilateral hypoplastic kidney but the daughters have no malformations. Conclusions This is the first report of a familial constitutional 9q22 deletion and the first deletion studied by array-CGH which does not involve the PTCH1 gene. The phenotype and penetrance are variable and the deletion found in the cognitively normal normal father poses a challenge in genetic counseling.
Distinct HIC1-SIRT1-p53 Loop Deregulation in Lung Squamous Carcinoma and Adenocarcinoma Patients
Directory of Open Access Journals (Sweden)
Ruo-Chia Tseng
2009-08-01
Full Text Available A HIC1-SIRT1-p53 circular loop in which hypermethylation in cancer 1 (HIC1 represses the transcription of SIRT1 that deacetylates and inactivates p53 thus leading to HIC1 inactivation has been identified in cell and animal models. However, the alteration and prognostic effects of HIC1-SIRT1-p53 circular loop have never been demonstrated in human cancer patients. We examine the HIC1-SIRT1-p53 alterations in 118 lung cancer patients to define their etiological roles in tumorigenesis. We found that patients with lung squamous cell carcinoma with low p53 acetylation and SIRT1 expression mostly showed low HIC1 expression, confirming deregulation of HIC1-SIRT1-p53 circular loop in the clinical model. Interestingly, the expression of deleted in breast cancer 1 (DBC1, which blocks the interaction between SIRT1 deacetylase and p53, led to acetylated p53 in patients with lung adenocarcinoma. However, epigenetic alteration of HIC1 promoter by posttranslational modifications of histones and promoter hypermethylation favoring the compacted chromatin production attenuated the transcriptional induction by acetylated p53. Importantly, lung cancer patients with altered HIC1-SIRT1-p53 circular regulation showed poor prognosis. Our data show the first valid clinical evidence of the deregulation of HIC1-SIRT1-p53 loop in lung tumorigenesis and prognosis. Distinct status of p53 acetylation/deacetylation and HIC1 alteration mechanism result from different SIRT1-DBC1 control and epigenetic alteration in lung squamous cell carcinoma and lung adenocarcinoma.
Angiotensin-converting enzyme insertion/deletion gene ...
Indian Academy of Sciences (India)
Angiotensin-converting enzyme insertion/deletion gene polymorphism in cystic fibrosis patients. Sabrine Oueslati Sondess Hadj Fredj Hajer Siala Amina Bibi Hajer Aloulou Lamia Boughamoura Khadija Boussetta Sihem Barsaoui Taieb Messaoud. Research Note Volume 95 Issue 1 March 2016 pp 193-196 ...
Angiotensin Converting Enzyme Insertion/Deletion Gene ...
African Journals Online (AJOL)
Angiotensin Converting Enzyme Insertion/Deletion Gene Polymorphism: An Observational Study among Diabetic Hypertensive Subjects in Malaysia. ... Methods: The pharmacological effect of ACE inhibition on mean arterial pressure (MAP) and glomerular filtration rate (GFR) were observed among a total of 62 subjects for ...
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
HOXA genes cluster: clinical implications of the smallest deletion
Pezzani, Lidia; Milani, Donatella; Manzoni, Francesca; Baccarin, Marco; Silipigni, Rosamaria; Guerneri, Silvana; Esposito, Susanna
2015-01-01
Background HOXA genes cluster plays a fundamental role in embryologic development. Deletion of the entire cluster is known to cause a clinically recognizable syndrome with mild developmental delay, characteristic facies, small feet with unusually short and big halluces, abnormal thumbs, and urogenital malformations. The clinical manifestations may vary with different ranges of deletions of HOXA cluster and flanking regions. Case presentation We report a girl with the smallest deletion reporte...
Post-irradiation pericardial malignant mesothelioma with deletion of p16: a case report.
Naeini, Yalda B; Arcega, Ramir; Hirschowitz, Sharon; Rao, Nagesh; Xu, Haodong
2018-02-01
Malignant mesotheliomas are rather uncommon neoplasms associated primarily with asbestos exposure; however, they may also arise as second primary malignancies after radiation therapy, with a latency period of 15-25 years. Numerous studies have reported an association between pleural malignant mesothelioma and chest radiation performed for other malignancies; on the other hand, post-irradiation mesotheliomas of the pericardium have been reported in only a few published cases to date, and no homozygous deletion of 9p21 has been described in such cases. We report the case of a 48-year-old man with a history of Hodgkin's lymphoma and no prior asbestos exposure who developed pericardial malignant epithelioid mesothelioma. We further discuss the cytologic, histologic, immunophenotypic, and fluorescence in situ hybridization findings in this case. To our knowledge, this is the first well-documented case of post-radiation pericardial malignant mesothelioma showing homozygous deletion of 9p21. Homozygous deletion of 9p21, the locus harboring the p16 gene, is present in post-irradiation pericardial malignant mesothelioma.
Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.
2008-01-01
Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Møller, Michael Boe; Gerdes, A M; Skjødt, K
1999-01-01
screening for p53 gene mutations as a prognostic marker in a population-based group of B- and T-cell non-Hodgkin's lymphomas (NHLs). On the basis of p53 gene mutation status and immunohistochemically detected p53 and p21Waf1 expression in 34 lymphomas, we established an immunophenotype (delta p53......) correlating with p53 gene mutation. The immunohistochemical analysis was extended to encompass 199 lymphomas from a population-based registry and was correlated with clinical parameters. Delta p53 showed 100% concordance with p53 gene mutation and was detected in 42 cases (21%). Multivariate analysis...... of advanced stage lymphomas showed that delta p53 was independently associated with treatment failure (relative risk, 3.8; P = 0.001). Delta p53 predicted poor survival when analyzing all patients (P = 0.0001), as well as B-cell (P = 0.04) and T-cell NHL (P = 0.000002). In multivariate analysis, delta p53...
Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.
2015-01-01
Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...
Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B
2000-09-01
Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.
p21(Waf1/Cip1) expression and the p53/MDM2 feedback loop in gastric carcinogenesis
Craanen, M. E.; Blok, P.; Offerhaus, G. J.; Meijer, G. A.; Dekker, W.; Kuipers, E. J.; Meuwissen, S. G.
1999-01-01
Data are non-existent regarding coincidental alterations in the expression of p53 and its downstream target genes MDM2 and p21(Waf1/Cip1) in gastric carcinogenesis. An immunohistochemical study was therefore performed to examine the interrelationships of p53, MDM2, and p21(Waf1/Cip1) expression in a
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
Directory of Open Access Journals (Sweden)
Liu Jun
2004-07-01
Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
International Nuclear Information System (INIS)
Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei
2004-01-01
BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
Deletion analysis of SMN1 and NAIP genes in southern Chinese children with spinal muscular atrophy
Institute of Scientific and Technical Information of China (English)
Yu-hua LIANG; Xiao-ling CHEN; Zhong-sheng YU; Chun-yue CHEN; Sheng BI; Lian-gen MAO; Bo-lin ZHOU; Xian-ning ZHANG
2009-01-01
Spinal muscular atrophy (SMA) is a disorder characterized by degeneration of lower motor neurons and occasionally bulbar motor neurons leading to progressive limb and trunk paralysis as well as muscular atrophy. Three types of SMA are rec-ognized depending on the age of onset, the maximum muscular activity achieved, and survivorship: SMA1, SMA2, and SMA3. The survival of motor neuron (SMN) gene has been identified as an SMA determining gene, whereas the neuronal apoptosis inhibitory protein (NAIP) gene is considered to be a modifying factor of the severity of SMA. The main objective of this study was to analyze the deletion of SMN1 and NAIP genes in southern Chinese children with SMA. Here, polymerase chain reaction (PCR) combined with restriction fragment length polymorphism (RFLP) was performed to detect the deletion of both exon 7 and exon 8 of SMNI and exon 5 of NAIP in 62 southern Chinese children with strongly suspected clinical symptoms of SMA. All the 32 SMAI patients and 76% (13/17) of SMA2 patients showed homozygous deletions for exon 7 and exon 8, and all the 13 SMA3 patients showed single deletion of SMN1 exon 7 along with 24% (4/17) of SMA2 patients. Eleven out of 32 (34%) SMA1 patients showed NAIP deletion, and none of SMA2 and SMA3 patients was found to have NAIP deletion. The findings of homozygous deletions of exon 7 and/or exon 8 of SMN1 gene confirmed the diagnosis of SMA, and suggested that the deletion of SMN1 exon 7 is a major cause of SMA in southern Chinese children, and that the NA1P gene may be a modifying factor for disease severity of SMA 1. The molecular diagnosis system based on PCR-RFLP analysis can conveniently be applied in the clinical testing, genetic counseling, prenatal diagnosis and preimplantation genetic diagnosis of SMA.
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Directory of Open Access Journals (Sweden)
Iva Simeonova
2013-06-01
Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.
Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E
1996-09-01
Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.
Camp, Shelley; Zhang, Limin; Marquez, Michael; de la Torre, Brian; Long, Jeffery M; Bucht, Goran; Taylor, Palmer
2005-12-15
AChE is an alternatively spliced gene. Exons 2, 3 and 4 are invariantly spliced, and this sequence is responsible for catalytic function. The 3' alternatively spliced exons, 5 and 6, are responsible for AChE disposition in tissue [J. Massoulie, The origin of the molecular diversity and functional anchoring of cholinesterases. Neurosignals 11 (3) (2002) 130-143; Y. Li, S. Camp, P. Taylor, Tissue-specific expression and alternative mRNA processing of the mammalian acetylcholinesterase gene. J. Biol. Chem. 268 (8) (1993) 5790-5797]. The splice to exon 5 produces the GPI anchored form of AChE found in the hematopoietic system, whereas the splice to exon 6 produces a sequence that binds to the structural subunits PRiMA and ColQ, producing AChE expression in brain and muscle. A third alternative RNA species is present that is not spliced at the 3' end; the intron 3' of exon 4 is used as coding sequence and produces the read-through, unanchored form of AChE. In order to further understand the role of alternative splicing in the expression of the AChE gene, we have used homologous recombination in stem cells to produce gene specific deletions in mice. Alternatively and together exon 5 and exon 6 were deleted. A cassette containing the neomycin gene flanked by loxP sites was used to replace the exon(s) of interest. Tissue analysis of mice with exon 5 deleted and the neomycin cassette retained showed very low levels of AChE expression, far less than would have been anticipated. Only the read-through species of the enzyme was produced; clearly the inclusion of the selection cassette disrupted splicing of exon 4 to exon 6. The selection cassette was then deleted in exon 5, exon 6 and exons 5 + 6 deleted mice by breeding to Ella-cre transgenic mice. AChE expression in serum, brain and muscle has been analyzed. Another AChE gene targeted mouse strain involving a region in the first intron, found to be critical for AChE expression in muscle cells [S. Camp, L. Zhang, M. Marquez, B
PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1994-01-01
From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.
Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A
2018-06-04
Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Wei Tang; Powell, Simon N.
1996-01-01
Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA
Yoshikawa, Yoshie; Sato, Ayuko; Tsujimura, Tohru; Morinaga, Tomonori; Fukuoka, Kazuya; Yamada, Shusai; Murakami, Aki; Kondo, Nobuyuki; Matsumoto, Seiji; Okumura, Yoshitomo; Tanaka, Fumihiro; Hasegawa, Seiki; Hashimoto-Tamaoki, Tomoko; Nakano, Takashi
2011-12-01
Array-based comparative genomic hybridization analysis was performed on 21 malignant mesothelioma (MM) samples (16 primary cell cultures and 5 cell lines) and two reactive mesothelial hyperplasia (RM) primary cell cultures. The RM samples did not have any genomic losses or gains. In MM samples, deletions in 1p, 3p21, 4q, 9p21, 16p13 and 22q were detected frequently. We focused on 3p21 because this deletion was specific to the epithelioid type. Especially, a deletion in 3p21.1 region carrying seven genes including SEMA3G was found in 52% of MM samples (11 of 14 epithelioid samples). The allele loss of 3p21.1 might be a good marker for the epithelioid MM. A homozygous deletion in this region was detected in two MM primary cell cultures. A heterozygous deletion detected in nine samples contained the 3p21.1 region and 3p21.31 one carrying the candidate tumor suppressor genes such as semaphorin 3F (SEMA3F), SEMA3B and Ras association (RalGDS/AF-6) domain family member 1 (RASSF1A). SEMA3B, 3F and 3G are class 3 semaphorins and inhibit growth by competing with vascular endothelial growth factor (VEGF) through binding to neuropilin. All MM samples downregulated the expression of more than one gene for SEMA3B, 3F and 3G when compared with Met5a, a normal pleura-derived cell line. Moreover, in 12 of 14 epithelioid MM samples the expression level of SEMA3A was lower than that in Met5a and the two RM samples. An augmented expression of VEGFA was detected in half of the MM samples. The expression ratio of VEGFA/SEMA3A was significantly higher in the epithelioid MMs than in Met5a, RMs and the non-epithelioid MMs. Our data suggest that the downregulated expression of SEMA3A and several SEMA3s results in a loss of inhibitory activities in tumor angiogenesis and tumor growth of VEGFA; therefore, it may play an important role on the pathogenesis of the epithelioid type of MM.
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.
Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A
2014-10-01
Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M
2004-11-01
Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.
Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.
Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J
2006-04-01
p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.
Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A
1990-11-30
Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.
Dumble, Melissa L; Croager, Emma J; Yeoh, George C T; Quail, Elizabeth A
2002-03-01
Oval cells are bipotential liver stem cells able to differentiate into hepatocytes and bile duct epithelia. In normal adult liver oval cells are quiescent, existing in low numbers around the periportal region, and proliferate following severe, prolonged liver trauma. There is evidence implicating oval cells in the development of hepatocellular carcinoma, and hence the availability of an immortalized oval cell line would be invaluable for the study of liver cell lineage differentiation and carcinogenesis. A novel approach in the generation of cell lines is the use of the p53 knockout mouse. Absence of p53 allows a cell to cycle past the normal Hayflick limit, rendering it immortalized, although subsequent genetic alterations are thought necessary for transformation. p53 knockout mice were fed a choline-deficient, ethionine-supplemented diet, previously shown to increase oval cell numbers in wild-type mice. The oval cells were isolated by centrifugal elutriation and maintained in culture. Colonies of hepatic cells were isolated and characterized with respect to phenotype, growth characteristics and tumorigenicity. Analysis of gene expression by Northern blotting and immunocytochemistry suggests they are oval-like cells by virtue of albumin and transferrin expression, as well as the oval cell markers alpha fetoprotein, M(2)-pyruvate kinase and A6. Injection into athymic nude mice shows the cell lines are capable of forming tumors which phenotypically resemble hepatocellular carcinoma. Thus, the use of p53 null hepatic cells successfully generated immortalized and tumorigenic hepatic stem cell lines. The results presented support the idea that deleting p53 allows immortalization and contributes to the transformation of the oval-like cell lines. Further, the tumorigenic status of the cell lines is direct evidence for the participation of oval cells in the formation of hepatocellular carcinoma.
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
Energy Technology Data Exchange (ETDEWEB)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.
Directory of Open Access Journals (Sweden)
C.R.O. Lima
2016-06-01
Full Text Available ABSTRACT The canine transmissible venereal tumor (TVT affects the external genitalia of dogs by the natural transplant of viable tumor cells. Thus, this research aimed to diagnose and characterize TVT morphological patterns, identify the insertion of the LINE-1 element in C-MYC gene, by means of the polymerase chain reaction (PCR, and evaluate the immunohistochemical expression of C-MYC, p53, p21 and p27 proteins. The relationship between C-MYC and p53 proteins and their interference on the expression of p21 and p27 were also studied. For that, 20 samples of naturally occurring TVT were used, subjected to cytopathological, histopathological and immunohistochemical analysis, and to molecular diagnosis of neoplasia. The increased tissue expression and the correlation among C-MYC, p53, p21 and p27 proteins indicate reduction and/or loss of their functionality in the TVT microenvironment, with consequent apoptotic suppression, maintenance of cell growth and progression of neoplasia.
Gsell, Martina; Mascher, Gerald; Schuiki, Irmgard; Ploier, Birgit; Hrastnik, Claudia; Daum, Günther
2013-01-01
In the yeast, Saccharomyces cerevisiae, the synthesis of the essential phospholipid phosphatidylethanolamine (PE) is accomplished by a network of reactions which comprises four different pathways. The enzyme contributing most to PE formation is the mitochondrial phosphatidylserine decarboxylase 1 (Psd1p) which catalyzes conversion of phosphatidylserine (PS) to PE. To study the genome wide effect of an unbalanced cellular and mitochondrial PE level and in particular the contribution of Psd1p to this depletion we performed a DNA microarray analysis with a ∆psd1 deletion mutant. This approach revealed that 54 yeast genes were significantly up-regulated in the absence of PSD1 compared to wild type. Surprisingly, marked down-regulation of genes was not observed. A number of different cellular processes in different subcellular compartments were affected in a ∆psd1 mutant. Deletion mutants bearing defects in all 54 candidate genes, respectively, were analyzed for their growth phenotype and their phospholipid profile. Only three mutants, namely ∆gpm2, ∆gph1 and ∆rsb1, were affected in one of these parameters. The possible link of these mutations to PE deficiency and PSD1 deletion is discussed.
Stress-specific response of the p53-Mdm2 feedback loop
Directory of Open Access Journals (Sweden)
Jensen Mogens H
2010-07-01
Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.
MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1
Directory of Open Access Journals (Sweden)
Olsson Hans
2013-01-01
Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in
Energy Technology Data Exchange (ETDEWEB)
Yi, Jung-Yeon; Han, Jeong-Hee; Yoon, Byung-Il [Kangwon National University, School of Veterinary Medicine, Chuncheon, Gangwon (Korea); Hirabayashi, Yoko; Kodama, Yukio; Kanno, Jun [National Institute of Health Sciences, Division of Cellular and Molecular Toxicology, Center for Biological Safety and Research, Tokyo (Japan); Choi, Yang-Kyu [Konkuk University, College of Veterinary Medicine, Seoul (Korea); Inoue, Tohru [National Institute of Health Sciences, Biological Safety and Research Center, Tokyo (Japan)
2009-08-15
Benzene is a well-known environmental pollutant that can induce hematotoxicity, aplastic anemia, acute myelogenous leukemia, and lymphoma. However, although benzene metabolites are known to induce oxidative stress and disrupt the cell cycle, the mechanism underlying lympho/leukemogenicity is not fully understood. Caspase-4 (alias caspase-11) and -12 are inflammatory caspases implicated in inflammation and endoplasmic reticulum stress-induced apoptosis. The objectives of this study were to investigate the altered expression of caspase-4 and -12 in mouse bone marrow after benzene exposure and to determine whether their alterations are associated with benzene-induced bone marrow toxicity, especially cellular apoptosis. In addition, we evaluated whether the p53 gene is involved in regulating the mechanism, using both wild-type (WT) mice and mice lacking the p53 gene. For this study, 8-week-old C57BL/6 mice [WT and p53 knockout (KO)] were administered a benzene solution (150 mg/kg diluted in corn oil) via oral gavage once daily, 5 days/week, for 1 or 2 weeks. Blood and bone marrow cells were collected and cell counts were measured using a Coulter counter. Total mRNA and protein extracts were prepared from the harvested bone marrow cells. Then qRT-PCR and Western blotting were performed to detect changes in the caspases at the mRNA and protein level, respectively. A DNA fragmentation assay and Annexin-V staining were carried out on the bone marrow cells to detect apoptosis. Results indicated that when compared to the control, leukocyte number and bone marrow cellularity decreased significantly in WT mice. The expression of caspase-4 and -12 mRNA increased significantly after 12 days of benzene treatment in the bone marrow cells of benzene-exposed p53KO mice. However, apoptosis detection assays indicated no evidence of apoptosis in p53KO or WT mice. In addition, no changes of other apoptosis-related caspases, such as caspase-3 and -9, were found in WT or p53KO mice at the
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
Loudin, Michael G.; Wang, Jinhua; Leung, Hon-Chiu Eastwood; Gurusiddappa, Sivashankarappa; Meyer, Julia; Condos, Gregory; Morrison, Debra; Tsimelzon, Anna; Devidas, Meenakshi; Heerema, Nyla A.; Carroll, Andrew J.; Plon, Sharon E.; Hunger, Stephen P.; Basso, Giuseppe; Pession, Andrea; Bhojwani, Deepa; Carroll, William L.; Rabin, Karen R.
2014-01-01
Patients with Down syndrome (DS) and acute lymphoblastic leukemia (ALL) have distinct clinical and biological features. Whereas most DS-ALL cases lack the sentinel cytogenetic lesions that guide risk assignment in childhood ALL, JAK2 mutations and CRLF2 overexpression are highly enriched. To further characterize the unique biology of DS-ALL, we performed genome-wide profiling of 58 DS-ALL and 68 non-Down syndrome (NDS) ALL cases by DNA copy number, loss of heterozygosity, gene expression, and methylation analyses. We report a novel deletion within the 6p22 histone gene cluster as significantly more frequent in DS-ALL, occurring in 11 DS (22%) and only two NDS cases (3.1%) (Fisher’s exact p = 0.002). Homozygous deletions yielded significantly lower histone expression levels, and were associated with higher methylation levels, distinct spatial localization of methylated promoters, and enrichment of highly methylated genes for specific pathways and transcription factor binding motifs. Gene expression profiling demonstrated heterogeneity of DS-ALL cases overall, with supervised analysis defining a 45-transcript signature associated with CRLF2 overexpression. Further characterization of pathways associated with histone deletions may identify opportunities for novel targeted interventions. PMID:21647151
VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes
Energy Technology Data Exchange (ETDEWEB)
Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao
2013-05-20
Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.
Duchenne muscular dystrophy in a female with compound heterozygous contiguous exon deletions.
Takeshita, Eri; Minami, Narihiro; Minami, Kumiko; Suzuki, Mikiya; Awashima, Takeya; Ishiyama, Akihiko; Komaki, Hirofumi; Nishino, Ichizo; Sasaki, Masayuki
2017-06-01
Females with Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) mutations rarely exhibit clinical symptoms from childhood, although potential mechanisms for symptoms associated with DMD and BMD in females have been reported. We report the case of a female DMD patient with a clinical course indistinguishable from that of a male DMD patient, and who possessed compound heterozygous contiguous exon deletions in the dystrophin gene. She exhibited Gowers' sign, calf muscle hypertrophy, and a high serum creatine kinase level at 2 years. Her muscle pathology showed most of the fibers were negative for dystrophin immunohistochemical staining. She lost ambulation at 11 years. Multiplex ligation-dependent probe amplification analysis of this gene detected one copy of exons 48-53; she was found to be a BMD carrier with an in-frame deletion. Messenger RNA from her muscle demonstrated out-of-frame deletions of exons 48-50 and 51-53 occurring on separate alleles. Genomic DNA from her lymphocytes demonstrated the accurate deletion region on each allele. To our knowledge, this is the first report on a female patient possessing compound heterozygous contiguous exon deletions in the dystrophin gene, leading to DMD. Copyright © 2017 Elsevier B.V. All rights reserved.
Familial deletion 18p syndrome: case report
Directory of Open Access Journals (Sweden)
Lemyre Emmanuelle
2006-07-01
Full Text Available Abstract Background Deletion 18p is a frequent deletion syndrome characterized by dysmorphic features, growth deficiencies, and mental retardation with a poorer verbal performance. Until now, five families have been described with limited clinical description. We report transmission of deletion 18p from a mother to her two daughters and review the previous cases. Case presentation The proband is 12 years old and has short stature, dysmorphic features and moderate mental retardation. Her sister is 9 years old and also has short stature and similar dysmorphic features. Her cognitive performance is within the borderline to mild mental retardation range. The mother also presents short stature. Psychological evaluation showed moderate mental retardation. Chromosome analysis from the sisters and their mother revealed the same chromosomal deletion: 46, XX, del(18(p11.2. Previous familial cases were consistent regarding the transmission of mental retardation. Our family differs in this regard with variable cognitive impairment and does not display poorer verbal than non-verbal abilities. An exclusive maternal transmission is observed throughout those families. Women with del(18p are fertile and seem to have a normal miscarriage rate. Conclusion Genetic counseling for these patients should take into account a greater range of cognitive outcome than previously reported.
P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.
He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M
2000-09-26
P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p
Directory of Open Access Journals (Sweden)
Praveen Kumar Bharti
Full Text Available Plasmodium falciparum encoded histidine rich protein (HRP2 based malaria rapid diagnostic tests (RDTs are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions.This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR.Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521 and 1.8% (27/1521 of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0-25% (2.4, 95% CI; 1.6-3.3. The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0-8% (1.6, 95% CI; 1.0-2.4.This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs.
Bragagnolo, Silvia; Colovati, Mileny E S; Guilherme, Roberta S; Dantas, Anelisa G; de Souza, Malú Zamariolli; de Soares, Maria F; Melaragno, Maria I; Perez, Ana B
2016-01-01
Wolf-Hirschhorn syndrome (WHS) is a contiguous gene and multiple malformation syndrome that results from a deletion in the 4p16.3 region. We describe here a 6-month-old girl that presented with WHS features but also displayed unusual findings, such as epibulbar dermoid in the left eye, ear tags, and left microtia. Although on G-banding her karyotype appeared to be normal, chromosomal microarray analysis revealed an ∼13-Mb 4p16.3p15.33 deletion and an ∼9-Mb Xp22.33p22.31 duplication, resulting from a balanced maternal t(X;4)(p22.31;p15.33) translocation. The patient presented with functional Xp disomy due to an unbalanced X-autosome translocation, a rare cytogenetic finding in females with unbalanced rearrangements. Sequencing of both chromosome breakpoints detected no gene disruption. To the best of our knowledge, this is the first patient described in the literature with WHS and epibulbar dermoid, a typical characteristic of the oculoauriculovertebral spectrum (OAVS). Our data suggest that possible candidate genes for OAVS may have been deleted along with the WHS critical region. © 2016 S. Karger AG, Basel.
Molecular and cellular pathways associated with chromosome 1p deletions during colon carcinogenesis
Directory of Open Access Journals (Sweden)
Payne CM
2011-05-01
Full Text Available Claire M Payne, Cheray Crowley-Skillicorn, Carol Bernstein, Hana Holubec, Harris BernsteinDepartment of Cell Biology and Anatomy, College of Medicine, University of Arizona Tucson, AZ, USAAbstract: Chromosomal instability is a major pathway of sporadic colon carcinogenesis. Chromosome arm 1p appears to be one of the “hot spots” in the non-neoplastic mucosa that, when deleted, is associated with the initiation of carcinogenesis. Chromosome arm 1p contains genes associated with DNA repair, spindle checkpoint function, apoptosis, multiple microRNAs, the Wnt signaling pathway, tumor suppression, antioxidant activities, and defense against environmental toxins. Loss of 1p is dangerous since it would likely contribute to genomic instability leading to tumorigenesis. The 1p deletion-associated colon carcinogenesis pathways are reviewed at the molecular and cellular levels. Sporadic colon cancer is strongly linked to a high-fat/low-vegetable/low-micronutrient, Western-style diet. We also consider how selected dietary-related compounds (eg, excess hydrophobic bile acids, and low levels of folic acid, niacin, plant-derived antioxidants, and other modulatory compounds might affect processes leading to chromosomal deletions, and to the molecular and cellular pathways specifically altered by chromosome 1p loss.Keywords: chromosome 1p, colon carcinogenesis, molecular pathways, cellular pathways
Are there ethnic differences in deletions in the dystrophin gene?
Energy Technology Data Exchange (ETDEWEB)
Banerjee, M.; Verma, I.C. [All India Inst. of Medical Sciences, New Delhi (India)
1997-01-20
We studied 160 cases of Duchenne muscular dystrophy (DMD) drawn from all parts of India, using multiplex PCR of 27 exons. Of these, 103 (64.4%) showed intragenic deletions. Most (69.7%) of the deletions involved exons 45-51. The phenotype of cases with deletion of single exons did not differ significantly from those with deletion of multiple exons. The distribution of deletions in studies from different countries was variable, but this was accounted for either by the small number of cases studied, or by fewer exons analyzed. It is concluded that there is likely to be no ethnic difference with respect to deletions in the DMD gene. 38 refs., 2 figs., 3 tabs.
TP53 dysfunction in CLL: Implications for prognosis and treatment
te Raa, Gera D.; Kater, Arnon P.
2016-01-01
Despite the availability of novel targeted agents, TP53 defects remain the most important adverse prognostic factor in chronic lymphocytic leukemia (CLL). Detection of deletion of TP53 locus (17p deletion) by fluorescent in situ hybridization (FISH) has become standard and performed prior to every
Generation of a selectively cytotoxic fusion protein against p53 mutated cancers
International Nuclear Information System (INIS)
Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A
2012-01-01
A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology
Generation of a selectively cytotoxic fusion protein against p53 mutated cancers
Directory of Open Access Journals (Sweden)
Kousparou Christina A
2012-08-01
Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.
THE EXON 5, 6, 7, 8 OF P53 MUTATIONS IN ORAL SQUAMOUS CELLS CARCINOMA
Directory of Open Access Journals (Sweden)
Retno P Rahayu
2012-04-01
Full Text Available Genetic instability may underlie the etiology of multistep carcinogenesis. The altered p53 gene observed in tumors may represent the expression of such instability and may allow the accumulation of other gene alterations caused by multiple mechanism. p53 gene is the guardian of the genome, that is why we pay more attention to this gene. In this study, we evaluated the significance of p53 mutation in 55 patient with oral squamous carcinoma. Thirty among them underwent well-differentiated carcinoma, while the remaining 25 patients underwent poorly differentiated carcinoma. The mutations were detected by PCR-SSCP (Single strand Conformational Polymorphism analysis in the region between exon 5 and exon 8. The results indicated that the p53 mutation in exon 5 (40%, exon 6 (28%, exon 7 (24% and exon 8 (8% were associated with poorly differentiated carcinoma, whereas mutation in exon 5 (10%, exon 6 (30%, exon 7 (40% and exon 8 (20% were associated with well-differentiated carcinoma. These observations suggest that p53 mutation in exon 5, 6, and 7 have strong correlation with poorly differentiated in oral squamous carcinoma while well-differentiated level was related with mutation in exon 6,7 and 8.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K
2017-01-01
The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Directory of Open Access Journals (Sweden)
Anup K Kundu
Full Text Available The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line.The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency.Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent.This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Directory of Open Access Journals (Sweden)
Rouba Hage-Sleiman
Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes
Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.
2009-01-01
Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229
Directory of Open Access Journals (Sweden)
Mohammad Esmaeil Afzalpour
2016-11-01
Full Text Available Physical activity and diet are the most important modifiable determinants of cancer risk. The objective of this study was to examine the effect of intense intermittent training with and without taking vitamin E on expression of p53 and PTEN tumor suppressing genes in the prostate gland of male rats. For this purpose, 50 Sprague-Dawley male rats were randomly assigned into 5 groups: [1] control (CON, n = 10, [2] sham (S, n = 10, [3] intense intermittent training (IIT, n = 10, [4] intense intermittent training + vitamin E (IIT + VE, n = 10, [5] vitamin E (VE, n = 10. Protocol of this study was implemented for 6 days per week for 6 weeks, with observing the overload principle on the motorized treadmill. After implementing training protocol, expression rate of p53 and PTEN genes reduced significantly (p<0.000, p<0.031, respectively. Taking vitamin E with intermittent training caused significant reduction in p53 expression (p<0.013, while it caused significant increase in expression of PTEN (p<0.035. These results showed that intense intermittent training reduces expression of p53 and PTEN tumor suppressing genes and taking supplementation vitamin E along with this type of training could cause different effects in expression of these tumor suppressor genes.
Directory of Open Access Journals (Sweden)
Ikuo Konishi
2006-01-01
Full Text Available BRCA1 is a tumor suppressor which plays a crucial role in the repair of DNA double-strand breaks, and its abnormality is responsible for hereditary ovarian cancer syndrome. It has recently been reported that reduced expression of BRCA1 is also common in sporadic ovarian carcinoma via its promoter hypermethylation, and that ovarian carcinoma patients negative for BRCA1 expression showed favorable prognosis. To address if BRCA1 expression plays a role in the chemotherapeutic response, we analyzed the effect of BRCA1 suppression on the sensitivity to cisplatin and paclitaxel in ovarian cancer cells. Specific siRNA for BRCA1 gene was transfected into 3 ovarian cancer cell lines with various p53 status. Reduced expression of BRCA1 by transfection of BRCA1-siRNA resulted in a 5.3-fold increase in sensitivity to cisplatin in p53-wild A2780 cells, but not in p53-mutated A2780/CDDP and p53-deleted SKOV3 cells. Regarding the sensitivity to paclitaxel, BRCA1 suppression caused no significant changes in all the 3 cell lines. For ionizing radiation sensitivity, BRCA1 suppression also showed a significant higher sensitivity in A2780 cells. Growth curve and cell cycle analyses showed no signifi cant differences between BRCA1-siRNA-transfected A2780 cells and control cells. However, cisplatin treatment under suppression of BRCA1 showed a significantly increased apoptosis along with up-regulation of p53 and p21 in A2780 cells. Accordingly, reduced expression of BRCA1 enhances the cisplatin sensitivity and apoptosis via up-regulation of p53 and p21, but does not affect the paclitaxel sensitivity. Expression of BRCA1 might be an important biomarker for cisplatin resistance in ovarian carcinoma.
Energy Technology Data Exchange (ETDEWEB)
Gong, Y.; Li, X.M.; Shapiro, L.J. [UCSF School of Medicine, San Francisco, CA (United States)] [and others
1994-09-01
Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand, and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.
Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas
Directory of Open Access Journals (Sweden)
Ming-Fu eChiang
2013-03-01
Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.
Directory of Open Access Journals (Sweden)
Fuqiang Xing
Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
Franco, E; Hodgson, S; Lench, N; Roberts, G J
1995-03-01
A case of Nance-Horan syndrome in a male is presented, with some features of the condition in his carrier mother and her mother. It is proposed that Nance-Horan syndrome might be a contiguous gene syndrome mapping to chromosome Xp21.2-p22.3. The proband had congenital cataract microphthalmia and dental abnormalities including screwdriver shaped incisors and evidence of enamel pitting hypoplasia. The region Xp21.2-p22.3 also contains the tooth enamel protein gene, amelogenin (AMGX). Using molecular genetic techniques, we have shown that there is no evidence that the AMGX gene is deleted in this case of the Nance-Horan syndrome.
Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein
2017-09-01
The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.
p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.
Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R
1999-05-01
The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
Directory of Open Access Journals (Sweden)
J.V. Moro
2010-04-01
Full Text Available The expression of p53 protein was evaluated in canine transmissible venereal tumor (CTVT, as following: natural occurrence (n=8; resistant to chemotherapy (n=4; and allogeneic transplanted in progression (n=8, stable (n=8, and regression (n=8stages. The collected specimens were submitted to GM1 immunohistochemical reaction. Results showed a mean percentage of immunomarked cells around 18.6% in CTVT of natural occurrence, 23.8% in CTVT resistant to chemotherapy, 22.9% in allogeneic transplanted CTVT in both progression and stable stages, and 35.8% in transplanted CTVT in regression stage. The results suggest that there is a functional abnormality in p53 gene and its products in the studied tumors; although, it is not possible to correlate the percentage of cells marked by p53 and a prognosis.A expressão da proteína p53 foi avaliada em espécimes de tumor venéreo transmissível canino (TVT de ocorrência natural (n=8; resistente à quimioterapia (n=4 e transplantado em cão nas fases de progressão tumoral (n=8, de latência (n=8 e de regressão (n=8. Os espécimes foram submetidos à reação de imunoistoquímica. Os resultados mostraram porcentagem média de células imunomarcadas de 18,6% no TVT de ocorrência natural, de 23,8% no TVT refratário, 22,9% nos TVTs transplantados nas fases de progressão e latência e de 35,8% na fase de regressão. Os resultados sugerem que há uma anormalidade funcional no gene P53 e seus produtos nos tumores estudados, apesar de não ser possível correlacionar a porcentagem de células marcadas pelo p53 ao prognóstico.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...
The p53-dependent radioadaptive response
Ohnishi, Takeo
We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.
Partial Gene Deletions of PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies
Directory of Open Access Journals (Sweden)
Sun-Mi Cho
2014-01-01
Full Text Available Hereditary neuropathy with liability to pressure palsies (HNPP is an autosomal neuropathy that is commonly caused by a reciprocal 1.5 Mb deletion on chromosome 17p11.2, at the site of the peripheral myelin protein 22 (PMP22 gene. Other patients with similar phenotypes have been shown to harbor point mutations or small deletions, although there is some clinical variation across these patients. In this report, we describe a case of HNPP with copy number changes in exon or promoter regions of PMP22. Multiplex ligation-dependent probe analysis revealed an exon 1b deletion in the patient, who had been diagnosed with HNPP in the first decade of life using molecular analysis.
Bailey, Nathanael G; South, Sarah T; Hummel, Marybeth; Wenger, Sharon L
2010-01-01
We report on a two-year-old female with a de novo proximal interstitial deletion of the short arm of chromosome 4 and a tetralogy of Fallot malformation. The patient had a karyotype of 46,XX,del(4)(p14p15.33) that was further characterized by array comparative genomic hybridization (aCGH). Phenotypic abnormalities for our patient are compared with those of previously reported patients with similar proximal 4p deletions as well as more distal deletions. The functions of genes that are deleted within this segment are reviewed.
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A
2016-07-27
Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia
2004-06-01
G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for
Prognostic significance of 1p36 locus deletion in adenoid cystic carcinoma of the salivary glands
DEFF Research Database (Denmark)
Šteiner, Petr; Andreasen, Simon; Grossmann, Petr
2018-01-01
Adenoid cystic carcinoma (AdCC) of the salivary glands is characterized by MYB-NFIB or MYBL1-NFIB fusion, prolonged but relentlessly progressive clinical course with frequent recurrences, and development of distant metastasis resulting in high long-term mortality. Currently, no effective therapy...... is available for patients with advanced non-resectable and/or metastatic disease. Complicating the clinical management of this patient group is the lack of prognostic markers. The purpose of this study is to investigate the prognostic value of 1p36 loss in patients with AdCC. The presence of 1p36 deletion...... and gene fusions involving the MYB, NFIB, and MYBL1 genes in a cohort of 93 salivary gland AdCCs was studied using fluorescence in situ hybridization. These results were statistically correlated with clinical data and outcome. Deletion of 1p36 in AdCC was identified in 13 of 85 analyzable cases (15...
Directory of Open Access Journals (Sweden)
Dadi Jiang
Full Text Available p53 is an important tumor suppressor gene which is mutated in ~50% of all human cancers. Some of these mutants appear to have acquired novel functions beyond merely losing wild-type functions. To investigate these gain-of-function effects in vivo, we generated mice of three different genotypes: MMTV-Hras/p53(+/+, MMTV-Hras/p53(-/-, and MMTV-Hras/p53R172H/R172H. Salivary tumors from these mice were characterized with regard to age of tumor onset, tumor growth rates, cell cycle distribution, apoptotic levels, tumor histopathology, as well as response to doxorubicin treatment. Microarray analysis was also performed to profile gene expression. The MMTV-Hras/p53(-/- and MMTV-Hras/p53R172H/R172H mice displayed similar properties with regard to age of tumor onset, tumor growth rates, tumor histopathology, and response to doxorubicin, while both groups were clearly distinct from the MMTV-Hras/p53(+/+ mice by these measurements. In addition, the gene expression profiles of the MMTV-Hras/p53(-/- and MMTV-Hras/p53(R172H/R172H tumors were tightly clustered, and clearly distinct from the profiles of the MMTV-Hras/p53(+/+ tumors. Only a small group of genes showing differential expression between the MMTV-Hras/p53(-/- and MMTV-Hras/p53(R172H/R172H tumors, that did not appear to be regulated by wild-type p53, were identified. Taken together, these results indicate that in this MMTV-Hras-driven salivary tumor model, the major effect of the p53 R172H mutant is due to the loss of wild-type p53 function, with little or no gain-of-function effect on tumorigenesis, which may be explained by the tissue- and tumor type-specific properties of this gain-of-function mutant of p53.
Distinct pattern of p53 mutations in bladder cancer
DEFF Research Database (Denmark)
Spruck, C H; Rideout, W M; Olumi, A F
1993-01-01
A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...
Gene therapy for carcinoma of the breast: Therapeutic genetic correction strategies
International Nuclear Information System (INIS)
Obermiller, Patrice S; Tait, David L; Holt, Jeffrey T
2000-01-01
Gene therapy is a therapeutic approach that is designed to correct specific molecular defects that contribute to the cause or progression of cancer. Genes that are mutated or deleted in cancers include the cancer susceptibility genes p53 and BRCA1. Because mutational inactivation of gene function is specific to tumor cells in these settings, cancer gene correction strategies may provide an opportunity for selective targeting without significant toxicity for normal nontumor cells. Both p53 and BRCA1 appear to inhibit cancer cells that lack mutations in these genes, suggesting that the so-called gene correction strategies may have broader potential than initially believed. Increasing knowledge of cancer genetics has identified these and other genes as potential targets for gene replacement therapy. Initial patient trials of p53 and BRCA1 gene therapy have provided some indications of potential efficacy, but have also identified areas of basic and clinical research that are needed before these approaches may be widely used in patient care
Sajeevan, Thara Purath; Saraswathi, Tillai Rajasekaran; Ranganathan, Kannan; Joshua, Elizabeth; Rao, Uma Devi K
2014-07-01
p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA) is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC) and periapical cyst (PA). A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%), whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1) OKC showed p53 expression in 6 cases (60%) whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2) The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.
Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten
2014-12-01
Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.
International Nuclear Information System (INIS)
Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.
2009-01-01
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.
Piccione, Maria; Salzano, Emanuela; Vecchio, Davide; Ferrara, Dante; Malacarne, Michela; Pierluigi, Mauro; Ferrara, Ines; Corsello, Giovanni
2015-07-01
Microscopically chromosome rearrangements of the short arm of chromosome 4 include the two known clinical entities: partial trisomy 4p and deletions of the Wolf-Hirschhorn critical regions 1 and 2 (WHSCR-1 and WHSCR-2, respectively), which cause cranio-facial anomalies, congenital malformations and developmental delay/intellectual disability. We report on clinical findings detected in a Chinese patient with a de novo 4p16.1-p15.32 duplication in association with a subtle 4p terminal deletion of 6 Mb in size. This unusual chromosome imbalance resulted in WHS classical phenotype, while clinical manifestations of 4p trisomy were practically absent. This observation suggests the hypothesis that haploinsufficiency of sensitive dosage genes with regulatory function placed in WHS critical region, is more pathogenic than concomitant 4p duplicated segment. Additionally clinical findings in our patient confirm a variable penetrance of major malformations and neurological features in Chinese children despite of WHS critical region's deletion. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Mihai TOMA
2009-11-01
Full Text Available Inactivation of tumor suppressor genes p53 and DCC has been frequently observed in colorectal cancer. The aim of this case-control study was to test possible association between polymorphisms g.32008376A>G (rs714 of DCC gene and g.7175464A>G (rs1625895 of p53 gene and colorectal cancer risk in Romanian patients. We investigate these two polymorphisms by PCR-RFLP in individuals with colorectal cancer (n=120, M:W=74:46 and healthy persons (n=60, M:W=32:28. We observed that GG genotype of both genes confer protection for CRC (ORDCC 0.34, 95%CI 0.18-0.66, ORp53 0.28, 95%CI 0.14-0.55. The presence of DCC AA (OR 2.97, 95%CI 0.97-9.08 and p53 GA (OR 3.86, 95%CI 1.89-7.87 genotypes are associated with an increased risk for CRC. The alleles A of both markers are associated with the risk for disease (OR 2.87, 95%CI 1.49-5.50, respectively 3.54, 95%CI 1.81-6.91. We also observed that coinheritance of DCC GG genotype and p53 GG (OR 0.36 or p53 GA (OR 0.23 confer protection for CRC. These apparent discordant results obtained for the p53 gene may be the result of interaction with other markers or a selection bias. Our findings indicate that the p53 and DCC polymorphisms are associated with a risk of CRC in Romanian patients.
Clinical and molecular consequences of exon 78 deletion in DMD gene.
Traverso, Monica; Assereto, Stefania; Baratto, Serena; Iacomino, Michele; Pedemonte, Marina; Diana, Maria Cristina; Ferretti, Marta; Broda, Paolo; Minetti, Carlo; Gazzerro, Elisabetta; Madia, Francesca; Bruno, Claudio; Zara, Federico; Fiorillo, Chiara
2018-03-19
We present a 13-year-old patient with persistent increase of serum Creatine Kinase (CK) and myalgia after exertion. Skeletal muscle biopsy showed marked reduction of dystrophin expression leading to genetic analysis of DMD gene by MLPA, which detected a single deletion of exon 78. To the best of our knowledge, DMD exon 78 deletion has never been described in literature and, according to prediction, it should lead to loss of reading frame in the dystrophin gene. To further assess the actual effect of exon 78 deletion, we analysed cDNA from muscle mRNA. This analysis confirmed the absence of 32 bp of exon 78. Exclusion of exon 78 changes the open reading frame of exon 79 and generate a downstream stop codon, producing a dystrophin protein of 3703 amino acids instead of 3685 amino acids. Albeit loss of reading frame usually leads to protein degradation and severe phenotype, in this case, we demonstrated that deletion of DMD exon 78 can be associated with a functional protein able to bind DGC complex and a very mild phenotype. This study adds a novel deletion in DMD gene in human and helps to define the compliance between maintaining/disrupting the reading frame and clinical form of the disease.
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
Energy Technology Data Exchange (ETDEWEB)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish, E-mail: ashish.lal@nih.gov [Genetics Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States)
2013-12-04
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways.
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
International Nuclear Information System (INIS)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish
2013-01-01
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways
3p interstitial deletion including PRICKLE2 in identical twins with autistic features.
Okumura, Akihisa; Yamamoto, Toshiyuki; Miyajima, Masakazu; Shimojima, Keiko; Kondo, Satoshi; Abe, Shinpei; Ikeno, Mitsuru; Shimizu, Toshiaki
2014-11-01
Microdeletion and microduplication syndromes without characteristic dysmorphic features are difficult to diagnose without chromosomal microarrays. We describe the clinical course and genetic findings of monozygotic twins with intellectual disabilities and autistic features associated with mild facial dysmorphism and microdeletion of chromosome 3p14. The postnatal course of the second twin was complicated by intestinal malrotation, whereas that of the first twin was unremarkable. Both twins had several mild dysmorphic features including upswept frontal hair, low-set posterior rotated ears, arched down-slanting eyebrows, prominent forehead, epicanthic folds, micrognathia, hypertelorism, broad nasal bridge, short philtrum, and camptodactyly of the bilateral fifth fingers. They had autistic features such as poor eye contact and no social smile, stereotyped behaviors, and preference for solitary play. Array comparative genomic hybridization analysis revealed de novo 6.88-Mb deletions of 3p14 (chr3: 60,472,496-67,385,119) involving 17 genes in both twins. The deleted region contained 17 genes, five of which are known or presumed to be related to central nervous system disorders: FEZF2, SYNPR, ATXN7, PRICKLE2, and MAGI1. We consider that PRICKLE2 is the most likely causative gene for the autistic features exhibited by these individuals. Copyright © 2014 Elsevier Inc. All rights reserved.
Sun, Huihui; Wan, Naijun; Wang, Xinli; Chang, Liang; Cheng, Dazhi
2018-01-01
18p deletion syndrome is a rare chromosomal disease caused by deletion of the short arm of chromosome 18. By using cytogenetic and SNP array analysis, we identified a girl with 18p deletion syndrome exhibiting craniofacial anomalies, intellectual disability, and short stature. G-banding analysis of metaphase cells revealed an abnormal karyotype 46,XX,del(18)(p10). Further, SNP array detected a 15.3-Mb deletion at 18p11.21p11.32 (chr18:12842-15375878) including 61 OMIM genes. Genotype-phenotype correlation analysis showed that clinical manifestations of the patient were correlated with LAMA1, TWSG1, and GNAL deletions. Her neuropsychological assessment test demonstrated delay in most cognitive functions including impaired mathematics, linguistic skills, visual motor perception, respond speed, and executive function. Meanwhile, her integrated visual and auditory continuous performance test (IVA-CPT) indicated a severe comprehensive attention deficit. At age 7 and 1/12 years, her height was 110.8 cm (-2.5 SD height for age). Growth hormone (GH) treatment was initiated. After 27 months treatment, her height was increased to 129.6 cm (-1.0 SD height for age) at 9 and 4/12 years, indicating an effective response to GH treatment. © 2018 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
O. B. Abdurakhmanov
2015-01-01
Full Text Available Objective. To investigate the prognostic value of the apoptotic markers (p53 and vascular endothelial growth factor (VEGF in evaluating the clinical course of juvenile nasopharyngeal angiofibroma (JNA.Subjects and methods. The investigation enrolled 43 patients with primary JNA (a study group and 20 with its relapses (a control group. The expression of VEGF and mutant p53 (mtp53 gene was immunohistochemically determined using DAKO kits (Denmark. The results of reactions with antibodies to VEGF-A and mtp53 located in the nuclei and membranes were expressed as percentages in terms of stained cell counts per 100 cells examined in different visual fields.Results. An associative analysis showed that both study and control group patients with high mtp53 gene expression in the tumor cells had clinical stages IIIA–B and IV and those in whom the expression of this gene in the tumor cells was weak or absent were found to have clinical stages I and II. The high (3+ and moderate (2+ mtp53 gene expressions suggest that the disease is severe. Consequently, this is of prognostic value and a poor predictor and the absence of mutations or the decreased expression of this gene is associated with a favorable disease outcome.Our investigations indicated that the high expression of the VEGF gene was detected in none of the tumor specimens. In the study group, the tumor cell expression of this gene was found to be moderate (2+ in 18 (41.9 % patients, weak in 6 (13.9 % and absent in 19 (44.2 % of the 43 patients. In the control group, the absence of VEGF gene expression in the tumor specimens was 9 times lower than that in the study group.A comparison with the clinical characteristics of the patients demonstrated that in both the study and control groups, the VEGF expression was observed to be moderate, or weak and absent in those with clinical stages IIIA–B and IV or in those with stage II and I, respectively.Conclusion. The associative analysis showed that both
Clonal expansion to anaplasia in Wilms` tumors is associated with p53 mutations
Energy Technology Data Exchange (ETDEWEB)
Pelletier, J.; Beckwith, B.; Bardeesy, N. [Loma Linda Univ., CA (United States)]|[McGill Univ., Montreal (Canada)
1994-09-01
The genetics of Wilms` tumor (WT), a pediatric malignancy of the kidney, is complex. Three loci are implicated in WT initiation and include the WT1 tumor suppressor gene (residing at 11p13), an 11p15 locus, and a non-11p locus. As well, allelic loss at 16q24 in {approximately}20% of sporadic WTs suggests the location of (an) additional gene(s) involved in tumor progression. Initiation and progression in WTs is associated with multiple histological variants. Anaplasia is a rare WT subtype associated with poor prognosis and defined by enlarged and multipolar mitotic figures, a threefold nuclear enlargement (compared with adjacent nuclei of the same cell type), and hyperchromasia of the enlarged nuclei. We have previously demonstrated that p53 gene mutations are exclusively associated with anaplastic WTs, being absent from a large number of non-anaplastic WTs analyzed. To determine if such mutations are involved in clonal progression to anaplasia, we performed a retrospective analysis of histologically defined sections from tumor specimens. Six of ten WTs demonstrated p53 mutations by PCR-single stranded conformational polymorphism analysis. Two of these samples were paired, consisting of geographically demarcated anaplastic cells embedded within a non-anaplastic tumor bed. In these cases, p53 mutations were only present in the anaplastic region of the tumor. An overall decrease in the number of apoptotic cells was found associated with the anaplastic tumor region, compared to adjacent non-anaplastic tumor bed. These results indicate that p53 mutations arise during progression to anaplasia late in Wilms` tumor etiology and are associated with a more aggressive form of this cancer.
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.
1998-01-01
Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result
Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination
Directory of Open Access Journals (Sweden)
Zhou Y
2018-04-01
Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had
Directory of Open Access Journals (Sweden)
Artur Brandt
Full Text Available We describe a stromal predominant Wilms tumor with focal anaplasia and a complex, tumor specific chromosome 11 aberration: a homozygous deletion of the entire WT1 gene within a heterozygous 11p13 deletion and an additional region of uniparental disomy (UPD limited to 11p15.5-p15.2 including the IGF2 gene. The tumor carried a heterozygous p.T41A mutation in CTNNB1. Cells established from the tumor carried the same chromosome 11 aberration, but a different, homozygous p.S45Δ CTNNB1 mutation. Uniparental disomy (UPD 3p21.3pter lead to the homozygous CTNNB1 mutation. The tumor cell line was immortalized using the catalytic subunit of human telomerase (hTERT in conjunction with a novel thermolabile mutant (U19dl89-97tsA58 of SV40 large T antigen (LT. This cell line is cytogenetically stable and can be grown indefinitely representing a valuable tool to study the effect of a complete lack of WT1 in tumor cells. The origin/fate of Wilms tumors with WT1 mutations is currently poorly defined. Here we studied the expression of several genes expressed in early kidney development, e.g. FOXD1, PAX3, SIX1, OSR1, OSR2 and MEIS1 and show that these are expressed at similar levels in the parental and the immortalized Wilms10 cells. In addition the limited potential for muscle/ osteogenic/ adipogenic differentiation similar to all other WT1 mutant cell lines is also observed in the Wilms10 tumor cell line and this is retained in the immortalized cells. In summary these Wilms10 cells are a valuable model system for functional studies of WT1 mutant cells.
Brandt, Artur; Löhers, Katharina; Beier, Manfred; Leube, Barbara; de Torres, Carmen; Mora, Jaume; Arora, Parineeta; Jat, Parmjit S.; Royer-Pokora, Brigitte
2016-01-01
We describe a stromal predominant Wilms tumor with focal anaplasia and a complex, tumor specific chromosome 11 aberration: a homozygous deletion of the entire WT1 gene within a heterozygous 11p13 deletion and an additional region of uniparental disomy (UPD) limited to 11p15.5-p15.2 including the IGF2 gene. The tumor carried a heterozygous p.T41A mutation in CTNNB1. Cells established from the tumor carried the same chromosome 11 aberration, but a different, homozygous p.S45Δ CTNNB1 mutation. Uniparental disomy (UPD) 3p21.3pter lead to the homozygous CTNNB1 mutation. The tumor cell line was immortalized using the catalytic subunit of human telomerase (hTERT) in conjunction with a novel thermolabile mutant (U19dl89-97tsA58) of SV40 large T antigen (LT). This cell line is cytogenetically stable and can be grown indefinitely representing a valuable tool to study the effect of a complete lack of WT1 in tumor cells. The origin/fate of Wilms tumors with WT1 mutations is currently poorly defined. Here we studied the expression of several genes expressed in early kidney development, e.g. FOXD1, PAX3, SIX1, OSR1, OSR2 and MEIS1 and show that these are expressed at similar levels in the parental and the immortalized Wilms10 cells. In addition the limited potential for muscle/ osteogenic/ adipogenic differentiation similar to all other WT1 mutant cell lines is also observed in the Wilms10 tumor cell line and this is retained in the immortalized cells. In summary these Wilms10 cells are a valuable model system for functional studies of WT1 mutant cells. PMID:27213811
Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism in Migraine Patients
Directory of Open Access Journals (Sweden)
Belgin Alaşehirli
2009-12-01
Full Text Available OBJECTIVE: The beneficial effects of angiotensin converting enzyme inhibitor drugs on migraine attack frequency have been shown. We aimed to study the relationship between the angiotensin converting enzyme gene and migraine pathophysiology. METHODS: In the present study, to assess whether the angiotensin converting enzyme insertion/deletion (I/D gene polymorphisms have an effect on migraine attacks, we studied the angiotensin converting enzyme genotypes of 102 migraine patients (35 cases of migraine with aura and 67 of migraine without aura and 75 age-and sex-matched normal volunteers. Frequency and age of onset of migraine attacks were also assessed according to angiotensin converting enzyme genotypes. RESULTS: Patients with migraine with and without aura were comparable with each other and the control group with respect to angiotensin converting enzyme genotypes (respectively; p= 0.88 and p= 0.76, p= 0.624. We could not determine a relationship between angiotensin converting enzyme genotypes and attack frequency (p= 0.125, but cases with angiotensin converting enzyme-II genotype showed a significantly younger age for onset of migraine attacks in comparison with the I/D genotype patients (p= 0.021. CONCLUSION: We believe that further angiotensin converting enzyme gene studies are warranted in younger age groups of patients with migraine and also in different populations
The p53 codon 72 polymorphism and association to prostate cancer ...
African Journals Online (AJOL)
Jane
2011-10-05
Oct 5, 2011 ... the bones and lymph nodes. This is called metastatic prostate cancer. Many studies indicate that environ- mental and genetic factors such as p53 gene play a ... genotoxic stimulus, triggering the expression of several genes that affect DNA .... cervical cancer, breast cancer, colorectal and prostate cancer.
Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene
Directory of Open Access Journals (Sweden)
Colovati Mileny ES
2012-01-01
Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.
Autographa californica multiple nucleopolyhedrovirus ac53 plays a role in nucleocapsid assembly
International Nuclear Information System (INIS)
Liu Chao; Li Zhaofei; Wu Wenbi; Li Lingling; Yuan Meijin; Pan Lijing; Yang Kai; Pang Yi
2008-01-01
Autographa californica multiple nucleopolyhedrovirus (AcMNPV) orf53 (ac53) is a highly conserved gene existing in all sequenced Lepidoptera and Hymenoptera baculoviruses, but its function remains unknown. To investigate its role in the baculovirus life cycle, an ac53 deletion virus (vAc ac53KO-PH-GFP ) was generated through homologous recombination in Escherichia coli. Fluorescence and light microscopy and titration analysis revealed that vAc ac53KO-PH-GFP could not produce infectious budded virus in infected Sf9 cells. Real-time PCR demonstrated that the ac53 deletion did not affect the levels of viral DNA replication. Electron microscopy showed that many lucent tubular shells devoid of the nucleoprotein core are present in the virogenic stroma and ring zone, indicating that the ac53 knockout affected nucleocapsid assembly. With a recombinant virus expressing an Ac53-GFP fusion protein, we observed that Ac53 was distributed within the cytoplasm and nucleus at 24 h post-infection, but afterwards accumulated predominantly near the nucleus-cytoplasm boundary. These data demonstrate that ac53 is involved in nucleocapsid assembly and is an essential gene for virus production
Directory of Open Access Journals (Sweden)
Thara Purath Sajeevan
2014-01-01
Full Text Available Introduction: p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. Aim: The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC and periapical cyst (PA. Materials and Methods: A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. Results: The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%, whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1 OKC showed p53 expression in 6 cases (60% whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2 The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. Conclusion: OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.
p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*
Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping
2011-01-01
The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasmic reticulum (ER) protein that is shuttled to the ER via an N-terminal endoplasmic reticulum targeting signal. One important function of the ER is synthesis of neutral lipids that are packaged into lipid droplets whose biogenesis occurs from ER-derived membranes. DHRS3 is enriched at focal points of lipid droplet budding where it also localizes to the phospholipid monolayer of ER-derived lipid droplets. p53 promotes lipid droplet accumulation in a manner consistent with DHRS3 enrichment in the ER. As a p53 target gene, the observations of Dhrs3 location and potential function provide novel insight into an unexpected role for p53 in lipid droplet dynamics with implications in cancer cell metabolism and obesity. PMID:21659514
Ishida-Yamamoto, Akemi; Furio, Laetitia; Igawa, Satomi; Honma, Masaru; Tron, Elodie; Malan, Valerie; Murakami, Masamoto; Hovnanian, Alain
2014-01-01
Peeling skin syndrome (PSS) type B is a rare recessive genodermatosis characterized by lifelong widespread, reddish peeling of the skin with pruritus. The disease is caused by small-scale mutations in the Corneodesmosin gene (CDSN) leading to premature termination codons. We report for the first time a Japanese case resulting from complete deletion of CDSN. Corneodesmosin was undetectable in the epidermis, and CDSN was unamplifiable by PCR. QMPSF analysis demonstrated deletion of CDSN exons inherited from each parent. Deletion mapping using microsatellite haplotyping, CGH array and PCR analysis established that the genomic deletion spanned 49-72 kb between HCG22 and TCF19, removing CDSN as well as five other genes within the psoriasis susceptibility region 1 (PSORS1) on 6p21.33. This observation widens the spectrum of molecular defects underlying PSS type B and shows that loss of these five genes from the PSORS1 region does not result in an additional cutaneous phenotype. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Dana Austin
Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.
Directory of Open Access Journals (Sweden)
Momoko Ishimine
2018-01-01
Full Text Available Irinotecan (CPT-11 is an anticancer prodrug that is activated by the carboxylesterase CES2 and has been approved for the treatment of many types of solid tumors, including colorectal cancer. Recent studies with cell lines show that CES2 expression is regulated by the tumor suppressor protein p53. However, clinical evidence for this regulatory mechanism in cancer is lacking. In this study, we examined the relationship between TP53 gene status and CES2 expression in human colorectal cancer. Most colorectal cancer specimens (70%; 26 of 37 showed lower CES2 mRNA levels (≥1.5-fold lower than the adjacent normal tissue, and only 30% (12 of 37 showed similar (<1.5-fold lower or higher CES2 mRNA levels. However, TP53 gene sequencing revealed no relationship between CES2 downregulation and TP53 mutational status. Moreover, while colorectal cancer cells expressing wild-type p53 exhibited p53-dependent upregulation of CES2, PRIMA-1MET, a drug that restores the transcriptional activity of mutant p53, failed to upregulate CES2 expression in cells with TP53 missense mutations. These results, taken together, suggest that CES2 mRNA expression is decreased in human colorectal cancer independently of p53.
Expression of p53 and p21 in primary glioblastomas
International Nuclear Information System (INIS)
Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.
2005-01-01
Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures
Immunohistochemical study of p53, pRb, p16 in esophageal cancer
International Nuclear Information System (INIS)
Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee
1998-01-01
To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs
Zhao, Feng; Meng, Songsong; Zhou, Deqing
2016-02-04
To construct heptyl glycosyltransferase gene II (waaF) gene deletion mutant of Vibrio parahaemolyticus, and explore the function of the waaF gene in Vibrio parahaemolyticus. The waaF gene deletion mutant was constructed by chitin-based transformation technology using clinical isolates, and then the growth rate, morphology and serotypes were identified. The different sources (O3, O5 and O10) waaF gene complementations were constructed through E. coli S17λpir strains conjugative transferring with Vibrio parahaemolyticus, and the function of the waaF gene was further verified by serotypes. The waaF gene deletion mutant strain was successfully constructed and it grew normally. The growth rate and morphology of mutant were similar with the wild type strains (WT), but the mutant could not occurred agglutination reaction with O antisera. The O3 and O5 sources waaF gene complementations occurred agglutination reaction with O antisera, but the O10 sources waaF gene complementations was not. The waaF gene was related with O-antigen synthesis and it was the key gene of O-antigen synthesis pathway in Vibrio parahaemolyticus. The function of different sources waaF gene were not the same.
Effect of radon and its progeny on the expression and mutation of p53 in lung tissues of mice
International Nuclear Information System (INIS)
Piao Chunnan; Tian Mei; Liu Jianxiang; Ruan Jianlei; Su Xu
2010-01-01
Objective: To explore the effect of radon and its progeny on the expression and mutations of p53 in lung tissue of mouse model. Methods: Apoptosis was detected by terminal deoxynucleotidy transferase-mediated dUTP-biotin nick end labeling. The expression of p53 gene was analyzed by immunohistochemistry, Western blot and realtime-PCR. PCR-SSCP was used to detect the mutation of p53 in lung tissues. Results: Compared with those in the control group, the apoptotic index were increased significantly in 30 WLM and 60 WLM groups (t=18.11, -10.30, P<0.05). The p53 protein was increased significantly (t=-11.08, P<0.05; t=-7.00, P<0.05) in 30 WLM and 60 WLM groups. The mutation of p53 gene was not detected in lungs of radon-exposure mice. Conclusions: Lung and bronchus might be the targets of radon and its progeny, and p53 gene plays an important role in the progression of radon-induced lung injury. (authors)
PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1993-01-01
From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
A Large PROP1 Gene Deletion in a Turkish Pedigree
Directory of Open Access Journals (Sweden)
Suheyla Gorar
2018-01-01
Full Text Available Pituitary-specific paired-like homeodomain transcription factor, PROP1, is associated with multiple pituitary hormone deficiency. Alteration of the gene encoding the PROP1 may affect somatotropes, thyrotropes, and lactotropes, as well as gonadotropes and corticotropes. We performed genetic analysis of PROP1 gene in a Turkish pedigree with three siblings who presented with short stature. Parents were first degree cousins. Index case, a boy, had somatotrope, gonadotrope, thyrotrope, and corticotrope deficiency. However, two elder sisters had somatotroph, gonadotroph, and thyrotroph deficiency and no corticotroph deficiency. On pituitary magnetic resonance, partial empty sella was detected with normal bright spot in all siblings. In genetic analysis, we found a gross deletion involving PROP1 coding region. In conclusion, we report three Turkish siblings with a gross deletion in PROP1 gene. Interestingly, although little boy with combined pituitary hormone deficiency has adrenocorticotropic hormone (ACTH deficiency, his elder sisters with the same gross PROP1 deletion have no ACTH deficiency. This finding is in line with the fact that patients with PROP1 mutations may have different phenotype/genotype correlation.
Mosad, E; Said Abd El-Rahman Allam, M; Moustafa, H M; Mohammed, A Eliaw; El kebeer, A M; Abdel-Moneim, S S
2014-12-01
The hepatitis C virus (HCV) core protein is able to accumulate genetic p53 mutations and may be considered co-oncogenic. This study investigates 1p36.3 telomere deletion in B-non-Hodgkin's lymphoma (NHL) patients with chronic HCV infection using fluorescence in situ hybridization (FISH) in relation to survival to assess Ki-67 antigen expression. A study group and a control group of 100 patients with B-NHL (50 HCV positive and 50 HCV negative) and 60 control bone marrow biopsies were subjected to FISH for the detection of 1P36.3 deletion and to immunohistochemical staining with Ki-67 antigens. 1p36.3 deletion by FISH was detected in 40% of the study group, and Ki-67 was expressed in approximately 74% of patients. A significant difference was found between positive and negative HCV patients in their overall survival, the qualitative expression of Ki-67 and the quantitative detection of 1p36.3 deletion by FISH. The overall survival was shorter with the presence of an 1p36 deletion by FISH and HCV positive. We concluded that the coexistence of Ki-67 positivity, HCV positivity and 1p36.3 deletion may contribute to infection-related cancers at the 1p36.3 locus. © 2014 John Wiley & Sons Ltd.
Gene alterations in radiation-induced F344 rat lung tumors
International Nuclear Information System (INIS)
Kelly, G.; Hahn, F.F.
1994-01-01
The p53 tumor suppressor gene is frequently altered in all major histopathologic types of human lung tumors. Reported p53 mutations include base substitutions, allelic loss, rearrangements, and deletions. Point mutations resulting in base substitutions are clustered within a highly conserved region of the gene encoding exons 508, and mutations in this region substantially extend the half-life of the p53 protein. In addition to its prominent importance in lung carcinogenesis, the p53 gene plays a critical role in the cellular response to genetic damage caused by radiation. Specifically, the protein product of p53 induces a pause or block at the G 1 to S boundary of the cell cycle following radiation-caused DNA damage. This G 1 block may allow the cell time to repair the damaged DNA prior to replication. Cells lacking a functional p53 protein fail to pause for repair and consequently accumulate mutations in the genome at an accelerated rate. p53 has also been implicated as a controlling factor in apoptosis or in programmed cell death induced by DNA-damaging agents, such as ionizing radiation. The p53 gene is mutated in approximately 50% of squamous cell carcinomas from uranium miners who inhaled high doses of radon daughters. The purpose of the present study was to determine if a similar percentage of squamous cell carcinomas with p53 mutations developed in the lungs of rats exposed to aerosols of 239 PuO 2
Emanuels, AG; Koudstaal, J; Burger, MPM; Hollema, H
To offer more tailored treatment to individual patients with squamous cell carcinoma of the vulval more accurate prediction of lymph node metastases is required. As p53 and mdm2 are genes known to be involved in the development of other tumours, we studied expression of p53 and mdm2 in
p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors
Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't
1999-01-01
Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this
Palli, D; Caporaso, N E; Shiao, Y H; Saieva, C; Amorosi, A; Masala, G; Rice, J M; Fraumeni, J F
1997-12-01
A series of 105 gastric cancer (GC) cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. Overall, 33 of 105 cases had a mutation (p53+) identified by single-strand conformational polymorphism and confirmed by sequencing (Y-H. Shiao et al., submitted for publication). p53+ cases had a more traditional dietary pattern (i.e., corn meal mush, meat soup, and other homemade dishes) and reported less frequent consumption of raw vegetables (particularly lettuce and raw carrots). A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. In addition, p53+ cases tended to be located in the upper portion of the stomach and to be associated with advanced age and blood group A. No relation was found between the presence of p53 mutations and histologically defined Helicobacter pylori infection, smoking history, family history of gastric cancer, education, and social class. Of the 33 p53+ cases, 19 had G:C-->A:T transitions at CpG sites. These tumors tended to occur in females and in association with H. pylori infection but not other risk factors. The remaining 14 cases with a p53 mutation had mainly transversions but also two deletions and two transitions at non-CpG sites. These tumors showed a strong positive association with a traditional dietary pattern and with the estimated intake of selected nutrients (nitrite, protein, and fat, particularly from animal sources). The findings of this case-case analysis suggest that p53 mutations at non-CpG sites are related to exposure to alkylating compounds from diet, whereas p53 mutations at CpG sites might be related to H. pylori infection.
Size unlimited markerless deletions by a transconjugative plasmid-system in Bacillus licheniformis.
Rachinger, Michael; Bauch, Melanie; Strittmatter, Axel; Bongaerts, Johannes; Evers, Stefan; Maurer, Karl-Heinz; Daniel, Rolf; Liebl, Wolfgang; Liesegang, Heiko; Ehrenreich, Armin
2013-09-20
Conjugative shuttle vectors of the pKVM series, based on an IncP transfer origin and the pMAD vector with a temperature sensitive replication were constructed to establish a markerless gene deletion protocol for Bacilli without natural competence such as the exoenzyme producer Bacillus licheniformis. The pKVM plasmids can be conjugated to strains of B. licheniformis and B. subtilis. For chromosomal gene deletion, regions flanking the target gene are fused and cloned in a pKVM vector prior to conjugative transfer from Escherichia coli to B. licheniformis. Appropriate markers on the vector backbone allow for the identification of the integration at the target locus and thereafter the vector excision, both events taking place via homologous recombination. The functionality of the deletion system was demonstrated with B. licheniformis by a markerless 939 bp in-frame deletion of the yqfD gene and the deletion of a 31 kbp genomic segment carrying a PBSX-like prophage. Copyright © 2013 Elsevier B.V. All rights reserved.
Association between p53 codon 72 polymorphism and systemic lupus erythematosus
Directory of Open Access Journals (Sweden)
Mohammad Nabavi
2014-06-01
Full Text Available Aim : Systemic lupus erythematosus (SLE is a systemic vasculitic disorder, with multiple genes involved in the disease pathogenesis. The p53 gene plays an important role in controlling the cell cycle. We aimed to study the prevalence of p53 polymorphism in SLE patients and analyze the relationship between the p53 polymorphism and clinical-laboratory features of the disease. Material and methods : This case-control study was conducted on patients with confirmed SLE at Namazi Hospital, Shiraz, Iran. Seventy-seven patients with SLE including 9 (11.8% men and 68 (88.2% women with mean age of 25.61 ±10.69 years and 80 healthy controls with mean age of 51.82 ±14.25 years were included. The patients’ information, including the epidemiological profile, disease history, disease symptoms and also the laboratory findings, were extracted from the hospital records. The p53 expression was determined in lyzed lymphocytes. The data were analyzed using SPSS software version 14.00 for Windows considering p < 0.05 as statistically significant. Results : The frequencies of Arg/Arg, Pro/Pro and Arg/Pro among normal controls were 38.8%, 28.8% and 37.5%, respectively, but in the patients, Arg/Arg, Pro/Pro and Arg/Pro genotypes frequencies were shown to be 29.2%, 12.3% and 58.5%, respectively. Thus, heterozygous form of this polymorphism was shown to be associated with the disease more than the homozygous alleles. There was a significant relationship between the different allele types of p53 and some clinical features of SLE. There was no association between the different allele types and any of the initial manifestations of the disease and the laboratory findings, as well. Conclusions: In an Iranian population the functional oncoprotein of p53 with codon 72 polymorphism may play an important role in the pathogenesis and clinical presentation of SLE.
Analysis of the ARF/p53 Pathway During Oncogenic Stimulation
National Research Council Canada - National Science Library
Nahle, Zaher
2003-01-01
... or deficient for the ARF and/or p53 genes. We found that the ElA oncoprotein regulates the expression of a myriad of targets involved in a diversity of functions such as apoptosis, cell cycle progression, checkpoint control, DNA replication...
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
Survivin inhibits anti-growth effect of p53 activated by aurora B
International Nuclear Information System (INIS)
Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee
2005-01-01
Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53
Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei
2017-06-01
Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.
International Nuclear Information System (INIS)
Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.
1995-01-01
G1/S arrest. Cell cycle checkpoint arrest in response to 4 or 8 Gy X-rays was measured without caffeine and with 0.5 and 2mM caffeine. In (+/+) cells, G1/S and G2/M arrest was seen and there was no demonstrable impact of caffeine at either dose on either checkpoint. By contrast (-/-) cells showed a clear reduction (50%) of the size of G2/M arrest at 0.5mM caffeine and complete override at 2mM caffeine. These data imply that cells which lack p53, are sensitized by low-dose caffeine and their G2/M checkpoint is altered, seen by the different effects of caffeine upon G2/M override. Tumor cells which do and do not have functional p53 have also been evaluated. Preliminary data suggest a similar conclusion can be drawn. MCF-7 cells transfected with control plasmid or plasmids containing the gene for HPV-E6 protein also show sensitization with low dose caffeine only in cells which have E6. Conclusions: The greater caffeine-induced radiosensitization in p53(-) cells suggests that p53, already shown to control the G1/S checkpoint, may also influence aspects of G2/M arrest. These data indicate an opportunity for therapeutic gain by combining DNA damaging agents with compounds that disrupt G2/M arrest in tumors lacking functional p53. The role of p53 in G2/M transition remains to be defined
Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage
International Nuclear Information System (INIS)
Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru
2005-01-01
The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1991-01-01
A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.
Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C
2012-12-13
p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.
Directory of Open Access Journals (Sweden)
Heba Bassiony
Full Text Available BACKGROUND: Magnetite nanoparticles (MNPs have been widely used as contrast agents and have promising approaches in cancer treatment. In the present study we used Ehrlich solid carcinoma (ESC bearing mice as a model to investigate MNPs antitumor activity, their effect on expression of p53 and p16 genes as an indicator for apoptotic induction in tumor tissues. METHOD: MNPs coated with ascorbic acid (size: 25.0±5.0 nm were synthesized by co-precipitation method and characterized. Ehrlich mice model were treated with MNPs using 60 mg/Kg day by day for 14 injections; intratumorally (IT or intraperitoneally (IP. Tumor size, pathological changes and iron content in tumor and normal muscle tissues were assessed. We also assessed changes in expression levels of p53 and p16 genes in addition to p53 protein level by immunohistochemistry. RESULTS: Our results revealed that tumor growth was significantly reduced by IT and IP MNPs injection compared to untreated tumor. A significant increase in p53 and p16 mRNA expression was detected in Ehrlich solid tumors of IT and IP treated groups compared to untreated Ehrlich solid tumor. This increase was accompanied with increase in p53 protein expression. It is worth mentioning that no significant difference in expression of p53 and p16 could be detected between IT ESC and control group. CONCLUSION: MNPs might be more effective in breast cancer treatment if injected intratumorally to be directed to the tumor tissues.
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino
2011-11-01
Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.
Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji
2008-04-01
Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.
International Nuclear Information System (INIS)
Yang, Shan; Kawamura, Kiyoko; Okamoto, Shinya; Yamauchi, Suguru; Shingyoji, Masato; Sekine, Ikuo; Kobayashi, Hiroshi; Tada, Yuji; Tatsumi, Koichiro; Hiroshima, Kenzo; Shimada, Hideaki; Tagawa, Masatoshi
2015-01-01
Improvement of transduction and augmentation of cytotoxicity are crucial for adenoviruses (Ad)-mediated gene therapy for cancer. Down-regulated expression of type 5 Ad (Ad5) receptors on human tumors hampered Ad-mediated transduction. Furthermore, a role of the p53 pathways in cytotoxicity mediated by replication-competent Ad remained uncharacterized. We constructed replication-competent Ad5 of which the E1 region genes were activated by a transcriptional regulatory region of the midkine or the survivin gene, which is expressed preferentially in human tumors. We also prepared replication-competent Ad5 which were regulated by the same region but had a fiber-knob region derived from serotype 35 (AdF35). We examined the cytotoxicity of these Ad and a possible combinatory use of the replication-competent AdF35 and Ad5 expressing the wild-type p53 gene (Ad5/p53) in esophageal carcinoma cells. Expression levels of molecules involved in cell death, anti-tumor effects in vivo and production of viral progenies were also investigated. Replication-competent AdF35 in general achieved greater cytotoxic effects to esophageal carcinoma cells than the corresponding replication-competent Ad5. Infection with the AdF35 induced cleavages of caspases and increased sub-G1 fractions, but did not activate the autophagy pathway. Transduction with Ad5/p53 in combination with the replication-competent AdF35 further enhanced the cytotoxicity in a synergistic manner. We also demonstrated the combinatory effects in an animal model. Transduction with Ad5/p53 however suppressed production of replication-competent AdF35 progenies, but the combination augmented Ad5/p53-mediated p53 expression levels and the downstream pathways. Combination of replication-competent AdF35 and Ad5/p53 achieved synergistic cytotoxicity due to enhanced p53-mediated apoptotic pathways. The online version of this article (doi:10.1186/s12885-015-1482-8) contains supplementary material, which is available to authorized
Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A
2002-08-22
A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.
Olson, Daniel G.; Giannone, Richard J.; Hettich, Robert L.
2013-01-01
The CipA scaffoldin protein plays a key role in the Clostridium thermocellum cellulosome. Previous studies have revealed that mutants deficient in binding or solubilizing cellulose also exhibit reduced expression of CipA. To confirm that CipA is, in fact, necessary for rapid solubilization of crystalline cellulose, the gene was deleted from the chromosome using targeted gene deletion technologies. The CipA deletion mutant exhibited a 100-fold reduction in cellulose solubilization rate, although it was eventually able to solubilize 80% of the 5 g/liter cellulose initially present. The deletion mutant was complemented by a copy of cipA expressed from a replicating plasmid. In this strain, Avicelase activity was restored, although the rate was 2-fold lower than that in the wild type and the duration of the lag phase was increased. The cipA coding sequence is located at the beginning of a gene cluster containing several other genes thought to be responsible for the structural organization of the cellulosome, including olpB, orf2p, and olpA. Tandem mass spectrometry revealed a 10-fold reduction in the expression of olpB, which may explain the lower growth rate. This deletion experiment adds further evidence that CipA plays a key role in cellulose solubilization by C. thermocellum, and it raises interesting questions about the differential roles of the anchor scaffoldin proteins OlpB, Orf2p, and SdbA. PMID:23204466
Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F; Morton, Lindsay C; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Udhayakumar, Venkatachalam; Barnwell, John W
2017-01-01
More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.
Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C
2017-12-01
Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
AAVPG: A vigilant vector where transgene expression is induced by p53
Energy Technology Data Exchange (ETDEWEB)
Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br
2013-12-15
Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.
Analysis of the K-ras and p53 pathways in x-ray-induced lung tumors in the rat
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Middleton, S.K.; Hahn, F.F.; Nikula, K.J. [Inhalation Toxicology Research Inst., Albuquerque, NM (United States); Picksley, S.M. [Medical Sciences Inst., Dundee (United Kingdom)
1996-04-01
The risk from exposure to low-dose radiation in conjunction with cigarette smoking has not been estimated due in part to lmited knowledge surrounding the molecular mechanisms underlying radiation-induced cancers. The purpose of this investigation was to determine the frequency for alterations in genes within the K-ras and p53 signal and cell cycle regulatory pathways, respectively, in X-ray-induced lung tumors in the F344/N rat. These tumors were examined for genetic alterations in the K-ras, c-raf-1, p53, mdm2 and cip1 genes. No K-ras mutations were detected by sequencing in 18 squamous cell carcinomas (SCCs) or 17 adenocarcinomas. However, using a K-ras codon 12 mutation selection assay, a codon 12 GGT {r_arrow} GAT mutation was detected in one SCC, suggesting that activation of the K-ras proto-oncogene is both a rare and late event. Single-strand conformation polymorphism (SSCP) analysis of the kinase-binding domain of the c-raf-1 gene did not detect any polymorphisms. Three of 18 SCCs but none of the adenocarcinomas showed p53 nuclear immunoreactivity. Single-strand conformation polymorphism analysis of exons 4-9 of the p53 gene detected only an exon 9 mutation in one SCC. Mutations were not detected in the three SCCs with immunoreactive p53 protein. No amplification of the mdm2 gene was detected; however, nuclear mdm2 immunoreactivity was present in one of the three SCCs that stained positive for the p53 protein. The complete cDNA of the rat cip1 gene comprising 810 bases was cloned and sequenced. The frequency of somatic mutations in exon 2 of the cip1 gene was determined by SSCP analysis. No alterations in electrophoretic mobility were detected. The results of this investigation indicate that alterations in the K-ras and p53 pathways do not play a major role in the genesis of X-ray-induced lung tumors in the rat. 49 refs., 5 figs.
Directory of Open Access Journals (Sweden)
Youfeng Shen
2017-11-01
Full Text Available Abstract Background Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Methods Transcription activator-like effector nucleases (TALENs were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. Results The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19 were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean
Deleting the Arntl clock gene in the granular layer of the mouse cerebellum
DEFF Research Database (Denmark)
Bering, Tenna; Carstensen, Mikkel Bloss; Rath, Martin Fredensborg
2017-01-01
nucleus. It has been suggested that the cerebellar circadian oscillator is involved in food anticipation, but direct molecular evidence of the role of the circadian oscillator of the cerebellar cortex is currently unavailable. To investigate the hypothesis that the circadian oscillator of the cerebellum...... is involved in circadian physiology and food anticipation, we therefore by use of Cre-LoxP technology generated a conditional knockout mouse with the core clock gene Arntl deleted specifically in granule cells of the cerebellum, since expression of clock genes in the cerebellar cortex is mainly located...
Yatagai, Fumio; Morimoto, Shigeko; Kato, Takesi; Honma, Masamitsu
2004-06-13
Loss of heterozygosity (LOH) is the predominant mechanism of spontaneous mutagenesis at the heterozygous thymindine kinase locus (tk) in TK6 cells. LOH events detected in spontaneous TK(-) mutants (110 clones from p53 wild-type cells TK6-20C and 117 clones from p53-abrogated cells TK6-E6) were analyzed using 13 microsatellite markers spanning the whole of chromosome 17. Our analysis indicated an approximately 60-fold higher frequency of terminal deletions in p53-abrogated cells TK6-E6 compared to p53 wild-type cells TK6-20C whereas frequencies of point mutations (non-LOH events), interstitial deletions, and crossing over events were found to increase only less than twofold by such p53 abrogation. We then made use of an additional 17 microsatellite markers which provided an average map-interval of 1.6Mb to map various LOH endpoints on the 45Mb portion of chromosome 17q corresponding to the maximum length of LOH tracts (i.e. from the distal marker D17S932 to the terminal end). There appeared to be four prominent peaks (I-IV) in the distribution of LOH endpoints/Mb of Tk6-20C cells that were not evident in p53-abrogated cells TK6-E6, where they appeared to be rather broadly distributed along the 15-20Mb length (D17S1807 to D17S1607) surrounding two of the peaks that we detected in TK6-20C cells (peaks II and III). We suggest that the chromosomal instability that is so evident in TK6-E6 cells may be due to DNA double-strand break repair occurring through non homologous end-joining rather than allelic recombination.
Directory of Open Access Journals (Sweden)
Praveen Baskaran
Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.
Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR
Energy Technology Data Exchange (ETDEWEB)
Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)
1994-09-01
Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.
Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.
Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D
2017-08-01
Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.
DEFF Research Database (Denmark)
Lanfrancone, L; Pengue, G; Pandolfi, P P
1992-01-01
We report the structural and functional characterization of the HF.10 zinc finger gene (ZNF35) in normal human cells, as well as a processed pseudogene. The HF.10 gene spans about 13 kb and it is interrupted by three introns. All 11 zinc finger DNA-binding domains are contiguously encoded within...... and partial nucleotide sequencing of the HF.10 pseudogene indicated that it has arisen by retroposition of spliced HF.10 mRNA. In situ hybridization experiments revealed that both the functional locus and the pseudogene map to chromosome 3p21p22, a region that is frequently deleted in small cell lung...... and renal carcinomas. Hybridization of the HF.10 gene and the HF.10 pseudogene DNA probes to metaphases from a small cell lung carcinoma cell line with the 3p deletion revealed that both loci are part of the deleted chromosome region....
Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V
2014-11-01
Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in
DEFF Research Database (Denmark)
Li, Xiaomu; Cheng, Kenneth K. Y.; Liu, Zhuohao
2016-01-01
deletion or pharmacological inhibition of its negative regulator MDM2, impairs GSIS, leading to glucose intolerance in mice. Mechanistically, p53 activation represses the expression of the mitochondrial enzyme pyruvate carboxylase (PC), resulting in diminished production of the TCA cycle intermediates...
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
p53, a New Master Regulator of Stem Cell Differentiation | Center for Cancer Research
When the genome is damaged, a key player in stabilizing and maintaining genomic integrity is a protein called p53. This protein can activate or shut down gene activity in response to DNA damage. But how exactly does p53 accomplish its task? This question has yet to be answered completely at the molecular level.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra
2017-09-29
p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Copy Number Deletion Has Little Impact on Gene Expression Levels in Racehorses
Directory of Open Access Journals (Sweden)
Kyung-Do Park
2014-09-01
Full Text Available Copy number variations (CNVs, important genetic factors for study of human diseases, may have as large of an effect on phenotype as do single nucleotide polymorphisms. Indeed, it is widely accepted that CNVs are associated with differential disease susceptibility. However, the relationships between CNVs and gene expression have not been characterized in the horse. In this study, we investigated the effects of copy number deletion in the blood and muscle transcriptomes of Thoroughbred racing horses. We identified a total of 1,246 CNVs of deletion polymorphisms using DNA re-sequencing data from 18 Thoroughbred racing horses. To discover the tendencies between CNV status and gene expression levels, we extracted CNVs of four Thoroughbred racing horses of which RNA sequencing was available. We found that 252 pairs of CNVs and genes were associated in the four horse samples. We did not observe a clear and consistent relationship between the deletion status of CNVs and gene expression levels before and after exercise in blood and muscle. However, we found some pairs of CNVs and associated genes that indicated relationships with gene expression levels: a positive relationship with genes responsible for membrane structure or cytoskeleton and a negative relationship with genes involved in disease. This study will lead to conceptual advances in understanding the relationship between CNVs and global gene expression in the horse.
Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.
Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F
2009-01-01
Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.
Nongenotoxic p53 activation protects cells against S-phase-specific chemotherapy
DEFF Research Database (Denmark)
Kranz, Dominique; Dobbelstein, Matthias
2006-01-01
Mutations in the tumor suppressor gene TP53 represent the most frequent genetic difference between tumor cells and normal cells. Here, we have attempted to turn this difference into an advantage for normal cells during therapy. Using the Mdm2 antagonist nutlin-3, we first activated p53 in U2OS an...... a killer to a protector of cells, with the potential to reduce unwanted side effects of chemotherapy....
Directory of Open Access Journals (Sweden)
Di Bartolo Daniel L
2012-07-01
Full Text Available Abstract Partial duplication and partial deletion of the short arm of chromosome 9 have each been reported in the literature as clinically recognizable syndromes. We present clinical, cytogenetic, and molecular findings on a five-week-old female infant with concomitant duplication and terminal deletion of the short arm of chromosome 9. To our knowledge ten such cases have previously been reported. Conventional cytogenetic analysis identified additional material on chromosome 9 at band p23. FISH analysis aided in determining the additional material consisted of an inverted duplication with a terminal deletion of the short arm. Microarray analysis confirmed this interpretation and further characterized the abnormality as a duplication of about 32.7 Mb, from 9p23 to 9p11.2, and a terminal deletion of about 11.5 Mb, from 9p24.3 to 9p23. The infant displayed characteristic features of Duplication 9p Syndrome (hypotonia, bulbous nose, single transverse palmar crease, cranial anomalies, as well as features associated with Deletion 9p Syndrome (flat nasal bridge, long philtrum, cardiac anomalies despite the deletion being distal to the reported critical region for this syndrome. This case suggests that there are genes or regulatory elements that lie outside of the reported critical region responsible for certain phenotypic features associated with Deletion 9p Syndrome. It also underscores the importance of utilizing array technology to precisely define abnormalities involving the short arm of 9p in order to further refine genotype/phenotype associations and to identify additional cases of duplication/deletion.
P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation
International Nuclear Information System (INIS)
Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.
2006-01-01
Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells
p53 mutations promote proteasomal activity.
Oren, Moshe; Kotler, Eran
2016-07-27
p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.
Energy Technology Data Exchange (ETDEWEB)
Lipson, A.; Sholler, G.; Issacs, D. [Royal Alexandra Hospital for Children, Sydney (Australia)] [and others
1996-11-11
We report on a female with a interstitial deletion of 10p13 and a phenotype similar to that seen with the 22q deletion syndromes (DiGeorge/velo-cardio-facial). She had a posterior cleft palate, perimembranous ventricular septal defect, dyscoordinate swallowing, T-cell subset abnormalities, small ears, maxillary and mandibular hypoplasia, broad nasal bridge, deficient alae nasi, contractures of fingers and developmental delay. This could indicate homology of some developmental genes at 22q and 10p so that patients with the velocardiofacial phenotype who do not prove to be deleted on 22q are candidates for a 10p deletion. 58 refs., 3 figs.
Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies
Directory of Open Access Journals (Sweden)
Laila K. Effat
2000-01-01
Full Text Available Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program.
Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea
2009-06-01
Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Geller, A.I.; Keyomarsi, K.; Bryan, J.; Pardee, A.B.
1990-01-01
The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli β-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; ts mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses β-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline
Directory of Open Access Journals (Sweden)
Noriko Mori
2004-10-01
Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.
La Serna-Infantes, Jorge; Pastor, Miguel Chávez; Trubnykova, Milana; Velásquez, Félix Chavesta; Sotomayor, Flor Vásquez; Barriga, Hugo Abarca
2018-02-05
Trichothiodystrophy type 4 is a rare autosomal recessive and ectodermal disorder, characterized by dry, brittle, sparse and sulfur-deficient hair and other features like intellectual disability, ichthyotic skin and short stature, caused by a homozygous mutation in MPLKIP gene. Glutaric aciduria type 3 is caused by a homozygous mutation in SUGCT gene with no distinctive phenotype. Both genes are localized on chromosome 7 (7p14). We report an 8-year-old female with short stature, microcephaly, development delay, intellectual disability and hair characterized for dark, short, coarse, sparse and brittle associated to classical trichorrhexis microscopy pattern. Chromosome microarray analysis showed a 125 kb homozygous pathogenic deletion, which includes genes MPLKIP and SUGCT, not described before. This is the first case described in Peru of a novel contiguous gene deletion of Trichothiodystrophy type 4 and Glutaric aciduria type 3 performed by chromosome microarray analysis, highlighting the contribution and importance of molecular technologies on diagnosis of rare genetic conditions. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
P53 overexpression in head and neck carcinoma and radiotherapy results
International Nuclear Information System (INIS)
Awwad, Saif; Jaros, Evelyn; Somes, James; Lunec, John
1996-01-01
Purpose: P53 gene mutations are the common genetic changes encountered in human cancers, and there is extensive evidence that the P53 status may determine tumor response to therapy. This study was carried out to investigate whether there is any correlation between accumulation (overexpression) of P53 protein and poor prognosis in patients with head and neck carcinomas treated with radical radiotherapy. Methods and Materials: Seventy-nine patients with head and neck carcinomas who were diagnosed and treated in 1989-90 with curative radiotherapy were studied retrospectively. Paraffin sections from archival material were studied using immunohistochemical staining (IHC) with mouse monoclonal antibodies (D0-7) to human P53 protein. Univariate and multivariate analysis of loco-regional tumor control and patient survival were performed on possible prognostic factors. Results: Forty-two (53%) patients showed positive IHC staining in their tumors. Fifty-three percent of the laryngeal, 64% of the oropharyngeal, and 43% of the oral cavity carcinomas showed P53 overexpression. All tumor specimens with vascular, lymphatic, and/or sarcolemmal invasion showed P53 overexpression. The proportion of tumor-stained nuclei was higher in the poorly differentiated than in the well and moderately differentiated tumors (p < 0.05), but there was no correlation with the patient overall or disease-free 5-year actuarial survival. There was no difference in the 5-year actuarial survival and disease-free survival between patients with P53 immunostaining in their tumors and those with no immunostaining (59% vs. 65% and 57% vs. 51%, respectively). The TNM tumor stage was the most significant prognostic factor with 5-year actuarial survival of 87% for early and 14% for late stages (p << 0.0001). There was a significant correlation between immunostaining and history of smoking (p = 0.02). Conclusion: The data demonstrate that the P53 accumulation as detected by immunohistochemical staining in a
International Nuclear Information System (INIS)
Gallì, Paola; Boccia, Stefania; Cadoni, Gabriella; Volante, Mariangela; De Feo, Emma; Amore, Rosarita; Giorgio, Arianna; Arzani, Dario; Paludetti, Gaetano; Ricciardi, Gualtiero
2009-01-01
The purpose of this study is to analyze the combined effects of selected p53 and p73 polymorphisms and their interaction with lifestyle habits on squamous cell carcinoma of the head and neck (SCCHN) risk and progression in an Italian population. Two hundred and eighty-three cases and 295 hospital controls were genotyped for p53 polymorphisms on exon 4 (Arg72Pro), intron 3 and 6, and p73 G4C14-to-A4T14. Their association with SCCHN was estimated using a logistic regression analysis, while a multinomial logistic regression approach was applied to calculate the effect of the selected polymorphisms on SCCHN different sites (oral cavity, oropharynx, hypopharynx and larynx). We performed an haplotype analysis of the p53 polymorphisms, and a gene-gene interaction analysis for the combined effects of p73 G4C14-to-A4T14 and p53 polymorphisms. We found a significant increased risk of SCCHN among individuals with combined p73 exon 2 G4A and p53 intron 3 variant alleles (OR = 2.22, 95% CI: 1.08–4.56), and a protective effect for those carrying the p53 exon 4-p53 intron 6 diplotype combination (OR = 0.67; 95% CI: 0.47–0.92). From the gene-environment interaction analysis we found that individuals aged < 45 years carrying p73 exon 2 G4A variant allele have a 12.85-increased risk of SCCHN (95% CI: 2.10–78.74) compared with persons of the same age with the homozygous wild type genotype. Improved survival rate was observed among p53 intron 6 variant allele carriers (Hazard Ratio = 0.51 (95% CI: 0.23–1.16). Our study provides for the first time evidence that individuals carrying p53 exon 4 and p53 intron 6 variant alleles are significantly protected against SCCHN, and also shows that an additional risk is conferred by the combination of p73 exon 2 G4C14-to-A4T14 and p53 intron 3 variant allele. Larger studies are required to confirm these findings
Yang, Jian-kai; Song, Jian; Huo, Hao-ran; Zhao, Yin-long; Zhang, Guang-yu; Zhao, Zong-mao; Sun, Guo-zhu; Jiao, Bao-hua
2017-01-01
Background: Glioblastoma multiforme (GBM) is the most aggressive and deadly primary brain cancer that arises from astrocytes and classified as grade IV. Recently, exosomes have been reported as an essential mediator in diverse cancer carcinogenesis and metastasis. However, their role in GBM is still unclear. In this study, we aimed to investigate whether blood exosomes can be potential clinical diagnostic markers for GBM. Methods: We used a xenograft orthotopic mouse model to detect the differentially expressed genes in the brain and blood exosomes of original/recurrent GBM. Results: We found that recurrent GBM had stronger growth capacity and lethality than original GBM in the mouse model. A gene microarray of original tumors and blood exosomes from GBM orthotopic xenografts results showed that DNM3, p65 and CD117 expressions increased, whereas PTEN and p53 expressions decreased in both original tumors and blood exosomes. In the recurrent GBM tumor model, DNM3 and p65 showed increased expressions, whereas ST14 and p53 showed decreased expressions in tumor and blood exosomes of the recurrent GBM mouse model. Conclusion: In summary, we found that DNM3, p65 and p53 had a similar trend in brain and blood exosomes both for original and recurrent GBM, and could serve as potential clinical diagnostic markers for GBM. PMID:29449895
Structure and stability insights into tumour suppressor p53 evolutionary related proteins.
Directory of Open Access Journals (Sweden)
Bruno Pagano
Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.
Directory of Open Access Journals (Sweden)
Shinya Okamoto
Full Text Available We examined anti-tumor effects of zoledronic acid (ZOL, one of the bisphosphonates agents clinically used for preventing loss of bone mass, on human mesothelioma cells bearing the wild-type p53 gene. ZOL-treated cells showed activation of caspase-3/7, -8 and -9, and increased sub-G1 phase fractions. A combinatory use of ZOL and cisplatin (CDDP, one of the first-line anti-cancer agents for mesothelioma, synergistically or additively produced the cytotoxicity on mesothelioma cells. Moreover, the combination achieved greater anti-tumor effects on mesothelioma developed in the pleural cavity than administration of either ZOL or CDDP alone. ZOL-treated cells as well as CDDP-treated cells induced p53 phosphorylation at Ser 15, a marker of p53 activation, and up-regulated p53 protein expression levels. Down-regulation of p53 levels with siRNA however did not influence the ZOL-mediated cytotoxicity but negated the combinatory effects by ZOL and CDDP. In addition, ZOL treatments augmented cytotoxicity of adenoviruses expressing the p53 gene on mesothelioma. These data demonstrated that ZOL-mediated augmentation of p53, which was not linked with ZOL-induced cytotoxicity, played a role in the combinatory effects with a p53 up-regulating agent, and suggests a possible clinical use of ZOL to mesothelioma with anti-cancer agents.
Exome sequencing in 53 sporadic cases of schizophrenia identifies 18 putative candidate genes.
Directory of Open Access Journals (Sweden)
Michel Guipponi
Full Text Available Schizophrenia (SCZ is a severe, debilitating mental illness which has a significant genetic component. The identification of genetic factors related to SCZ has been challenging and these factors remain largely unknown. To evaluate the contribution of de novo variants (DNVs to SCZ, we sequenced the exomes of 53 individuals with sporadic SCZ and of their non-affected parents. We identified 49 DNVs, 18 of which were predicted to alter gene function, including 13 damaging missense mutations, 2 conserved splice site mutations, 2 nonsense mutations, and 1 frameshift deletion. The average number of exonic DNV per proband was 0.88, which corresponds to an exonic point mutation rate of 1.7×10(-8 per nucleotide per generation. The non-synonymous-to-synonymous mutation ratio of 2.06 did not differ from neutral expectations. Overall, this study provides a list of 18 putative candidate genes for sporadic SCZ, and when combined with the results of similar reports, identifies a second proband carrying a non-synonymous DNV in the RGS12 gene.
Energy Technology Data Exchange (ETDEWEB)
Murty, V.V.V.S.; Bosl, G.J.; Chaganti, R.S.K. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others
1996-08-01
A candidate tumor suppressor gene (TSG) site at 12q22 characterized by a high frequency of loss of heterozygosity (LOH) and a homozygous deletion has previously (LOH) and a homozygous deletion has previously been reported in human male germ cell tumors (GCTs). In a detailed deletion mapping analysis of 67 normal-tumor DNAs utilizing 20 polymorphic markers mapped to 12q22-q24, we identified the limits of the minimal region of deletion at 12q22 between D12S377 (priximal) and D12S296 (distal). We have constructed a YAC contig map of a 3-cM region of this band between the proximal marker D12S101 and the distal marker D12S346, which contained the minimal region of deletion in GCTs. The map is composed of 53 overlapping YACs and 3 cosmids onto which 25 polymorphic and nonpolymorphic sequence-tagged sites (STSs) were placed in a unique order. The size of the minimal region of deletion was approximately 2 Mb from overlapping, nonchimeric YACs that spanned the region. We also developed a radiation hybrid (RH) map of the region between D12S101 and D12S346 containing 17 loci. The consensus order developed by RH mapping is in good agreement with the YAC STS-content map order. The RH map estimated the distance between D12S101 and D12S346 to be 246 cR{sub 8000} and the minimal region of deletion to be 141 cR{sub 8000}. In addition, four genes that were previously mapped to 12q22 have been excluded as candidate genes. The leads gained from the deletion mapping and physical maps should expedite the isolation and characterization of the TSG at 12q22. 35 refs., 4 figs., 2 tabs.
The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma
International Nuclear Information System (INIS)
Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei
1999-01-01
Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53
The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.
Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J
2013-01-01
Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.
p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*
Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping
2011-01-01
The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasm...
Energy Technology Data Exchange (ETDEWEB)
Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y. [Tel Aviv Univ. (Israel)
1994-02-15
Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.
International Nuclear Information System (INIS)
Moonen, Luc; Ong, Francisca; Gallee, Maarten; Verheij, Marcel; Horenblas, Simon; Hart, Augustinus A.M.; Bartelink, Harry
2001-01-01
Purpose: To determine whether the apoptotic index, the Ki67 index, and the expression of the p53, cyclin D1, and retinoblastoma genes correlate with local control, overall survival, and time to distant metastases in invasive bladder cancer treated with external beam radiation. Methods and Materials: Paraffin-embedded pretreatment biopsies from 83 patients with invasive transitional cell carcinoma of the bladder were scored morphologically for apoptosis and immunohistochemically for Ki67, p53, cyclin D1, and retinoblastoma gene expression. Survival analysis methods were used to assess overall survival, local control, and freedom from distant metastases. A multiple proportional hazard (PH) regression analysis was performed to study the prognostic value of the above mentioned biologic parameters (all divided into two categories, except Ki67) in addition to classical prognostic factors such as T stage, histologic grade, multifocality of the tumor, and completeness of transurethral resection. All patients were treated with external beam radiation as sole treatment. Median follow-up for the 19 patients still living was 7.5 years. Results: Apoptotic index varied from 0% to 3.4% with a mean of 0.8% and a median of 0.6%. Ki67 index varied from 0% to 60% with a mean of 14% and a median of 12%. P53 protein was detectable in 61% of the tumors. Overexpression of cyclin D1 was observed in 39% of the tumors and loss of retinoblastoma protein in 23% of the tumors. High Ki67 index was found to be significantly associated with p53 expression (p=0.04) and cyclin D1 overexpression (p=0.023). Cyclin D1 overexpression was found more often in Rb-positive tumors than in Rb-negative tumors (p=0.006). Other associations between the markers are less clear. Biologic markers were not correlated with T stage or grade. In the PH analysis local control was found to be significantly better for tumors with wild-type p53 (p=0.028). Also, tumors with an apoptotic index above the median value (0