WorldWideScience

Sample records for p53 binding site

  1. Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

    Directory of Open Access Journals (Sweden)

    Monica M Horvath

    2007-07-01

    Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

  2. Impact of Alu repeats on the evolution of human p53 binding sites

    Directory of Open Access Journals (Sweden)

    Sirotin Michael V

    2011-01-01

    Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu

  3. Two sequence motifs from HIF-1α bind to the DNA-binding site of p53

    OpenAIRE

    Hansson, Lars O.; Friedler, Assaf; Freund, Stefan; Rüdiger, Stefan; Fersht, Alan R.

    2002-01-01

    There is evidence that hypoxia-inducible factor-1α (HIF-1α) interacts with the tumor suppressor p53. To characterize the putative interaction, we mapped the binding of the core domain of p53 (p53c) to an array of immobilized HIF-1α-derived peptides and found two peptide-sequence motifs that bound to p53c with micromolar affinity in solution. One sequence was adjacent to and the other coincided with the two proline residues of the oxygen-dependent degradation domain (P402 and P564) that act as...

  4. Interactions of Chromatin Context, Binding Site Sequence Content, and Sequence Evolution in Stress-Induced p53 Occupancy and Transactivation

    OpenAIRE

    Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.

    2015-01-01

    Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...

  5. R248Q mutation--Beyond p53-DNA binding.

    Science.gov (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  6. Modeling of arylamide helix mimetics in the p53 peptide binding site of hDM2 suggests parallel and anti-parallel conformations are both stable.

    Directory of Open Access Journals (Sweden)

    Jonathan C Fuller

    Full Text Available The design of novel α-helix mimetic inhibitors of protein-protein interactions is of interest to pharmaceuticals and chemical genetics researchers as these inhibitors provide a chemical scaffold presenting side chains in the same geometry as an α-helix. This conformational arrangement allows the design of high affinity inhibitors mimicking known peptide sequences binding specific protein substrates. We show that GAFF and AutoDock potentials do not properly capture the conformational preferences of α-helix mimetics based on arylamide oligomers and identify alternate parameters matching solution NMR data and suitable for molecular dynamics simulation of arylamide compounds. Results from both docking and molecular dynamics simulations are consistent with the arylamides binding in the p53 peptide binding pocket. Simulations of arylamides in the p53 binding pocket of hDM2 are consistent with binding, exhibiting similar structural dynamics in the pocket as simulations of known hDM2 binders Nutlin-2 and a benzodiazepinedione compound. Arylamide conformations converge towards the same region of the binding pocket on the 20 ns time scale, and most, though not all dihedrals in the binding pocket are well sampled on this timescale. We show that there are two putative classes of binding modes for arylamide compounds supported equally by the modeling evidence. In the first, the arylamide compound lies parallel to the observed p53 helix. In the second class, not previously identified or proposed, the arylamide compound lies anti-parallel to the p53 helix.

  7. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul

    2001-01-01

    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  8. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    Energy Technology Data Exchange (ETDEWEB)

    Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.

    2011-12-15

    We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.

  9. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    Science.gov (United States)

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    Science.gov (United States)

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  12. Preferential binding of p53 tumor suppressor to p21 promoter sites that contain inverted repeats capable of forming cruciform structure

    Czech Academy of Sciences Publication Activity Database

    Coufal, Jan; Jagelská, Eva; Liao, J.C.C.; Brázda, Václav

    2013-01-01

    Roč. 441, č. 1 (2013), s. 83-85 ISSN 0006-291X R&D Projects: GA ČR(CZ) GAP301/11/2076; GA ČR(CZ) GBP206/12/G151 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DNA-BINDING * SUPERCOILED DNA * EXPRESSION Subject RIV: BO - Biophysics Impact factor: 2.281, year: 2013

  13. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

    Directory of Open Access Journals (Sweden)

    Asita Elengoe

    2015-01-01

    Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

  14. Nuclear localization signal of ING4 plays a key role in its binding to p53

    International Nuclear Information System (INIS)

    Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang

    2005-01-01

    ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53

  15. Isolation and identification of the human homolog of a new p53-binding protein, Mdmx

    NARCIS (Netherlands)

    Shvarts, A.; Bazuine, M.; Dekker, P.; Ramos, Y. F.; Steegenga, W. T.; Merckx, G.; van Ham, R. C.; van der Houven van Oordt, W.; van der Eb, A. J.; Jochemsen, A. G.

    1997-01-01

    We recently reported the identification of a mouse cDNA encoding a new p53-associating protein that we called Mdmx because of its structural similarity to Mdm2, a well-known p53-binding protein. Here we report the isolation of a cDNA encoding the human homolog of Mdmx. The ORF of the cDNA encodes a

  16. Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

    International Nuclear Information System (INIS)

    Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.

    1996-01-01

    ataxia-telangiectasia (A-T) cells. In parallel with the 3-fold increase in levels of p53 seen following IR in FC and FS cells, oligonucleotide binding increased greater than 20-fold in FC cells, and showed only a 3-fold increase in FS cells. Oligonucleotide binding by p53 is currently being measured in A-T cells. Conclusions: The sequence-specific binding of p53 is enhanced in response to ionizing radiation damage, above and beyond changes in the level of p53 protein. The scid gene product (p350, catalytic sub-unit of the DNA-dependent protein kinase, DNA-PK) appears to regulate the post translational modification of p53, presumably by phosphorylation. Confirmation of differences in phosphorylation between normal cells and scid cells is awaited, as are attempts to map the site of post-translational modification resulting in enhanced sequence-specific DNA binding

  17. Mapping the structural and dynamical features of multiple p53 DNA binding domains: insights into loop 1 intrinsic dynamics.

    Directory of Open Access Journals (Sweden)

    Suryani Lukman

    Full Text Available The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD. In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs. Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3. Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart. Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1 a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2 possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site.

  18. New ELISA technique for analysis of p53 protein/DNA binding properties

    Czech Academy of Sciences Publication Activity Database

    Jagelská, Eva; Brázda, Václav; Pospíšilová, Š.; Vojtěšek, B.; Paleček, Emil

    2002-01-01

    Roč. 267, č. 2 (2002), s. 227-235 ISSN 0022-1759 R&D Projects: GA ČR GA301/00/D001; GA AV ČR IAB5004203; GA ČR GA301/00/P094; GA ČR GA301/02/0831; GA MZd NC6404; GA MZd NC5343; GA AV ČR IAA4004110 Institutional research plan: CEZ:AV0Z5004920 Keywords : ELISA * p53 * DNA-binding Subject RIV: BO - Biophysics Impact factor: 2.598, year: 2002

  19. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding.

    Science.gov (United States)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  20. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

    Science.gov (United States)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  1. Prediction of P53 mutants (multiple sites transcriptional activity based on structural (2D&3D properties.

    Directory of Open Access Journals (Sweden)

    R Geetha Ramani

    Full Text Available Prediction of secondary site mutations that reinstate mutated p53 to normalcy has been the focus of intense research in the recent past owing to the fact that p53 mutants have been implicated in more than half of all human cancers and restoration of p53 causes tumor regression. However laboratory investigations are more often laborious and resource intensive but computational techniques could well surmount these drawbacks. In view of this, we formulated a novel approach utilizing computational techniques to predict the transcriptional activity of multiple site (one-site to five-site p53 mutants. The optimal MCC obtained by the proposed approach on prediction of one-site, two-site, three-site, four-site and five-site mutants were 0.775,0.341,0.784,0.916 and 0.655 respectively, the highest reported thus far in literature. We have also demonstrated that 2D and 3D features generate higher prediction accuracy of p53 activity and our findings revealed the optimal results for prediction of p53 status, reported till date. We believe detection of the secondary site mutations that suppress tumor growth may facilitate better understanding of the relationship between p53 structure and function and further knowledge on the molecular mechanisms and biological activity of p53, a targeted source for cancer therapy. We expect that our prediction methods and reported results may provide useful insights on p53 functional mechanisms and generate more avenues for utilizing computational techniques in biological data analysis.

  2. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    International Nuclear Information System (INIS)

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A.

    2006-01-01

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection

  3. Skp2B overexpression alters a prohibitin-p53 axis and the transcription of PAPP-A, the protease of insulin-like growth factor binding protein 4.

    Directory of Open Access Journals (Sweden)

    Harish Chander

    Full Text Available We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established.We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured.These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.

  4. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, A.; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, M.L.; Subramaniam, V.; Babkova, Z.; Martínek, T.; Lexa, M.; Adámik, Matěj

    2016-01-01

    Roč. 11, č. 12 (2016), č. článku e0167439. E-ISSN 1932-6203 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP204/06/P369; GA ČR GA15-02891S Institutional support: RVO:68081707 Keywords : c-terminal domain * suppressor protein p53 * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 2.806, year: 2016

  5. Using electrophoretic mobility shift assays to measure equilibrium dissociation constants: GAL4-p53 binding DNA as a model system.

    Science.gov (United States)

    Heffler, Michael A; Walters, Ryan D; Kugel, Jennifer F

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K(D) ) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel; the DNA migrates more slowly when bound to a protein. To determine a K(D) the amount of unbound and protein-bound DNA in the gel is measured as the protein concentration increases. By performing this experiment, students will be introduced to making affinity measurements and gain experience in performing quantitative EMSAs. The experiment describes measuring the K(D) for the interaction between the chimeric protein GAL4-p53 and its DNA recognition site; however, the techniques are adaptable to other DNA binding proteins. In addition, the basic experiment described can be easily expanded to include additional inquiry-driven experimentation. © 2012 by The International Union of Biochemistry and Molecular Biology. Copyright © 2012 Wiley Periodicals, Inc.

  6. Mechanism of DNA–binding loss upon single-point mutation in p53

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    loss in protein−DNA binding affinity and specificity upon single point ..... we computed the root–mean–square–deviations (RMSDs) of each residue's ...... Petsko G and Ringe D 1984 Fluctuations in protein structure from. X-ray diffraction; Annu.

  7. Molecular screening of compounds to the predicted Protein-Protein Interaction site of Rb1-E7 with p53- E6 in HPV

    Science.gov (United States)

    Shaikh, Faraz; Sanehi, Parvish; Rawal, Rakesh

    2012-01-01

    Cervical cancer is malignant neoplasm of the cervix uteri or cervical area. Human Papillomaviruses (HPVs) which are heterogeneous groups of small double stranded DNA viruses are considered as the primary cause of cervical cancer, involved in 90% of all Cervical Cancers. Two early HPV genes, E6 and E7, are known to play crucial role in tumor formation. E6 binds with p53 and prevents its translocation and thereby inhibit the ability of p53 to activate or repress target genes. E7 binds to hypophosphorylated Rb and thereby induces cells to enter into premature S-phase by disrupting Rb-E2F complexes. The strategy of the research work was to target the site of interaction of Rb1 -E7 & p53-E6. A total of 88 compounds were selected for molecular screening, based on comprehensive literature survey for natural compounds with anti-cancer activity. Molecular docking analysis was carried out with Molegro Virtual Docker, to screen the 88 chosen compounds and rank them according to their binding affinity towards the site of interaction of the viral oncoproteins and human tumor suppressor proteins. The docking result revealed that Nicandrenone a member of Withanolides family of chemical compounds as the most likely molecule that can be used as a candidate drug against HPV induced cervical cancer. Abbreviations HPV - Human Papiloma Virus, HTSP - Human Tumor Suppressor Proteins, VOP - Viral oncoproteins. PMID:22829740

  8. Binding of mutant and wild type p53 proteins to supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Pivoňková, Hana; Walter, K.; Warnecke, Gabriele; Živanovic, Marko; Krstic, Dušan; Paleček, Emil; Deppert, W.; Fojta, Miroslav

    2005-01-01

    Roč. 3, č. 1 (2005), S4-S5 ISSN 1214-021X. [Cells VI - Biological Days /18./. 24.10.2005-26.10.2005, České Budějovice] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GA301/05/0416 Institutional research plan: CEZ:AV0Z50040507 Keywords : wtp53 * hot spot mutp53 * SCS binding Subject RIV: BO - Biophysics

  9. p53 DNA结合域与抗癌多肽的拉伸分子动力学研究%Steered Molecular Dynamics of an Anticancer Peptide Interacting With The p53 DNA-binding Domain

    Institute of Scientific and Technical Information of China (English)

    许先进; 苏计国; 陈慰祖; 王存新; CANNISTRARO Salvatore; BIZZARRI Anna-Rita

    2014-01-01

    The p28 peptide,derived from the blue copper protein azurin,is known to enhance the anticancer capabilities of the tumor suppressor p53 likely binding to its DNA-binding domain (DBD).The p28-p53 DBD complex has been investigated by steered molecular dynamics in order to characterize the unbinding process at atomic resolution.We found that the unbinding of the complex follows a candidate pathway with a well-defined detaching sequence between the partners.The analysis of the unbinding force and the calculation of the irreversible work done along several unbinding paths have allowed us to extract information on the energy landscape regulating the unbinding process.%研究发现,取自蓝铜蛋白azur的一段多肽p28能够进入癌细胞,结合到肿瘤抑制因子p53的DNA结合域上,进而增加p53的抗癌能力.本工作中,通过拉伸分子动力学方法,在原子尺度上研究了p28-p53 DBD复合物的解离过程.分析结果显示复合物的解离过程遵循着一定的分离顺序.对解离力的分析以及对沿着解离路径的不可逆做功的计算,使我们能够从复合物的能量地貌中提取有用的信息,而这些信息也决定了复合物的解离过程.

  10. p53 binding protein 1 foci as a biomarker of DNA double strand breaks induced by ionizing radiation

    International Nuclear Information System (INIS)

    Ng, C.K.M.; Wong, M.Y.P.; Lam, R.K.K.; Ho, J.P.Y.; Chiu, S.K.; Yu, K.N.

    2011-01-01

    Foci of p53 binding protein 1 (53 BP1) have been used as a biomarker of DNA double-strand breaks (DSBs) in cells induced by ionizing radiations. 53 BP1 was shown to relocalize into foci shortly after irradiation, with the number of foci closely paralleling the number of DNA DSBs. However, consensus on criteria in terms of the numbers of 53 BP1 foci to define cells damaged by direct irradiation or by bystander signals has not been reached, which is partly due to the presence of 53 BP1 also in normal cells. The objective of the present work was to study the changes in the distribution of cells with different numbers of 53 BP1 foci in a cell population after low-dose ionizing irradiation (<0.1 Gy) provided by alpha particles, with a view to propose feasible criteria for defining cells damaged by direct irradiation or by bystander signals. It was proposed that the change in the percentage of cells with 1-3 foci should be used for such purposes. The underlying reasons were discussed.

  11. Isolation and characterization of DUSP11, a novel p53 target gene

    DEFF Research Database (Denmark)

    Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

    2009-01-01

    target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

  12. Missense mutations located in structural p53 DNA-binding motifs are associated with extremely poor survival in chronic lymphocytic leukemia.

    Science.gov (United States)

    Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri

    2011-07-01

    There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.

  13. High throughput testing of the SV40 Large T antigen binding to cellular p53 identifies putative drugs for the treatment of SV40-related cancers

    International Nuclear Information System (INIS)

    Carbone, Michele; Rudzinski, Jennifer; Bocchetta, Maurizio

    2003-01-01

    SV40 has been linked to some human malignancies, and the evidence that this virus plays a causative role in mesothelioma and brain tumors is mounting. The major SV40 oncoprotein is the Large tumor antigen (Tag). A key Tag transforming activity is connected to its capability to bind and inactivate cellular p53. In this study we developed an effective, high throughput, ELISA-based method to study Tag-p53 interaction in vitro. This assay allowed us to screen a chemical library and to identify a chemical inhibitor of the Tag binding to p53. We propose that our in vitro assay is a useful method to identify molecules that may be used as therapeutic agents for the treatment of SV40-related human cancers

  14. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  15. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  16. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  18. Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, M.; Hrstka, R.; Pečinka, Petr; Adámik, Matěj; Vojtěšek, B.; Paleček, Emil; Deppert, W.; Fojta, Miroslav

    2013-01-01

    Roč. 8, č. 3 (2013), e59567 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP301/10/2370; GA ČR GA13-36108S; GA ČR(CZ) GP204/06/P369; GA ČR(CZ) GA204/08/1560; GA ČR(CZ) GAP301/11/2055; GA MŠk(CZ) 1K04119 Grant - others:GA ČR(CZ) GAP301/11/1678 Institutional research plan: CEZ:AV0Z50040702 Keywords : TUMOR-SUPPRESSOR P53 * C-TERMINAL DOMAIN * OF-FUNCTION MUTATIONS Subject RIV: BO - Biophysics Impact factor: 3.534, year: 2013

  19. A Unique Mdm2-Binding Mode of the 3-Pyrrolin-2-one- and 2-Furanone-Based Antagonists of the p53-Mdm2 Interaction

    NARCIS (Netherlands)

    Surmiak, Ewa; Twarda-Clapa, Aleksandra; Zak, Krzysztof M.; Musielak, Bogdan; Tomala, Marcin D.; Kubica, Katarzyna; Grudnik, Przemyslaw; Madej, Mariusz; Jablonski, Mateusz; Potempa, Jan; Kalinowska-Tluscik, Justyna; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.

    2016-01-01

    The p53 pathway is inactivated in almost all types of cancer by mutations in the p53 encoding gene or overexpression of the p53 negative regulators, Mdm2 and/or Mdmx. Restoration of the p53 function by inhibition of the p53-Mdm2/Mdmx interaction opens up a prospect for a nongenotoxic anticancer

  20. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G

    2013-01-01

    Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches

  2. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  3. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  4. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4

  5. Regulation of p53 tetramerization and nuclear export by ARC.

    Science.gov (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

    2007-12-26

    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  6. Translocation of p53 to Mitochondria Is Regulated by Its Lipid Binding Property to Anionic Phospholipids and It Participates in Cell Death Control

    Directory of Open Access Journals (Sweden)

    Ching-Hao Li

    2010-02-01

    Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.

  7. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  8. Ensemble-based computational approach discriminates functional activity of p53 cancer and rescue mutants.

    Directory of Open Access Journals (Sweden)

    Özlem Demir

    2011-10-01

    Full Text Available The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain ("cancer mutants". Activity can be restored by second-site suppressor mutations ("rescue mutants". This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD, without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC metric was strongly correlated (r(2 = 0.77 with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i p53 cancer mutants were more flexible than wild-type protein, (ii second-site rescue mutations decreased the flexibility of cancer mutants, and (iii negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants.

  9. B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

    International Nuclear Information System (INIS)

    Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong

    2011-01-01

    The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.

  10. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  11. Characterization of highly frequent epitope-specific CD45RA+/CCR7+/- T lymphocyte responses against p53-binding domains of the human polyomavirus BK large tumor antigen in HLA-A*0201+ BKV-seropositive donors

    Directory of Open Access Journals (Sweden)

    Zajac Paul

    2006-11-01

    Full Text Available Abstract Human polyomavirus BK (BKV has been implicated in oncogenic transformation. Its ability to replicate is determined by the binding of its large tumor antigen (LTag to products of tumor-suppressor genes regulating cell cycle, as specifically p53. We investigated CD8+ T immune responses to BKV LTag portions involved in p53 binding in HLA-A*0201+ BKV LTag experienced individuals. Peptides selected from either p53-binding region (LTag351–450 and LTag533–626 by current algorithms and capacity to bind HLA-A*0201 molecule were used to stimulate CD8+ T responses, as assessed by IFN-γ gene expression ex vivo and detected by cytotoxicity assays following in vitro culture. We observed epitope-specific immune responses in all HLA-A*0201+ BKV LTag experienced individuals tested. At least one epitope, LTag579–587; LLLIWFRPV, was naturally processed in non professional antigen presenting cells and induced cytotoxic responses with CTL precursor frequencies in the order of 1/20'000. Antigen specific CD8+ T cells were only detectable in the CD45RA+ subset, in both CCR7+ and CCR7- subpopulations. These data indicate that widespread cellular immune responses against epitopes within BKV LTag-p53 binding regions exist and question their roles in immunosurveillance against tumors possibly associated with BKV infection.

  12. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  13. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    Science.gov (United States)

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  14. Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Tan, Yu-Hong [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Shaw, Gary [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Zhou, Zheng; Bai, Yawen [Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 (United States); Luo, Ray [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Ji, Xinhua, E-mail: jix@ncifcrf.gov [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States)

    2008-05-01

    The impact of hotspot mutation R282Q on the structure of human p53 DNA-binding domain has been characterized by X-ray crystallography and molecular-dynamics simulations. Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53.

  15. Low p53 Binding Protein 1 (53BP1) Expression Is Associated With Increased Local Recurrence in Breast Cancer Patients Treated With Breast-Conserving Surgery and Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Neboori, Hanmanth J.R. [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Haffty, Bruce G., E-mail: hafftybg@umdnj.edu [Department of Radiation Oncology, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Wu Hao [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Yang Qifeng [Department of Breast Surgery, Qilu Hospital, Shandong University, Ji' nan (China); Aly, Amal [Division of Medical Oncology, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Goyal, Sharad; Schiff, Devora [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Moran, Meena S. [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, CT (United States); Golhar, Ryan [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Chen Chunxia; Moore, Dirk [Department of Biostatistics, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); and others

    2012-08-01

    Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log-rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence-free survival (IBRFS), distant metastasis-free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survival (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their clinical

  16. Low p53 Binding Protein 1 (53BP1) Expression Is Associated With Increased Local Recurrence in Breast Cancer Patients Treated With Breast-Conserving Surgery and Radiotherapy

    International Nuclear Information System (INIS)

    Neboori, Hanmanth J.R.; Haffty, Bruce G.; Wu Hao; Yang Qifeng; Aly, Amal; Goyal, Sharad; Schiff, Devora; Moran, Meena S.; Golhar, Ryan; Chen Chunxia; Moore, Dirk

    2012-01-01

    Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log–rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence–free survival (IBRFS), distant metastasis–free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survival (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their

  17. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  18. Mutual interactions between P53 and growth factors in cancer

    NARCIS (Netherlands)

    Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE

    1998-01-01

    The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

  19. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    , other significant changes in the axolotl proteins may play more subtle roles on p53 functions, including DNA binding and promoter specificity and could represent useful adaptations to ensure p53 activity and tumor suppression in animals able to regenerate or subject to large variations in oxygen levels or temperature.

  20. SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

    International Nuclear Information System (INIS)

    Milner, J.; Gamble, J.

    1985-01-01

    The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

  1. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  2. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis

    2000-05-01

    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  3. Lactose binding to human galectin-7 (p53-induced gene 1) induces long-range effects through the protein resulting in increased dimer stability and evidence for positive cooperativity

    Science.gov (United States)

    Ermakova, Elena; Miller, Michelle C; Nesmelova, Irina V; López-Merino, Lara; Berbís, Manuel Alvaro; Nesmelov, Yuri; Tkachev, Yaroslav V; Lagartera, Laura; Daragan, Vladimir A; André, Sabine; Cañada, F Javier; Jiménez-Barbero, Jesús; Solís, Dolores; Gabius, Hans-Joachim; Mayo, Kevin H

    2013-01-01

    The product of p53-induced gene 1 is a member of the galectin family, i.e., galectin-7 (Gal-7). To move beyond structural data by X-ray diffraction, we initiated the study of the lectin by nuclear magnetic resonance (NMR) and circular dichroism spectroscopies, and molecular dynamics (MD) simulations. In concert, our results indicate that lactose binding to human Gal-7 induces long-range effects (minor conformational shifts and changes in structural dynamics) throughout the protein that result in stabilization of the dimer state, with evidence for positive cooperativity. Monte Carlo fits of 15N-Gal-7 HSQC titrations with lactose using a two-site model yield K1 = 0.9 ± 0.6 × 103 M−1 and K2 = 3.4 ± 0.8 × 103 M−1. Ligand binding-induced stabilization of the Gal-7 dimer was supported by several lines of evidence: MD-based calculations of interaction energies between ligand-loaded and ligand-free states, gel filtration data and hetero-FRET spectroscopy that indicate a highly reduced tendency for dimer dissociation in the presence of lactose, CD-based thermal denaturation showing that the transition temperature of the lectin is significantly increased in the presence of lactose, and saturation transfer difference (STD) NMR using a molecular probe of the monomer state whose presence is diminished in the presence of lactose. MD simulations with the half-loaded ligand-bound state also provided insight into how allosteric signaling may occur. Overall, our results reveal long-range effects on Gal-7 structure and dynamics, which factor into entropic contributions to ligand binding and allow further comparisons with other members of the galectin family. PMID:23376190

  4. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    Science.gov (United States)

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  5. The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle.

    Science.gov (United States)

    1996-08-01

    that my statement of work (SOW) for the current project omitted many of the tasks that had to be carried out in order to get the lab up and running...that we knew that we could stabilize wild-type p53 in ML-1 cells along with the possibility of being able to get an excellent elutriation profile with...nuclear protein extract was immunoprecipitated with PAb421 cross-linked to ProteinA -Sepharose beads and analysed by SDS-PAGE Western blot analysis with

  6. The E7 protein of the cottontail rabbit papillomavirus immortalizes normal rabbit keratinocytes and reduces pRb levels, while E6 cooperates in immortalization but neither degrades p53 nor binds E6AP

    International Nuclear Information System (INIS)

    Ganzenmueller, Tina; Matthaei, Markus; Muench, Peter; Scheible, Michael; Iftner, Angelika; Hiller, Thomas; Leiprecht, Natalie; Probst, Sonja; Stubenrauch, Frank; Iftner, Thomas

    2008-01-01

    Human papillomaviruses (HPVs) cause cervical cancer and are associated with the development of non-melanoma skin cancer. A suitable animal model for papillomavirus-associated skin carcinogenesis is the infection of domestic rabbits with the cottontail rabbit papillomavirus (CRPV). As the immortalizing activity of CRPV genes in the natural target cells remains unknown, we investigated the properties of CRPV E6 and E7 in rabbit keratinocytes (RK) and their influence on the cell cycle. Interestingly, CRPV E7 immortalized RK after a cellular crisis but showed no such activity in human keratinocytes. Co-expressed CRPV E6 prevented cellular crisis. The HPV16 or CRPV E7 protein reduced rabbit pRb levels thereby causing rabbit p19 ARF induction and accumulation of p53 without affecting cellular proliferation. Both CRPV E6 proteins failed to degrade rabbit p53 in vitro or to bind E6AP; however, p53 was still inducible by mitomycin C. In summary, CRPV E7 immortalizes rabbit keratinocytes in a species-specific manner and E6 contributes to immortalization without directly affecting p53

  7. Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

    Science.gov (United States)

    Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

    2017-10-01

    In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

  8. Translational Control Protein 80 Stimulates IRES-Mediated Translation of p53 mRNA in Response to DNA Damage

    Directory of Open Access Journals (Sweden)

    Marie-Jo Halaby

    2015-01-01

    Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.

  9. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    Science.gov (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  10. p53-Dependent and -Independent Epithelial Integrity: Beyond miRNAs and Metabolic Fluctuations

    Directory of Open Access Journals (Sweden)

    Tsukasa Oikawa

    2018-05-01

    Full Text Available In addition to its classical roles as a tumor suppressor, p53 has also been shown to act as a guardian of epithelial integrity by inducing the microRNAs that target transcriptional factors driving epithelial–mesenchymal transition. On the other hand, the ENCODE project demonstrated an enrichment of putative motifs for the binding of p53 in epithelial-specific enhancers, such as CDH1 (encoding E-cadherin enhancers although its biological significance remained unknown. Recently, we identified two novel modes of epithelial integrity (i.e., maintenance of CDH1 expression: one involves the binding of p53 to a CDH1 enhancer region and the other does not. In the former, the binding of p53 is necessary to maintain permissive histone modifications around the CDH1 transcription start site, whereas in the latter, p53 does not bind to this region nor affect histone modifications. Furthermore, these mechanisms likely coexisted within the same tissue. Thus, the mechanisms involved in epithelial integrity appear to be much more complex than previously thought. In this review, we describe our findings, which may instigate further experimental scrutiny towards understanding the whole picture of epithelial integrity as well as the related complex asymmetrical functions of p53. Such understanding will be important not only for cancer biology but also for the safety of regenerative medicine.

  11. Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

    Directory of Open Access Journals (Sweden)

    Carlos Farkas

    Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

  12. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    Science.gov (United States)

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  13. Phosphorylation Regulates the Bound Structure of an Intrinsically Disordered Protein: The p53-TAZ2 Case.

    Directory of Open Access Journals (Sweden)

    Raúl Esteban Ithuralde

    Full Text Available Disordered regions and Intrinsically Disordered Proteins (IDPs are involved in critical cellular processes and may acquire a stable three-dimensional structure only upon binding to their partners. IDPs may follow a folding-after-binding process, known as induced folding, or a folding-before-binding process, known as conformational selection. The transcription factor p53 is involved in the regulation of cellular events that arise upon stress or DNA damage. The p53 domain structure is composed of an N-terminal transactivation domain (p53TAD, a DNA Binding Domain and a tetramerization domain. The activity of TAD is tightly regulated by interactions with cofactors, inhibitors and phosphorylation. To initiate transcription, p53TAD binds to the TAZ2 domain of CBP, a co-transcription factor, and undergoes a folding and binding process, as revealed by the recent NMR structure of the complex. The activity of p53 is regulated by phosphorylation at multiple sites on the TAD domain and recent studies have shown that modifications at three residues affect the binding towards TAZ2. However, we still do not know how these phosphorylations affect the structure of the bound state and, therefore, how they regulate the p53 function. In this work, we have used computational simulations to understand how phosphorylation affects the structure of the p53TAD:TAZ2 complex and regulates the recognition mechanism. Phosphorylation has been proposed to enhance binding by direct interaction with the folded protein or by changing the unbound conformation of IDPs, for example by pre-folding the protein favoring the recognition mechanism. Here, we show an interesting turn in the p53 case: phosphorylation mainly affects the bound structure of p53TAD, highlighting the complexity of IDP protein-protein interactions. Our results are in agreement with previous experimental studies, allowing a clear picture of how p53 is regulated by phosphorylation and giving new insights into how

  14. Transformation and radiosensitivity of human diploid skin fibroblasts transfected with SV40 T-antigen mutants defective in RB and P53 binding domains

    International Nuclear Information System (INIS)

    LingNah Su; Little, J.B.

    1992-01-01

    A series of human diploid fibroblast cell clones were developed by DNA transfection with either wild-type SV40 T-antigen (SV40T) or T-antigen mutants defective in its various functional domains. Cell clones expressing the wild-type SV40 T were significantly radioresistant as compared with clones transfected with the neo gene only (D o 192 ± 13 vs 127 ± 19). This radioresistance persisted in post-crisis, immortalized cell lines. A series of mutants with point or deletion mutations within each functionally active domain of SV40 T were also examined for their ability to alter radiosensitivity and induce morphological transformation. Cell clones transfected with T-antigen mutants defective in nuclear localization or origin binding showed increased radioresistance similar to clones transfected with wild-type T-antigen, and expressed morphological changes characteristic of SV40 T-transfected cells. (author)

  15. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    Science.gov (United States)

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  16. A synthetic interaction screen identifies factors selectively required for proliferation and TERT transcription in p53-deficient human cancer cells.

    Directory of Open Access Journals (Sweden)

    Li Xie

    Full Text Available Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi-based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53- human cancer cells. We find that compared to p53-competent (p53+ human cancer cell lines, diverse p53- human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53- cells, RNAi-mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53- but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53- cancer cells.

  17. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  18. A central role for CK1 in catalysing phosphorylation of the P53 transactivation domain at serine 20 after HHV-6B viral infection

    DEFF Research Database (Denmark)

    Maclaine, NJ; Øster, Bodil; Bundgaard, Bettina

    2008-01-01

    The tumour suppressor protein p53 is activated by distinct cellular stresses including radiation, hypoxia, type-I interferon, and DNA/RNA virus infection. The transactivation domain of p53 contains a phosphorylation site at serine 20 (Ser20) whose modification stabilises the binding of the transc...... was not blocked by D4476. These data highlight a central role for CK1 as the Ser20-site kinase for p53 in DNA virus-infected cells, but also suggest that distinct stresses may selectively trigger different protein kinases to modify the transactivation domain of p53 at Ser20....

  19. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  20. Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

    Directory of Open Access Journals (Sweden)

    Ravshan Burikhanov

    2014-01-01

    Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

  1. HEXIM1, a New Player in the p53 Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)

    2013-07-04

    Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

  2. The nucleolus directly regulates p53 export and degradation.

    Science.gov (United States)

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  3. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  4. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Manujendra N Saha

    Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

  5. A negative regulation loop of long noncoding RNA HOTAIR and p53 in non-small-cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zhai N

    2016-09-01

    Full Text Available Nailiang Zhai,1 Yongfu Xia,1 Rui Yin,2 Jinping Liu,3 Fuquan Gao1 1Department of Respiratory Medicine, Affiliated Hospital of Binzhou Medical University, 2Department of Respiratory Medicine, People’s Hospital of Binzhou City, 3Department of Pharmacology, Binzhou Medical University, Binzhou, Shandong, People’s Republic of China Abstract: Non-small-cell lung cancer (NSCLC is one of the leading causes of cancer-related death worldwide, and the 5-year survival rate is still low despite advances in diagnosis and therapeutics. A long noncoding RNA (lncRNA HOX antisense intergenic RNA (HOTAIR has been revealed to play important roles in NSCLC carcinogenesis but the detailed mechanisms are still unclear. In the current study, we aimed to investigate the regulation between the lncRNA HOTAIR and p53 in the NSCLC patient samples and cell lines. Our results showed that HOTAIR expression was significantly higher in the cancer tissues than that in the adjacent normal tissue, and was negatively correlated with p53 functionality rather than expression. When p53 was overexpressed in A549 cells, the lncRNA HOTAIR expression was downregulated, and the cell proliferation rate and cell invasion capacity decreased as a consequence. We identified two binding sites of p53 on the promoter region of HOTAIR, where the p53 protein would bind to and suppress the HOTAIR mRNA transcription. Inversely, overexpression of lncRNA HOTAIR inhibited the expression of p53 in A549 cells. Mechanistic studies revealed that HOTAIR modified the promoter of p53 and enhanced histone H3 lysine 27 trimethylation (H3K27me3. These studies identified a specific negative regulation loop of lncRNA HOTAIR and p53 in NSCLC cells, which revealed a new understanding of tumorigenesis in p53 dysfunction NSCLC cells. Keywords: NSCLC, LncRNA HOTAIR, p53, negative loop

  6. Conformational detection of p53's oligomeric state by FlAsH Fluorescence

    OpenAIRE

    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

    2009-01-01

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...

  7. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  8. p53 mutations promote proteasomal activity.

    Science.gov (United States)

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  9. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    Science.gov (United States)

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  10. Polymorphism at codon 36 of the p53 gene.

    Science.gov (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  11. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

    2006-11-15

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  12. A dynamic P53-MDM2 model with time delay

    International Nuclear Information System (INIS)

    Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

    2006-01-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

  13. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  14. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

    Science.gov (United States)

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-10-29

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

  15. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  16. The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

    Science.gov (United States)

    Noda, Takeshi

    2011-12-01

    I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. p53 and the pathogenesis of skin cancer

    International Nuclear Information System (INIS)

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-01-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

  18. Identification and characterization of small molecule inhibitors of the calcium-dependent S100B-p53 tumor suppressor interaction.

    Science.gov (United States)

    Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J

    2004-10-07

    The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).

  19. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  20. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  1. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  2. A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

    International Nuclear Information System (INIS)

    Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

    2011-01-01

    eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

  3. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

    1993-01-01

    textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

  4. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

    1993-01-01

    The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

  5. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  6. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Renee

    2001-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...

  7. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Rene

    2002-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...

  8. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  9. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-01-01

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  10. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  11. p53 in differentiation of thyroid cancer

    International Nuclear Information System (INIS)

    Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

    1993-01-01

    P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

  12. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    Science.gov (United States)

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  13. A dual role of p53 in the control of autophagy.

    Science.gov (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  14. The expanding regulatory universe of p53 in gastrointestinal cancer.

    Science.gov (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  15. Hormonal control of p53 and chemoprevention

    International Nuclear Information System (INIS)

    Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C

    2002-01-01

    Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

  16. P53 Gene Mutagenesis in Breast Cancer

    National Research Council Canada - National Science Library

    Sommer, Steve S

    2005-01-01

    .... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

  17. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats

    2004-01-01

    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  18. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

    2001-01-01

    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  20. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  1. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    Science.gov (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  2. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    Science.gov (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  3. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    Science.gov (United States)

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  4. Molecular dynamics simulation of S100B protein to explore ligand blockage of the interaction with p53 protein

    Science.gov (United States)

    Zhou, Zhigang; Li, Yumin

    2009-10-01

    As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.

  5. Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

    Science.gov (United States)

    Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

    2018-05-31

    The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Structural Basis of Competitive Recognition of p53 and MDM2 by HAUSP/USP7: Implications for the Regulation of the p53-MDM2 Pathway.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.

  7. Regulation of Metabolic Activity by p53

    Directory of Open Access Journals (Sweden)

    Jessica Flöter

    2017-05-01

    Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

  8. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    International Nuclear Information System (INIS)

    Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

    2011-01-01

    Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

  9. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    Energy Technology Data Exchange (ETDEWEB)

    Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

  10. Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

    Science.gov (United States)

    Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

    2009-06-19

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

  11. Ets-2 and p53 mediate cAMP-induced MMP-2 expression, activity and trophoblast invasion

    Directory of Open Access Journals (Sweden)

    Goldman Shlomit

    2009-11-01

    Full Text Available Abstract Background We have previously shown that Matrix metalloproteinase (MMP -2 is a key-enzyme in early trophoblast invasion and that Protein Kinase A (PKA increases MMP-2 expression and trophoblast invasion. The aim of this study was to examine MMP -2 regulation by PKA in invasive trophoblasts: JAR choriocarcinoma cell-line and 6-8 w first trimester trophoblasts. Methods The effect of Forskolin (PKA on MMP-2 expression was assessed by Northern Blot and RT-PCR. Possible transcription factors binding to consensus MMP-2 promoter sequences in response to Forskolin, were detected by EMSA binding assay and their expression assessed by western blot analysis. Antisense transfection of relevant transcription factors was performed and the inhibitory effect assessed on MMP-2 expression (RT-PCR, secretion (zymography and trophoblast invasiveness (transwell migration assay. Results We found that Forskolin increased MMP-2 mRNA in JAR cells within 24 hours, and induced binding to p53, Ets, C/EBP and AP-2. Transcription factors Ets-2, phospho- p53, C/EBP epsilon, C/EBP lambda and AP-2 alpha bound to their respective binding sequences in response to Forskolin and the expressions of these transcription factors were all elevated in Forskolin- treated cells. Inhibition of Ets-2 and p53 reduced MMP-2 expression, secretion and invasiveness of Forskolin treated cells. Conclusion MMP-2 is regulated by PKA through several binding sites and transcription factors including Ets-2, p53, C/EBP, C/EBP lambda and AP-2 alpha. Ets-2 and p53 mediate cAMP- induced trophoblast invasiveness, through regulation of MMP-2.

  12. Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73

    Directory of Open Access Journals (Sweden)

    Lu Xin

    2009-06-01

    Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.

  13. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  14. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  15. P53 overexpression and outcome of radiation therapy in head and neck cancers

    International Nuclear Information System (INIS)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae

    1999-01-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers

  16. P53 overexpression and outcome of radiation therapy in head and neck cancers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)

    1999-03-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.

  17. miR-34 and p53: New Insights into a Complex Functional Relationship.

    Directory of Open Access Journals (Sweden)

    Francisco Navarro

    Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

  18. hSSB1 regulates both the stability and the transcriptional activity of p53

    OpenAIRE

    Xu, Shuangbing; Wu, Yuanzhong; Chen, Qiong; Cao, Jingying; Hu, Kaishun; Tang, Jianjun; Sang, Yi; Lai, Fenju; Wang, Li; Zhang, Ruhua; Li, Sheng-Ping; Zeng, Yi-Xin; Yin, Yuxin; Kang, Tiebang

    2012-01-01

    The tumor suppressor p53 is essential for several cellular processes that are involved in the response to diverse genotoxic stress, including cell cycle arrest, DNA repair, apoptosis and senescence. Studies of the regulation of p53 have mostly focused on its stability and transactivation; however, new regulatory molecules for p53 have also been frequently identified. Here, we report that human ssDNA binding protein SSB1 (hSSB1), a novel DNA damage-associated protein, can interact with p53 and...

  19. Structural Fingerprints of Transcription Factor Binding Site Regions

    Directory of Open Access Journals (Sweden)

    Peter Willett

    2009-03-01

    Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.

  20. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson

    2006-07-01

    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  1. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    Science.gov (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  2. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang

    2013-03-01

    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  3. ATR-p53 restricts homologous recombination in response to replicative stress but does not limit DNA interstrand crosslink repair in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Bianca M Sirbu

    Full Text Available Homologous recombination (HR is required for the restart of collapsed DNA replication forks and error-free repair of DNA double-strand breaks (DSB. However, unscheduled or hyperactive HR may lead to genomic instability and promote cancer development. The cellular factors that restrict HR processes in mammalian cells are only beginning to be elucidated. The tumor suppressor p53 has been implicated in the suppression of HR though it has remained unclear why p53, as the guardian of the genome, would impair an error-free repair process. Here, we show for the first time that p53 downregulates foci formation of the RAD51 recombinase in response to replicative stress in H1299 lung cancer cells in a manner that is independent of its role as a transcription factor. We find that this downregulation of HR is not only completely dependent on the binding site of p53 with replication protein A but also the ATR/ATM serine 15 phosphorylation site. Genetic analysis suggests that ATR but not ATM kinase modulates p53's function in HR. The suppression of HR by p53 can be bypassed under experimental conditions that cause DSB either directly or indirectly, in line with p53's role as a guardian of the genome. As a result, transactivation-inactive p53 does not compromise the resistance of H1299 cells to the interstrand crosslinking agent mitomycin C. Altogether, our data support a model in which p53 plays an anti-recombinogenic role in the ATR-dependent mammalian replication checkpoint but does not impair a cell's ability to use HR for the removal of DSB induced by cytotoxic agents.

  4. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  5. Adaptive evolution of transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Berg Johannes

    2004-10-01

    Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.

  6. Thioredoxin binding site of phosphoribulokinase overlaps the catalytic site

    International Nuclear Information System (INIS)

    Porter, M.A.; Hartman, F.C.

    1986-01-01

    The ATP-regulatory binding site of phosphoribulokinase was studied using bromoacetylethanolamine phosphate (BrAcNHEtOP). BrAcNHEtOP binds to the active-regulatory binding site of the protein. Following trypsin degradation of the labeled protein, fragments were separated by HPLC and sequenced. (DT)

  7. Wildtype p53-specific Antibody and T-Cell Responses in Cancer Patients

    DEFF Research Database (Denmark)

    Pedersen, Anders Elm; Stryhn, Anette; Justesen, Sune

    2011-01-01

    patients. Detection of antibodies against wt p53 protein has been used as a diagnostic and prognostic marker and discovery of new T-cell epitopes has enabled design of cancer vaccination protocols with promising results. Here, we identified wt p53-specific antibodies in various cancer patients......(264-272) in breast cancer patients and against HLA-A*01:01 binding peptide wt p53(226-234) and HLA-B*07:02 binding peptide wt p53(74-82) in renal cell cancer and breast cancer patients, respectively. Finally, we analyzed antibody and T-cell responses against wt p53 15-mer peptides in patients with metastatic renal...

  8. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  9. Mutant p53 interactions with supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Činčárová, Lenka; Šebest, Peter; Pivoňková, Hana; Brázda, Václav; Fojta, Miroslav; Paleček, Emil

    2007-01-01

    Roč. 24, č. 6 (2007), s. 639-640 ISSN 0739-1102. [Alban 2007: The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GP204/06/P369; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : mutant p53 * supercoiled DNA * cancer Subject RIV: BO - Biophysics

  10. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

    Science.gov (United States)

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

    2017-10-15

    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

  11. Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression

    Directory of Open Access Journals (Sweden)

    Shang-Jui Wang

    2016-10-01

    Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.

  12. Bitopic Ligands and Metastable Binding Sites

    DEFF Research Database (Denmark)

    Fronik, Philipp; Gaiser, Birgit I; Sejer Pedersen, Daniel

    2017-01-01

    of orthosteric binding sites. Bitopic ligands have been employed to address the selectivity problem by combining (linking) an orthosteric ligand with an allosteric modulator, theoretically leading to high-affinity subtype selective ligands. However, it remains a challenge to identify suitable allosteric binding...... that have been reported to date, this type of bitopic ligands would be composed of two identical pharmacophores. Herein, we outline the concept of bitopic ligands, review metastable binding sites, and discuss their potential as a new source of allosteric binding sites....

  13. P53 suppresses expression of the 14-3-3gamma oncogene

    Directory of Open Access Journals (Sweden)

    Qi Wenqing

    2011-08-01

    Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.

  14. [3]tetrahydrotrazodone binding. Association with serotonin binding sites

    International Nuclear Information System (INIS)

    Kendall, D.A.; Taylor, D.P.; Enna, S.J.

    1983-01-01

    High (17 nM) and low (603 nM) affinity binding sites for [ 3 ]tetrahydrotrazodone ([ 3 ] THT), a biologically active analogue of trazodone, have been identified in rat brain membranes. The substrate specificity, concentration, and subcellular and regional distributions of these sites suggest that they may represent a component of the serotonin transmitter system. Pharmacological analysis of [ 3 ]THT binding, coupled with brain lesion and drug treatment experiments, revealed that, unlike other antidepressants, [ 3 ] THT does not attach to either a biogenic amine transporter or serotonin binding sites. Rather, it would appear that [ 3 ]THT may be an antagonist ligand for the serotonin binding site. This probe may prove of value in defining the mechanism of action of trazodone and in further characterizing serotonin receptors

  15. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    Science.gov (United States)

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  16. LIBRA: LIgand Binding site Recognition Application.

    Science.gov (United States)

    Hung, Le Viet; Caprari, Silvia; Bizai, Massimiliano; Toti, Daniele; Polticelli, Fabio

    2015-12-15

    In recent years, structural genomics and ab initio molecular modeling activities are leading to the availability of a large number of structural models of proteins whose biochemical function is not known. The aim of this study was the development of a novel software tool that, given a protein's structural model, predicts the presence and identity of active sites and/or ligand binding sites. The algorithm implemented by ligand binding site recognition application (LIBRA) is based on a graph theory approach to find the largest subset of similar residues between an input protein and a collection of known functional sites. The algorithm makes use of two predefined databases for active sites and ligand binding sites, respectively, derived from the Catalytic Site Atlas and the Protein Data Bank. Tests indicate that LIBRA is able to identify the correct binding/active site in 90% of the cases analyzed, 90% of which feature the identified site as ranking first. As far as ligand binding site recognition is concerned, LIBRA outperforms other structure-based ligand binding sites detection tools with which it has been compared. The application, developed in Java SE 7 with a Swing GUI embedding a JMol applet, can be run on any OS equipped with a suitable Java Virtual Machine (JVM), and is available at the following URL: http://www.computationalbiology.it/software/LIBRAv1.zip. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. CD40-mediated apoptosis in murine B-lymphoma lines containing mutated p53

    DEFF Research Database (Denmark)

    Hollmann, Annette C; Gong, Qiaoke; Owens, Trevor

    2002-01-01

    Crosslinking CD40 induces normal B-cells to proliferate and differentiate but causes many tumor cell lines to undergo apoptosis. As p53 is required for many apoptotic pathways, we analyzed the effects of CD40 ligation and their correlation with p53 function in four murine B-lymphoma lines. A20...... of detectable p21 mRNA in A20 and M12 cells. P21 mRNA was increased to detectable levels in M12 cells upon CD40 ligation; however, blocking this effect with the p53 inhibitor pifithrin had no effect on CD40-mediated apoptosis. Sequencing showed that p53 in A20 and M12 cells contained point mutations leading...... to amino acid substitutions in DNA binding regions, but was unmutated in WEHI231 and WEHI 279. These results suggest that CD40-mediated apoptosis can occur in the absence of functional p53....

  18. The PRR11-SKA2 Bidirectional Transcription Unit Is Negatively Regulated by p53 through NF-Y in Lung Cancer Cells

    Directory of Open Access Journals (Sweden)

    Yitao Wang

    2017-03-01

    Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.

  19. The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.

    Science.gov (United States)

    Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang

    2017-05-01

    This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.

  20. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    Science.gov (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  1. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  2. Recent progress of the study of p53 control mechanism by ionizing radiation

    International Nuclear Information System (INIS)

    Kawai, Hidehiko

    2004-01-01

    Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)

  3. Pax3 stimulates p53 ubiquitination and degradation independent of transcription.

    Directory of Open Access Journals (Sweden)

    Xiao Dan Wang

    Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.

  4. Mutations in p53, p53 protein overexpression and breast cancer survival

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

    2009-01-01

    Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

  5. Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

    DEFF Research Database (Denmark)

    Savelyeva, I.; Dobbelstein, M.

    2011-01-01

    to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

  6. Molecular mechanism of X-ray-induced p53-dependent apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

    1999-03-01

    Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

  7. p53 Activation following Rift Valley fever virus infection contributes to cell death and viral production.

    Directory of Open Access Journals (Sweden)

    Dana Austin

    Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.

  8. FATS is a transcriptional target of p53 and associated with antitumor activity

    Directory of Open Access Journals (Sweden)

    Zhang Xifeng

    2010-09-01

    Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.

  9. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  10. p53 specific (auto)immunity in mice

    NARCIS (Netherlands)

    Lauwen, Marjolein Monique

    2008-01-01

    Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T

  11. Restriction of human herpesvirus 6B replication by p53

    DEFF Research Database (Denmark)

    Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina

    2008-01-01

    Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...

  12. The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

    Directory of Open Access Journals (Sweden)

    Jennifer M. Smith

    2007-12-01

    Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

  13. Interaction of an anticancer peptide fragment of azurin with p53 and its isolated domains studied by atomic force spectroscopy.

    Science.gov (United States)

    Bizzarri, Anna Rita; Santini, Simona; Coppari, Emilia; Bucciantini, Monica; Di Agostino, Silvia; Yamada, Tohru; Beattie, Craig W; Cannistraro, Salvatore

    2011-01-01

    p28 is a 28-amino acid peptide fragment of the cupredoxin azurin derived from Pseudomonas aeruginosa that preferentially penetrates cancerous cells and arrests their proliferation in vitro and in vivo. Its antitumor activity reportedly arises from post-translational stabilization of the tumor suppressor p53 normally downregulated by the binding of several ubiquitin ligases. This would require p28 to specifically bind to p53 to inhibit specific ligases from initiating proteosome-mediated degradation. In this study, atomic force spectroscopy, a nanotechnological approach, was used to investigate the interaction of p28 with full-length p53 and its isolated domains at the single molecule level. Analysis of the unbinding forces and the dissociation rate constant suggest that p28 forms a stable complex with the DNA-binding domain of p53, inhibiting the binding of ubiquitin ligases other than Mdm2 to reduce proteasomal degradation of p53.

  14. Diet, Helicobacter pylori, and p53 mutations in gastric cancer: a molecular epidemiology study in Italy.

    Science.gov (United States)

    Palli, D; Caporaso, N E; Shiao, Y H; Saieva, C; Amorosi, A; Masala, G; Rice, J M; Fraumeni, J F

    1997-12-01

    A series of 105 gastric cancer (GC) cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. Overall, 33 of 105 cases had a mutation (p53+) identified by single-strand conformational polymorphism and confirmed by sequencing (Y-H. Shiao et al., submitted for publication). p53+ cases had a more traditional dietary pattern (i.e., corn meal mush, meat soup, and other homemade dishes) and reported less frequent consumption of raw vegetables (particularly lettuce and raw carrots). A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. In addition, p53+ cases tended to be located in the upper portion of the stomach and to be associated with advanced age and blood group A. No relation was found between the presence of p53 mutations and histologically defined Helicobacter pylori infection, smoking history, family history of gastric cancer, education, and social class. Of the 33 p53+ cases, 19 had G:C-->A:T transitions at CpG sites. These tumors tended to occur in females and in association with H. pylori infection but not other risk factors. The remaining 14 cases with a p53 mutation had mainly transversions but also two deletions and two transitions at non-CpG sites. These tumors showed a strong positive association with a traditional dietary pattern and with the estimated intake of selected nutrients (nitrite, protein, and fat, particularly from animal sources). The findings of this case-case analysis suggest that p53 mutations at non-CpG sites are related to exposure to alkylating compounds from diet, whereas p53 mutations at CpG sites might be related to H. pylori infection.

  15. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

    International Nuclear Information System (INIS)

    Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira

    2007-01-01

    p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain

  16. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

    2003-01-01

    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  17. A novel radiation-induced p53 mutation is not implicated in radiation resistance via a dominant-negative effect.

    Directory of Open Access Journals (Sweden)

    Yunguang Sun

    Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.

  18. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    NARCIS (Netherlands)

    Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,

  19. p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors

    NARCIS (Netherlands)

    Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't

    1999-01-01

    Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this

  20. Characterization of enzymatic properties of human ribonucleotide reductase holoenzyme reconstituted in vitro from hRRM1, hRRM2, and p53R2 subunits.

    Science.gov (United States)

    Qiu, Weihua; Zhou, Bingsen; Darwish, Dana; Shao, Jimin; Yen, Yun

    2006-02-10

    Ribonucleotide reductase (RR) is a highly regulated enzyme in the deoxyribonucleotide synthesis pathway. RR is responsible for the de novo conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates, which are essential for DNA synthesis and repair. Besides two subunits, hRRM1 and hRRM2, p53R2 is a newly identified member of RR family that is induced by ultraviolet light in a p53-dependent manner. To understand the molecular interaction of RR subunits, we employed a eukaryotic expression system to express and purify all three subunits. After in vitro reconstitution, the results of [(3)H]CDP reduction assay showed that both eukaryotic recombinant hRRM2 and p53R2 proteins could interact with hRRM1 to form functional RR holoenzyme. The reconstituted RR activity was time-dependent and the reaction rate reached the plateau phase after 40min incubation. No matter the concentration, RR holoenzyme reconstituted from p53R2 and hRRM1 could only achieve about 40-75% kinetic activity of that from hRRM2 and hRRM1. The synthetic C-terminal heptapeptide competition assays confirmed that hRRM2 and p53R2 share the same binding site on hRRM1, but the binding site on hRRM1 demonstrated higher affinity for hRRM2 than for p53R2. In allosteric regulation assay, the effect of activation or inhibition of hRRM1 with ATP or dATP suggested that these effectors could regulate RR activity independent of different RR small subunits. Taken together, the eukaryotic expression system RR holoenzyme will provide a very useful tool to understand the molecular mechanisms of RR activity and the interactions of its subunits.

  1. Chemical Variations on the p53 Reactivation Theme

    Directory of Open Access Journals (Sweden)

    Carlos J. A. Ribeiro

    2016-05-01

    Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

  2. Immunohistochemical analysis of P53 protein in odontogenic cysts

    Science.gov (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  3. Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients.

    Science.gov (United States)

    Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; De Lena, M; Allegra, C J; Johnston, P G

    2000-02-01

    The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated-5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53- cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively; P < 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P < 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34-1.01; two-sided P < 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85-1.26; two-sided P < 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy.

  4. Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.

    Science.gov (United States)

    Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles

    2006-10-16

    The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.

  5. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  6. Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

    International Nuclear Information System (INIS)

    An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee

    2011-01-01

    Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.

  7. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  8. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  9. Targeting the p53 Pathway in Ewing Sarcoma

    Science.gov (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  10. A Novel In Vitro CypD-Mediated p53 Aggregation Assay Suggests a Model for Mitochondrial Permeability Transition by Chaperone Systems.

    Science.gov (United States)

    Lebedev, Ivan; Nemajerova, Alice; Foda, Zachariah H; Kornaj, Maja; Tong, Michael; Moll, Ute M; Seeliger, Markus A

    2016-10-09

    Tissue necrosis as a consequence of ischemia-reperfusion injury and oxidative damage is a leading cause of permanent disability and death worldwide. The complete mechanism by which cells undergo necrosis upon oxidative stress is not understood. In response to an oxidative insult, wild-type p53 has been implicated as a central regulatory component of the mitochondrial permeability transition (mPT), triggering necrosis. This process is associated with cellular stabilization and translocation of p53 into the mitochondrial matrix. Here, we probe the mechanism by which p53 activates the key mPT regulator cyclophilin D (CypD). We explore the involvement of Trap1, an Hsp90-related mitochondrial matrix protein and a member of the mitochondrial unfolded protein response, and its ability to suppress mPT in a p53-dependent manner. Our study finds that catalytically active CypD causes strong aggregation of wild-type p53 protein (both full-length and isolated DNA-binding domain) into amyloid-type fibrils in vitro. The responsible CypD residues for this activity were mapped by NMR to the active site amino acids R55, F60, F113, and W121. The data also present a new proline isomerization assay for CypD by monitoring the aggregation of p53 as an indicator of CypD activity. Moreover, we find that the inhibition of Trap1 by the mitochondria-specific HSP90 ATPase antagonist Gamitrinib strongly sensitizes primary mouse embryonic fibroblasts to mPT and permeability transition pore opening in a p53- and CypD-dependent manner. We propose a mechanism by which the influx of unfolded p53 into the mitochondrial matrix in response to oxidative stress indirectly activates the normally inhibited CypD by displacing it from Trap1 complexes. This activates CypD's isomerase activity. Liberated CypD then isomerizes multiple proteins including p53 (causing p53 aggregation) and the structural components of the mPTP pore, inducing pore opening. This working model can now be tested in the future

  11. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  12. Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

    Science.gov (United States)

    Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

    2010-12-01

    Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

  13. Analysis of p53- immunoreactivity in astrocytic brain tumors

    Directory of Open Access Journals (Sweden)

    Shinkarenko T.V.

    2016-12-01

    Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

  14. Bladder-like graphical representation of p53 gene alterations in some human cancers

    International Nuclear Information System (INIS)

    Helal, N.L.; Dorrah, M.; LI, C.

    2005-01-01

    the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

  15. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

    2005-01-01

    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  16. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  17. Targeting p53 by small molecules in hematological malignancies

    OpenAIRE

    Saha, Manujendra N; Qiu, Lugui; Chang, Hong

    2013-01-01

    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...

  18. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2017-06-01

    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  19. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  20. Cytotoxic T-lymphocyte clones, established by stimulation with the HLA-A2 binding p5365-73 wild type peptide loaded on dendritic cells In vitro, specifically recognize and lyse HLA-A2 tumour cells overexpressing the p53 protein

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Petersen, T R; Kirkin, A F

    2000-01-01

    of recognizing p53 derived wild type (self) peptides. Furthermore, the capacity of R9V specific T cell clones to exert HLA restricted cytotoxicity, argues that the R9V peptide is naturally presented on certain cancer cells. This supports the view that p53 derived wild type peptides might serve as candidate......Mutations in the tumour suppressor gene p53 are among the most frequent genetic alterations in human malignancies, often associated with an accumulation of the p53 protein in the cytoplasm. We have generated a number of cytotoxic T lymphocyte (CTL) clones that specifically recognize the HLA-A*0201...

  1. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    Directory of Open Access Journals (Sweden)

    Bruno Pagano

    Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  2. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    International Nuclear Information System (INIS)

    Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.

    2009-01-01

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.

  3. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  4. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2010-08-01

    Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  5. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  6. Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.

    Science.gov (United States)

    Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko

    2017-11-30

    Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.

  7. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  8. Exploring a minimal two-component p53 model

    International Nuclear Information System (INIS)

    Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei

    2010-01-01

    The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

  9. p53 downregulates the Fanconi anaemia DNA repair pathway.

    Science.gov (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  10. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-01-01

    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  11. Chronology of p53 protein accumulation in gastric carcinogenesis

    NARCIS (Netherlands)

    Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1995-01-01

    p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early

  12. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  13. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  14. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  15. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    Science.gov (United States)

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  16. Molecular analysis of p53 and K-ras in lung carcinomas of coal miners

    Energy Technology Data Exchange (ETDEWEB)

    Sarkar, F.H.; Li, Y.W.; Vallyathan, V. [Wayne State University, Detroit, MI (United States). School of Medicine, Dept. of Pathology

    2001-10-01

    Thirty-three cases of non-small cell lung cancers (NSCLC) from the archives of National Coal Workers' Autopsy Study were studied for mutational alterations in p53 and K-ras using PCR-SSCP, DNA sequencing and PCR-oligonucleotide probe hybridization techniques. Mutations of the p53 were observed in 4 smokers (19%) and one in a never smoker (8%). Two polymorphisms in smokers were detected at codon 213, a common site for sequence variation. Among the smokers the p53 mutations were in the heavy smokers. In never smokers there was only a single p53 mutation and two K-ras mutations. In never smokers the frequency of K-ras mutations was similar (17%) in smokers, but one never smoker had two K-ras mutations. Mutations of p53 were more frequent in adenocarcinomas (27%) and they were AT-GC transitions. There were two large cell undifferentiated carcinomas with p53 mutation and one with a K-ras mutation. Two of the 16 squamous cell carcinomas were positive for p53 mutation, while no K-ras mutations were found in this group. The results of these preliminary studies indicate a moderately different mutational spectrum of p53 and K-ras in coal miners independent of cigarette smoking. The mutational spectrum observed in this study of coal miners with heavy cigarette smoking history suggest a protective effect of coal mine dust in preventing abnormal mutations induced by chemical carcinogens in cigarette smoke or reactive oxygen species.

  17. Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

    Science.gov (United States)

    Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

    2014-01-01

    The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

  18. Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.

    Science.gov (United States)

    Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei

    2013-07-01

    Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.

  19. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia

    2001-01-01

    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  20. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2012-02-01

    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  1. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

    2011-01-01

    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  2. Robustness of the p53 network and biological hackers.

    Science.gov (United States)

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  3. Molecular basis of Bcl-X(L-p53 interaction: insights from molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Nagakumar Bharatham

    Full Text Available Bcl-X(L, an antiapoptotic Bcl-2 family protein, plays a central role in the regulation of the apoptotic pathway. Heterodimerization of the antiapoptotic Bcl-2 family proteins with the proapoptotic family members such as Bad, Bak, Bim and Bid is a crucial step in the apoptotic regulation. In addition to these conventional binding partners, recent evidences reveal that the Bcl-2 family proteins also interact with noncanonical binding partners such as p53. Our previous NMR studies showed that Bcl-X(L: BH3 peptide and Bcl-X(L: SN15 peptide (a peptide derived from residues S15-N29 of p53 complex structures share similar modes of bindings. To further elucidate the molecular basis of the interactions, here we have employed molecular dynamics simulations coupled with MM/PBSA approach. Bcl-X(L and other Bcl-2 family proteins have 4 hydrophobic pockets (p1-p4, which are occupied by four systematically spaced hydrophobic residues (h1-h4 of the proapoptotic Bad and Bak BH3 peptides. We observed that three conserved hydrophobic residues (F19, W23 and L26 of p53 (SN15 peptide anchor into three hydrophobic pockets (p2-p4 of Bcl-X(L in a similar manner as BH3 peptide. Our results provide insights into the novel molecular recognition by Bcl-X(L with p53.

  4. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    Science.gov (United States)

    Vadrot, Nathalie; Ghanem, Sarita; Braut, Françoise; Gavrilescu, Laura; Pilard, Nathalie; Mansouri, Abdellah; Moreau, Richard; Reyl-Desmars, Florence

    2012-01-01

    During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α) targets hepatocytes and induces abnormal reactive oxygen species (ROS) production responsible for mitochondrial DNA (mtDNA) alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β) plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR) we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC) was used to measure the rapid (10 min) and transient TNF-α induced increase in ROS production (168±15%). A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM). In addition, mitochondrial D-loop immunoprecipitation (mtDIP) revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15)p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  5. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    Directory of Open Access Journals (Sweden)

    Nathalie Vadrot

    Full Text Available During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α targets hepatocytes and induces abnormal reactive oxygen species (ROS production responsible for mitochondrial DNA (mtDNA alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC was used to measure the rapid (10 min and transient TNF-α induced increase in ROS production (168±15%. A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM. In addition, mitochondrial D-loop immunoprecipitation (mtDIP revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  6. Human herpesvirus 6B induces phosphorylation of p53 in its regulatory domain by a CK2- and p38-independent pathway

    DEFF Research Database (Denmark)

    Øster, Bodil; Bundgaard, B; Hupp, T R

    2008-01-01

    Here, we demonstrate that human herpesvirus 6B (HHV-6B) infection upregulates the tumour suppressor p53 and induces phosphorylation of p53 at Ser392. Interestingly, phosphorylation at the equivalent site has previously been shown to correlate with p53 tumour suppression in murine models. Although...

  7. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  8. Comparing the mechanical influence of vinculin, focal adhesion kinase and p53 in mouse embryonic fibroblasts

    International Nuclear Information System (INIS)

    Klemm, Anna H.; Diez, Gerold; Alonso, Jose-Luis; Goldmann, Wolfgang H.

    2009-01-01

    Cytoskeletal reorganization is an ongoing process when cells adhere, move or invade extracellular substrates. The cellular force generation and transmission are determined by the intactness of the actomyosin-(focal adhesion complex)-integrin connection. We investigated the intracellular course of action in mouse embryonic fibroblasts deficient in the focal adhesion proteins vinculin and focal adhesion kinase (FAK) and the nuclear matrix protein p53 using magnetic tweezer and nanoparticle tracking techniques. Results show that the lack of these proteins decrease cellular stiffness and affect cell rheological behavior. The decrease in cellular binding strength was higher in FAK- to vinculin-deficient cells, whilst p53-deficient cells showed no effect compared to wildtype cells. The intracellular cytoskeletal activity was lowest in wildtype cells, but increased in the following order when cells lacked FAK+p53 > p53 > vinculin. In summary, cell mechanical processes are differently affected by the focal adhesion proteins vinculin and FAK than by the nuclear matrix protein, p53.

  9. Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation

    International Nuclear Information System (INIS)

    Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY

    1996-01-01

    Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)

  10. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    Science.gov (United States)

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  11. Family matters: sibling rivalry and bonding between p53 and p63 in cancer.

    Science.gov (United States)

    Romano, Rose-Anne; Sinha, Satrajit

    2014-04-01

    The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Andrew Fesler

    2016-04-01

    Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  13. Comparison of Transcription Factor Binding Site Models

    KAUST Repository

    Bhuyan, Sharifulislam

    2012-05-01

    Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.

  14. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53.

    Science.gov (United States)

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.

  15. Human glioblastoma multiforme: p53 reactivation by a novel MDM2 inhibitor.

    Directory of Open Access Journals (Sweden)

    Barbara Costa

    Full Text Available Cancer development and chemo-resistance are often due to impaired functioning of the p53 tumor suppressor through genetic mutation or sequestration by other proteins. In glioblastoma multiforme (GBM, p53 availability is frequently reduced because it binds to the Murine Double Minute-2 (MDM2 oncoprotein, which accumulates at high concentrations in tumor cells. The use of MDM2 inhibitors that interfere with the binding of p53 and MDM2 has become a valid approach to inhibit cell growth in a number of cancers; however little is known about the efficacy of these inhibitors in GBM. We report that a new small-molecule inhibitor of MDM2 with a spirooxoindolepyrrolidine core structure, named ISA27, effectively reactivated p53 function and inhibited human GBM cell growth in vitro by inducing cell cycle arrest and apoptosis. In immunoincompetent BALB/c nude mice bearing a human GBM xenograft, the administration of ISA27 in vivo activated p53, inhibited cell proliferation and induced apoptosis in tumor tissue. Significantly, ISA27 was non-toxic in an in vitro normal human cell model and an in vivo mouse model. ISA27 administration in combination with temozolomide (TMZ produced a synergistic inhibitory effect on GBM cell viability in vitro, suggesting the possibility of lowering the dose of TMZ used in the treatment of GBM. In conclusion, our data show that ISA27 releases the powerful antitumor capacities of p53 in GBM cells. The use of this MDM2 inhibitor could become a novel therapy for the treatment of GBM patients.

  16. Somatotropinomas, but not nonfunctioning pituitary adenomas, maintain a functional apoptotic RET/Pit1/ARF/p53 pathway that is blocked by excess GDNF.

    Science.gov (United States)

    Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V

    2014-11-01

    Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in

  17. P53 autoantibodies in 1006 patients followed up for breast cancer

    International Nuclear Information System (INIS)

    Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A

    2000-01-01

    to p53 would reflect tumour behaviour. However, we found that the presence or absence of p53 autoantibodies was not predictive of presence or absence of recurrent disease. There was an equivalent incidence of active disease at the time of sampling in both the autoantibody-negative and autoantibody-positive groups, these being 25.2 and 28.7%, respectively. Thus, humoral immune activity against p53 appeared to be relatively restricted to a subgroup of patients in whom, once an autoantibody response had been generated, antibody was likely to persist regardless of tumour behaviour. Conversely, where no detectable p53 autoantibody was present at the time of primary diagnosis, these patients remained similarly negative for antibody, irrespective of subsequent disease activity (Table 3). In contrast to shed markers that correlate with tumour mass, such as CA15.3 for cancer of the breast, any tumour-related immune response will be subject to complex regulation. Autoantibody responses to p53 will require appropriate primary immunization; initial low-dose antigen exposure may induce immune tolerance and lack of response. Higher antigen doses may activate either antibody-mediated immunity, or cellular immunity. In breast cancer patients, our results suggest that, once an active humoral response against p53 is established, then this remains active. This persistent humoral reaction may be driven by persistent antigenic stimulation by p53 protein derived from overexpression of p53 at distant metastatic sites; alternatively, irradiated normal tissue may be a source of continued antigenic stimulation, because a long-term side effect of radiation therapy is an increased expression of p53 in normal breast tissue that persists for several years [12]. Since the great majority of our total patient cohort had received radiotherapy, humoral immunity to p53 associated with primary disease might persist, even in those patients who enter remission, due to tumour-independent antigenic

  18. A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation

    Directory of Open Access Journals (Sweden)

    Kumar Sonia

    2011-02-01

    Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.

  19. P53 activation, a key event of the cellular response to gamma irradiation; L'activation de la proteine p53, un evenement determinant de la reponse cellulaire aux radiations ionisantes

    Energy Technology Data Exchange (ETDEWEB)

    Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)

    2002-03-01

    The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)

  20. Role of P53 in Mammary Epithelial Cell Senescence

    National Research Council Canada - National Science Library

    Dimri, Goberdhan P

    2006-01-01

    .... We also chose several other targets of p53 that are induced by DNA damage. The RT PCR analysis aws carried out using mRNA prepared from young growing early passage and senescent late passage HMECs...

  1. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  2. Post-translational regulation enables robust p53 regulation.

    Science.gov (United States)

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

    2013-08-30

    The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

  3. Thymocyte apoptosis induced by p53-dependent and independent pathways

    International Nuclear Information System (INIS)

    Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

    1993-01-01

    The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

  4. Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)

    2012-01-13

    Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

  5. Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

    International Nuclear Information System (INIS)

    Yang, Zhihong; Zhang, Yuxia; Wang, Li

    2012-01-01

    Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

  6. Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.

    Science.gov (United States)

    Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun

    2014-07-23

    The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. S-phase checkpoint elements of the E2F-1 family increase radiosensitivity in fibrosarcoma cells lacking p53

    International Nuclear Information System (INIS)

    Bodis, Stephan; Pruschy, Martin; Wirbelauer, Christiane; Glanzmann, Christoph; Krek, Wilhelm

    1997-01-01

    Purpose: Correct advance of cells through the S-phase of the mammalian cell cycle depends on the timely controlled activity of the E2F-1 transcription factor by cyclin A-cdk2. We are studying the reproductive integrity and radiosensitation of isogenic mouse fibrosarcoma cells, differing only in their p53 status, after expression of E2F-1 wildtype (wt) and specific E2F-1 mutants (mt) lacking the cyclin-A-binding domain. In this tumor model system only p53 wild-type expressing tumor cells are sensitive to ionizing radiation in vitro and in vivo. Material and Methods: Either wild-type p53 or genetically engineered p53 'null' mouse embryo fibroblasts were transfected with the oncogenes E1A and ras. These otherwise isogenic fibrosarcoma cells, with a malignant phenotype and tumorigenic in nude mice, were transfected with retroviruses containing either E2F-1 wild-type or specific E2F-1 mutants lacking the cyclin-A binding domain. Reproductive integrity after E2F-1 transfection with or without ionizing radiation (RT) was tested using the clonogenic assay. Tumor cell morphology of treated cells is analyzed for cell death mechanism. Results: E2F-1 wild-type expression in fibrosarcoma cells induced a clear p53 dependent cell death. While clonogenic survival of p53 'null' tumor cells was only slightly reduced with the expression of E2F-1 wild type (survival fraction of 0.5), the clonogenic survival of p53 wild-type fibrosarcoma tumor cells was reduced by at least one logarithm (survival fraction of 0.05). However, expression of the specific E2F-1 mutant lacking the cyclin-A binding domain reduced clonogenic survival in both the p53 'null' and the p53 wild-type fibrosarcoma cells by at least 2 logarithms (survival fraction 0.01 for p53 'null' and 0.002 for p53 wild-type). The mean values of the survival fractions after 2 and 5 Gy radiation alone in p53 'null' fibrosarcoma cells (SF 2 and SF 5) were SF 2 0.7, SF 5 = 0.15, respectively. The combination of ionizing RT in the p53

  8.  Immunohistochemical Expression of ki-67 and p53 in Colorectal Adenomas: A Clinicopathological Study

    Directory of Open Access Journals (Sweden)

    Hussam Hasson Ali

    2011-07-01

    Full Text Available  Objectives: To evaluate the significance of P53 and Ki-67 expression as immunohistochemical markers in early detection of premalignant changes in different types of colorectal adenomas. Also, to correlate immunohistochemical expression of the two markers with different clinicopathological parameters including; age, and sex of the patient, type, site, size and grade of dysplasia of colorectal adenomas.Methods: Forty-seven polypectomy specimens of colorectal adenomas were retrieved from the archival materials of the Gastrointestinal and Hepatic Diseases Teaching Hospital in Baghdad from 2009 - 2010. Four µm section specimens were stained by immunohistochemical technique with Ki-67 and P53 tumor markers. P-values <0.05 were considered statistically significant.Results: Immunohistochemical expressions of Ki-67 and P53 had a significant correlation with the size and grade of dysplasia in colorectal adenomas. However, there was no significant correlation among the immunohistochemical expression of Ki-67 and P53 with the age and gender of the patient, and the type and site of colorectal adenomas. There was no significant correlation between Ki-67 and P53 expressions in colorectal adenomas. Villous adenomas of colorectum showed a significant correlation with the grade of dysplasia, while there was no significant correlation between size and site of colorectal adenoma with the grade of dysplasia.Conclusion: High grade dysplasia with significant positive immunohistochemical markers of Ki-67 and P53 could be valuable parameters for selecting from the total colorectal adenoma population, those most deserving of close surveillance in follow-up cancer prevention programs. It is closely linked with increasing age particularly in patients with a large size adenoma of villous component in their histology.

  9. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    Science.gov (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  10. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

    Science.gov (United States)

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-07-19

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

  11. Autoradiographic localization of benzomorphan binding sites in rat brain

    Energy Technology Data Exchange (ETDEWEB)

    Crain, B.J.; Kwenjen Chang; McNamara, J.O.; Valdes, F.

    1985-07-17

    The benzomorphan subpopulation of opiate binding sites was labeled by (TH)diprenorphine in the presence of unlabeled ligands selected to quench and delta opiate binding sites. The distribution of benzomorphan binding sites was then localized autoradiographically. The distribution differs from the distributions of , delta and kappa opiate binding and is quite similar to the distribution of US -endorphin immunoreactivity. These observations support the hypothesis, based on biochemical studies in brain membranes, that benzomorphan binding sites may represent the ligand recognition sites of putative epsilon receptors. (Auth.). 34 refs.; 3 figs.

  12. Rheumatoid arthritis and p53: how oxidative stress might alter the course of inflammatory diseases

    NARCIS (Netherlands)

    Tak, P. P.; Zvaifler, N. J.; Green, D. R.; Firestein, G. S.

    2000-01-01

    Oxidative stress at sites of chronic inflammation can cause permanent genetic changes. The development of mutations in the p53 tumor suppressor gene and other key regulatory genes could help convert inflammation into chronic disease in rheumatoid arthritis and other inflammatory disorders

  13. System-based strategies for p53 recovery.

    Science.gov (United States)

    Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

    2018-06-01

    The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

  14. Simplified approaches for the development of an ELISA to detect circulating autoantibodies to p53 in cancer patients

    Directory of Open Access Journals (Sweden)

    Tayapiwatana Chatchai

    2008-02-01

    Full Text Available Abstract Background The recognition that human tumors stimulate the production of autoantibodies has initiated the use of this immune response as serological markers for the early diagnosis and management of cancer. The enzyme-linked immunosorbent assay (ELISA is the most common method used in detecting autoantibodies, which involves coating the microtiter plate with the tumor associated antigen (TAA of interest and allowing serum antibodies to bind. The patient's sample is directly in contact with the coating antigen so the protein used for coating must be pure to avoid non-specific binding. In this study, a simplified method to selectively and specifically immobilize TAAs onto microtiter plates in order to detect circulating autoantibodies in cancer patients without prior purification process was described. Wild type full-length p53 protein was produced in fusion with biotin carboxyl carrier peptide (BCCP or hexahistidine [(His6] using pAK400 and pET15b(+ vectors, respectively. The recombinant p53 fusion protein produced was then subjected to react with either a commercial p53 monoclonal antibody (mAb or sera from lung cancer patients and healthy volunteers in an enzyme-linked immunosorbent assay (ELISA format. Results Both of the immobilized p53 fusion proteins as well as the purified (His6-p53 fusion protein had a similar dose response of detection to a commercial p53 mAb (DO7. When the biotinylated p53-BCCP fusion protein was used as an antigen to detect p53 autoantibodies in clinical samples, the result showed that human serum reacted strongly to avidin-coated microwell even in the absence of the biotinylated p53-BCCP fusion protein, thus compromised its ability to differentiate weakly positive sera from those that were negative. In contrast, the (His6-p53 protein immobilized directly onto Ni+ coated microplate was able to identify the p53 autoantibody positive serum. In addition, its reactivity to clinical serum samples highly correlated

  15. Characterisation of the p53-mediated cellular responses evoked in primary mouse cells following exposure to ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Gillian D McFeat

    Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.

  16. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    Science.gov (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  17. Detection of secondary binding sites in proteins using fragment screening.

    Science.gov (United States)

    Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren

    2015-12-29

    Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.

  18. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  19. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  20. p53-Mediated Molecular Control of Autophagy in Tumor Cells

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic

    2018-03-01

    Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.

  1. Tumor hypoxia, p53, and prognosis in cervical cancers

    International Nuclear Information System (INIS)

    Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen

    2001-01-01

    Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p

  2. Super p53 for Treatment of Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14

  3. Electrochemical sensing of tumor suppressor protein p53-deoxyribonucleic acid complex stability at an electrified interface

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil; Černocká, Hana; Ostatná, Veronika; Navrátilová, Lucie; Brázdová, Marie

    2014-01-01

    Roč. 828, MAY2014 (2014), s. 1-8 ISSN 0003-2670 R&D Projects: GA ČR(CZ) GAP301/11/2055; GA ČR(CZ) GA13-00956S; GA ČR(CZ) GA13-36108S Institutional support: RVO:68081707 Keywords : Deoxyribonucleic acid-protein binding * Tumor suppressor protein p53 * Electrochemical sensing Subject RIV: BO - Biophysics Impact factor: 4.513, year: 2014

  4. Harnessing the p53-PUMA Axis to Overcome DNA Damage Resistance in Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Xiaoguang Zhou

    2014-12-01

    Full Text Available Resistance to DNA damage–induced apoptosis is a hallmark of cancer and a major cause of treatment failure and lethal disease outcome. A tumor entity that is largely resistant to DNA-damaging therapies including chemo- or radiotherapy is renal cell carcinoma (RCC. This study was designed to explore the underlying molecular mechanisms of DNA damage resistance in RCC to develop strategies to resensitize tumor cells to DNA damage–induced apoptosis. Here, we show that apoptosis-resistant RCC cells have a disconnect between activation of p53 and upregulation of the downstream proapoptotic protein p53 upregulated modulator of apoptosis (PUMA. We demonstrate that this disconnect is not caused by gene-specific repression through CCCTC-binding factor (CTCF but instead by aberrant chromatin compaction. Treatment with an HDAC inhibitor was found to effectively reactivate PUMA expression on the mRNA and protein level and to revert resistance to DNA damage–induced cell death. Ectopic expression of PUMA was found to resensitize a panel of RCC cell lines to four different DNA-damaging agents tested. Remarkably, all RCC cell lines analyzed were wild-type for p53, and a knockdown was likewise able to sensitize RCC cells to acute genotoxic stress. Taken together, our results indicate that DNA damage resistance in RCC is reversible, involves the p53-PUMA axis, and is potentially targetable to improve the oncological outcomes of RCC patients.

  5. Involvement of hGLD-2 in cytoplasmic polyadenylation of human p53 mRNA

    DEFF Research Database (Denmark)

    Glahder, Jacob-Andreas Harald; Norrild, Bodil

    2011-01-01

    Cytoplasmic polyadenylation is a post-transcriptional mechanism regulating mRNA stability and translation. The human p53 3'-untranslated region (3'-UTR) contains two regions similar to cytoplasmic polyadenylation elements (CPEs) just upstream of the poly(A) hexanucleotide. Evaluation of the p53 CPE......-like elements was performed by luciferase reporter assays, qPCR, and poly(A) assays. Herein, we report the down regulation of a luciferase reporter fused to the p53 3'-UTR, when human CPE-binding protein 1 (hCPEB1) is overexpressed. This inhibition is partially rescued when hCPEB1fused to hGLD-2 [a human...... cytoplasmic poly(A) polymerase] is overexpressed instead. The stability of a luciferase mRNA containing the p53 3'-UTR downstream, is decreased when hCPEB1 is overexpressed as seen by qPCR. Expression of hGLD-2 restores the mRNA stability. This is due to elongation of the poly(A) tail as seen by a PCR...

  6. Haploinsufficiency for Core Exon Junction Complex Components Disrupts Embryonic Neurogenesis and Causes p53-Mediated Microcephaly.

    Directory of Open Access Journals (Sweden)

    Hanqian Mao

    2016-09-01

    Full Text Available The exon junction complex (EJC is an RNA binding complex comprised of the core components Magoh, Rbm8a, and Eif4a3. Human mutations in EJC components cause neurodevelopmental pathologies. Further, mice heterozygous for either Magoh or Rbm8a exhibit aberrant neurogenesis and microcephaly. Yet despite the requirement of these genes for neurodevelopment, the pathogenic mechanisms linking EJC dysfunction to microcephaly remain poorly understood. Here we employ mouse genetics, transcriptomic and proteomic analyses to demonstrate that haploinsufficiency for each of the 3 core EJC components causes microcephaly via converging regulation of p53 signaling. Using a new conditional allele, we first show that Eif4a3 haploinsufficiency phenocopies aberrant neurogenesis and microcephaly of Magoh and Rbm8a mutant mice. Transcriptomic and proteomic analyses of embryonic brains at the onset of neurogenesis identifies common pathways altered in each of the 3 EJC mutants, including ribosome, proteasome, and p53 signaling components. We further demonstrate all 3 mutants exhibit defective splicing of RNA regulatory proteins, implying an EJC dependent RNA regulatory network that fine-tunes gene expression. Finally, we show that genetic ablation of one downstream pathway, p53, significantly rescues microcephaly of all 3 EJC mutants. This implicates p53 activation as a major node of neurodevelopmental pathogenesis following EJC impairment. Altogether our study reveals new mechanisms to help explain how EJC mutations influence neurogenesis and underlie neurodevelopmental disease.

  7. Structural effects and competition mechanisms targeting the interactions between p53 and MDM2 for cancer therapy

    Science.gov (United States)

    Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei

    2017-06-01

    Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.

  8. The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

    Directory of Open Access Journals (Sweden)

    Krzysztof Puszynski

    2014-12-01

    Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

  9. Mu opioid receptor binding sites in human brain

    International Nuclear Information System (INIS)

    Pilapil, C.; Welner, S.; Magnan, J.; Zamir, N.; Quirion, R.

    1986-01-01

    Our experiments focused on the examination of the distribution of mu opioid receptor binding sites in normal human brain using the highly selective ligand [ 3 H]DAGO, in both membrane binding assay and in vitro receptor autoradiography. Mu opioid binding sites are very discretely distributed in human brain with high densities of sites found in the posterior amygdala, caudate, putamen, hypothalamus and certain cortical areas. Moreover the autoradiographic distribution of [ 3 H]DAGO binding sites clearly reveals the discrete lamination (layers I and III-IV) of mu sites in cortical areas

  10. Growth of the Developing Cerebral Cortex Is Controlled by MicroRNA-7 through the p53 Pathway

    Directory of Open Access Journals (Sweden)

    Andrew Pollock

    2014-05-01

    Full Text Available Proper growth of the mammalian cerebral cortex is crucial for normal brain functions and is controlled by precise gene-expression regulation. Here, we show that microRNA-7 (miR-7 is highly expressed in cortical neural progenitors and describe miR-7 sponge transgenic mice in which miR-7-silencing activity is specifically knocked down in the embryonic cortex. Blocking miR-7 function causes microcephaly-like brain defects due to reduced intermediate progenitor (IP production and apoptosis. Upregulation of miR-7 target genes, including those implicated in the p53 pathway, such as Ak1 and Cdkn1a (p21, is responsible for abnormalities in neural progenitors. Furthermore, ectopic expression of Ak1 or p21 and specific blockade of miR-7 binding sites in target genes using protectors in vivo induce similarly reduced IP production. Using conditional miRNA sponge transgenic approaches, we uncovered an unexpected role for miR-7 in cortical growth through its interactions with genes in the p53 pathway.

  11. Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

    Science.gov (United States)

    Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

    2012-10-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

  12. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  13. The Hunger Games: p53 regulates metabolism upon serine starvation.

    Science.gov (United States)

    Tavana, Omid; Gu, Wei

    2013-02-05

    Cancer cells reprogram their metabolism to support a high proliferative rate. A new study shows that, upon serine starvation, the tumor suppressor p53 activates p21 to shift metabolic flux from purine biosynthesis to glutathione production, which enhances cellular proliferation and viability by combating ROS (Maddocks et al., 2013). Copyright © 2013 Elsevier Inc. All rights reserved.

  14. The p53-MDM2 network: from oscillations to apoptosis

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Apoptosis; cancer; cell cycle; MDM2 overexpression; tumour suppressor .... model of the p53-MDM2 negative feedback loop included an .... MDM2 overexpression, when subjected to nutlin-3 treatment. Some aspects of the model are similar to those ... A family of proteases termed caspases .... Implications for therapy; Proc.

  15. Overexpression of p53 in Nigerian breast cancers and its ...

    African Journals Online (AJOL)

    This study sought to determine the expression of p53 protein as well as the relationship with oestrogen receptor (ER) and progesterone receptor (PR) proteins. Methodology: Formalin-fixed, paraffin-embedded tissue samples of diagnosed invasive breast cancer were obtained from the Department of Anatomic and ...

  16. p53 expression in colorectal carcinoma in relation to ...

    African Journals Online (AJOL)

    Haematoxylin and eosin stain was used for evaluation of histological types and degree of differentiation of the tumors. Topography of the tumors and demographic data were obtained from accompanying histological request forms. Results: Out of 109 patient\\'s tissue blocks that were studied, 61 cases (56%) expressed p53 ...

  17. Cellular inactivation of nitric oxide induces p53-dependent ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.

  18. Morphological Heterogeneity of p53 Positive and p53 Negative Nuclei in Breast Cancers Stratified by Clinicopathological Variables

    Directory of Open Access Journals (Sweden)

    Katrin Friedrich

    1997-01-01

    Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.

  19. ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

    Science.gov (United States)

    Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

    2001-01-01

    The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

  20. Apoptosis in spermatogonia irradiated P53 null mice

    International Nuclear Information System (INIS)

    Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.

    2007-01-01

    Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after

  1. SIGNALING TO THE P53 TUMOR SUPPRESSOR THROUGH PATHWAYS ACTIVATED BY GENOTOXIC AND NON-GENOTOXIC STRESSES.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2002-07-01

    The p53 tumor suppressor is a tetrameric transcription factor that is post-translational modified at {approx}18 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review the posttranslational modifications to p53 and the pathways that produce them in response to both genotoxic and non-genotoxic stresses.

  2. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK

    International Nuclear Information System (INIS)

    Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi

    2006-01-01

    PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK

  3. Heterogeneity of Opioid Binding Sites in Guinea Pig Spinal Cord

    Science.gov (United States)

    1984-11-30

    MEDICAL CENTER WILFORD HALL AIR FORCE MEDICAL CENTER Title of Thesis: "Heterogeneity of Opioid Binding Sites in Guinea Pig Spinal Cord" Name of...that the use of any copyrighted material in the dissertation manuscript entitled: "Heterogeneity of Opioid Binding Sites in Guinea Pig Spinal Cord...University of the Health Sciences 11 Abstract Title of Thesis: Heterogenity of Opioid Binding Sites In Guinea Pig Spinal Cord Gary Dean Zarr MAJ/ANC

  4. Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner

    International Nuclear Information System (INIS)

    Panta, Sushil; Yamakuchi, Munekazu; Shimizu, Toshiaki; Takenouchi, Kazunori; Oyama, Yoko; Koriyama, Toyoyasu; Kojo, Tsuyoshi; Hashiguchi, Teruto

    2017-01-01

    In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclear localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β 3 -integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β 3 -integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β 3 -integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β 3 -integrin pathway in endothelial cells.

  5. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  6. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    Energy Technology Data Exchange (ETDEWEB)

    Nishida, Tamotsu, E-mail: nishida@gene.mie-u.ac.jp [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan); Yamada, Yoshiji [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan)

    2011-03-11

    Research highlights: {yields} SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. {yields} SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. {yields} SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. {yields} We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  7. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    International Nuclear Information System (INIS)

    Nishida, Tamotsu; Yamada, Yoshiji

    2011-01-01

    Research highlights: → SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. → SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. → SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. → We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  8. The structure formed by inverted repeats in p53 response elements determines the transactivation activity of p53 protein

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Čechová, Jana; Battistin, M.; Coufal, Jan; Jagelská, Eva; Raimondi, I.; Inga, A.

    2017-01-01

    Roč. 483, č. 1 (2017), s. 516-521 ISSN 0006-291X R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : tumor-suppressor p53 * cruciform structures * dna-conformation Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.466, year: 2016

  9. Formation of diastereomeric benzo[a]pyrene diol epoxide-guanine adducts in p53 gene-derived DNA sequences.

    Science.gov (United States)

    Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia

    2004-06-01

    G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for

  10. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or

  11. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    Science.gov (United States)

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  13. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Ganapathy, Suthakar, E-mail: s.ganapathy@neu.edu [Center for Drug Development, Northeastern University, Boston (United States); Li, Ping [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Fagman, Johan [The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Yu, Tianqi; Lafontant, Jean [Center for Drug Development, Northeastern University, Boston (United States); Zhang, Guojun [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); Chen, Changyan [Center for Drug Development, Northeastern University, Boston (United States); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden)

    2016-09-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  14. Distinct pattern of p53 mutations in bladder cancer

    DEFF Research Database (Denmark)

    Spruck, C H; Rideout, W M; Olumi, A F

    1993-01-01

    A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...

  15. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    International Nuclear Information System (INIS)

    Ganapathy, Suthakar; Li, Ping; Fagman, Johan; Yu, Tianqi; Lafontant, Jean; Zhang, Guojun; Chen, Changyan

    2016-01-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  16. COX-2 and p53 in human sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Cyr, Diane; Luce, Danièle

    2008-01-01

    The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...

  17. Super p53 for Treatment of Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public...a lead construct. Technical skills gained in the proposal include cell culture , transfections, microscopy, apoptosis assays, transcriptional assays...experiments complete 100% (DOD) Specific Aim 2: Deliver super p53 DNA with advanced polymeric systems alone and in combination with CPTX first in vitro

  18. p53 and ARF: Unexpected players in autophagy

    OpenAIRE

    Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.

    2010-01-01

    p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino...

  19. Influence of p53 and bcl-2 on chemosensitivity in benign and malignant prostatic cell lines.

    Science.gov (United States)

    Serafin, Antonio M; Bohm, Lothar

    2005-01-01

    The administration of cancer chemotherapeutic agents results in an increase in the apoptotic cells in the tumor: therefore, it has been assumed that anticancer drugs exhibit their cytotoxic effects via apoptotic signaling pathways. Characteristics that confer sensitivity to drug-induced apoptosis are, a functional p53 protein and expression of the apoptosis-promoting protein, bax. The role of p53 and bax/bcl-2 in drug-induced apoptosis was assessed in six prostate cell lines, 1532T, 1535T, 1542T, 1542N, BPH-1 and LNCaP using TD(50) concentrations of etoposide, vinblastine and estramustine. Cell death was monitored morphologically by fluorescent microscopy, and by flow cytometry (Annexin-V assay). Apoptotic morphology was rather low and ranged from 0.1% to 12.1%, 3.0% to 6.0% and 0.1% to 8.5% for etoposide, estramustine and vinblastine, respectively. Annexin-V binding and flow cytometry indicated apoptotic propensities of 0% to 4%, 0% to 3% and 0% to 5%, respectively. The percentage of cells responding to drug-induced apoptosis was, on average, higher in the tumor cell lines than in the normal cell lines, but showed no correlation with p53 status. The percentage of cells showing necrosis, assessed by Annexin binding and Propidium Iodide permeability in aqueous medium, tended to be much higher, and was found to be at the level of 5% to 30%. Immunoblotting demonstrated that bax and bcl-2 proteins were expressed at a basal level in all cell lines, but did not increase after exposure to TD(50) doses of the three drugs. The ratio of bax and bcl-2, measured by laser scanning densitometry, was not altered by the drug-induced DNA damage. The results suggest that apoptosis is not a major mechanism of drug-induced cell death in prostate cell lines and appears to be independent of p53 status and bax/bcl-2 expression.

  20. Non-Canonical Cell Death Induced by p53

    Directory of Open Access Journals (Sweden)

    Atul Ranjan

    2016-12-01

    Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.

  1. Electrophoretic detection of protein p53 in human leukocytes

    International Nuclear Information System (INIS)

    Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.

    1986-01-01

    The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients

  2. Targeting GRP75 improves HSP90 inhibitor efficacy by enhancing p53-mediated apoptosis in hepatocellular carcinoma.

    Directory of Open Access Journals (Sweden)

    Weiwei Guo

    Full Text Available Heat shock protein 90 (HSP90 inhibitors are potential drugs for cancer therapy. The inhibition of HSP90 on cancer cell growth largely through degrading client proteins, like Akt and p53, therefore, triggering cancer cell apoptosis. Here, we show that the HSP90 inhibitor 17-AAG can induce the expression of GRP75, a member of heat shock protein 70 (HSP70 family, which, in turn, attenuates the anti-growth effect of HSP90 inhibition on cancer cells. Additionally, 17-AAG enhanced binding of GRP75 and p53, resulting in the retention of p53 in the cytoplasm. Blocking GRP75 with its inhibitor MKT-077 potentiated the anti-tumor effects of 17-AAG by disrupting the formation of GRP75-p53 complexes, thereby facilitating translocation of p53 into the nuclei and leading to the induction of apoptosis-related genes. Finally, dual inhibition of HSP90 and GRP75 was found to significantly inhibit tumor growth in a liver cancer xenograft model. In conclusion, the GRP75 inhibitor MKT-077 enhances 17-AAG-induced apoptosis in HCCs and increases p53-mediated inhibition of tumor growth in vivo. Dual targeting of GRP75 and HSP90 may be a useful strategy for the treatment of HCCs.

  3. Stress Hormone Cortisol Enhances Bcl2 Like-12 Expression to Inhibit p53 in Hepatocellular Carcinoma Cells.

    Science.gov (United States)

    Wu, Weizhong; Liu, Sanguang; Liang, Yunfei; Zhou, Zegao; Bian, Wei; Liu, Xueqing

    2017-12-01

    The pathogenesis of hepatocellular carcinoma (HC) is unclear. It is suggested that psychological stress associates with the pathogenesis of liver cancer. Bcl2-like protein 12 (Bcl2L12) suppresses p53 protein. This study tests a hypothesis that the major stress hormone, cortisol, inhibits the expression of p53 in HC cells (HCC) via up regulating the expression of Bcl2L12. Peripheral blood samples were collected from patients with HC to be analyzed for the levels of cortisol. HCC were cultured to assess the role of cortisol in the regulation of the expression of Bcl2L12 and p53 in HCC. We observed that the serum cortisol levels were higher in HC patients. Expression of Bcl2L12 in HCC was correlated with serum cortisol. Cortisol enhanced the Bcl2L12 expression in HCC. Bcl2L12 binding to the TP53 promoter was correlated with p53 expression in HCC. Cortisol increased the Bcl2L12 expression in HCC to inhibit p53 expression. Stress hormone cortisol suppresses p53 in HCC via enhancing Bcl2L12 expression in HCC. The results suggest that cortisol may be a therapeutic target for the treatment of HC.

  4. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  5. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  6. Effects of serum starvation on radiosensitivity, proliferation and apoptosis in four human tumor cell lines with different p53 status

    International Nuclear Information System (INIS)

    Oya, N.; Zoelzer, F.; Werner, F.; Streffer, C.

    2003-01-01

    Purpose: The effects of serum starvation on radiation sensitivity, cell proliferation and apoptosis were investigated with particular consideration of the p53 status. Material and Methods: Four human tumor cell lines, Be11 (melanoma, p53 wild-type), MeWo (melanoma, p53 mutant), 4197 (squamous cell carcinoma, p53 wild-type) and 4451 (squamous cell carcinoma, p53 mutant), were used. After the cells had been incubated in starvation medium (0.5% FCS) for 1-6 days, changes in cell cycle distribution, induction of apoptosis and necrosis, and changes in radiation sensitivity were assessed by two-parameter flow cytometric measurements of DNA content/BrdU labeling, two-parameter flow cytometric measurements of DNA-dye-exclusion/Annexin V binding, and a conventional colony assay, respectively. Results: p53 wild-type cell lines showed a decrease in the BrdU labeling index and an increase in the apoptotic cell frequency in starvation medium. p53 mutant cell lines showed a decrease in the BrdU labeling index but no evidence of apoptosis. These cells went into necrosis instead. The radiation sensitivity was increased in 4451 and slightly decreased in Be11 and 4197 in starvation medium. Conclusion: These data suggest a functional involvement of p53 in starvation-induced G1-block and apoptosis in tumor cells. Altered radiosensitivity after culture in starvation medium seemed to be explained at least in part by the starvation-induced G1-block. The frequency of starvation-induced apoptosis or necrosis was not correlated with radiation sensitivity. (orig.)

  7. Immunohistochemical Expression of P53 Protein in Cutaneous Basal Cell Carcinoma: A Clinicopathological Study of 66 Cases

    Directory of Open Access Journals (Sweden)

    Vladim and iacute;r Barto and scaron;

    2016-12-01

    Full Text Available Objective: Nuclear expression of p53 protein is associated with a biological behavior in a variety of human malignancies. In cutaneous basal cell carcinoma (BCC, however, many studies have provided conflicting results in this regard. We aimed to determine whether there is relationship between p53 expression and different histologic subtypes of BCC, and whether it may indicate tumor aggressiveness. Materials and Methods: Biopsy samples from 66 cutaneous BCCs from 57 patients were collected. P53 expression was demonstrated by immunohistochemical staining using the anti-p53 antibody. Among them, 52 cases were also evaluated for Ki-67 antigen. Results: Immunoreactivity of p53 protein varied in the range of 0 to 100% of total tumor tissue (mean value 46.0%. The expression exceeding 5% of cancer tissue (positive staining was found in 54 BCCs (81.8%. Within this group, there were 25 cases (37.9% with low and 29 cases (43.9% with high expression. In superficial, superficial-nodular, nodular, nodular-infiltrative and infiltrative BCCs, p53 protein positivity was found in 100% (8/8, 80% (8/10, 70.4% (19/27, 88.2% (15/17 and 100% (4/4, respectively. We did not reveal a significant correlation between the extent of p53 protein expression and BCC subtypes except for nodular BCC, in which a number of negative cases (8/27, 29.6% were just above the threshold of statistical significance (P = 0.04. After merging cancers into non-aggressive and aggressive growth phenotype, no association with expression of p53 protein was found. There was no relationship between p53 protein expression and topographical sites after they have been gathered into sun-exposed and sun-protected locations. We did not observe any association between expression of p53 protein and Ki-67 antigen. Conclusion: In cutaneous BCC, the expression of p53 protein does not seem to reflect a biological behavior and tumor aggressiveness. Therefore, in a routine dermatopathological practice

  8. Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla

    2004-01-01

    Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

  9. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.; Stemmler, T.L.; Gil, J.A.; Mateos, L.M.; Rosen, B.P.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, and the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.

  10. Tumour suppression in skin and other tissues via cross-talk between vitamin D- and p53-signalling

    Directory of Open Access Journals (Sweden)

    Joerg eReichrath

    2014-06-01

    Full Text Available P53 and its family members have been implicated in the direct regulation of the vitamin D receptor (VDR. Vitamin D- and p53-signaling pathways have a significant impact on spontaneous or carcinogen-induced malignant transformation of cells, with VDR and p53 representing important tumour suppressors. VDR and the p53/p63/p73 proteins all function typically as receptors or sensors that turn into transcriptional regulators upon stimulus, with the main difference being that the nuclear VDR is activated as a transcription factor after binding its naturally occurring ligand 1,25-dihydroxyvitamin D with high affinity while the p53 family of transcription factors, mostly in the nucleoplasm, responds to a large number of alterations in cell homeostasis commonly referred to as stress. An increasing body of evidence now convincingly demonstrates a cross-talk between vitamin D- and p53-signaling that occurs at different levels, has genome-wide implications and that should be of high importance for many malignancies, including non-melanoma skin cancer. One interaction involves the ability of p53 to increase skin pigmentation via POMC derivatives including alpha-MSH and ACTH. Pigmentation protects the skin against UV-induced DNA damage and skin carcinogenesis, yet on the other hand reduces cutaneous synthesis of vitamin D. A second level of interaction may be through the ability of 1,25-dihydroxyvitamin D to increase the survival of skin cells after UV irradiation. UV irradiation-surviving cells show significant reductions in thymine dimers in the presence of 1,25-dihydroxyvitamin D that are associated with increased nuclear p53 protein expression, and significantly reduced NO products. A third level of interaction is documented by the ability of vitamin D compounds to regulate the expression of the murine double minute 2 (MDM2 gene in dependence of the presence of wild-type p53. MDM2 has a well established role as a key negative regulator of p53 activity

  11. Regulation of GAD65 expression by SMAR1 and p53 upon Streptozotocin treatment

    Directory of Open Access Journals (Sweden)

    Singh Sandeep

    2012-09-01

    Full Text Available Abstract Background GAD65 (Glutamic acid decarboxylase 65 KDa isoform is one of the most important auto-antigens involved in Type 1 diabetes induction. Although it serves as one of the first injury markers of β-islets, the mechanisms governing GAD65 expression remain poorly understood. Since the regulation of GAD65 is crucial for the proper functioning of insulin secreting cells, we investigated the stress induced regulation of GAD65 transcription. Results The present study shows that SMAR1 regulates GAD65 expression at the transcription level. Using a novel protein-DNA pull-down assay, we show that SMAR1 binding is very specific to GAD65 promoter but not to the other isoform, GAD67. We show that Streptozotocin (STZ mediated DNA damage leads to upregulation of SMAR1 and p53 expression, resulting in elevated levels of GAD65, in both cell lines as well as mouse β-islets. SMAR1 and p53 act synergistically to up-regulate GAD65 expression upon STZ treatment. Conclusion We propose a novel mechanism of GAD65 regulation by synergistic activities of SMAR1 and p53.

  12. HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

    Science.gov (United States)

    Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

    2006-02-01

    HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

  13. Degradation of p53 by human Alphapapillomavirus E6 proteins shows a stronger correlation with phylogeny than oncogenicity.

    Directory of Open Access Journals (Sweden)

    Leiping Fu

    2010-09-01

    Full Text Available Human Papillomavirus (HPV E6 induced p53 degradation is thought to be an essential activity by which high-risk human Alphapapillomaviruses (alpha-HPVs contribute to cervical cancer development. However, most of our understanding is derived from the comparison of HPV16 and HPV11. These two viruses are relatively distinct viruses, making the extrapolation of these results difficult. In the present study, we expand the tested strains (types to include members of all known HPV species groups within the Alphapapillomavirus genus.We report the biochemical activity of E6 proteins from 27 HPV types representing all alpha-HPV species groups to degrade p53 in human cells. Expression of E6 from all HPV types epidemiologically classified as group 1 carcinogens significantly reduced p53 levels. However, several types not associated with cancer (e.g., HPV53, HPV70 and HPV71 were equally active in degrading p53. HPV types within species groups alpha 5, 6, 7, 9 and 11 share a most recent common ancestor (MRCA and all contain E6 ORFs that degrade p53. A unique exception, HPV71 E6 ORF that degraded p53 was outside this clade and is one of the most prevalent HPV types infecting the cervix in a population-based study of 10,000 women. Alignment of E6 ORFs identified an amino acid site that was highly correlated with the biochemical ability to degrade p53. Alteration of this amino acid in HPV71 E6 abrogated its ability to degrade p53, while alteration of this site in HPV71-related HPV90 and HPV106 E6s enhanced their capacity to degrade p53.These data suggest that the alpha-HPV E6 proteins' ability to degrade p53 is an evolved phenotype inherited from a most recent common ancestor of the high-risk species that does not always segregate with carcinogenicity. In addition, we identified an amino-acid residue strongly correlated with viral p53 degrading potential.

  14. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer

    Directory of Open Access Journals (Sweden)

    Youfeng Shen

    2017-11-01

    section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. Conclusion TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.

  15. P53-dependent antiproliferative and pro-apoptotic effects of trichostatin A (TSA) in glioblastoma cells.

    Science.gov (United States)

    Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R

    2012-05-01

    Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.

  16. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  17. E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    David G. Johnson

    2012-10-01

    Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.

  18. Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

    OpenAIRE

    Meng, X; Carlson, NR; Dong, J; Zhang, Y

    2015-01-01

    The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...

  19. The Inherited p53 Mutation in the Brazilian Population.

    Science.gov (United States)

    Achatz, Maria Isabel; Zambetti, Gerard P

    2016-12-01

    A common criticism of studying rare diseases is the often-limited relevance of the findings to human health. Here, we review ∼15 years of research into an unusual germline TP53 mutation (p.R337H) that began with its detection in children with adrenocortical carcinoma (ACC), a remarkably rare childhood cancer that is associated with poor prognosis. We have come to learn that the p.R337H mutation exists at a very high frequency in Southern and Southeastern Brazil, occurring in one of 375 individuals within a total population of ∼100 million. Moreover, it has been determined that carriers of this founder mutation display variable tumor susceptibility, ranging from isolated cases of pediatric ACC to Li-Fraumeni or Li-Fraumeni-like (LFL) syndromes, thus representing a significant medical issue for this country. Studying the biochemical and molecular consequences of this mutation on p53 tumor-suppressor activity, as well as the putative additional genetic alterations that cooperate with this mutation, is advancing our understanding of how p53 functions in tumor suppression in general. These studies, which originated with a rare childhood tumor, are providing important information for guiding genetic counselors and physicians in treating their patients and are already providing clinical benefit. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  20. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  1. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  2. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    Science.gov (United States)

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  3. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik

    2006-01-01

    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  4. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    NARCIS (Netherlands)

    Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.

    2013-01-01

    Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,

  5. p53-dependent non-coding RNA networks in chronic lymphocytic leukemia

    NARCIS (Netherlands)

    Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.

    2015-01-01

    Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We

  6. p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer

    DEFF Research Database (Denmark)

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F

    2014-01-01

    The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....

  7. Localization of gonadotropin binding sites in human ovarian neoplasms

    International Nuclear Information System (INIS)

    Nakano, R.; Kitayama, S.; Yamoto, M.; Shima, K.; Ooshima, A.

    1989-01-01

    The binding of human luteinizing hormone and human follicle-stimulating hormone to ovarian tumor biopsy specimens from 29 patients was analyzed. The binding sites for human luteinizing hormone were demonstrated in one tumor of epithelial origin (mucinous cystadenoma) and in one of sex cord-stromal origin (theca cell tumor). The binding sites for human follicle-stimulating hormone were found in three tumors of epithelial origin (serous cystadenoma and mucinous cystadenoma) and in two of sex cord-stromal origin (theca cell tumor and theca-granulosa cell tumor). The surface-binding autoradiographic study revealed that the binding sites for gonadotropins were localized in the stromal tissue. The results suggest that gonadotropic hormones may play a role in the growth and differentiation of a certain type of human ovarian neoplasms

  8. A systematic review of p53 regulation of oxidative stress in skeletal muscle.

    Science.gov (United States)

    Beyfuss, Kaitlyn; Hood, David A

    2018-12-01

    transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p

  9. Development of cholecystokinin binding sites in rat upper gastrointestinal tract

    International Nuclear Information System (INIS)

    Robinson, P.H.; Moran, T.H.; Goldrich, M.; McHugh, P.R.

    1987-01-01

    Autoradiography using 125 I-labeled Bolton Hunter-CCK-33 was used to study the distribution of cholecystokinin binding sites at different stages of development in the rat upper gastrointestinal tract. Cholecystokinin (CCK) binding was present in the distal stomach, esophagus, and gastroduodenal junction in the rat fetus of gestational age of 17 days. In the 20-day fetus, specific binding was found in the gastric mucosa, antral circular muscle, and pyloric sphincter. Mucosal binding declined during postnatal development and had disappeared by day 15. Antral binding declined sharply between day 10 and day 15 and disappeared by day 50. Pyloric muscle binding was present in fetal stomach and persisted in the adult. Pancreatic CCK binding was not observed before day 10. These results suggest that CCK may have a role in the control of gastric emptying and ingestive behavior in the neonatal rat

  10. Development of cholecystokinin binding sites in rat upper gastrointestinal tract

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, P.H.; Moran, T.H.; Goldrich, M.; McHugh, P.R.

    1987-04-01

    Autoradiography using /sup 125/I-labeled Bolton Hunter-CCK-33 was used to study the distribution of cholecystokinin binding sites at different stages of development in the rat upper gastrointestinal tract. Cholecystokinin (CCK) binding was present in the distal stomach, esophagus, and gastroduodenal junction in the rat fetus of gestational age of 17 days. In the 20-day fetus, specific binding was found in the gastric mucosa, antral circular muscle, and pyloric sphincter. Mucosal binding declined during postnatal development and had disappeared by day 15. Antral binding declined sharply between day 10 and day 15 and disappeared by day 50. Pyloric muscle binding was present in fetal stomach and persisted in the adult. Pancreatic CCK binding was not observed before day 10. These results suggest that CCK may have a role in the control of gastric emptying and ingestive behavior in the neonatal rat.

  11. Floating Production Unit FPU P53: logistic and modules installation; Logistica e instalacao dos modulos da Unidade Flutuante de Producao FPU P53

    Energy Technology Data Exchange (ETDEWEB)

    Arantes, Joao Durval [UTC Engenharia S.A., SP (Brazil)

    2008-07-01

    This work intends to show a 'case' of success, namely the model of management and the strategy, applied in the logistics and installation of the P53 modules. The criteria, which took QUIP to contract, in Brazil and abroad, technology companies, to supply integrated modules, including engineering, procurement, construction and warranty of performance, are shown. Establishment, at the initial phase of the Project, of the discipline 'constructibility', with the attribution to interact with the engineering design and construction of the modules under QUIP's responsibility, modules supplied by PETROBRAS and mainly, with the site of Naval Conversion in Singapore. Establishment of the discipline 'Marinharia', to act together with 'constructibility' to overcome the difficulties and restrictions of Porto de Rio Grande, such as the following: the width of the sailing channel, interferences of commercial port, availability of mooring pier, relationship with port pilotage and authorities of the Fifth Naval District of Brazilian Navy. The challenges were the maneuvers with 2 crane barges for modules installation, in front the P-53, a VLCC ship and maneuvers the barges, involved at the time of installation of the modules. And, finally, to show the proceeding applied in the physical interfaces of installation of the modules, such as: interferences, supports of the modules, stools in the ship, guides and bumpers. Dimensional control, simulations and extensive planning were the tools of success. (author)

  12. Influence of X-ray on the P53 gene in human peripheral blood lymphocytes

    International Nuclear Information System (INIS)

    Jin Wenwei; Cai Ting

    2002-01-01

    Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation

  13. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  15. p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.

    Science.gov (United States)

    Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina

    2009-11-01

    Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.

  16. Opioid binding sites in the guinea pig and rat kidney: Radioligand homogenate binding and autoradiography

    Energy Technology Data Exchange (ETDEWEB)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C. (Parke-Davis Research Unit, Addenbrookes Hospital Site, Cambridge (England))

    1991-07-01

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE bound with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.

  17. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    Energy Technology Data Exchange (ETDEWEB)

    Gangi Setty, Thanuja [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Cho, Christine [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Govindappa, Sowmya [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Apicella, Michael A. [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Ramaswamy, S., E-mail: ramas@instem.res.in [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India)

    2014-07-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  18. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    International Nuclear Information System (INIS)

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.

    2014-01-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states

  19. p53 is involved in clearance of ionizing radiation-induced RAD51 foci in a human colon cancer cell line

    International Nuclear Information System (INIS)

    Orre, Lukas M.; Stenerloew, Bo; Dhar, Sumeer; Larsson, Rolf; Lewensohn, Rolf; Lehtioe, Janne

    2006-01-01

    We have investigated p53-related differences in cellular response to DNA damaging agents, focusing on p53s effects on RAD51 protein level and sub-cellular localization post exposure to ionizing radiation. In a human colon cancer cell line, HCT116 and its isogenic p53-/- subcell line we show here p53-independent RAD51 foci formation but interestingly the resolution of RAD51 foci showed clear p53 dependence. In p53 wt cells, but not in p53-/- cells, RAD51 protein level decreased 48 h post irradiation and fluorescence immunostaining showed resolution of RAD51 foci and relocalization of RAD51 to nucleoli at time points corresponding to the decrease in RAD51 protein level. Both cell lines rejoined DNA double strand breaks efficiently with similar kinetics and p53 status did not influence sensitivity to DNA damaging agents. We suggest that p53 has a role in RAD51 clearance post DSB repair and that nucleoli might be sites of RAD51 protein degradation

  20. (-)PPAP: a new and selective ligand for sigma binding sites.

    Science.gov (United States)

    Glennon, R A; Battaglia, G; Smith, J D

    1990-11-01

    Most agents employed for the investigation of sigma (sigma) binding sites display relatively low affinity for these sites, bind both at sigma sites and at either phencyclidine (PCP) sites or dopamine receptors with similar affinity, and/or produce some dopaminergic activity in vivo. We describe a new agent, (-)PPAP or R(-)-N-(3-phenyl-n-propyl)-1-phenyl-2-aminopropane hydrochloride, that binds with high affinity and selectivity at sigma (IC50 = 24 nM) versus either PCP sites (IC50 greater than 75,000 nM) or D1 and D2 dopamine receptors (IC50 greater than 5,000 nM). The sigma affinity of this agent is comparable to that of the standard ligands (+)-3-PPP and DTG. Furthermore, although (-)PPAP is structurally related to amphetamine, it neither produces nor antagonizes amphetamine-like stimulus effect in rats trained to discriminate 1 mg/kg of S(+)amphetamine from saline.

  1. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

    2008-01-01

    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  2. Chloride binding site of neurotransmitter sodium symporters

    DEFF Research Database (Denmark)

    Kantcheva, Adriana Krassimirova; Quick, Matthias; Shi, Lei

    2013-01-01

    Neurotransmitter:sodium symporters (NSSs) play a critical role in signaling by reuptake of neurotransmitters. Eukaryotic NSSs are chloride-dependent, whereas prokaryotic NSS homologs like LeuT are chloride-independent but contain an acidic residue (Glu290 in LeuT) at a site where eukaryotic NSSs...

  3. Kaiso Directs the Transcriptional Corepressor MTG16 to the Kaiso Binding Site in Target Promoters

    Science.gov (United States)

    Barrett, Caitlyn W.; Smith, J. Joshua; Lu, Lauren C.; Markham, Nicholas; Stengel, Kristy R.; Short, Sarah P.; Zhang, Baolin; Hunt, Aubrey A.; Fingleton, Barbara M.; Carnahan, Robert H.; Engel, Michael E.; Chen, Xi; Beauchamp, R. Daniel; Wilson, Keith T.; Hiebert, Scott W.; Reynolds, Albert B.; Williams, Christopher S.

    2012-01-01

    Myeloid translocation genes (MTGs) are transcriptional corepressors originally identified in acute myelogenous leukemia that have recently been linked to epithelial malignancy with non-synonymous mutations identified in both MTG8 and MTG16 in colon, breast, and lung carcinoma in addition to functioning as negative regulators of WNT and Notch signaling. A yeast two-hybrid approach was used to discover novel MTG binding partners. This screen identified the Zinc fingers, C2H2 and BTB domain containing (ZBTB) family members ZBTB4 and ZBTB38 as MTG16 interacting proteins. ZBTB4 is downregulated in breast cancer and modulates p53 responses. Because ZBTB33 (Kaiso), like MTG16, modulates Wnt signaling at the level of TCF4, and its deletion suppresses intestinal tumorigenesis in the ApcMin mouse, we determined that Kaiso also interacted with MTG16 to modulate transcription. The zinc finger domains of Kaiso as well as ZBTB4 and ZBTB38 bound MTG16 and the association with Kaiso was confirmed using co-immunoprecipitation. MTG family members were required to efficiently repress both a heterologous reporter construct containing Kaiso binding sites (4×KBS) and the known Kaiso target, Matrix metalloproteinase-7 (MMP-7/Matrilysin). Moreover, chromatin immunoprecipitation studies placed MTG16 in a complex occupying the Kaiso binding site on the MMP-7 promoter. The presence of MTG16 in this complex, and its contributions to transcriptional repression both required Kaiso binding to its binding site on DNA, establishing MTG16-Kaiso binding as functionally relevant in Kaiso-dependent transcriptional repression. Examination of a large multi-stage CRC expression array dataset revealed patterns of Kaiso, MTG16, and MMP-7 expression supporting the hypothesis that loss of either Kaiso or MTG16 can de-regulate a target promoter such as that of MMP-7. These findings provide new insights into the mechanisms of transcriptional control by ZBTB family members and broaden the scope of co

  4. p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

    International Nuclear Information System (INIS)

    Willers, H.; Powell, S.N.; Dahm-Daphi, J.

    2003-01-01

    Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

  5. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    Science.gov (United States)

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  6. RBPmap: a web server for mapping binding sites of RNA-binding proteins.

    Science.gov (United States)

    Paz, Inbal; Kosti, Idit; Ares, Manuel; Cline, Melissa; Mandel-Gutfreund, Yael

    2014-07-01

    Regulation of gene expression is executed in many cases by RNA-binding proteins (RBPs) that bind to mRNAs as well as to non-coding RNAs. RBPs recognize their RNA target via specific binding sites on the RNA. Predicting the binding sites of RBPs is known to be a major challenge. We present a new webserver, RBPmap, freely accessible through the website http://rbpmap.technion.ac.il/ for accurate prediction and mapping of RBP binding sites. RBPmap has been developed specifically for mapping RBPs in human, mouse and Drosophila melanogaster genomes, though it supports other organisms too. RBPmap enables the users to select motifs from a large database of experimentally defined motifs. In addition, users can provide any motif of interest, given as either a consensus or a PSSM. The algorithm for mapping the motifs is based on a Weighted-Rank approach, which considers the clustering propensity of the binding sites and the overall tendency of regulatory regions to be conserved. In addition, RBPmap incorporates a position-specific background model, designed uniquely for different genomic regions, such as splice sites, 5' and 3' UTRs, non-coding RNA and intergenic regions. RBPmap was tested on high-throughput RNA-binding experiments and was proved to be highly accurate. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    Directory of Open Access Journals (Sweden)

    Lin Tai-Du

    2010-12-01

    Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

  8. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  9. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  10. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-01-01

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  11. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  12. Opioid binding site in EL-4 thymoma cell line

    International Nuclear Information System (INIS)

    Fiorica, E.; Spector, S.

    1988-01-01

    Using EL-4 thymoma cell-line we found a binding site similar to the k opioid receptor of the nervous system. The Scatchard analysis of the binding of [ 3 H] bremazocine indicated a single site with a K/sub D/ = 60 +/- 17 nM and Bmax = 2.7 +/- 0.8 pmols/10 6 cells. To characterize this binding site, competition studies were performed using selective compounds for the various opioid receptors. The k agonist U-50,488H was the most potent displacer of [ 3 H] bremazocine with an IC 50 value = 0.57μM. The two steroisomers levorphanol and dextrorphan showed the same affinity for this site. While morphine, [D-Pen 2 , D-Pen 5 ] enkephalin and β-endorphin failed to displace, except at very high concentrations, codeine demonstrated a IC 50 = 60μM, that was similar to naloxone. 32 references, 3 figures, 2 tables

  13. Human chorionic ganodotropin binding sites in the human endometrium

    International Nuclear Information System (INIS)

    Bhattacharya, S.; Banerjee, J.; Sen, S.; Manna, P.R.

    1993-01-01

    The existence of high-affinity and low-capacity specific binding sites for luteinizing hormone/human chorionic gonadotropin (hCG) has been reported in porcine, rabbit and rat uteri. The authors have identified the hCG binding sites in the human endometrium collected from 35-42-year-old ovulatory and anovulatory women. The binding characteristics of hCG to endometrial tissue preparations from ovulatory and anovulatory women showed saturability with high affinity and low capacity. Scatchard plot analysis showed the dissociation constant of specific binding sites in the ovulatory women to be 3.5x10 -10 mol/l and in anovulatory women to be 3.1x10 -10 mol/l. The maximum binding capacity varied considerably between ovulatory and anovulatory endometrium. Among the divalent metal ions tested Zn 2+ effected a remarkable increase in [ 125 I]hCG binding to the endometrium, whereas Mn 2+ showed a marginal increase and other metal ions did not have any effect. Data obtained with human endometrium indicate an influence of the functional state of the ovary on [ 125 I]hCG binding to endometrium. 14 refs., 3 figs

  14. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  15. Domain-based small molecule binding site annotation

    Directory of Open Access Journals (Sweden)

    Dumontier Michel

    2006-03-01

    Full Text Available Abstract Background Accurate small molecule binding site information for a protein can facilitate studies in drug docking, drug discovery and function prediction, but small molecule binding site protein sequence annotation is sparse. The Small Molecule Interaction Database (SMID, a database of protein domain-small molecule interactions, was created using structural data from the Protein Data Bank (PDB. More importantly it provides a means to predict small molecule binding sites on proteins with a known or unknown structure and unlike prior approaches, removes large numbers of false positive hits arising from transitive alignment errors, non-biologically significant small molecules and crystallographic conditions that overpredict ion binding sites. Description Using a set of co-crystallized protein-small molecule structures as a starting point, SMID interactions were generated by identifying protein domains that bind to small molecules, using NCBI's Reverse Position Specific BLAST (RPS-BLAST algorithm. SMID records are available for viewing at http://smid.blueprint.org. The SMID-BLAST tool provides accurate transitive annotation of small-molecule binding sites for proteins not found in the PDB. Given a protein sequence, SMID-BLAST identifies domains using RPS-BLAST and then lists potential small molecule ligands based on SMID records, as well as their aligned binding sites. A heuristic ligand score is calculated based on E-value, ligand residue identity and domain entropy to assign a level of confidence to hits found. SMID-BLAST predictions were validated against a set of 793 experimental small molecule interactions from the PDB, of which 472 (60% of predicted interactions identically matched the experimental small molecule and of these, 344 had greater than 80% of the binding site residues correctly identified. Further, we estimate that 45% of predictions which were not observed in the PDB validation set may be true positives. Conclusion By

  16. Transcription factor binding sites prediction based on modified nucleosomes.

    Directory of Open Access Journals (Sweden)

    Mohammad Talebzadeh

    Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method

  17. LIGAND-BINDING SITES ON THE MYCOBACTERIUM TUBERCULOSIS UREASE

    Directory of Open Access Journals (Sweden)

    Lisnyak Yu. V.

    2017-10-01

    Full Text Available Introduction. Mycobacterium tuberculosis is the causative agent of tuberculosis that remains a serious medical and social health problem. Despite intensive efforts have been made in the past decade, there are no new efficient anti-tuberculosis drugs today, and that need is growing due to the spread of drug-resistant strains of M.tuberculosis. M. tuberculosis urease (MTU, being an important factor of the bacterium viability and virulence, is an attractive target for anti-tuberculosis drugs acting by inhibition of urease activity. However, the commercially available urease inhibitors are toxic and unstable, that prevent their clinical use. Therefore, new more potent anti-tuberculosis drugs inhibiting new targets are urgently needed. A useful tool for the search of novel inhibitors is a computational drug design. The inhibitor design is significantly easier if binding sites on the enzyme are identified in advance. This paper aimed to determine the probable ligand binding sites on the surface of M. tuberculosis urease. Methods. To identify ligand binding sites on MTU surface, сomputational solvent mapping method FTSite was applied by the use of MTU homology model we have built earlier. The method places molecular probes (small organic molecules containing various functional groups on a dense grid defined around the enzyme, and for each probe finds favorable positions. The selected poses are refined by free energy minimization, the low energy conformations are clustered, and the clusters are ranked on the basis of the average free energy. FTSite server outputs the protein residues delineating a binding sites and the probe molecules representing each cluster. To predict allosteric pockets on MTU, AlloPred and AlloSite servers were applied. AlloPred uses the normal mode analysis (NMA and models how the dynamics of a protein would be altered in the presence of a modulator at a specific pocket. Pockets on the enzyme are predicted using the Fpocket

  18. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)

    2015-11-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.

  19. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    International Nuclear Information System (INIS)

    Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.

    2015-01-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.

  20. Mutational myriad of tumor suppressor p53 in Filipino breast cancer: results and perspectives in molecular pathology and epidemiology

    International Nuclear Information System (INIS)

    Deocaris, Custer C.

    2000-04-01

    The p53 tumor suppressor is by far the most widely mutated gene in human cancers. p53 encodes a 53-kDa phosphoprotein, transcription-activator whose targets include genes and gene products that orchestrate genomic stability, cellular response to DNA damage, cell cycle progression apoptosis and aging (senescence). Analysis of the p53 gene profile has previously resulted in identifying several cancer-causative factors in the human setting, as well as, in creating a unique molecular profile of a tumor useful in the design of tailored-therapies for individual cancer patients. Our results in screening for p53 abnormalities in 140 Filipino patients with primary breast lesions confined from 1997-1998 in 5 major hospitals in Manila reveal that p53 plays an important role in the development and progression of breast cancer in at least 48% of all cases. Two methods of p53 analysis are employed, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction-temporal temperature gradient electrophoresis (PCR-TTGE). Inter-comparisons of method exhibit 63.3% concordance in 21 fresh breast carcinoma samples, with ELISA demonstrating 14% false-positives and 10% false-negatives. Only mutations in exon 7 (p=0.063) in the tumor samples how significant correlation with abnormal cellular elevation of p53. PCR-TTGE screening in a large series of 140 patients show that most genetic lesions are localized in exons 5 (41% of the total cases) and 6 (27% of the total cases). No mutations are, however, detected in the transactivation (exons 2-4) and oligomerization (exons 10-11) domains. Invasive carcinomas (stages II and III) are characterized with more frequent and diverse genetic alterations compared with benign tumors, most significantly at exon 5B (p=0.066) and at independently multiple sites (p=0.066). Earlier-onset cases (age of diagnosis < 50 yrs), known to be more clinico-pathologically aggressive, are diagnosed harboring more frequent p53 mutations centered at exon 7 (p=0

  1. Mutational myriad of tumor suppressor p53 in Filipino breast cancer: results and perspectives in molecular pathology and epidemiology

    Energy Technology Data Exchange (ETDEWEB)

    Deocaris, Custer C

    2000-04-01

    The p53 tumor suppressor is by far the most widely mutated gene in human cancers. p53 encodes a 53-kDa phosphoprotein, transcription-activator whose targets include genes and gene products that orchestrate genomic stability, cellular response to DNA damage, cell cycle progression apoptosis and aging (senescence). Analysis of the p53 gene profile has previously resulted in identifying several cancer-causative factors in the human setting, as well as, in creating a unique molecular profile of a tumor useful in the design of tailored-therapies for individual cancer patients. Our results in screening for p53 abnormalities in 140 Filipino patients with primary breast lesions confined from 1997-1998 in 5 major hospitals in Manila reveal that p53 plays an important role in the development and progression of breast cancer in at least 48% of all cases. Two methods of p53 analysis are employed, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction-temporal temperature gradient electrophoresis (PCR-TTGE). Inter-comparisons of method exhibit 63.3% concordance in 21 fresh breast carcinoma samples, with ELISA demonstrating 14% false-positives and 10% false-negatives. Only mutations in exon 7 (p=0.063) in the tumor samples how significant correlation with abnormal cellular elevation of p53. PCR-TTGE screening in a large series of 140 patients show that most genetic lesions are localized in exons 5 (41% of the total cases) and 6 (27% of the total cases). No mutations are, however, detected in the transactivation (exons 2-4) and oligomerization (exons 10-11) domains. Invasive carcinomas (stages II and III) are characterized with more frequent and diverse genetic alterations compared with benign tumors, most significantly at exon 5B (p=0.066) and at independently multiple sites (p=0.066). Earlier-onset cases (age of diagnosis < 50 yrs), known to be more clinico-pathologically aggressive, are diagnosed harboring more frequent p53 mutations centered at exon 7 (p=0

  2. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  3. Probing binding hot spots at protein-RNA recognition sites.

    Science.gov (United States)

    Barik, Amita; Nithin, Chandran; Karampudi, Naga Bhushana Rao; Mukherjee, Sunandan; Bahadur, Ranjit Prasad

    2016-01-29

    We use evolutionary conservation derived from structure alignment of polypeptide sequences along with structural and physicochemical attributes of protein-RNA interfaces to probe the binding hot spots at protein-RNA recognition sites. We find that the degree of conservation varies across the RNA binding proteins; some evolve rapidly compared to others. Additionally, irrespective of the structural class of the complexes, residues at the RNA binding sites are evolutionary better conserved than those at the solvent exposed surfaces. For recognitions involving duplex RNA, residues interacting with the major groove are better conserved than those interacting with the minor groove. We identify multi-interface residues participating simultaneously in protein-protein and protein-RNA interfaces in complexes where more than one polypeptide is involved in RNA recognition, and show that they are better conserved compared to any other RNA binding residues. We find that the residues at water preservation site are better conserved than those at hydrated or at dehydrated sites. Finally, we develop a Random Forests model using structural and physicochemical attributes for predicting binding hot spots. The model accurately predicts 80% of the instances of experimental ΔΔG values in a particular class, and provides a stepping-stone towards the engineering of protein-RNA recognition sites with desired affinity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    Science.gov (United States)

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  5. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    Science.gov (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  6. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  7. An adaptive molecular timer in p53-meidated cell fate decision

    Science.gov (United States)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  8. The critical role of catalase in prooxidant and antioxidant function of p53

    Science.gov (United States)

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  9. Penicillin-binding site on the Escherichia coli cell envelope

    International Nuclear Information System (INIS)

    Amaral, L.; Lee, Y.; Schwarz, U.; Lorian, V.

    1986-01-01

    The binding of 35 S-labeled penicillin to distinct penicillin-binding proteins (PBPs) of the cell envelope obtained from the sonication of Escherichia coli was studied at different pHs ranging from 4 to 11. Experiments distinguishing the effect of pH on penicillin binding by PBP 5/6 from its effect on beta-lactamase activity indicated that although substantial binding occurred at the lowest pH, the amount of binding increased with pH, reaching a maximum at pH 10. Based on earlier studies, it is proposed that the binding at high pH involves the formation of a covalent bond between the C-7 of penicillin and free epsilon amino groups of the PBPs. At pHs ranging from 4 to 8, position 1 of penicillin, occupied by sulfur, is considered to be the site that establishes a covalent bond with the sulfhydryl groups of PBP 5. The use of specific blockers of free epsilon amino groups or sulfhydryl groups indicated that wherever the presence of each had little or no effect on the binding of penicillin by PBP 5, the presence of both completely prevented binding. The specific blocker of the hydroxyl group of serine did not affect the binding of penicillin

  10. Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

    Science.gov (United States)

    Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

    2014-01-01

    Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

  11. Expression of p53-regulated proteins in human cultured lymphoblastoid TSCE5 and WTK1 cell lines during spaceflight

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko

    2012-01-01

    The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)

  12. Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes

    International Nuclear Information System (INIS)

    Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.

    2008-01-01

    Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53

  13. Gephyrin-binding peptides visualize postsynaptic sites and modulate neurotransmission

    DEFF Research Database (Denmark)

    Maric, Hans Michael; Hausrat, Torben Johann; Neubert, Franziska

    2017-01-01

    is associated with perturbation of the basic physiological action. Here we pursue a fundamentally different approach, by instead targeting the intracellular receptor-gephyrin interaction. First, we defined the gephyrin peptide-binding consensus sequence, which facilitated the development of gephyrin super......-binding peptides and later effective affinity probes for the isolation of native gephyrin. Next, we demonstrated that fluorescent super-binding peptides could be used to directly visualize inhibitory postsynaptic sites for the first time in conventional and super-resolution microscopy. Finally, we demonstrate...

  14. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  15. Radiotracers for per studies of neurotransmitter binding sites: Design considerations

    International Nuclear Information System (INIS)

    Kilbourn, M.R.

    1991-01-01

    Neurotransmitter binding sites, such as receptors, neuronal uptake systems, and vesicular uptake systems, are important targets for new radiopharmaceutical design. Selection of potential radioligands can be guided by in vitro laboratory data including such characteristics as selectivity and affinity for specific binding sites. However, development of PET radiotracers for use in vivo must include considerations of in vivo pharmacokinetics and metabolism. Introduction of potential radioligands is further narrowed by the demands of the radiochemical synthesis, which must produce radioligands of high chemical and radiochemical purity and of high specific activity. This paper will review examples of previous and current attempts by radiopharmaceutical chemists to meet these demands for new positron emitter-labeled radioligands for PET studies of a wide array of neurotransmitter binding sites

  16. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    International Nuclear Information System (INIS)

    Zhang, Y.; Woloschak, G.E.

    1997-01-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed

  17. The role of hypoxia, p53, and apoptosis in human cervical carcinoma pathogenesis

    International Nuclear Information System (INIS)

    Kim, Charlotte Y.; Tsai, Mitchell H.; Osmanian, Cynthia; Calkins, Dennise P.; Graeber, Thomas G.; Greenspan, David L.; Kennedy, Andrew S.; Rinker, Lillian H.; Varia, Mahesh A.; DiPaolo, Joseph A.; Peehl, Donna M.; Raleigh, James A.; Giaccia, Amato J.

    1997-01-01

    Objective: Low oxygen tension in the tumor microenvironment may have an important role during tumor growth, and is of particular prognostic significance in human cervical carcinoma. Because some human papillomavirus (HPV) infections are associated with cervical neoplasia, the relationship between hypoxia and apoptosis in primary cervical epithelial cells containing HPV16 E6 and E7, intact HPV 16 genome, and HPV positive cervical carcinoma cell lines, was examined. In addition, the relationship between hypoxia and apoptosis in spontaneous human cervical carcinomas was determined in situ. Materials and Methods: Primary normal human cervical epithelial cells were infected with retroviral vectors containing HPV16 E6 and E7 or transfected with a plasmid containing the whole HPV 16 genome. Clones were selected in neomycin containing medium. Exponentially growing cells were incubated under aerobic conditions (20% O 2 ), anaerobic conditions (0.02% O 2 ), or irradiated with 6 Gy. Analysis of apoptotic cells was performed by staining with Hoechst dye and propidium iodide and viewing with a fluorescent microscope. To determine the level of expression of the apoptotic modulators p53 and Bax, immunoblots were performed on whole cell extracts from treated cells. A clinical tumor hypoxia study was conducted at the University of North Carolina utilizing pimonidazole, a 2-nitroimidazole compound which binds irreversibly to cellular macromolecules under low oxygen conditions. Nine patients were enrolled with biopsy proven squamous cell carcinoma of the cervix and no prior treatment. Biopsies of the gross tumor were obtained after pimonidazole infusion. Contiguous histological sections were analyzed for hypoxia using a immunohistochemical technique and for apoptosis using TUNEL. Results: In vitro, hypoxia uncoupled p53 from E6 mediated degradation, and stimulated both p53 induction and apoptosis in primary cervical epithelial cells infected with the HPV E6 and E7 genes. In contrast

  18. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    Science.gov (United States)

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.

  19. Neem oil limonoids induces p53-independent apoptosis and autophagy

    Science.gov (United States)

    Chandra, Dhyan

    2012-01-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  20. Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site.

    Science.gov (United States)

    Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J; Hogle, James M

    2016-01-13

    Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. Regulation of p53 by reversible post-transcriptional and post-translational mechanisms in liver and skeletal muscle of an anoxia tolerant turtle, Trachemys scripta elegans.

    Science.gov (United States)

    Zhang, Jing; Biggar, Kyle K; Storey, Kenneth B

    2013-01-15

    The red-eared slider turtle (Trachemys scripta elegans) exhibits well-developed natural anoxia tolerance that depends on multiple biochemical adaptations, including anoxia-induced hypometabolism. We hypothesized that signaling by the p53 protein could aid in establishing the hypometabolic state by arresting the cell cycle, protecting against DNA damage as well as altering pathways of energy metabolism. Immunoblotting was used to evaluate the regulation and post-transcriptional modifications of p53 in liver and skeletal muscle of red-eared slider turtles subjected to 5h or 20h of anoxic submergence. Tissue specific regulation of p53 was observed with the liver showing a more rapid activation of p53 in response to anoxia as well as differential expression of seven serine phosphorylation and two lysine acetylation sites when compared with skeletal muscle. Protein expression of MDM2, a major p53 inhibitor, was also examined but did not change during anoxia. Reverse-transcriptase PCR was used to assess transcript levels of selected p53 target genes (14-3-3σ, Gadd45α and Pgm) and one microRNA (miR-34a); results showed down-regulation of Pgm and up-regulation of the other three. These findings show an activation of p53 in response to anoxia exposure and suggest an important role for the p53 stress response pathway in regulating natural anoxia tolerance and hypometabolism in a vertebrate facultative anaerobe. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  3. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  4. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  5. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    NARCIS (Netherlands)

    Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent

  6. FGFR3 and P53 characterize alternative genetic pathways in the pathogenesis of urothelial cell carcinoma

    NARCIS (Netherlands)

    B.W. van Rhijn (Bas); Th.H. van der Kwast (Theo); A.N. Vis (André); W.J. Kirkels (Wim); E.R. Boeve; A.C. Jobsis; E.C. Zwarthoff (Ellen)

    2004-01-01

    textabstractFibroblast growth factor receptor 3 (FGFR3) and P53 mutations are frequently observed in bladder cancer. We here describe the distribution of FGFR3 mutations and P53 overexpression in 260 primary urothelial cell carcinomas. FGFR3 mutations were observed in 59% and P53

  7. GRIM-19 disrupts E6/E6AP complex to rescue p53 and induce apoptosis in cervical cancers.

    Directory of Open Access Journals (Sweden)

    Ying Zhou

    Full Text Available BACKGROUND: Our previous studies showed a down-regulation of GRIM-19 in primary human cervical cancers, and restoration of GRIM-19 induced tumor regression. The induction of tumor suppressor protein p53 ubiquitination and degradation by E6 oncoportein of high risk-HPV through forming a stable complex with E6AP is considered as a critical mechanism for cervical tumor development. The aims of this study were to determine the potential role of GRIM-19 in rescuing p53 protein and inducing cervical cancer cell apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: The protein levels of GRIM-19 and p53 were detected in normal cervical tissues from 45 patients who underwent hysterectomy for reasons other than neoplasias of either the cervix or endometrium, and cervical cancer tissues from 60 patients with non-metastatic squamous epithelial carcinomas. Coimmunoprecipitation and GST pull-down assay were performed to examine the interaction of GRIM-19 with 18E6 and E6AP in vivo and in vitro respectively. The competition of 18E6 with E6AP in binding GRIM-19 by performing competition pull-down assays was designed to examine the disruption of E6/E6AP complex by GRIM-19. The augment of E6AP ubiquitination by GRIM-19 was detected in vivo and in vitro ubiquitination assay. The effects of GRIM-19-dependent p53 accumulation on cell proliferation, cell cycle, apoptosis were explored by MTT, flow cytometry and transmission electron microscopy respectively. The tumor suppression was detected by xenograft mouse model. CONCLUSION/SIGNIFICANCE: The levels of GRIM-19 and p53 were concurrently down regulated in cervical cancers. The restoration of GRIM-19 can induce ubiquitination and degradation of E6AP, and disrupt the E6/E6AP complex through the interaction of N-terminus of GRIM-19 with both E6 and E6AP, which protected p53 from degradation and promoted cell apoptosis. Tumor xenograft studies also revealed the suppression of p53 degradation in presence of GRIM-19. These data

  8. Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

    Science.gov (United States)

    White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

    2014-08-01

    The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

  9. Multiple [3H]-nemonapride binding sites in calf brain.

    Science.gov (United States)

    Helmeste, D M; Tang, S W; Li, M; Fang, H

    1997-07-01

    [3H]-Nemonapride has been the ligand of choice to label D4 dopamine receptors. Its specificity was questioned when it was discovered that sigma (sigma) sites were also labeled by [3H]-nemonapride. To further characterize the binding of [3H]-nemonapride, three areas of calf brain (striatum, frontal cortex and cerebellum) were examined. In all three areas, [3H]-nemonapride labeled multiple sites. Dopaminergic and sigma sites were the most prominent. The sigma binding profile was sigma-1 like with a Ki binding profile as follows (in order of decreasing potency): haloperidol, PPAP, pentazocine, DTG, U-50488, R(+)-3-PPP. Experiments using sulpiride and pentazocine to block striatal dopaminergic and sigma sites, respectively, revealed additional, not previously characterized binding sites for [3H]-nemonapride. One component which was present in striatum but not in frontal cortex or cerebellum, had affinity for some neuroleptics and WB-4101, but not for typical serotonergic agents. Thus, [3H]-nemonapride has no selectivity for dopamine receptors unless stringent experimental conditions are met.

  10. Binding-site assessment by virtual fragment screening.

    Directory of Open Access Journals (Sweden)

    Niu Huang

    2010-04-01

    Full Text Available The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock approximately 11,000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors.

  11. p53 shapes genome-wide and cell type-specific changes in microRNA expression during the human DNA damage response.

    Science.gov (United States)

    Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R

    2014-01-01

    The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.

  12. Griseofulvin stabilizes microtubule dynamics, activates p53 and inhibits the proliferation of MCF-7 cells synergistically with vinblastine

    International Nuclear Information System (INIS)

    Rathinasamy, Krishnan; Jindal, Bhavya; Asthana, Jayant; Singh, Parminder; Balaji, Petety V; Panda, Dulal

    2010-01-01

    Griseofulvin, an antifungal drug, has recently been shown to inhibit proliferation of various types of cancer cells and to inhibit tumor growth in athymic mice. Due to its low toxicity, griseofulvin has drawn considerable attention for its potential use in cancer chemotherapy. This work aims to understand how griseofulvin suppresses microtubule dynamics in living cells and sought to elucidate the antimitotic and antiproliferative action of the drug. The effects of griseofulvin on the dynamics of individual microtubules in live MCF-7 cells were measured by confocal microscopy. Immunofluorescence microscopy, western blotting and flow cytometry were used to analyze the effects of griseofulvin on spindle microtubule organization, cell cycle progression and apoptosis. Further, interactions of purified tubulin with griseofulvin were studied in vitro by spectrophotometry and spectrofluorimetry. Docking analysis was performed using autodock4 and LigandFit module of Discovery Studio 2.1. Griseofulvin strongly suppressed the dynamic instability of individual microtubules in live MCF-7 cells by reducing the rate and extent of the growing and shortening phases. At or near half-maximal proliferation inhibitory concentration, griseofulvin dampened the dynamicity of microtubules in MCF-7 cells without significantly disrupting the microtubule network. Griseofulvin-induced mitotic arrest was associated with several mitotic abnormalities like misaligned chromosomes, multipolar spindles, misegregated chromosomes resulting in cells containing fragmented nuclei. These fragmented nuclei were found to contain increased concentration of p53. Using both computational and experimental approaches, we provided evidence suggesting that griseofulvin binds to tubulin in two different sites; one site overlaps with the paclitaxel binding site while the second site is located at the αβ intra-dimer interface. In combination studies, griseofulvin and vinblastine were found to exert synergistic

  13. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    Science.gov (United States)

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  14. Eel calcitonin binding site distribution and antinociceptive activity in rats

    International Nuclear Information System (INIS)

    Guidobono, F.; Netti, C.; Sibilia, V.; Villa, I.; Zamboni, A.; Pecile, A.

    1986-01-01

    The distribution of binding site for [ 125 I]-eel-calcitonin (ECT) to rat central nervous system, studied by an autoradiographic technique, showed concentrations of binding in the diencephalon, the brain stem and the spinal cord. Large accumulations of grains were seen in the hypothalamus, the amygdala, in the fasciculus medialis prosencephali, in the fasciculus longitudinalis medialis, in the ventrolateral part of the periventricular gray matter, in the lemniscus medialis and in the raphe nuclei. The density of grains in the reticular formation and in the nucleus tractus spinalis nervi trigemini was more moderate. In the spinal cord, grains were scattered throughout the dorsal horns. Binding of the ligand was displaced equally by cold ECT and by salmon CT(sCT), indicating that both peptides bind to the same receptors. Human CT was much weaker than sCT in displacing [ 125 I]-ECT binding. The administration of ECT into the brain ventricles of rats dose-dependently induced a significant and long-lasting enhancement of hot-plate latencies comparable with that obtained with sCT. The antinociceptive activity induced by ECT is compatible with the topographical distribution of binding sites for the peptide and is a further indication that fish CTs are active in the mammalian brain

  15. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    Science.gov (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  16. CLIPZ: a database and analysis environment for experimentally determined binding sites of RNA-binding proteins.

    Science.gov (United States)

    Khorshid, Mohsen; Rodak, Christoph; Zavolan, Mihaela

    2011-01-01

    The stability, localization and translation rate of mRNAs are regulated by a multitude of RNA-binding proteins (RBPs) that find their targets directly or with the help of guide RNAs. Among the experimental methods for mapping RBP binding sites, cross-linking and immunoprecipitation (CLIP) coupled with deep sequencing provides transcriptome-wide coverage as well as high resolution. However, partly due to their vast volume, the data that were so far generated in CLIP experiments have not been put in a form that enables fast and interactive exploration of binding sites. To address this need, we have developed the CLIPZ database and analysis environment. Binding site data for RBPs such as Argonaute 1-4, Insulin-like growth factor II mRNA-binding protein 1-3, TNRC6 proteins A-C, Pumilio 2, Quaking and Polypyrimidine tract binding protein can be visualized at the level of the genome and of individual transcripts. Individual users can upload their own sequence data sets while being able to limit the access to these data to specific users, and analyses of the public and private data sets can be performed interactively. CLIPZ, available at http://www.clipz.unibas.ch, aims to provide an open access repository of information for post-transcriptional regulatory elements.

  17. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

    Science.gov (United States)

    Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

    2013-04-16

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

  18. p53 expression in biopsies from children with Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik

    2002-01-01

    based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....

  19. Dangerous connections : on binding site models of infectious disease dynamics

    NARCIS (Netherlands)

    Leung, Ka Yin; Diekmann, Odo

    2017-01-01

    We formulate models for the spread of infection on networks that are amenable to analysis in the large population limit. We distinguish three different levels: (1) binding sites, (2) individuals, and (3) the population. In the tradition of physiologically structured population models, the

  20. Fabrication of supramolecular frameworks by tuning the binding site ...

    Indian Academy of Sciences (India)

    Administrator

    Fabrication of supramolecular frameworks by tuning the binding site of a tripodal ligand with d. 10 metal ions 803. Table 1. Crystal data and structure refinement parameters for 1 and 2. 1 .... e-mail: deposit@ccdc.cam.ac.uk web: http://www. ccdc. cam.ac.uk/deposit]. Supplementary figures and tables can be found in website ...

  1. Autologous peptides constitutively occupy the antigen binding site on Ia

    DEFF Research Database (Denmark)

    Buus, S; Sette, A; Colon, S M

    1988-01-01

    Low molecular weight material associated with affinity-purified class II major histocompatibility complex (MHC) molecules of mouse (Ia) had the expected properties of peptides bound to the antigen binding site of Ia. Thus, the low molecular weight material derived from the I-Ad isotype...

  2. Incorporating evolution of transcription factor binding sites into ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Identifying transcription factor binding sites (TFBSs) is essential to elucidate ... alignments with parts annotated as gap lessly aligned TFBSs (pair-profile hits) are generated. Moreover, the pair- profile related parameters are derived in a sound statistical framework. ... Much research has gone into the study of the evolution of.

  3. Stimulation of autophagy by the p53 target gene Sestrin2.

    Science.gov (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  4. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    Science.gov (United States)

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  5. Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation

    International Nuclear Information System (INIS)

    Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki

    2001-01-01

    We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)

  6. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra

    2009-06-01

    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  7. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    Science.gov (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  8. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

    2003-01-01

    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  9. Friend or Foe: MicroRNAs in the p53 network.

    Science.gov (United States)

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  10. Essentials in clinical application of p53 for tumors intervention-example of liver cancer

    International Nuclear Information System (INIS)

    Guan Yongsong; He Qing

    2008-01-01

    Recombinant human adenovirus p53 (Ad-p53)injection has been used for treating tumors in combination with several local therapeutic methods. Taking liver cancer as an example, this article introduces the combination of Ad-p53 in procedures of interventional therapy. Mechanisms of their effects are emphasized to pursue an optimal synergism in killing tumors. Intratumoral injection is suggested as the first choice of Ad- p53 administration with the least recommended dosage for a single tumor. The optimal time for intervention of liver cancer is supposed to be 2 to 5 days after the administration of Ad-p53. There are several theories on the therapeutic method taking p53 as a target, some of them are contradictional; therefore one has to select either activating or inhibiting the p53 pathway beforehand. For advanced malignancies, the selection should be cautious for appropriater cases from the proper candidates. (authors)

  11. Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline

    Directory of Open Access Journals (Sweden)

    Noriko Mori

    2004-10-01

    Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.

  12. Association of p53 protein expression with clinical outcome in advanced supraglottic cancer

    International Nuclear Information System (INIS)

    Kang, Jin Oh; Hong, Seong Eon

    1998-01-01

    To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression

  13. Inhibition of Endothelial p53 Improves Metabolic Abnormalities Related to Dietary Obesity

    Directory of Open Access Journals (Sweden)

    Masataka Yokoyama

    2014-06-01

    Full Text Available Accumulating evidence has suggested a role for p53 activation in various age-associated conditions. Here, we identified a crucial role of endothelial p53 activation in the regulation of glucose homeostasis. Endothelial expression of p53 was markedly upregulated when mice were fed a high-calorie diet. Disruption of endothelial p53 activation improved dietary inactivation of endothelial nitric oxide synthase that upregulated the expression of peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscle, thereby increasing mitochondrial biogenesis and oxygen consumption. Mice with endothelial cell-specific p53 deficiency fed a high-calorie diet showed improvement of insulin sensitivity and less fat accumulation, compared with control littermates. Conversely, upregulation of endothelial p53 caused metabolic abnormalities. These results indicate that inhibition of endothelial p53 could be a novel therapeutic target to block the vicious cycle of cardiovascular and metabolic abnormalities associated with obesity.

  14. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  15. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the splee