The genetic alteration of p53 in esophageal cancer

Energy Technology Data Exchange (ETDEWEB)

Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

1996-01-01

Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

Science.gov (United States)

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

Science.gov (United States)

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

Gene expression patterns associated with p53 status in breast cancer

International Nuclear Information System (INIS)

Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

2006-01-01

Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

The p53 gene with emphasis on its paralogues in mosquitoes

Directory of Open Access Journals (Sweden)

Tien-Huang Chen

2017-12-01

Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

Energy Technology Data Exchange (ETDEWEB)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4�

A dual role of p53 in the control of autophagy.

Science.gov (United States)

Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

2008-08-01

Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

International Nuclear Information System (INIS)

Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira

2007-01-01

p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain

High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Zhihong CHEN

2011-10-01

Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

Directory of Open Access Journals (Sweden)

Christian Bressy

2017-06-01

Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

International Nuclear Information System (INIS)

Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

2006-01-01

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

Energy Technology Data Exchange (ETDEWEB)

Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

2006-02-22

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

p53 tumor suppressor gene: significance in neoplasia - a review

International Nuclear Information System (INIS)

Alam, J.M.

2000-01-01

p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

Stimulation of autophagy by the p53 target gene Sestrin2.

Science.gov (United States)

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Identification of differentially expressed proteins in spontaneous thymic lymphomas from knockout mice with deletion of p53

DEFF Research Database (Denmark)

Honoré, Bent; Buus, Søren; Claësson, Mogens H

2008-01-01

ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two-dimensiona......ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two...... alpha type 3, transforming acidic coiled-coil containing protein 3, mitochondrial ornithine aminotransferase and epidermal fatty acid binding protein and down-regulation of adenylosuccinate synthetase, tubulin beta-3 chain, a 25 kDa actin fragment, proteasome subunit beta type 9, cofilin-1 and glia...

Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

International Nuclear Information System (INIS)

Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

2008-01-01

Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

International Nuclear Information System (INIS)

Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

2014-01-01

Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

Science.gov (United States)

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

The expanding regulatory universe of p53 in gastrointestinal cancer.

Science.gov (United States)

Fesler, Andrew; Zhang, Ning; Ju, Jingfang

2016-01-01

Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

p53 as the focus of gene therapy: past, present and future.

Science.gov (United States)

Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

2018-01-15

Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

Alterations in the K-ras and p53 genes in rat lung tumors

Energy Technology Data Exchange (ETDEWEB)

Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

1997-06-01

Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

Directory of Open Access Journals (Sweden)

Simon Leuchs

Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

Allelic deletions of cell growth regulators during progression of bladder cancer

DEFF Research Database (Denmark)

Primdahl, H; von der Maase, H; Christensen, M

2000-01-01

Cell growth regulators include proteins of the p53 pathway encoded by the genes CDKN2A (p16, p14arf), MDM2, TP53, and CDKN1A (p21) as well as proteins encoded by genes like RB1, E2F, and MYCL. In the present study we investigated allelic deletions of all these genes in each recurrent bladder tumor...... difference in the numbers of gene loci hit by deletions muscle-invasive versus noninvasive tumors (P = 0.0000002), with the genes most often hit by deletions in muscle-invasive tumors being TP53, RB1, and MYCL. A number of novel findings were made. Losses of MYCL and RB1 alleles were more pronounced...... that a characteristic difference between recurrent noninvasive and recurrent progressing bladder tumors is loss of cell cycle-regulatory genes in the latter group....

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.

Science.gov (United States)

Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T

2017-08-01

X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.

P450XXI (steroid 21-hydroxylase) gene deletions are not found in family studies of congenital adrenal hyperplasia

International Nuclear Information System (INIS)

Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.

1987-01-01

Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase)], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions

Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.

Science.gov (United States)

Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi

2018-04-19

Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.

Menin and p53 have non-synergistic effects on tumorigenesis in mice

International Nuclear Information System (INIS)

Loffler, Kelly A; Mould, Arne W; Waring, Paul M; Hayward, Nicholas K; Kay, Graham F

2012-01-01

While it is now more than a decade since the first description of the gene mutation underlying the tumour predisposition syndrome multiple endocrine neoplasia type 1 (MEN1), the mechanism by which its protein product menin acts to prevent development of tumours is still poorly understood. We undertook a genetic experiment to assess whether menin synergises with p53. Mice carrying various combinations of Men1 and Trp53 mutations were generated then survival and pathology assessed. While homozygous loss of Trp53 in mice resulted in early onset, aggressive tumours and profoundly reduced lifespan, heterozygous loss of either Trp53 or Men1 caused later onset disease, with a spectrum of tumours characteristic of each tumour suppressor gene. Loss of one copy of Men1 in animals also lacking both alleles of Trp53 did not exacerbate phenotype, based on survival, animal weight or sites of pathology, compared to Trp53 deletion alone. Dual heterozygous deletion of Men1 and Trp53 resulted in a small reduction in lifespan compared to the individual mutations, without new tumour sites. In the adrenal, we observed development of cortical tumours in dual heterozygous animals, as we have previously seen in Men1 +/− animals, and there was loss of heterozygosity at the Men1 allele in these tumours. Median number of pathology observations per animal was increased in dual heterozygous animals compared with heterozygous loss of Trp53 alone. Simultaneous heterozygous deletion of Men1 in animals with either heterozygous or homozygous deletion of Trp53 did not result in formation of tumours at any new sites, implying additive rather than synergistic effects of these pathways. Mice that were Men1 +/− in addition to Trp53 +/− had tumours in endocrine as well as other sites, implying that increase in total tumour burden, at sites typically associated with either Men1 or Trp53 loss, contributed to the slight decrease in survival in Men1 +/− : Trp53 +/− animals in comparison with their

Isolation and characterization of DUSP11, a novel p53 target gene

DEFF Research Database (Denmark)

Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

2009-01-01

target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

International Nuclear Information System (INIS)

Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

2007-01-01

We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

A importância do gene p53 na carcinogênese humana The importance of the p53 gene in human carcinogenesis

Directory of Open Access Journals (Sweden)

Agnes C. Fett-Conte

2002-04-01

Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.

HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

Science.gov (United States)

Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

2018-03-01

HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

Energy Technology Data Exchange (ETDEWEB)

Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)

2007-02-15

Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

International Nuclear Information System (INIS)

Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying

2007-01-01

Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

Polymorphism at codon 36 of the p53 gene.

Science.gov (United States)

Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

1994-01-01

A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

International Nuclear Information System (INIS)

Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

2011-01-01

Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

Energy Technology Data Exchange (ETDEWEB)

Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

2011-11-04

Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

OTUD5 regulates p53 stability by deubiquitinating p53.

Directory of Open Access Journals (Sweden)

Judong Luo

Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

Science.gov (United States)

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Nuclear localization signal of ING4 plays a key role in its binding to p53

International Nuclear Information System (INIS)

Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang

2005-01-01

ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53

Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

Science.gov (United States)

Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

2005-04-01

The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

International Nuclear Information System (INIS)

Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

2001-01-01

Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Alterations in tumour suppressor gene p53 in human gliomas from ...

Indian Academy of Sciences (India)

Unknown

Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

Regulation of Metabolic Activity by p53

Directory of Open Access Journals (Sweden)

Jessica Flöter

2017-05-01

Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

Novel deletion alleles carrying CYP21A1P/A2 chimeric genes in Brazilian patients with 21-hydroxylase deficiency

Directory of Open Access Journals (Sweden)

Guerra-Júnior Gil

2010-06-01

Full Text Available Abstract Background Congenital adrenal hyperplasia due to 21-hydroxylase deficiency is caused by deletions, large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes for putative serine/threonine Kinase RP, complement C4, steroid 21-hydroxylase CYP21 tenascin TNX, normally, in a duplicated cluster known as RCCX module. The CYP21 extra copy is a pseudogene (CYP21A1P. In Brazil, 30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles. Such alleles are considered to result from unequal crossovers within the bimodular C4/CYP21 locus. Depending on the localization of recombination breakpoint, different alleles can be generated conferring the locus high degree of allelic variability. The purpose of the study was to investigate the variability of deleted alleles in patients with 21-hydroxylase deficiency. Methods We used different techniques to investigate the variability of 30-kb deletion alleles in patients with 21-hydroxylase deficiency. Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR and MLPA analyses followed by sequencing to refine the location of recombination breakpoints. Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. Results An allele carrying a CYP21A1P/A2 chimeric gene was found unusually associated to a C4B/C4A Taq I 6.4-kb fragment, generally associated to C4B and CYP21A1P deletions. A novel haplotype bearing both p.P34L and p.H62L, novel and rare mutations, respectively, was identified in exon 1, however p.P30L, the most frequent pseudogene-derived mutation in this exon, was absent. Four unrelated patients showed this haplotype. Absence of p.P34L in CYP21A1P of normal controls indicated that it is not derived from pseudogene. In addition, the combination of different

Status and advances of p53-gene therapy and radiotherapy in malignant tumor

International Nuclear Information System (INIS)

Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

2006-01-01

Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

OpenAIRE

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

Multigene deletions in lung adenocarcinomas from irradiated and control mice

International Nuclear Information System (INIS)

Zhang, Y.; Woloschak, G.E.

1996-01-01

K-ras codon 12 point mutations mRb and p53 gene deletions were examined in tissues from 120 normal lungs and lung adenocarcinomas that were Formalin-treated and paraffin-embedded 25 years ago. The results showed that 12 of 60 (20%) lung adenocarcinomas had mRb deletions. All lung adenocarcinomas that were initially found bearing deleted mRb had p53 deletions (15 of 15; 100%). A significantly higher mutation frequency for K-ras codon 12 point mutations was also found in the lung adenocarcinomas from mice exposed to 24 once-weekly neutron irradiation (10 of 10; 100%) compared with those exposed to 24 or 60 once-weekly γ-ray doses (5 of 10; 50%). The data suggested that p53 and K-ras gene alterations were two contributory factors responsible for the increased incidence of lung adenocarcinoma in B6CF 1 male mice exposed to protracted neutron radiation

p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

Directory of Open Access Journals (Sweden)

Sally Hopkins-Donaldson

2006-07-01

Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

Science.gov (United States)

Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

2011-12-01

Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

Biallelic ATM alterations detected at diagnosis identify a subset of treatment-naïve chronic lymphocytic leukemia patients with reduced overall survival similar to patients with p53 deletion.

Science.gov (United States)

Lozano-Santos, Carol; García-Vela, José A; Pérez-Sanz, Nuria; Nova-Gurumeta, Sara; Fernandez-Cuevas, Belen; Gomez-Lozano, Natalia; Sánchez-Beato, Margarita; Sanchez-Godoy, Pedro; Bueno, José Luis; Garcia-Marco, José A

2017-04-01

The prognostic impact of biallelic ATM abnormalities (ATM mutation and concurrent 11q deletion) remains unknown. We studied ATM, BIRC3, SF3B1, and NOTCH1 genes in 118 treatment-naïve CLL patients at diagnosis. Patients with biallelic ATM alteration had a similar time to first treatment (TTFT) and shorter overall survival (OS) compared with patients with isolated 11q deletion and shorter TTFT and OS when compared to patients with wild-type ATM. Furthermore, biallelic ATM alteration (HR: 6.4; p ≤ 0.007) was significantly associated with an increased risk of death similar to p53 deletion (HR: 6.1; p ≤ 0.004), superior to 11q deletion alone (HR: 2.8; p ≤ 0.022) and independent of other significant parameters such as age, advanced clinical stage, and complex karyotype. Our results suggest the identification of ATM mutations in CLL patients with 11q deletion at diagnosis is clinically relevant and predicts disease progression, poor response to the treatment, and reduced OS independent of other molecular prognostic factors.

The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Andrew Fesler

2016-04-01

Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

Regulation of autophagy by cytoplasmic p53.

Science.gov (United States)

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer

Directory of Open Access Journals (Sweden)

Wen-Cheng Chung

2017-11-01

Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.

The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

Directory of Open Access Journals (Sweden)

Daniel Menendez

2011-03-01

Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

Directory of Open Access Journals (Sweden)

Peiyuan Jia

Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2005-01-01

In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

TAF6delta controls apoptosis and gene expression in the absence of p53.

Directory of Open Access Journals (Sweden)

Emmanuelle Wilhelm

Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

International Nuclear Information System (INIS)

Tong, Ying; Smith, M.A.; Tucker, S.B.

1997-01-01

Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

Science.gov (United States)

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status

International Nuclear Information System (INIS)

Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki

2004-01-01

We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)

The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

International Nuclear Information System (INIS)

Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

2010-01-01

To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

Science.gov (United States)

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Changes in protein expression in p53 deleted spontaneous thymic lymphomas

DEFF Research Database (Denmark)

Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm

2004-01-01

with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....

Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2006-01-01

In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

International Nuclear Information System (INIS)

Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

2009-01-01

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

Energy Technology Data Exchange (ETDEWEB)

Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

2009-09-04

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

Multiple Patterns of FHIT Gene Homozygous Deletion in Egyptian Breast Cancer Patients

International Nuclear Information System (INIS)

Ismail, H.M.S.; Zakhary, N.I.; Medhat, A.M.; Karim, A.M.

2011-01-01

Fragile histidine triad (FHIT) gene encodes a putative tumour suppressor protein. Loss of Fhit protein in cancer is attributed to different genetic alterations that affect the FHIT gene structure. In this study, we investigated the pattern of homozygous deletion that target the FHIT gene exons 3 to 9 genomic structure in Egyptian breast cancer patients. We have found that 65% (40 out of 62) of the cases exhibited homozygous deletion in at least one FHIT exon. The incidence of homozygous deletion was not associated with patients clinico pathological parameters including patients age, tumour grade, tumour type, and lymph node involvement. Using correlation analysis, we have observed a strong correlation between homozygous deletions of exon 3 and exon 4 (P<0.0001). Deletions in exon 5 were positively correlated with deletions in exon 7 (P<0.0001), Exon 8 (P<0.027), and exon 9 (P=0.04). Additionally, a strong correlation was observed between exons 8 and exon 9 (P<0.0001).We conclude that FHIT gene exons are homozygously deleted at high frequency in Egyptian women population diagnosed with breast cancer. Three different patterns of homozygous deletion were observed in this population indicating different mechanisms of targeting FHIT gene genomic structure.

Deletion of GOLGA2P3Y but not GOLGA2P2Y is a risk factor for oligozoospermia.

Science.gov (United States)

Sen, Sanjukta; Agarwal, Rupesh; Ambulkar, Prafulla; Hinduja, Indira; Zaveri, Kusum; Gokral, Jyotsna; Pal, Asoke; Modi, Deepak

2016-02-01

The AZFc locus on the human Y chromosome harbours several multicopy genes, some of which are required for spermatogenesis. It is believed that deletion of one or more copies of these genes is a cause of infertility in some men. GOLGA2LY is one of the genes in the AZFc locus and it exists in two copies, GOLGA2P2Y and GOLGA2P3Y. The involvement of GOLGA2LY gene copy deletions in male infertility, however, is unknown. This study aimed to investigate the association of deletions of GOLGA2P2Y and GOLGA2P3Y gene copies with male infertility and with sperm concentration and motility. The frequency of GOLGA2P3Y deletion was significantly higher in oligozoospermic men compared with normozoospermic men (7.7% versus 1.2%; P = 0.0001), whereas the frequency of GOLGA2P2Y deletion was comparable between oligozoospermic and normozoospermic men (10.3% versus 11.3%). The deletion of GOLGA2P3Y but not GOLGA2P2Y was significantly higher (P = 0.03) in men with gr/gr rearrangements, indicating that GOLGA2P3Y deletions increase the susceptibility of men with gr/gr rearrangements to oligozoospermia. Furthermore, men with GOLGA2P3Y deletion had reduced sperm concentration and motility compared with men without deletion or with deletion of GOLGA2P2Y. These findings indicate GOLGA2P3Y gene copy may be candidate AZFc gene for male infertility. Copyright © 2015 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

International Nuclear Information System (INIS)

Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

2005-01-01

Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

Cell-Cycle-Specific Function of p53 in Fanconi Anemia Hematopoietic Stem and Progenitor Cell Proliferation

Directory of Open Access Journals (Sweden)

Xiaoli Li

2018-02-01

Full Text Available Summary: Overactive p53 has been proposed as an important pathophysiological factor for bone marrow failure syndromes, including Fanconi anemia (FA. Here, we report a p53-dependent effect on hematopoietic stem and progenitor cell (HSPC proliferation in mice deficient for the FA gene Fanca. Deletion of p53 in Fanca−/− mice leads to replicative exhaustion of the hematopoietic stem cell (HSC in transplant recipients. Using Fanca−/− HSCs expressing the separation-of-function mutant p53515C transgene, which selectively impairs the p53 function in apoptosis but keeps its cell-cycle checkpoint activities intact, we show that the p53 cell-cycle function is specifically required for the regulation of Fanca−/− HSC proliferation. Our results demonstrate that p53 plays a compensatory role in preventing FA HSCs from replicative exhaustion and suggest a cautious approach to manipulating p53 signaling as a therapeutic utility in FA. : In this article, Pang and colleagues demonstrate a p53-dependent HSPC proliferation regulation in mice deficient for the Fanca gene in the Fanconi anemia (FA pathway. They show that the p53 cell-cycle function is specifically required for the regulation of FA HSC proliferation. These results suggest that overactive p53 may represent a compensatory checkpoint mechanism for FA HSC proliferation. Keywords: p53, bone marrow failure, Fanconi anemia, hematopoietic stem and progenitor cells, apoptosis, cell cycle, proliferation

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

Science.gov (United States)

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

Science.gov (United States)

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-08-27

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine

International Nuclear Information System (INIS)

Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R

2008-01-01

p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development

Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

International Nuclear Information System (INIS)

Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

2008-01-01

Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

Science.gov (United States)

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

Directory of Open Access Journals (Sweden)

Jeyran eShahbazi

2013-05-01

Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

Conditional inactivation of PDCD2 induces p53 activation and cell cycle arrest

Directory of Open Access Journals (Sweden)

Celine J. Granier

2014-08-01

Full Text Available PDCD2 (programmed cell death domain 2 is a highly conserved, zinc finger MYND domain-containing protein essential for normal development in the fly, zebrafish and mouse. The molecular functions and cellular activities of PDCD2 remain unclear. In order to better understand the functions of PDCD2 in mammalian development, we have examined PDCD2 activity in mouse blastocyst embryos, as well as in mouse embryonic stem cells (ESCs and embryonic fibroblasts (MEFs. We have studied mice bearing a targeted PDCD2 locus functioning as a null allele through a splicing gene trap, or as a conditional knockout, by deletion of exon2 containing the MYND domain. Tamoxifen-induced knockout of PDCD2 in MEFs, as well as in ESCs, leads to defects in progression from the G1 to the S phase of cell cycle, associated with increased levels of p53 protein and p53 target genes. G1 prolongation in ESCs was not associated with induction of differentiation. Loss of entry into S phase of the cell cycle and marked induction of nuclear p53 were also observed in PDCD2 knockout blastocysts. These results demonstrate a unique role for PDCD2 in regulating the cell cycle and p53 activation during early embryonic development of the mouse.

A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

Directory of Open Access Journals (Sweden)

Alfredo Ribeiro-Silva

2003-06-01

Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.

Science.gov (United States)

Yeung, S J; Pan, J; Lee, M-H

2008-12-01

Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.

Feasibility of Breast Conservation after Neoadjuvant Chemotherapy in 58 Patients with Locally Advanced Breast Cancer Using p53 and MDRI Genes as Predictors of Response

International Nuclear Information System (INIS)

Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.

2002-01-01

The aim of this prospective trial was to evaluate the feasibility and outcome of breast conservation therapy for patients with locally advanced breast cancer after neoadjuvant chemotherapy. We studied also the value of p53 and MDR1 as predictors to neoadjuvant chemotherapy. Patients and methods: Bet ween August 1997 and May 2000, 58 patients with locally advanced breast carcinoma (stages IlIA and lllB) completed treatment consisting of 5 fluorouracil 600 mg/m 2 , epirubicin 60 mg/m 2 and cyclophosphamide 600 mg/m 2 (FEC) administered intravenously, at intervals of 3 weeks. The number of cycles of chemotherapy given depended on the clinical tumor response. Surgery (local excision if sufficiently down staged, or mastectomy if not, both with axillary dissection) was performed. Surgery was followed by radiation therapy and 4 more cycles of FEC chemotherapy as an adjuvant therapy. P53 and MDR1 were assessed in the initial tissue biopsy by means of reverse transcriptase-mediated polymerase chain reaction (RT-PCR). p53 and MDR1 findings were correlated with treatment response and linkage between p53 function and cellular response was assessed by terminal deoxynucleotidyl transferase-mediated nick end labeling assay. Results: The overall response (CR+PR) was 87.9%, with a clinical complete response rate of 29.3%. Six patients had a pathological complete response and 10 patients had only minimal residual disease. Median followup from the start of chemotherapy was 24 months (range 6 to 40). Twenty two patients (43%) underwent BCS with actuarial 3-year disease-free and overall survival of 58% and 75% respectively. Cosmetic results were good to excellent in 77.2% of the patients. Modified radical mastectomy was done in 29/51 (56.9%) patients with actuarial 3 year disease-free and overall survival of 60% and 78% respectively.In 13 out of 58 patients (22.4%), p53 mutations could be identified, including eight point mutations, three minor deletions and two complex deletions

The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

Directory of Open Access Journals (Sweden)

Jennifer M. Smith

2007-12-01

Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

Science.gov (United States)

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

Directory of Open Access Journals (Sweden)

Wei Xu

2010-08-01

Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

The Transcriptional Landscape of p53 Signalling Pathway

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2017-06-01

Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

Targeting the p53 Pathway in Ewing Sarcoma

Science.gov (United States)

Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

2011-01-01

The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

Directory of Open Access Journals (Sweden)

Anirban Chakraborty

Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

The Role of Tumor Protein 53 Mutations in Common Human Cancers and Targeting the Murine Double Minute 2–P53 Interaction for Cancer Therapy

Directory of Open Access Journals (Sweden)

Tayebeh Hamzehloie

2012-03-01

Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.

p53 and the pathogenesis of skin cancer

International Nuclear Information System (INIS)

Benjamin, Cara L.; Ananthaswamy, Honnavara N.

2007-01-01

The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

P53 suppresses expression of the 14-3-3gamma oncogene

Directory of Open Access Journals (Sweden)

Qi Wenqing

2011-08-01

Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.

Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors

International Nuclear Information System (INIS)

Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.

2010-01-01

Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)

Juvenile Moyamoya and Craniosynostosis in a Child with Deletion 1p32p31: Expanding the Clinical Spectrum of 1p32p31 Deletion Syndrome and a Review of the Literature

Directory of Open Access Journals (Sweden)

Paolo Prontera

2017-09-01

Full Text Available Moyamoya angiopathy (MA is a rare cerebrovascular disorder characterised by the progressive occlusion of the internal carotid artery. Its aetiology is uncertain, but a genetic background seems likely, given the high MA familial rate. To investigate the aetiology of craniosynostosis and juvenile moyamoya in a 14-year-old male patient, we performed an array-comparative genomic hybridisation revealing a de novo interstitial deletion of 8.5 Mb in chromosome region 1p32p31. The deletion involved 34 protein coding genes, including NF1A, whose haploinsufficiency is indicated as being mainly responsible for the 1p32-p31 chromosome deletion syndrome phenotype (OMIM 613735. Our patient also has a deleted FOXD3 of the FOX gene family of transcription factors, which plays an important role in neural crest cell growth and differentiation. As the murine FOXD3−/− model shows craniofacial anomalies and abnormal common carotid artery morphology, it can be hypothesised that FOXD3 is involved in the pathogenesis of the craniofacial and vascular defects observed in our patient. In support of our assumption, we found in the literature another patient with a syndromic form of MA who had a deletion involving another FOX gene (FOXC1. In addition to describing the clinical history of our patient, we have reviewed all of the available literature concerning other patients with a 1p32p31 deletion, including cases from the Decipher database, and we have also reviewed the genetic disorders associated with MA, which is a useful guide for the diagnosis of syndromic form of MA.

The expanding universe of p53 targets.

Science.gov (United States)

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

p53 downregulates the Fanconi anaemia DNA repair pathway.

Science.gov (United States)

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

International Nuclear Information System (INIS)

Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

2007-01-01

Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

p53 and PTEN/MMAC1/TEP1 gene therapy of human prostate PC-3 carcinoma xenograft, using transferrin-facilitated lipofection gene delivery strategy.

Science.gov (United States)

Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan

2002-04-10

We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

Science.gov (United States)

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

Science.gov (United States)

Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

2014-06-01

Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

Science.gov (United States)

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

1p13.2 deletion displays clinical features overlapping Noonan syndrome, likely related to NRAS gene haploinsufficiency

Directory of Open Access Journals (Sweden)

Natália Duarte Linhares

Full Text Available Abstract Deletion-induced hemizygosity may unmask deleterious autosomal recessive variants and be a cause of the phenotypic variability observed in microdeletion syndromes. We performed complete exome sequencing (WES analysis to examine this possibility in a patient with 1p13.2 microdeletion. Since the patient displayed clinical features suggestive of Noonan Syndrome (NS, we also used WES to rule out the presence of pathogenic variants in any of the genes associated with the different types of NS. We concluded that the clinical findings could be attributed solely to the 1p13.2 haploinsufficiency. Retrospective analysis of other nine reported patients with 1p13.2 microdeletions showed that six of them also presented some characteristics of NS. In all these cases, the deleted segment included the NRAS gene. Gain-of-function mutations of NRAS gene are causally related to NS type 6. Thus, it is conceivable that NRAS haploinsufficiency and gain-of-function mutations may have similar clinical consequences. The same phenomenon has been described for two other genes belonging to the Ras/MAPK pathway: MAP2K2 and SHOC2. In conclusion, we here report genotype-phenotype correlations in patients with chromosome 1p13.2 microdeletions and we propose that NRAS may be a critical gene for the NS characteristics in the patients.

p53 Gene (NY-CO-13 Levels in Patients with Chronic Myeloid Leukemia: The Role of Imatinib and Nilotinib

Directory of Open Access Journals (Sweden)

Hayder M. Al-kuraishy

2018-01-01

Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.

Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

Directory of Open Access Journals (Sweden)

Villiard Éric

2007-09-01

Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

Bladder-like graphical representation of p53 gene alterations in some human cancers

International Nuclear Information System (INIS)

Helal, N.L.; Dorrah, M.; LI, C.

2005-01-01

the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

Mutant p53 protein localized in the cytoplasm inhibits autophagy.

Science.gov (United States)

Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

2008-10-01

The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

NARCIS (Netherlands)

Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

1993-01-01

Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

Zebrafish homologs of genes within 16p11.2, a genomic region associated with brain disorders, are active during brain development, and include two deletion dosage sensor genes

Directory of Open Access Journals (Sweden)

Alicia Blaker-Lee

2012-11-01

Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs, intellectual disability disorder (IDD and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV. The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed ‘dosage sensors’, which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development – impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa and kinesin family member 22 (kif22 genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.

Transcriptome profiling identifies genes and pathways deregulated upon floxuridine treatment in colorectal cancer cells harboring GOF mutant p53

Directory of Open Access Journals (Sweden)

Arindam Datta

2016-06-01

Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.

TTY2 genes deletions as genetic risk factor of male infertility.

Science.gov (United States)

Shaveisi-Zadeh, F; Alibakhshi, R; Asgari, R; Rostami-Far, Z; Bakhtiari, M; Abdi, H; Movafagh, A; Mirfakhraie, R

2017-02-28

Y chromosome has a number of genes that are expressed in testis and have a role in spermatogenesis. TTY2L12A and TTY2L2A are the members of testis transcript Y2 (TTY2) that are Y linked multi-copy gene families, located on Yp11 and Yq11 loci respectively. The aim of this study was to investigate frequency of TTY2L12A and TTY2L2A deletions in azoospermic patients compared with fertile males. This study was performed on 45 infertile males with idiopathic azoospermia without any AZF micro deletions (group A), 33 infertile males with azoospermia which do not screened for AZF micro deletions (group B) and 65 fertile males (group C), from October 2013 to April 2015 in west of Iran. Polymerase chain reaction (PCR) method was used for detection of TTY2L12A and TTY2L2A gene deletions in studied groups. No deletions were detected in normal fertile males of group C. 1 out of 45 azoospermic males of group A (2.22%) and 3 out of 33 azoospermic males of group B (9.09%) had TTY2L2A deletion (p= 0.409 and p= 0.036 respectively), also 1 out of 45 azoospermic males of group A (2.22%) and 4 out of 33 azoospermic males of group B (12.12%) had TTY2L12A deletion (p= 0.409 and p= 0.011 respectively).  None of azoospermic males in Group A and B had deletions in both genes. Our data showed significant correlation between non-obstructive azoospermia and TTY2L12A and TTY2L2A deletions. Thus, it seems that TTY2L12A and TTY2L2A deletions can consider as one of the genetic risk factors for non-obstructive azoospermia.

Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

International Nuclear Information System (INIS)

Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

2006-01-01

The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

Rapid detection of single nucleotide mutation in p53 gene based on ...

Indian Academy of Sciences (India)

mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

Analysis of full coding sequence of the TP53 gene in invasive vulvar cancers: Implications for therapy.

Science.gov (United States)

Kashofer, Karl; Regauer, Sigrid

2017-08-01

This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.

Chemical Variations on the p53 Reactivation Theme

Directory of Open Access Journals (Sweden)

Carlos J. A. Ribeiro

2016-05-01

Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.

Science.gov (United States)

Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete

2018-06-11

CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.

Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

OpenAIRE

Meng, X; Carlson, NR; Dong, J; Zhang, Y

2015-01-01

The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...

Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

International Nuclear Information System (INIS)

Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

2008-01-01

This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

Science.gov (United States)

Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

Directory of Open Access Journals (Sweden)

Manujendra N Saha

Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

p53 Acetylation: Regulation and Consequences

International Nuclear Information System (INIS)

Reed, Sara M.; Quelle, Dawn E.

2014-01-01

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

p53 Acetylation: Regulation and Consequences

Energy Technology Data Exchange (ETDEWEB)

Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

2014-12-23

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

NARCIS (Netherlands)

Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

1996-01-01

Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

CLCA2 as a p53-Inducible Senescence Mediator

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2012-02-01

Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

Science.gov (United States)

Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

2015-12-01

Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

Science.gov (United States)

Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

2010-01-01

A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

International Nuclear Information System (INIS)

Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

2009-01-01

A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?

International Nuclear Information System (INIS)

Blackburn, Anneke C; Jerry, D Joseph

2002-01-01

The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer

The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

Directory of Open Access Journals (Sweden)

Krzysztof Puszynski

2014-12-01

Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

Battle Against Cancer: An Everlasting Saga of p53

Directory of Open Access Journals (Sweden)

Qian Hao

2014-12-01

Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer

International Nuclear Information System (INIS)

Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong

2009-01-01

Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their

Prenatal diagnosis and molecular cytogenetic characterization of a de novo proximal interstitial deletion of chromosome 4p (4p15.2→p14).

Science.gov (United States)

Chen, Chih-Ping; Lee, Meng-Ju; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Chen, Yu-Ting; Lee, Meng-Shan; Wang, Wayseen

2013-10-25

We present prenatal diagnosis of de novo proximal interstitial deletion of chromosome 4p (4p15.2→p14) and molecular cytogenetic characterization of the deletion using uncultured amniocytes. We review the phenotypic abnormalities of previously reported patients with similar proximal interstitial 4p deletions, and we discuss the functions of the genes of RBPJ, CCKAR, STIM2, PCDH7 and ARAP2 that are deleted within this region. © 2013.

Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

Science.gov (United States)

White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

2014-08-01

The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

International Nuclear Information System (INIS)

Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong

2008-01-01

Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

Connection between cell phone use, p53 gene expression in different zones of glioblastoma multiforme and survival prognoses

Directory of Open Access Journals (Sweden)

Reza Akhavan-Sigari

2014-08-01

Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

Science.gov (United States)

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy

International Nuclear Information System (INIS)

Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.

1996-01-01

cellular phenotypes, including the radioresistant phenotype. Pre-clinical studies suggest that these phenotypes may be reversed using adenovirus-mediated gene therapy or pharmacologic strategies designed to re-institute WTp53 protein function. Our analysis of the published data strongly argues for the use offunctional assays for the determination of WTp53 protein function in studies which attempt to correlate normal and tumour tissue radioresponse with p53 genotype, or p53 protein expression

Expression of p53 Target Genes in the Early Phase of Long-Term Potentiation in the Rat Hippocampal CA1 Area

Directory of Open Access Journals (Sweden)

Vladimir O. Pustylnyak

2015-01-01

Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.

A strong deletion bias in nonallelic gene conversion.

Directory of Open Access Journals (Sweden)

Raquel Assis

Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.

Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

International Nuclear Information System (INIS)

Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

1997-01-01

Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

Molecular biologic study about the non-small cell lung carcinoma (2) : p53 gene alteration in non-small cell lung carcinoma

International Nuclear Information System (INIS)

Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee

1996-12-01

The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs

A Biomimic Reconstituted High-Density-Lipoprotein-Based Drug and p53 Gene Co-delivery System for Effective Antiangiogenesis Therapy of Bladder Cancer

Science.gov (United States)

Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao

2015-07-01

A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.

Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

DEFF Research Database (Denmark)

Savelyeva, I.; Dobbelstein, M.

2011-01-01

to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

Dysfunctional p53 deletion mutants in cell lines derived from Hodgkin's lymphoma

DEFF Research Database (Denmark)

Feuerborn, Alexander; Moritz, Constanze; von Bonin, Frederike

2006-01-01

Classical Hodgkin's lymphoma (cHL) is a distinct malignancy of the immune system. Despite the progress made in the understanding of the pathology of cHL, the transforming events remain to be elucidated. It has been proposed that mutations in the TP53 gene in biopsy material as well as cell lines ...

Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

International Nuclear Information System (INIS)

Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun

2007-01-01

Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

Energy Technology Data Exchange (ETDEWEB)

Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)

2007-02-15

Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

Directory of Open Access Journals (Sweden)

Zanatta Daniela B

2010-06-01

Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

International Nuclear Information System (INIS)

Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E

2010-01-01

Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19

40 Years of Research Put p53 in Translation

Science.gov (United States)

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

p53 functions as a cell cycle control protein in osteosarcomas.

Science.gov (United States)

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-11-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

p53 functions as a cell cycle control protein in osteosarcomas.

Science.gov (United States)

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-01-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

The role of p53 molecule in radiation and hyperthermic therapies

International Nuclear Information System (INIS)

Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

2003-01-01

In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

Science.gov (United States)

Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

1997-05-01

To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

Subtelomeric deletion of chromosome 10p15.3: clinical findings and molecular cytogenetic characterization.

Science.gov (United States)

DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

2012-09-01

We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.

The prognostic value of p53 mutation in pediatric marrow hypoplasia

Directory of Open Access Journals (Sweden)

Sharaf Alzahraa EA

2011-06-01

Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.

Friend or Foe: MicroRNAs in the p53 network.

Science.gov (United States)

Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

2018-04-10

The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

Deficiency of G1 regulators P53, P21Cip1 and/or pRb decreases hepatocyte sensitivity to TGFβ cell cycle arrest

Directory of Open Access Journals (Sweden)

Harrison David J

2007-11-01

Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of

Homozygous deletion of the α- and β1-interferon genes in human leukemia and derived cell lines

International Nuclear Information System (INIS)

Diaz, M.O.; Ziemin, S.; Le Beau, M.M.; Pitha, P.; Smith, S.D.; Chilcote, R.R.; Rowley, J.D.

1988-01-01

The loss of bands p21-22 from one chromosome 9 homologue as a consequence of a deletion of the short arm [del(9p)], unbalanced translocation, or monosomy 9 is frequently observed in the malignant cells of patients with lymphoid neoplasias, including acute lymphoblastic leukemia and non-Hodgkin lymphoma. The α- and β 1 -interferon genes have been assigned to this chromosome region (9p21-22). The authors now present evidence of the homozygous deletion of the interferon genes in neoplastic hematopoietic cell lines and primary leukemia cells in the presence or absence of chromosomal deletions that are detectable at the level of the light microscope. In these cell lines, the deletion of the interferon genes is accompanied by a deficiency of 5'-methylthioadenosine phosphorylase, an enzyme of purine metabolism. These homozygous deletions may be associated with the loss of a tumor-suppressor gene that is involved in the development of these neoplasias. The relevant genes may be either the interferon genes themselves or a gene that has a tumor-suppressor function and is closely linked to them

Subtelomeric Copy Number Variations: The Importance of 4p/4q Deletions in Patients with Congenital Anomalies and Developmental Disability.

Science.gov (United States)

Novo-Filho, Gil M; Montenegro, Marília M; Zanardo, Évelin A; Dutra, Roberta L; Dias, Alexandre T; Piazzon, Flavia B; Costa, Taís V M M; Nascimento, Amom M; Honjo, Rachel S; Kim, Chong A; Kulikowski, Leslie D

2016-01-01

The most prevalent structural variations in the human genome are copy number variations (CNVs), which appear predominantly in the subtelomeric regions. Variable sizes of 4p/4q CNVs have been associated with several different psychiatric findings and developmental disability (DD). We analyzed 105 patients with congenital anomalies (CA) and developmental and/or intellectual disabilities (DD/ID) using MLPA subtelomeric specific kits (P036 /P070) and 4 of them using microarrays. We found abnormal subtelomeric CNVs in 15 patients (14.3%), including 8 patients with subtelomeric deletions at 4p/4q (53.3%). Additional genomic changes were observed at 1p36, 2q37.3, 5p15.3, 5q35.3, 8p23.3, 13q11, 14q32.3, 15q11.2, and Xq28/Yq12. This indicates the prevalence of independent deletions at 4p/4q, involving PIGG, TRIML2, and FRG1. Furthermore, we identified 15 genes with changes in copy number that contribute to neurological development and/or function, among them CRMP1, SORCS2, SLC25A4, and HELT. Our results highlight the association of genes with changes in copy number at 4p and 4q subtelomeric regions and the DD phenotype. Cytogenomic characterization of additional cases with distal deletions should help clarifying the role of subtelomeric CNVs in neurological diseases. © 2016 S. Karger AG, Basel.

p53 functions as a cell cycle control protein in osteosarcomas.

OpenAIRE

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-01-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

Science.gov (United States)

Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

1998-01-01

The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

NARCIS (Netherlands)

Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

Retrospective analysis in oculocutaneous albinism patients for the 2.7 kb deletion in the OCA2 gene revealed a co-segregation of the controversial variant, p.R305W.

Science.gov (United States)

Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing

2017-01-01

Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.

The PRR11-SKA2 Bidirectional Transcription Unit Is Negatively Regulated by p53 through NF-Y in Lung Cancer Cells

Directory of Open Access Journals (Sweden)

Yitao Wang

2017-03-01

Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.

Phenotypic and molecular assessment of seven patients with 6p25 deletion syndrome: Relevance to ocular dysgenesis and hearing impairment

Directory of Open Access Journals (Sweden)

Ritch Robert

2004-06-01

Full Text Available Abstract Background Thirty-nine patients have been described with deletions involving chromosome 6p25. However, relatively few of these deletions have had molecular characterization. Common phenotypes of 6p25 deletion syndrome patients include hydrocephalus, hearing loss, and ocular, craniofacial, skeletal, cardiac, and renal malformations. Molecular characterization of deletions can identify genes that are responsible for these phenotypes. Methods We report the clinical phenotype of seven patients with terminal deletions of chromosome 6p25 and compare them to previously reported patients. Molecular characterization of the deletions was performed using polymorphic marker analysis to determine the extents of the deletions in these seven 6p25 deletion syndrome patients. Results Our results, and previous data, show that ocular dysgenesis and hearing impairment are the two most highly penetrant phenotypes of the 6p25 deletion syndrome. While deletion of the forkhead box C1 gene (FOXC1 probably underlies the ocular dysgenesis, no gene in this region is known to be involved in hearing impairment. Conclusions Ocular dysgenesis and hearing impairment are the two most common phenotypes of 6p25 deletion syndrome. We conclude that a locus for dominant hearing loss is present at 6p25 and that this locus is restricted to a region distal to D6S1617. Molecular characterization of more 6p25 deletion patients will aid in refinement of this locus and the identification of a gene involved in dominant hearing loss.

Mitofusin-2 is a novel direct target of p53

International Nuclear Information System (INIS)

Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

2010-01-01

Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

RBPJ is disrupted in a case of proximal 4p deletion syndrome with epilepsy.

Science.gov (United States)

Nakayama, Tojo; Saitsu, Hirotomo; Endo, Wakaba; Kikuchi, Atsuo; Uematsu, Mitsugu; Haginoya, Kazuhiro; Hino-fukuyo, Naomi; Kobayashi, Tomoko; Iwasaki, Masaki; Tominaga, Teiji; Kure, Shigeo; Matsumoto, Naomichi

2014-06-01

Proximal 4p deletion syndrome is characterized clinically by mental retardation, minor dysmorphic facial features, and is occasionally complicated with epilepsy. More than 20 cases of proximal 4p deletion syndrome have been reported, but the causative gene(s) remain elusive. We describe here a 2-year-old female patient with a common manifestation of proximal 4p deletion syndrome and infantile epileptic encephalopathy possessing a de novo balanced translocation t(4;13)(p15.2;q12.13). The patient was diagnosed as infantile spasms at 9 months of age. She presented with dysmorphic facial features and global developmental delay, compatible with proximal 4p deletion syndrome. Using fluorescence in situ hybridization, we determined the translocation breakpoint at 4p15.2 to be within RBPJ. RBPJ is a transcription factor in the Notch/RBPJ signaling pathway, playing a crucial role in the developing human brain, and particularly telencephalon development. Our findings, combined with those of previous studies, strongly suggest that RBPJ is causative for proximal 4p deletion syndrome and epilepsy in this case. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

[Construction and Function Verification of a Novel Shuttle Vector Containing a Marker Gene Self-deletion System].

Science.gov (United States)

Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi

2015-09-01

For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.

p53 represses autophagy in a cell cycle-dependent fashion.

Science.gov (United States)

Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

2008-10-01

Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

Directory of Open Access Journals (Sweden)

Labhart Paul

2007-05-01

Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

Expression of Androgen Receptor Is Negatively Regulated By p53

Directory of Open Access Journals (Sweden)

Fatouma Alimirah

2007-12-01

Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

International Nuclear Information System (INIS)

Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko

2015-01-01

Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

Molecular mechanism of X-ray-induced p53-dependent apoptosis

Energy Technology Data Exchange (ETDEWEB)

Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

1999-03-01

Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

Science.gov (United States)

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

Science.gov (United States)

Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

2010-11-01

Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

Estudo do polimorfismo genético no gene p53 (códon 72 em câncer colorretal Role of the genetic polymorphism of p53 (codon 72 gene in colorectal cancer

Directory of Open Access Journals (Sweden)

Jacqueline Miranda de Lima

2006-03-01

Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the

P53, K-RAS, β-CATENIN, C-KIT and BAK mutations in the lung cancer of Chinese and Japanese patients

International Nuclear Information System (INIS)

Shuo Xing; Nobotoshi Nawa; Kazuhiro Tanabe; Tadashi Hongyo; Li- Ya Li; Jing-Tian Tang; Mitsunori Ohta

2005-01-01

Seventeen Chinese (Beijing) and 24 Japanese (Osaka) lung cancer cases were analyzed for mutations of p53, K-ras, β-catenin, c-kit and bak genes by PCR-SSCP analysis followed by direct sequencing. Significantly higher mutation frequency of p53 gene, one of key genes for radiation sensitivity, was found in Chinese cases (11/17; 64.7 %) than Japanese cases (8/24; 33.3 %) (p< O.O5). Fourteen of the 16 mutations found in the Chinese cases were transitions at exon 4,5 and intron 4. In the Japanese cases, of the total of 11 mutations, 5 were transitions and 5 were transversions and one was deletion. Six β-catenin mutations were found in 6 Chinese cases (35.3 % ) at codon 53 and 58, and 4 were found in 3 Japanese cases (12.5 %). C-kit mutations were detected in 5 Chinese cases (29.4 %), while no mutations were found in Japanese cases (p< O.O5). No K-ras mutation was found in both Chinese and Japanese cases. For the first time, we report on bak mutation in human lung cancer in Chinese (2/17; 11.8% ) and Japanese cases (2/24; 8.3% ). C-kit and bak genes are also definitive factors to radiosensitivity. These data thus suggest that there were apparent differences in frequency and/or mutational types of p53, β-catenin and c-kit? genes between Chinese and Japanese cases. The differences can be attributed to factors such as lifestyles including smoking and racial and/or environmental factors, and also to the prediction of the response to radiotherapy. (author)

Missense mutations located in structural p53 DNA-binding motifs are associated with extremely poor survival in chronic lymphocytic leukemia.

Science.gov (United States)

Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri

2011-07-01

There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.

P53 Gene Mutagenesis in Breast Cancer

National Research Council Canada - National Science Library

Sommer, Steve S

2005-01-01

.... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

Cancerous hyper-mutagenesis in p53 genes is possibly associated with transcriptional bypass of DNA lesions

International Nuclear Information System (INIS)

Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.

2002-01-01

The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

Science.gov (United States)

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

2012-04-05

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

International Nuclear Information System (INIS)

Ohnishi, Takeo

1997-01-01

I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

Science.gov (United States)

Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

2009-06-17

P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

Association of mRNA expression of TP53 and the TP53 codon 72 Arg/Pro gene polymorphism with colorectal cancer risk in Asian population: a bioinformatics analysis and meta-analysis.

Science.gov (United States)

Dong, Zhiyong; Zheng, Longzhi; Liu, Weimin; Wang, Cunchuan

2018-01-01

The relationship between TP53 codon 72 Pro/Arg gene polymorphism and colorectal cancer risk in Asians is still controversial, and this bioinformatics analysis and meta-analysis was performed to assess the associations. The association studies were identified from PubMed, and eligible reports were included. RevMan 5.3.1 software, Oncolnc, cBioPortal, and Oncomine online tools were used for statistical analysis. A random/fixed effects model was used in meta-analysis. The data were reported as risk ratios or mean differences with corresponding 95% CI. We confirmed that TP53 was associated with colorectal cancer, the alteration frequency of TP53 was 53% mutation and 7% deep deletion, and TP53 mRNA expression was different in different types of colorectal cancer based on The Cancer Genome Atlas database. Then, 18 studies were included that examine the association of TP53 codon 72 gene polymorphism with colorectal cancer risk in Asians. The meta-analysis indicated that TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asian population, but Arg/Arg genotype was not (Pro allele: odds ratios [OR]=1.20, 95% CI: 1.06 to 1.35, P =0.003; Pro/Pro genotype: OR=1.39, 95% CI: 1.15 to 1.69, P =0.0007; Arg/Arg genotype: OR=0.86, 95% CI: 0.74 to 1.00, P =0.05). Interestingly, in the meta-analysis of the controls from the population-based studies, we found that TP53 codon 72 Pro/Arg gene polymorphism was associated with colorectal cancer risk (Pro allele: OR=1.33, 95% CI: 1.15 to 1.55, P =0.0002; Pro/Pro genotype: OR=1.61, 95% CI: 1.28 to 2.02, P colorectal cancer, but the different value levels of mRNA expression were not associated with survival rate of colon and rectal cancer. TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asians.

DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

Directory of Open Access Journals (Sweden)

Hong Wei Yang

2001-01-01

Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

Immunohistochemical analysis of P53 protein in odontogenic cysts

Science.gov (United States)

Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

2010-01-01

The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.

Science.gov (United States)

Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam

2015-01-21

Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

Directory of Open Access Journals (Sweden)

Rolletschek Alexandra

2009-06-01

Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

Characterization of mutations and loss of heterozygosity of p53 and K-ras2 in pancreatic cancer cell lines by immobilized polymerase chain reaction

Directory of Open Access Journals (Sweden)

Edwards Jeremy

2003-07-01

Full Text Available Abstract Background The identification of known mutations in a cell population is important for clinical applications and basic cancer research. In this work an immobilized form of the polymerase chain reaction, referred to as polony technology, was used to detect mutations as well as gene deletions, resulting in loss of heterozygosity (LOH, in cancer cell lines. Specifically, the mutational hotspots in p53, namely codons 175, 245, 248, 249, 273, and 282, and K-ras2, codons 12, 13 and 61, were genotyped in the pancreatic cell line, Panc-1. In addition LOH analysis was also performed for these same two genes in Panc-1 by quantifying the relative gene copy number of p53 and K-ras2. Results Using polony technology, Panc-1 was determined to possess only one copy of p53, which possessed a mutation in codon 273, and two copies of K-ras2, one wildtype and one with a mutation in codon 12. To further demonstrate the general approach of this method, polonies were also used to detect K-ras2 mutations in the pancreatic cell lines, AsPc-1 and CAPAN-1. Conclusions In conclusion, we have developed an assay that can detect mutations in hotspots of p53 and K-ras2 as well as diagnose LOH in these same genes.

Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

Science.gov (United States)

Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

2018-01-01

Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

Alterations of tumor suppressor genes (Rb, p16, p27 and p53) and an increased FDG uptake in lung cancer

International Nuclear Information System (INIS)

Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo

2003-01-01

The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)

Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

Directory of Open Access Journals (Sweden)

Monica M Horvath

2007-07-01

Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

Science.gov (United States)

Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

2017-09-19

Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

Science.gov (United States)

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

Regulation of p53 tetramerization and nuclear export by ARC.

Science.gov (United States)

Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

2007-12-26

Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

Aberrations of the p53 pathway components p53, MDM2 and CDKN2A appear independent in diffuse large B cell lymphoma

DEFF Research Database (Denmark)

Møller, Michael Boe; Ino, Y; Gerdes, A M

1999-01-01

The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...

P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

Directory of Open Access Journals (Sweden)

Ivan Raimondi

Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

[Reduced intensity conditioning allogeneic hematopoietic stem cell transplantation in chronic lymphocytic leukemia (CLL) patients with the aberration of p53 gene].

Science.gov (United States)

Wang, Li; Miao, Kourong; Fan, Lei; Xu, Ji; Wu, Hanxin; Li, Jianyong; Xu, Wei

2016-04-01

To investigate the effectiveness and safety of reduced intensity conditioning allogeneic hematopoietic stem cell transplantation (RIC allo-HSCT) in ultra high risk chronic lymphocytic leukemia (CLL) patients with the deletion of p53 to deepen the understanding of allo-HSCT in the treatment of CLL. In this retrospective study, a total of 4 ultra high risk CLL patients with the deletion of p53 in our center between July 2012 and Jan 2014 were enrolled. The RIC regimen was administered and the hematopoietic reconstitution, transplantation related mortality (TRM), overall survival (OS), progress free survival (PFS) were evaluated. We registered 4 patients with the median age of 56 years (49-61 years), including 3 males and 1 female. The median mononuclear cells (MNC) and CD34(+) cells were 6.54 (2.85-14.7) × 10(8)/kg (recipient body weight) and 5.81 (2.85-7.79) × 10(6)/kg (recipient body weight), respectively. The median time of the neutrophil recovery was 11 days (range of 9-12 days), and the median time of the platelet recovery 5.5 days (range of 0-11 days). Three patients (75%) attained a full donor chimerism at day 28 after transplantation and one (25%) got a mixed chimerism of donor and recipient. During the follow-up at a median time of 26.5 months (range of 21-39 months), 2 (50%) patients developed acute graft versus host disease (aGVHD) grade I and 2 (50%) patients got CMV infection. One patient got herpes zoster virus and EB virus infections. No transplantation related mortality was found in the 4 patients. One patient who was in partial response status progressed 5 months after transplantation, and the other 3 patients remained in durable remission after allo-HSCT. These results suggested that RIC allo-HSCT showed durable remission, good tolerance and acceptable toxicity, which could be a better option for the treatment of ultra high risk CLL patients with the deletion of p53 and was worth to be investigated and applied widely in future.

What is the best frontline therapy for patients with CLL and 17p deletion?

Science.gov (United States)

Badoux, Xavier C; Keating, Michael J; Wierda, William G

2011-03-01

Chronic lymphocytic leukemia (CLL) is a lymphoproliferative disease with significant variation in disease progression, response to therapy, and survival outcome. Deletions of 17p or mutations of TP53 have been identified as one of the poorest prognostic factors, being predictive of short time for disease progression, lack of response to therapy, short response duration, and short overall survival. The treatment of patients with CLL has improved significantly with the development of chemoimmunotherapy, but this benefit was not pronounced in patients with 17p deletion. We compare various treatment strategies used in these patients, including FCR-like chemoimmunotherapy, alemtuzumab, other antibody combinations, or novel targeted therapies with promising results. Allogeneic stem cell transplantation offers the possibility for long-term disease control in these patients and should be considered early in younger, transplant-eligible patients. The current state of therapy is far from optimal and resources should be applied to studying therapeutic options for patients who have CLL with loss of p53 function.

A dynamic P53-MDM2 model with time delay

Energy Technology Data Exchange (ETDEWEB)

Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

2006-11-15

Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

A dynamic P53-MDM2 model with time delay

International Nuclear Information System (INIS)

Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

2006-01-01

Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

Tumor suppressor p53 biology, its role in radioresponse and the analysis of p53 mutation/expression among Filipino breast cancers

International Nuclear Information System (INIS)

Deocaris, Custer C.

2004-01-01

Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death

Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

Directory of Open Access Journals (Sweden)

Kristina Kirschner

2015-03-01

Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

Clinical comparison of overlapping deletions of 19p13.3.

Science.gov (United States)

Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A

2013-05-01

We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.

Unmasking of a hemizygous WFS1 gene mutation by a chromosome 4p deletion of 8.3 Mb in a patient with Wolf-Hirschhorn syndrome.

Science.gov (United States)

Flipsen-ten Berg, Klara; van Hasselt, Peter M; Eleveld, Marc J; van der Wijst, Suzanne E; Hol, Frans A; de Vroede, Monique A M; Beemer, Frits A; Hochstenbach, P F Ron; Poot, Martin

2007-11-01

The Wolf-Hirschhorn syndrome (WHS (MIM 194190)), which is characterized by growth delay, mental retardation, epilepsy, facial dysmorphisms, and midline fusion defects, shows extensive phenotypic variability. Several of the proposed mutational and epigenetic mechanisms in this and other chromosomal deletion syndromes fail to explain the observed phenotypic variability. To explain the complex phenotype of a patient with WHS and features reminiscent of Wolfram syndrome (WFS (MIM 222300)), we performed extensive clinical evaluation and classical and molecular cytogenetic (GTG banding, FISH and array-CGH) and WFS1 gene mutation analyses. We detected an 8.3 Mb terminal deletion and an adjacent 2.6 Mb inverted duplication in the short arm of chromosome 4, which encompasses a gene associated with WFS (WFS1). In addition, a nonsense mutation in exon 8 of the WFS1 gene was found on the structurally normal chromosome 4. The combination of the 4p deletion with the WFS1 point mutation explains the complex phenotype presented by our patient. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletions represents an additional explanation for the phenotypic variability observed in chromosomal deletion disorders.

Phylogenetic analysis of human Tp53 gene using computational ...

African Journals Online (AJOL)

The TP53 gene encoding p53 protein is involved in regulating a series of pathways. New discoveries about the function and control of p53 are still in progress and it is hoped to develop better therapeutics and diagnostics by exploiting this system. Evolutionary studies are of prime importance in the field of biological ...

Activities of wildtype and mutant p53 in suppression of homologous recombination as measured by a retroviral vector system

International Nuclear Information System (INIS)

Lu Xiongbin; Lozano, Guillermina; Donehower, Lawrence A.

2003-01-01

DNA repair of double strand breaks, interstrand DNA cross-links, and other types of DNA damage utilizes the processes of homologous recombination and non-homologous end joining to repair the damage. Aberrant homologous recombination is likely to be responsible for a significant fraction of chromosomal deletions, duplications, and translocations that are observed in cancer cells. To facilitate measurement of homologous recombination frequencies in normal cells, mutant cells, and cancer cells, we have developed a high titer retroviral vector containing tandem repeats of mutant versions of a GFP-Zeocin resistance fusion gene and an intact neomycin resistance marker. Recombination between the tandem repeats regenerates a functional GFP-Zeo R marker that can be easily scored. This retroviral vector was used to assess homologous recombination frequencies in human cancer cells and rodent fibroblasts with differing dosages of wild type or mutant p53. Absence of wild type p53 stimulated spontaneous and ionizing radiation-induced homologous recombination, confirming previous studies. Moreover, p53 +/- mouse fibroblasts show elevated levels of homologous recombination compared to their p53 +/+ counterparts following retroviral vector infection, indicating that p53 is haploinsufficient for suppression of homologous recombination. Transfection of vector-containing p53 null Saos-2 cells with various human cancer-associated p53 mutants revealed that these altered p53 proteins retain some recombination suppression function despite being totally inactive for transcriptional transactivation. The retroviral vector utilized in these studies may be useful in performing recombination assays on a wide array of cell types, including those not readily transfected by normal vectors

Characterization of five partial deletions of the factor VIII gene

International Nuclear Information System (INIS)

Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.

1987-01-01

Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes

Tp53 gene mediates distinct dopaminergic neuronal damage in different dopaminergic neurotoxicant models

Directory of Open Access Journals (Sweden)

Tao Lu

2017-01-01

Full Text Available Tp53, a stress response gene, is involved in diverse cell death pathways and its activation is implicated in the pathogenesis of Parkinson's disease. However, whether the neuronal Tp53 protein plays a direct role in regulating dopaminergic (DA neuronal cell death or neuronal terminal damage in different neurotoxicant models is unknown. In our recent studies, in contrast to the global inhibition of Tp53 function by pharmacological inhibitors and in traditional Tp53 knock-out mice, we examined the effects of DA-specific Tp53 gene deletion after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and methamphetamine exposure. Our data suggests that the Tp53 gene might be involved in both neuronal apoptosis and neuronal terminal damage caused by different neurotoxicants. Additional results from other studies also suggest that as a master regulator of many pathways that regulate apoptosis and synaptic terminal damage, it is possible that Tp53 may function as a signaling hub to integrate different signaling pathways to mediate distinctive target pathways. Tp53 protein as a signaling hub might be able to evaluate the microenvironment of neurons, assess the forms and severities of injury incurred, and determine whether apoptotic cell death or neuronal terminal degeneration occurs. Identification of the precise mechanisms activated in distinct neuronal damage caused by different forms and severities of injuries might allow for development of specific Tp53 inhibitors or ways to modulate distinct downstream target pathways involved.