WorldWideScience

Sample records for p53 accumulation determined

  1. Chronology of p53 protein accumulation in gastric carcinogenesis

    NARCIS (Netherlands)

    Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1995-01-01

    p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early

  2. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats

    2004-01-01

    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  3. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra

    2009-06-01

    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  4. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    Science.gov (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  5. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

    Science.gov (United States)

    Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

    2011-01-01

    The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasmic reticulum (ER) protein that is shuttled to the ER via an N-terminal endoplasmic reticulum targeting signal. One important function of the ER is synthesis of neutral lipids that are packaged into lipid droplets whose biogenesis occurs from ER-derived membranes. DHRS3 is enriched at focal points of lipid droplet budding where it also localizes to the phospholipid monolayer of ER-derived lipid droplets. p53 promotes lipid droplet accumulation in a manner consistent with DHRS3 enrichment in the ER. As a p53 target gene, the observations of Dhrs3 location and potential function provide novel insight into an unexpected role for p53 in lipid droplet dynamics with implications in cancer cell metabolism and obesity. PMID:21659514

  6. p53 nuclear accumulation and multiploidy are adverse prognostic factors in surgically resected stage II colorectal cancers independent of fluorouracil-based adjuvant therapy.

    Science.gov (United States)

    Buglioni, S; D'Agnano, I; Vasselli, S; Perrone Donnorso, R; D'Angelo, C; Brenna, A; Benevolo, M; Cosimelli, M; Zupi, G; Mottolese, M

    2001-09-01

    To identify the prognostically highest risk patients, DNA content and p53 nuclear or cytoplasmic accumulation, evaluated by monoclonal antibody DO7 and polyclonal antibody CM1, were determined in 94 surgically resected stage II (Dukes B2) colorectal cancers, treated or not with adjuvant 5-fluorouracil-based chemotherapy. Sixty-one (65%) of the tumors were aneuploid, 16 (17%) of which had a multiploid DNA content; 50 (53%) displayed DO7 nuclear p53 accumulation, and 44 (47%) showed cytoplasmic CM1 positivity. In multivariate analysis, only multiploidy and p53 nuclear positivity emerged as independent prognostic indicators of a poorer outcome. Positivity for p53 was associated with shorter survival in 5-fluorouracil-treated and untreated patients. Therefore, in patients with Dukes B2 colorectal cancer, a biologic profile based on the combined evaluation of DNA multiploidy and p53 status can provide valuable prognostic information, identifying patients to be enrolled in alternative, more aggressive therapeutic trials.

  7. The structure formed by inverted repeats in p53 response elements determines the transactivation activity of p53 protein

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Čechová, Jana; Battistin, M.; Coufal, Jan; Jagelská, Eva; Raimondi, I.; Inga, A.

    2017-01-01

    Roč. 483, č. 1 (2017), s. 516-521 ISSN 0006-291X R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : tumor-suppressor p53 * cruciform structures * dna-conformation Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.466, year: 2016

  8. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    Science.gov (United States)

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  9. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

    OpenAIRE

    Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

    2011-01-01

    The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasm...

  10. The prognostic significance of accumulation of p53 protein in stage III non-small cell lung cancer treated by radiotherapy

    International Nuclear Information System (INIS)

    Langendijk, J.A.; Thunnissen, F.B.J.M.; Lamers, R.J.S.; Jong, J.M.A. de; Velde, G.P.M. ten; Wouters, E.F.M.

    1995-01-01

    In the present study the prognostic significance of accumulation of nuclear p53 protein on survival and freedom from local progression was investigated. Formalin-fixed, paraffin-embedded sections obtained by bronchoscopy or mediastinoscopy were used to examine the expression of nuclear p53 protein using immunohistochemistry. In 37 cases (57%), overexpression of the p53 protein was detected. No relation was found between p53 expression and other pretreatment variables. Response to radiotherapy was found in 11 p53-negative cases (65%) versus 10 p53-positive cases (42%). Freedom from local progression was significantly better in the p53-negative cases as compared with the p53-positive cases. The p53-negative cases who responded to radiotherapy showed an excellent freedom from local progression rate after 2 years of 100%, whereas all p53-positive cases without response to radiotherapy showed local progression within 24 months. Overall survival between p53-negative and -positive cases did not differ, however the disease-specific survival was found to be worse in the p53-positive cases as compared to the negative cases (median survival 8.4 vs. 14.4 months (P < 0.05)). No correlation was found between p53 expression and the frequency of distant metastases. In conclusion, the results of this study suggest that p53 protein expression may be of prognostic value on freedom from local progression in non-small cell lung carcinoma

  11. P53 activation, a key event of the cellular response to gamma irradiation; L'activation de la proteine p53, un evenement determinant de la reponse cellulaire aux radiations ionisantes

    Energy Technology Data Exchange (ETDEWEB)

    Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)

    2002-03-01

    The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)

  12. Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53

    Science.gov (United States)

    Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich

    2011-01-01

    Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600

  13. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  14. The influence of the level of lamina propria invasion and the prevalence of p53 nuclear accumulation on survival in stage T1 transitional cell bladder cancer

    DEFF Research Database (Denmark)

    Hermann, G G; Horn, T; Steven, K

    1998-01-01

    PURPOSE: We assessed the influence of the level of lamina propria invasion and the prevalence of p53 nuclear immunoreactivity on the survival of patients with stage T1 transitional cell bladder cancer. MATERIALS AND METHODS: All patients presenting with stage T1 bladder cancer were prospectively...... and routinely grouped according to the level of lamina propria invasion. Invasion of the tumor stalk was defined as stage T1a, invasion of the lamina propria proper superficial to the level of muscularis mucosa as stage T1b and into or deeper than the muscularis mucosa as stage T1c. The p53 nuclear...... related to age, level of lamina propria invasion and presence of p53 nuclear accumulation. For this subpopulation overall survival was 67%, and 79% for stage T1a, 70% for stage T1b and 57% for stage T1c (p

  15. Time-dependent effect of severe hypoxia/reoxygenation on oxidative stress level, antioxidant capacity and p53 accumulation in mitochondria of rat heart

    Directory of Open Access Journals (Sweden)

    O. A. Gonchar

    2017-12-01

    Full Text Available The intensity of oxidative stress, protein expression of antiapoptotic Bcl-2 as well as antioxidant enzymes manganese superoxide dismutase (MnSOD and glutathione peroxidase (GPx and their regulator p53 were studied in the mitochondria of rat heart. Sessions of repeated hypoxia/reoxygenation ((H/R, 5 cycles of 10 min hypoxia (5.5% O2 in N2 alternated with 10 min normoxia, daily were performed in our study. It was shown that short-term sessions of H/R (during 1-3 days caused a significant increase in the oxidative stress markers (ROS formation and lipid peroxidation, mitochondrial p53 translocation, a decrease in MnSOD­ protein expression/activity and Bcl-2 protein content, but up-regulated GPx. We have demonstrated that prolonged H/R (7-14 days induced myocardial tolerance to fluctuation in oxygen levels that was associa­ted with the reduction in mitochondrial p53 protein content, elevation of mitochondrial Bcl-2 protein level, and increase in antioxidant capacity. A close correlation between the mitochondrial p53 accumulation and ROS formation as well as the activity and protein content of MnSOD and GPx allowed us to assume that p53 took an active part in the regulation of prooxidant/antioxidant balance in mitochondria of rat heart during repeated H/R.

  16. Disposable Amperometric Immunosensor for the Determination of Human P53 Protein in Cell Lysates Using Magnetic Micro-Carriers

    Directory of Open Access Journals (Sweden)

    María Pedrero

    2016-11-01

    Full Text Available An amperometric magnetoimmunosensor for the determination of human p53 protein is described in this work using a sandwich configuration involving the covalent immobilization of a specific capture antibody onto activated carboxylic-modified magnetic beads (HOOC-MBs and incubation of the modified MBs with a mixture of the target protein and horseradish peroxidase-labeled antibody (HRP-anti-p53. The resulting modified MBs are captured by a magnet placed under the surface of a disposable carbon screen-printed electrode (SPCE and the amperometric responses are measured at −0.20 V (vs. an Ag pseudo-reference electrode, upon addition of hydroquinone (HQ as a redox mediator and H2O2 as the enzyme substrate. The magnetoimmunosensing platform was successfully applied for the detection of p53 protein in different cell lysates without any matrix effect after a simple sample dilution. The results correlated accurately with those provided by a commercial ELISA kit, thus confirming the immunosensor as an attractive alternative for rapid and simple determination of this protein using portable and affordable instrumentation.

  17. Regulation of p53 tetramerization and nuclear export by ARC.

    Science.gov (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

    2007-12-26

    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  18. The influence of the level of lamina propria invasion and the prevalence of p53 nuclear accumulation on survival in stage T1 transitional cell bladder cancer

    DEFF Research Database (Denmark)

    Hermann, G G; Horn, T; Steven, K

    1998-01-01

    and routinely grouped according to the level of lamina propria invasion. Invasion of the tumor stalk was defined as stage T1a, invasion of the lamina propria proper superficial to the level of muscularis mucosa as stage T1b and into or deeper than the muscularis mucosa as stage T1c. The p53 nuclear...

  19. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  20. Restriction of human herpesvirus 6B replication by p53

    DEFF Research Database (Denmark)

    Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina

    2008-01-01

    Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...

  1. Hormonal control of p53 and chemoprevention

    International Nuclear Information System (INIS)

    Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C

    2002-01-01

    Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

  2. Elevation of cAMP Levels Inhibits Doxorubicin-Induced Apoptosis in Pre- B ALL NALM- 6 Cells Through Induction of BAD Phosphorylation and Inhibition of P53 Accumulation.

    Science.gov (United States)

    Fatemi, Ahmad; Kazemi, Ahmad; Kashiri, Meysam; Safa, Majid

    2015-01-01

    Recognition of the molecular mechanisms of cAMP action against DNA damage-induced apoptosis can be useful to improve the efficacy of DNA damaging therapeutic agents. Considering the critical role of bcl-2-associated death promoter (BAD) and p53 proteins in DNA damage -induced apoptosis, the aim of this study was to assess the effect of cAMP-elevating agents on these proteins in doxorubicin-treated pre-B acute lymphoblastic leukemia (pre-B ALL) NALM-6 cells.The pre-B ALL cell line NALM-6 was cultured and treated with doxorubicin in combination with or without cAMP-elevating agents forskolin and 3-isobutyl-1-methylxanthine (IBMX). Cell viability was measured by trypan blue staining and MTT assay. For evaluation of apoptosis, annexin-V staining by flow cytometry and caspase-3 activity assay were used. Protein expression of p53, BAD and phoshorylated BAD was detected by western blotting analysis.cAMP-increasing agents diminished the doxorubicin-mediated cytotoxicity in NALM-6 cells as indicated by the viability assays. Annexin-V apoptosis assay showed that the cAMP-elevating agents decreased doxorubicin-induced apoptosis. Moreover, doxorubicin-induced caspase-3 activity was attenuated in the presence of cAMP-increasing agents. Western blot results revealed the reduced expression of p53 protein in cells treated with combination of cAMP-elevating agents and doxorubicin in contrast to cells treated with doxorubicin alone. Expression of total BAD protein was not affected by doxorubicin and cAMP-elevating agents. However, phosphorylation of BAD protein was induced in the presence of cAMP-elevating agents. Our study suggests that elevated cAMP levels inhibit doxorubicin-induced apoptosis in pre-B ALL cells through induction of BAD phosphorylation and abrogation of p53 accumulation.

  3. Mutual interactions between P53 and growth factors in cancer

    NARCIS (Netherlands)

    Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE

    1998-01-01

    The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

  4. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  5. Immunohistochemical analysis of P53 protein in odontogenic cysts

    Science.gov (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  6. Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla

    2004-01-01

    Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

  7. Analysis of p53- immunoreactivity in astrocytic brain tumors

    Directory of Open Access Journals (Sweden)

    Shinkarenko T.V.

    2016-12-01

    Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

  8. The nucleolus directly regulates p53 export and degradation.

    Science.gov (United States)

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  9. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  10. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  11. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

    2005-01-01

    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  12. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  13. Dual-cyclical nucleic acid strand-displacement polymerization based signal amplification system for highly sensitive determination of p53 gene.

    Science.gov (United States)

    Xu, Jianguo; Wu, Zai-Sheng; Li, Hongling; Wang, Zhenmeng; Le, Jingqing; Zheng, Tingting; Jia, Lee

    2016-12-15

    In the present study, we proposed a novel dual-cyclical nucleic acid strand-displacement polymerization (dual-CNDP) based signal amplification system for highly sensitive determination of tumor suppressor genes. The system primarily consisted of a signaling hairpin probe (SHP), a label-free hairpin probe (LHP) and an initiating primer (IP). The presence of target DNA was able to induce one CNDP through continuous process of ligation, polymerization and nicking, leading to extensively accumulation of two nicked triggers (NT1 and NT2). Intriguingly, the NT1 could directly hybridize SHP, while the NT2 could act as the target analog to induce another CNDP. The resulting dual-CNDP contributed the striking signal amplification, and only a very weak blank noise existed since the ligation template of target was not involved. In this case, the target could be detected in a wide linear range (5 orders of magnitude), and a low detection limit (78 fM) was obtained, which is superior to most of the existing fluorescent methods. Moreover, the dual-CNDP sensing system provided a high selectivity towards target DNA against mismatched target and was successfully applied to analysis of target gene extracted from cancer cells or in human serum-contained samples, indicating its great potential for practical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. p53 mutations promote proteasomal activity.

    Science.gov (United States)

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  15. G2-block after irradiation of cells with different p53 status

    International Nuclear Information System (INIS)

    Zoelzer, Friedo; Jagetia, Ganesh; Streffer, Christian

    2014-01-01

    Although it is clear that functional p53 is not required for radiation-induced G 2 block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G 2 compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G 2 phase itself. We observed the movement of BrdU-labeled cells through G 2 and M into G 1 . From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G 2 and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G 2 and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G 2 compartment alone is misleading when differences in the G 2 block are investigated and that the G 2 block itself is indeed independent of functional p53. (orig.) [de

  16. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-01-01

    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  17. P53 overexpression in head and neck carcinoma and radiotherapy results

    International Nuclear Information System (INIS)

    Awwad, Saif; Jaros, Evelyn; Somes, James; Lunec, John

    1996-01-01

    Purpose: P53 gene mutations are the common genetic changes encountered in human cancers, and there is extensive evidence that the P53 status may determine tumor response to therapy. This study was carried out to investigate whether there is any correlation between accumulation (overexpression) of P53 protein and poor prognosis in patients with head and neck carcinomas treated with radical radiotherapy. Methods and Materials: Seventy-nine patients with head and neck carcinomas who were diagnosed and treated in 1989-90 with curative radiotherapy were studied retrospectively. Paraffin sections from archival material were studied using immunohistochemical staining (IHC) with mouse monoclonal antibodies (D0-7) to human P53 protein. Univariate and multivariate analysis of loco-regional tumor control and patient survival were performed on possible prognostic factors. Results: Forty-two (53%) patients showed positive IHC staining in their tumors. Fifty-three percent of the laryngeal, 64% of the oropharyngeal, and 43% of the oral cavity carcinomas showed P53 overexpression. All tumor specimens with vascular, lymphatic, and/or sarcolemmal invasion showed P53 overexpression. The proportion of tumor-stained nuclei was higher in the poorly differentiated than in the well and moderately differentiated tumors (p < 0.05), but there was no correlation with the patient overall or disease-free 5-year actuarial survival. There was no difference in the 5-year actuarial survival and disease-free survival between patients with P53 immunostaining in their tumors and those with no immunostaining (59% vs. 65% and 57% vs. 51%, respectively). The TNM tumor stage was the most significant prognostic factor with 5-year actuarial survival of 87% for early and 14% for late stages (p << 0.0001). There was a significant correlation between immunostaining and history of smoking (p = 0.02). Conclusion: The data demonstrate that the P53 accumulation as detected by immunohistochemical staining in a

  18. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  19. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  20. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

    1993-01-01

    textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

  2. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

    1993-01-01

    The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

  3. A dual role of p53 in the control of autophagy.

    Science.gov (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  4. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  5. p53 in differentiation of thyroid cancer

    International Nuclear Information System (INIS)

    Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

    1993-01-01

    P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

  6. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  7. Inhibition of Endothelial p53 Improves Metabolic Abnormalities Related to Dietary Obesity

    Directory of Open Access Journals (Sweden)

    Masataka Yokoyama

    2014-06-01

    Full Text Available Accumulating evidence has suggested a role for p53 activation in various age-associated conditions. Here, we identified a crucial role of endothelial p53 activation in the regulation of glucose homeostasis. Endothelial expression of p53 was markedly upregulated when mice were fed a high-calorie diet. Disruption of endothelial p53 activation improved dietary inactivation of endothelial nitric oxide synthase that upregulated the expression of peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscle, thereby increasing mitochondrial biogenesis and oxygen consumption. Mice with endothelial cell-specific p53 deficiency fed a high-calorie diet showed improvement of insulin sensitivity and less fat accumulation, compared with control littermates. Conversely, upregulation of endothelial p53 caused metabolic abnormalities. These results indicate that inhibition of endothelial p53 could be a novel therapeutic target to block the vicious cycle of cardiovascular and metabolic abnormalities associated with obesity.

  8. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    OpenAIRE

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...

  9. P53 Gene Mutagenesis in Breast Cancer

    National Research Council Canada - National Science Library

    Sommer, Steve S

    2005-01-01

    .... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

  10. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  11. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    Directory of Open Access Journals (Sweden)

    Lin Tai-Du

    2010-12-01

    Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

  13. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

    2001-01-01

    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  14. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    Science.gov (United States)

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  15. p53-Mediated Molecular Control of Autophagy in Tumor Cells

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic

    2018-03-01

    Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.

  16. Role for p53 in the Recovery of Transcription and Protection Against Apoptosis Induced by Ultraviolet Light

    Directory of Open Access Journals (Sweden)

    Bruce C. McKay

    1999-08-01

    Full Text Available We have previously suggested that the inhibition of RNA polymerase II-mediated transcription after exposure to UV light promotes the accumulation of p53 and the induction of apoptosis (Oncogene 13, 823–831. However, it was not clear whether p53 induction was contributing to apoptosis. Here we report that apoptosis is triggered at lower UV doses in p53-deficient Li-Fraumeni syndrome (LFS and human papillomavirus (HPV E6 expressing fibroblasts than in normal cells, suggesting that p53 can be protective against UVinduced apoptosis. There is no significant difference in the effect of UV-irradiation on the cell cycle distribution of normal and primary LFS fibroblasts. Importantly, the recovery of nascent mRNA synthesis in all p53-deficient fibroblasts is significantly impaired compared with control cells after exposure to relevant doses of UV light. Taken together, our results suggest that wild-type p53 can protect cells against UV-induced apoptosis by facilitating the recovery of transcription. Furthermore, we suggest that the capacity of cells to recover transcription after genotoxic damage is an important determinant of sensitivity to apoptosis.

  17. An adaptive molecular timer in p53-meidated cell fate decision

    Science.gov (United States)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  18. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  19. G2-block after irradiation of cells with different p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Zoelzer, Friedo [University of South Bohemia in Ceske Budejovice, Department of Radiology, Toxicology and Civil Protection, Faculty of Health and Social Studies, Ceske Budejovice (Czech Republic); University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Jagetia, Ganesh [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Mizoram University, Department of Zoology, School of Life Sciences, Aizawl (India); Streffer, Christian [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany)

    2014-11-15

    Although it is clear that functional p53 is not required for radiation-induced G{sub 2} block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G{sub 2} compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G{sub 2} phase itself. We observed the movement of BrdU-labeled cells through G{sub 2} and M into G{sub 1}. From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G{sub 2} and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G{sub 2} and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G{sub 2} compartment alone is misleading when differences in the G{sub 2} block are investigated and that the G{sub 2} block itself is indeed independent of functional p53. (orig.) [German] Obwohl klar ist, dass ein funktionelles p53-Protein fuer die Ausbildung des strahleninduzierten G{sub 2}-Blocks nicht zwingend erforderlich ist, gibt es experimentelle Befunde, die nahe legen, dass p53 in diesem Zusammenhang doch eine gewisse Rolle spielt. Zum Beispiel bestaetigen wir hier fruehere Berichte, dass die Akkumulation von Zellen im G{sub 2}-Kompartiment bei p53-Mutanten deutlich spaeter nach Bestrahlung ihr Maximum erreicht als bei p53-Wildtypen. Es bleibt jedoch zu klaeren, ob dieser Unterschied seinen Grund in einem laengeren Block der G{sub 2}-Phase selbst hat. Beobachtet wurde die Bewegung von BrdU-markierten Zellen durch G{sub 2} und M nach G{sub 1}. Aus der zeitlichen Veraenderung des Anteils markierter Zellen im G{sub 1}-Kompartiment des naechsten Zellzyklus konnte die

  20. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  1. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  2. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    Science.gov (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  3. Regulation of Metabolic Activity by p53

    Directory of Open Access Journals (Sweden)

    Jessica Flöter

    2017-05-01

    Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

  4. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  5. Overexpression of p53 in Nigerian breast cancers and its ...

    African Journals Online (AJOL)

    This study sought to determine the expression of p53 protein as well as the relationship with oestrogen receptor (ER) and progesterone receptor (PR) proteins. Methodology: Formalin-fixed, paraffin-embedded tissue samples of diagnosed invasive breast cancer were obtained from the Department of Anatomic and ...

  6. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  7. Human herpesvirus 6B inhibits cell proliferation by a p53-independent pathway

    DEFF Research Database (Denmark)

    Øster, Bodil; Kaspersen, M.D.; Kofod-Olsen, Emil

    2006-01-01

    BACKGROUND: Various forms of cellular stress can activate the tumour suppressor protein p53, an important regulator of cell cycle arrest, apoptosis, and cellular senescence. Cells infected by human herpesvirus 6B (HHV-6B) accumulate aberrant amounts of p53. OBJECTIVES: The aim of this study...

  8. Determination of HER2 and p53 Mutations by Sequence Analysis Method and EGFR/Chromosome 7 Gene Status by Fluorescence in Situ Hybridization for the Predilection of Targeted Therapy Modalities in Immunohistochemically Triple Negative Breast Carcinomas in Turkish Population.

    Science.gov (United States)

    Pala, Emel Ebru; Bayol, Umit; Keskin, Elif Usturali; Ozguzer, Alp; Kucuk, Ulku; Ozer, Ozge; Koc, Altug

    2015-09-01

    Triple negative breast cancer (TNBC), an agressive subtype accounts nearly 15 % of all breast carcinomas. Conventional chemotherapy is the only treatment modality thus new, effective targeted therapy methods have been investigated. Epidermal growth factor receptor (EGFR) inhibitors give hope according to the recent studies results. Also therapeutic agents have been tried against aberrant p53 signal activity as TNBC show high p53 mutation rates. Our aim was to detect the incidence of mutations/amplifications identified in TNBC in our population. Here we used sequence analysis to detect HER2 (exon 18-23), p53 (exon 5-8) mutations; fluorescence in situ hybridization (FISH) method to analyse EGFR/chromosome 7 centromere gene status in 82 immunohistochemically TNBC. Basaloid phenotype was identified in 49 (59.8 %) patients. EGFR amplification was noted in 5 cases (6.1 %). All EGFR amplified cases showed EGFR overexpression by immunohistochemistry (IHC). p53 mutations were identified in 33 (40.2 %) cases. Almost 60 % of the basal like breast cancer cases showed p53 mutation. Only one case showed HER2 mutation (exon 20:g.36830_3). Our results showed that gene amplification is not the unique mechanism in EGFR overexpression. IHC might be used in the decision of anti-EGFR therapy in routine practice. p53 mutation rate was lower than the rates reported in the literature probably due to ethnic differences and low sensitivity of sanger sequences in general mutation screening. We also established the rarity of HER2 mutation in TNBC. In conclusion EGFR and p53 are the major targets in TNBC also for our population.

  9. Tumor hypoxia, p53, and prognosis in cervical cancers

    International Nuclear Information System (INIS)

    Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen

    2001-01-01

    Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p

  10. Association of p53 protein expression with clinical outcome in advanced supraglottic cancer

    International Nuclear Information System (INIS)

    Kang, Jin Oh; Hong, Seong Eon

    1998-01-01

    To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression

  11. Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

    Science.gov (United States)

    Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

    2018-05-31

    The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  12. P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent

    International Nuclear Information System (INIS)

    Dbaibo, G.; El-Assaad, W.

    2000-01-01

    Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation

  13. Combined use of nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 for hepatocellular carcinoma detection in high-risk chronic hepatitis C patients.

    Science.gov (United States)

    Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K

    2017-10-01

    Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.

  14. Mutant p53 interactions with supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Činčárová, Lenka; Šebest, Peter; Pivoňková, Hana; Brázda, Václav; Fojta, Miroslav; Paleček, Emil

    2007-01-01

    Roč. 24, č. 6 (2007), s. 639-640 ISSN 0739-1102. [Alban 2007: The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GP204/06/P369; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : mutant p53 * supercoiled DNA * cancer Subject RIV: BO - Biophysics

  15. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    Science.gov (United States)

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  16. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    International Nuclear Information System (INIS)

    Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

    2005-01-01

    p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein

  17. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    Directory of Open Access Journals (Sweden)

    Shah Keerti V

    2005-02-01

    Full Text Available Abstract Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT, and 8 supratentorial primitive neuroectodermal tumors (sPNET using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3 was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein.

  18. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    Science.gov (United States)

    Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

    2005-01-01

    Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein. PMID:15717928

  19. Radiation-induced p53 protein response in the A549 cell line is culture growth-phase dependent

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, N.F.; Gurule, D.M.; Carpenter, T.R.

    1995-12-01

    One role of the p53 tumor suppressor protein has been recently revealed. Kastan, M.B. reported that p53 protein accumulates in cells exposed to ionizing radiation. The accumulation of p53 protein is in response to DNA damage, most importantly double-strand breaks, that results from exposure to ionizing radiation. The rise in cellular p53 levels is necessary for an arrest in the G{sub 1} phase of the cell cycle to provide additional time for DNA repair. The p53 response has also been demonstrated to enhance PCNA-dependent repair. p53 is thus an important regulator of the cellular response to DNA-damaging radiation. From this data, it can be concluded that the magnitude of the p53 response is not dependent on the phase of culture growth.

  20. Structural Basis of Competitive Recognition of p53 and MDM2 by HAUSP/USP7: Implications for the Regulation of the p53-MDM2 Pathway.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.

  1. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  2. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    Science.gov (United States)

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  3. Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer

    International Nuclear Information System (INIS)

    Fariña Sarasqueta, Arantza; Morreau, Hans; Forte, Giusi; Corver, Wim E; Miranda, Noel F de; Ruano, Dina; Eijk, Ronald van; Oosting, Jan; Tollenaar, Rob AEM; Wezel, Tom van

    2013-01-01

    p53 (encoded by TP53) is involved in DNA damage repair, cell cycle regulation, apoptosis, aging and cellular senescence. TP53 is mutated in around 50% of human cancers. Nevertheless, the consequences of p53 inactivation in colon cancer outcome remain unclear. Recently, a new role of p53 together with CSNK1A1 in colon cancer invasiveness has been described in mice. By combining data on different levels of p53 inactivation, we aimed to predict p53 functionality and to determine its effects on colon cancer outcome. Moreover, survival effects of CSNK1A1 together with p53 were also studied. Eighty-three formalin fixed paraffin embedded colon tumors were enriched for tumor cells using flow sorting, the extracted DNA was used in a custom SNP array to determine chr17p13-11 allelic state; p53 immunostaining, TP53 exons 5, 6, 7 and 8 mutations were determined in combination with mRNA expression analysis on frozen tissue. Patients with a predicted functional p53 had a better prognosis than patients with non functional p53 (Log Rank p=0.009). Expression of CSNK1A1 modified p53 survival effects. Patients with low CSNK1A1 expression and non-functional p53 had a very poor survival both in the univariate (Log Rank p<0.001) and in the multivariate survival analysis (HR=4.74 95% CI 1.45 – 15.3 p=0.009). The combination of mutational, genomic, protein and downstream transcriptional activity data predicted p53 functionality which is shown to have a prognostic effect on colon cancer patients. This effect was specifically modified by CSKN1A1 expression

  4. Electrophoretic detection of protein p53 in human leukocytes

    International Nuclear Information System (INIS)

    Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.

    1986-01-01

    The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients

  5. The pro-survival function of p53 in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

    2014-11-15

    The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

  6. Molecular mechanism of X-ray-induced p53-dependent apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

    1999-03-01

    Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

  7. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    Science.gov (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  8. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  9. p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication

    Directory of Open Access Journals (Sweden)

    Constance Qiao Xin Yeo

    2016-04-01

    Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.

  10. Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

    Science.gov (United States)

    Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

    2016-04-01

    P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  11. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  12. Mutations in p53, p53 protein overexpression and breast cancer survival

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

    2009-01-01

    Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

  13. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, Akihisa

    2002-01-01

    We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)

  14. RNA content in the nucleolus alters p53 acetylation via MYBBP1A

    Science.gov (United States)

    Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn

    2011-01-01

    A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583

  15. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

    Science.gov (United States)

    Cox, Darren P

    2012-01-01

    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

    International Nuclear Information System (INIS)

    Frey, L. M.; Houben, R.; Brocker, E. B.

    2011-01-01

    Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

  17. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

    Directory of Open Access Journals (Sweden)

    Asita Elengoe

    2015-01-01

    Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

  18. Correlation between p53 expression and clinical-pathological characteristics of gastric cancer

    Directory of Open Access Journals (Sweden)

    Radovanović Dragče

    2011-01-01

    Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.

  19. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    Science.gov (United States)

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  20. SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

    International Nuclear Information System (INIS)

    Milner, J.; Gamble, J.

    1985-01-01

    The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

  1. Rb and p53 Liver Functions Are Essential for Xenobiotic Metabolism and Tumor Suppression.

    Directory of Open Access Journals (Sweden)

    Sathidpak Nantasanti

    Full Text Available The tumor suppressors Retinoblastoma (Rb and p53 are frequently inactivated in liver diseases, such as hepatocellular carcinomas (HCC or infections with Hepatitis B or C viruses. Here, we discovered a novel role for Rb and p53 in xenobiotic metabolism, which represent a key function of the liver for metabolizing therapeutic drugs or toxins. We demonstrate that Rb and p53 cooperate to metabolize the xenobiotic 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC. DDC is metabolized mainly by cytochrome P450 (Cyp3a enzymes resulting in inhibition of heme synthesis and accumulation of protoporphyrin, an intermediate of heme pathway. Protoporphyrin accumulation causes bile injury and ductular reaction. We show that loss of Rb and p53 resulted in reduced Cyp3a expression decreased accumulation of protoporphyrin and consequently less ductular reaction in livers of mice fed with DDC for 3 weeks. These findings provide strong evidence that synergistic functions of Rb and p53 are essential for metabolism of DDC. Because Rb and p53 functions are frequently disabled in liver diseases, our results suggest that liver patients might have altered ability to remove toxins or properly metabolize therapeutic drugs. Strikingly the reduced biliary injury towards the oxidative stress inducer DCC was accompanied by enhanced hepatocellular injury and formation of HCCs in Rb and p53 deficient livers. The increase in hepatocellular injury might be related to reduce protoporphyrin accumulation, because protoporphrin is well known for its anti-oxidative activity. Furthermore our results indicate that Rb and p53 not only function as tumor suppressors in response to carcinogenic injury, but also in response to non-carcinogenic injury such as DDC.

  2. Stabilization of alanine substituted p53 protein at Ser15, Thr18, and Ser20 in response to ionizing radiation

    International Nuclear Information System (INIS)

    Yamauchi, Motohiro; Suzuki, Keiji; Kodama, Seiji; Watanabe, Masami

    2004-01-01

    Phosphorylation of p53 at Ser15, Thr18, and Ser20 has been thought to be important for p53 stabilization in response to ionizing radiation. In the present study, we examined the X-ray-induced stabilization of Ala-substituted p53 protein at Ser15, Thr18, and Ser20, whose gene expression was controlled under an ecdyson-inducible promoter. We found that all single-, double-, or triple-Ala-substituted p53 at Ser15, Yhr18, and Ser20 were accumulated in the nucleus similarly to wild-type p53 after X-irradiation. These results indicate that the phosphorylation of p53 at Ser15, Thr18, and Ser20 is not necessarily needed for p53 stabilization in response to ionizing radiation

  3. GRIM-19 disrupts E6/E6AP complex to rescue p53 and induce apoptosis in cervical cancers.

    Directory of Open Access Journals (Sweden)

    Ying Zhou

    Full Text Available BACKGROUND: Our previous studies showed a down-regulation of GRIM-19 in primary human cervical cancers, and restoration of GRIM-19 induced tumor regression. The induction of tumor suppressor protein p53 ubiquitination and degradation by E6 oncoportein of high risk-HPV through forming a stable complex with E6AP is considered as a critical mechanism for cervical tumor development. The aims of this study were to determine the potential role of GRIM-19 in rescuing p53 protein and inducing cervical cancer cell apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: The protein levels of GRIM-19 and p53 were detected in normal cervical tissues from 45 patients who underwent hysterectomy for reasons other than neoplasias of either the cervix or endometrium, and cervical cancer tissues from 60 patients with non-metastatic squamous epithelial carcinomas. Coimmunoprecipitation and GST pull-down assay were performed to examine the interaction of GRIM-19 with 18E6 and E6AP in vivo and in vitro respectively. The competition of 18E6 with E6AP in binding GRIM-19 by performing competition pull-down assays was designed to examine the disruption of E6/E6AP complex by GRIM-19. The augment of E6AP ubiquitination by GRIM-19 was detected in vivo and in vitro ubiquitination assay. The effects of GRIM-19-dependent p53 accumulation on cell proliferation, cell cycle, apoptosis were explored by MTT, flow cytometry and transmission electron microscopy respectively. The tumor suppression was detected by xenograft mouse model. CONCLUSION/SIGNIFICANCE: The levels of GRIM-19 and p53 were concurrently down regulated in cervical cancers. The restoration of GRIM-19 can induce ubiquitination and degradation of E6AP, and disrupt the E6/E6AP complex through the interaction of N-terminus of GRIM-19 with both E6 and E6AP, which protected p53 from degradation and promoted cell apoptosis. Tumor xenograft studies also revealed the suppression of p53 degradation in presence of GRIM-19. These data

  4. Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Clarke Alan R

    2002-11-01

    Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.

  5. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    Science.gov (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  6. p53 specific (auto)immunity in mice

    NARCIS (Netherlands)

    Lauwen, Marjolein Monique

    2008-01-01

    Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T

  7. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

    International Nuclear Information System (INIS)

    Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira

    2007-01-01

    p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain

  8. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

    2003-01-01

    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  9. Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

    International Nuclear Information System (INIS)

    Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil

    2007-01-01

    Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent

  10. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  11. Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy

    Directory of Open Access Journals (Sweden)

    Christian M. Simon

    2017-12-01

    Full Text Available The hallmark of spinal muscular atrophy (SMA, an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons.

  12. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  13. Immunohistochemical study of p53, pRb, p16 in esophageal cancer

    International Nuclear Information System (INIS)

    Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee

    1998-01-01

    To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs

  14. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    NARCIS (Netherlands)

    Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,

  15. Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

    Science.gov (United States)

    Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

    2017-10-01

    In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

  16. p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors

    NARCIS (Netherlands)

    Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't

    1999-01-01

    Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this

  17. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    Science.gov (United States)

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  18. Expression of p53, inducible nitric oxide synthase and vascular endothelial growth factor in gastric precancerous and cancerous lesions: correlation with clinical features

    International Nuclear Information System (INIS)

    Feng, Chang Wei; Wang, Li Dong; Jiao, Lian Hua; Liu, Bin; Zheng, Shu; Xie, Xin Ji

    2002-01-01

    The growth and metastasis of tumors depend on the development of an adequate blood supply via angiogenesis. Recent studies indicate that the inducible nitric oxide synthase (iNOS), vascular endothelial growth factor (VEGF) and the tumor suppressor p53 are fundamental play-markers of the angiogenic process. Overexpression of iNOS and VEGF has been shown to induce angiogenesis in tumors. P53 suppresses angiogenesis by down-regulating VEGF and iNOS. The correlation of expression of p53, VEGF and iNOS and clinical features in gastric carcinogenesis, however, has not been well characterized. The expression of p53, iNOS and VEGF in gastric precancerous and cancerous lesions and its relation with the clinical features was determined with immunohistochemistry (avidin-biotin-peroxidase complex method) on 55 randomly selected GC patients and 60 symptom-free subjects from the mass survey in the high-incidence area for GC in Henan, northern China. The positive immunostainig rates for p53, iNOS and VEGF in gastric carcinomas were 51%, 44% and 51%, respectively, and correlated well with TNM stages, but did not show significant difference among the groups with different degrees of gastric wall invasion depth by GC. A positive immunostaining reaction for the iNOS protein was significantly correlated with lymph node metastasis (p = 0.019; Spearman correlation coefficient). P53 protein accumulation was higher in the poorly-differentiated gastric carcinoma than in well-differentiated one. In gastric biopsies, no positive immunosatining was observed for p53, iNOS and VEGF in the histologically normal tissue and chronic superficial gastritis (CSG). However, p53, iNOS and VEGF positive immunostaining was observed in the tissues with different severities of lesions of chronic atrophic gastritis (CAG), intestinal metaplasia (IM) and dysplasia (DYS), and the positive rates increased with the lesion progression from CAG to IM to DYS. A high coincidental positive and negative immunostaining

  19. Expression of p53, Bcl-2, VEGF, Ki67 and PCNA and prognostic significance in hepatocellular carcinoma.

    Science.gov (United States)

    Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel

    2008-12-01

    Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.

  20. Chemical Variations on the p53 Reactivation Theme

    Directory of Open Access Journals (Sweden)

    Carlos J. A. Ribeiro

    2016-05-01

    Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

  1. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  2. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  3. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  4. Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

    Energy Technology Data Exchange (ETDEWEB)

    Denamur, Sophie; Boland, Lidvine [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Beyaert, Maxime [Université catholique de Louvain, de Duve Institute, Laboratory of Physiological Chemistry, UCL B1.75.08, avenue Hippocrate, 75 B -1200 Brussels (Belgium); Verstraeten, Sandrine L. [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Fillet, Marianne [University of Liege, CIRM, Department of Pharmacy, Laboratory for the Analysis of Medicines, Quartier Hopital, Avenue Hippocrate, 15, B36, Tower 4, 4000 Liège 1 (Belgium); Tulkens, Paul M. [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Bontemps, Françoise [Université catholique de Louvain, de Duve Institute, Laboratory of Physiological Chemistry, UCL B1.75.08, avenue Hippocrate, 75 B -1200 Brussels (Belgium); Mingeot-Leclercq, Marie-Paule [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium)

    2016-10-15

    Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasome by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.

  5. Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

    International Nuclear Information System (INIS)

    Denamur, Sophie; Boland, Lidvine; Beyaert, Maxime; Verstraeten, Sandrine L.; Fillet, Marianne; Tulkens, Paul M.; Bontemps, Françoise; Mingeot-Leclercq, Marie-Paule

    2016-01-01

    Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasome by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.

  6. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

    Science.gov (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

    2017-06-01

    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  7. Mutant, wild type, or overall p53 expression: freedom from clinical progression in tumours of astrocytic lineage.

    Science.gov (United States)

    Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M

    2004-11-01

    Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.

  8. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.

    2003-01-01

    Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation

  9. Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

    DEFF Research Database (Denmark)

    Savelyeva, I.; Dobbelstein, M.

    2011-01-01

    to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

  10. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  11. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  12. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  13. Targeting the p53 Pathway in Ewing Sarcoma

    Science.gov (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  14. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

    2014-01-01

    Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

  16. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  17. Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

    Science.gov (United States)

    Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

    2010-04-15

    Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

  18. The Inherited p53 Mutation in the Brazilian Population.

    Science.gov (United States)

    Achatz, Maria Isabel; Zambetti, Gerard P

    2016-12-01

    A common criticism of studying rare diseases is the often-limited relevance of the findings to human health. Here, we review ∼15 years of research into an unusual germline TP53 mutation (p.R337H) that began with its detection in children with adrenocortical carcinoma (ACC), a remarkably rare childhood cancer that is associated with poor prognosis. We have come to learn that the p.R337H mutation exists at a very high frequency in Southern and Southeastern Brazil, occurring in one of 375 individuals within a total population of ∼100 million. Moreover, it has been determined that carriers of this founder mutation display variable tumor susceptibility, ranging from isolated cases of pediatric ACC to Li-Fraumeni or Li-Fraumeni-like (LFL) syndromes, thus representing a significant medical issue for this country. Studying the biochemical and molecular consequences of this mutation on p53 tumor-suppressor activity, as well as the putative additional genetic alterations that cooperate with this mutation, is advancing our understanding of how p53 functions in tumor suppression in general. These studies, which originated with a rare childhood tumor, are providing important information for guiding genetic counselors and physicians in treating their patients and are already providing clinical benefit. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  19. Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry

    Science.gov (United States)

    Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.

    2015-01-01

    p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145

  20. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  1. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  2. Targeting p53 by small molecules in hematological malignancies

    OpenAIRE

    Saha, Manujendra N; Qiu, Lugui; Chang, Hong

    2013-01-01

    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...

  3. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2017-06-01

    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  4. The role of hypoxia, p53, and apoptosis in human cervical carcinoma pathogenesis

    International Nuclear Information System (INIS)

    Kim, Charlotte Y.; Tsai, Mitchell H.; Osmanian, Cynthia; Calkins, Dennise P.; Graeber, Thomas G.; Greenspan, David L.; Kennedy, Andrew S.; Rinker, Lillian H.; Varia, Mahesh A.; DiPaolo, Joseph A.; Peehl, Donna M.; Raleigh, James A.; Giaccia, Amato J.

    1997-01-01

    Objective: Low oxygen tension in the tumor microenvironment may have an important role during tumor growth, and is of particular prognostic significance in human cervical carcinoma. Because some human papillomavirus (HPV) infections are associated with cervical neoplasia, the relationship between hypoxia and apoptosis in primary cervical epithelial cells containing HPV16 E6 and E7, intact HPV 16 genome, and HPV positive cervical carcinoma cell lines, was examined. In addition, the relationship between hypoxia and apoptosis in spontaneous human cervical carcinomas was determined in situ. Materials and Methods: Primary normal human cervical epithelial cells were infected with retroviral vectors containing HPV16 E6 and E7 or transfected with a plasmid containing the whole HPV 16 genome. Clones were selected in neomycin containing medium. Exponentially growing cells were incubated under aerobic conditions (20% O 2 ), anaerobic conditions (0.02% O 2 ), or irradiated with 6 Gy. Analysis of apoptotic cells was performed by staining with Hoechst dye and propidium iodide and viewing with a fluorescent microscope. To determine the level of expression of the apoptotic modulators p53 and Bax, immunoblots were performed on whole cell extracts from treated cells. A clinical tumor hypoxia study was conducted at the University of North Carolina utilizing pimonidazole, a 2-nitroimidazole compound which binds irreversibly to cellular macromolecules under low oxygen conditions. Nine patients were enrolled with biopsy proven squamous cell carcinoma of the cervix and no prior treatment. Biopsies of the gross tumor were obtained after pimonidazole infusion. Contiguous histological sections were analyzed for hypoxia using a immunohistochemical technique and for apoptosis using TUNEL. Results: In vitro, hypoxia uncoupled p53 from E6 mediated degradation, and stimulated both p53 induction and apoptosis in primary cervical epithelial cells infected with the HPV E6 and E7 genes. In contrast

  5. The p53-mediated cytotoxicity of photodynamic therapy of cancer: Recent advances

    International Nuclear Information System (INIS)

    Zawacka-Pankau, Joanna; Krachulec, Justyna; Grulkowski, Ireneusz; Bielawski, Krzysztof P.; Selivanova, Galina

    2008-01-01

    Photodynamic therapy (PDT) is a promising modality for the treatment of both pre-malignant and malignant lesions. The mechanism of action converges mainly on the generation of reactive oxygen species which damage cancer cells directly as well as indirectly acting on tumor vasculature. The exact mechanism of PDT action is not fully understood, which is a formidable barrier to its successful clinical application. Elucidation of the mechanisms of cancer cell elimination by PDT might help in establishing highly specific, non-genotoxic anti-cancer treatment of tomorrow. One of the candidate PDT targets is the well-known tumor suppressor p53 protein recognized as the guardian of the genome. Together with its family members, p73 and p63 proteins, p53 is involved in apoptosis induction upon stress stimuli. The wild-type and mutant p53-targeting chemotherapeutics are currently extensively investigated as a promising strategy for highly specific anti-cancer therapy. In photodynamic therapy porphyrinogenic sensitizers are the most widely used compounds due to their potent biophysical and biochemical properties. Recent data suggest that the p53 tumor suppressor protein might play a significant role in porphyrin-PDT-mediated cell death by direct interaction with the drug which leads to its accumulation and induction of p53-dependent cell death both in the dark and upon irradiation. In this review we describe the available evidence on the role of p53 in PDT

  6. RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response

    Directory of Open Access Journals (Sweden)

    Toshinori Ozaki

    2013-01-01

    Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.

  7. RT-PCR amplification of RNA extracted from formalin-fixed, paraffin-embedded oral cancer sections: analysis of p53 pathway.

    Science.gov (United States)

    Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro

    2003-01-01

    We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.

  8. The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

    International Nuclear Information System (INIS)

    Ohnishi, Takeo

    1997-01-01

    I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

  9. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya

    2017-07-15

    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  10. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdul-Hamid M.; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib

    2017-01-01

    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  11. A low dose pre-irradiation induces radio- and heat-resistance via HDM2 and NO radicals, and is associated with p53 functioning

    Science.gov (United States)

    Takahashi, A.; Ohnishi, T.

    2009-04-01

    The aim of this work was to clarify the effect of low dose pre-irradiation on radio- and heat-sensitivity. Wild-type (wt) p53 and mutated (m) p53 cells derived from the human lung cancer H1299 cell line were used. The parental H1299 cell line is p53-null. Cellular sensitivities were determined with a colony-forming assay. When wtp53 cells were exposed to a low dose X-irradiation, induction of radio- and heat-resistance was observed only in the absence of RITA (an inhibitor of p53-HDM2 interactions), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). In contrast, the induced radio- and heat-resistance was not observed under similar conditions in mp53 cells. Moreover, heat-resistance as well as radio-resistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of radio- and heat-resistance, and function through the activation of HDM2 and the depression of p53 accumulation.

  12. Free radical scavenger edaravone suppresses X-ray-induced apoptosis through p53 inhibition in MOLT-4 cells

    International Nuclear Information System (INIS)

    Sasano, Nakashi; Shiraishi, Kenshiro; Igaki, Hiroshi; Nakagawa, Keiichi; Enomoto, Atsushi; Hosoi, Yoshio; Matsumoto, Yoshihisa; Miyagawa, Kiyoshi; Katsumura, Yosuke

    2007-01-01

    Edaravone, a clinical drug used widely for the treatment of acute cerebral infarction, is reported to scavenge free radicals. In the present study, we investigated the radioprotective effect of edaravone on X-ray-induced apoptosis in MOLT-4 cells. Apoptosis was determined by the dye exclusion test, Annexin V binding assay, cleavage of caspase, and DNA fragmentation. We found that edaravone significantly suppressed the X-ray-induced apoptosis. The amount of intracellular reactive oxygen species (ROS) production was determined by the chloromethyl-2', 7'-dichlorodihydro-fluorescein diacetate system. We found that the intracellular ROS production by X-irradiation was completely suppressed by the addition of edaravone. The accumulation and phosphorylation of p53 and the expression of p21 WAF1 , a target protein of p53, which were induced by X-irradiation, were also suppressed by adding edaravone. We conclude that the free radical scavenger edaravone suppresses X-ray-induced apoptosis in MOLT-4 cells by inhibiting p53. (author)

  13. Free radical scavenger edaravone suppresses X-ray-induced apoptosis through p53 inhibition in MOLT-4 cells

    Energy Technology Data Exchange (ETDEWEB)

    Sasano, Nakashi; Shiraishi, Kenshiro; Igaki, Hiroshi; Nakagawa, Keiichi [Tokyo Univ., Graduate School of Medicine, Tokyo (Japan); Enomoto, Atsushi; Hosoi, Yoshio; Matsumoto, Yoshihisa; Miyagawa, Kiyoshi [Tokyo Univ., Faculty of Medicine, Tokyo (Japan); Katsumura, Yosuke [Tokyo Univ., Graduate School of Engineering, Tokyo (Japan)

    2007-11-15

    Edaravone, a clinical drug used widely for the treatment of acute cerebral infarction, is reported to scavenge free radicals. In the present study, we investigated the radioprotective effect of edaravone on X-ray-induced apoptosis in MOLT-4 cells. Apoptosis was determined by the dye exclusion test, Annexin V binding assay, cleavage of caspase, and DNA fragmentation. We found that edaravone significantly suppressed the X-ray-induced apoptosis. The amount of intracellular reactive oxygen species (ROS) production was determined by the chloromethyl-2', 7'-dichlorodihydro-fluorescein diacetate system. We found that the intracellular ROS production by X-irradiation was completely suppressed by the addition of edaravone. The accumulation and phosphorylation of p53 and the expression of p21{sup WAF1}, a target protein of p53, which were induced by X-irradiation, were also suppressed by adding edaravone. We conclude that the free radical scavenger edaravone suppresses X-ray-induced apoptosis in MOLT-4 cells by inhibiting p53. (author)

  14. The anti-hypercholesterolemic effect of low p53 expression protects vascular endothelial function in mice.

    Directory of Open Access Journals (Sweden)

    Francois Leblond

    Full Text Available To demonstrate that p53 modulates endothelial function and the stress response to a high-fat western diet (WD.Three-month old p53+/+ wild type (WT and p53+/- male mice were fed a regular or WD for 3 months. Plasma levels of total cholesterol (TC and LDL-cholesterol were significantly elevated (p<0.05 in WD-fed WT (from 2.1±0.2 mmol/L to 3.1±0.2, and from 0.64±0.09 mmol/L to 1.25±0.11, respectively but not in p53+/- mice. The lack of cholesterol accumulation in WD-fed p53+/- mice was associated with high bile acid plasma concentrations (p53+/- =  4.7±0.9 vs. WT =  3.3±0.2 μmol/L, p<0.05 concomitant with an increased hepatic 7-alpha-hydroxylase mRNA expression. While the WD did not affect aortic endothelial relaxant function in p53+/- mice (WD =  83±5 and RD =  82±4% relaxation, it increased the maximal response to acetylcholine in WT mice (WD =  87±2 vs. RD =  62±5% relaxation, p<0.05 to levels of p53+/-. In WT mice, the rise in TC associated with higher (p<0.05 plasma levels of pro-inflammatory keratinocyte-derived chemokine, and an over-activation (p<0.05 of the relaxant non-nitric oxide/non-prostacyclin endothelial pathway. It is likely that in WT mice, activations of these pathways are adaptive and contributed to maintain endothelial function, while the WD neither promoted inflammation nor affected endothelial function in p53+/- mice.Our data demonstrate that low endogenous p53 expression prevents the rise in circulating levels of cholesterol when fed a WD. Consequently, the endothelial stress of hypercholesterolemia is absent in young p53+/- mice as evidenced by the absence of endothelial adaptive pathway over-activation to minimize stress-related damage.

  15. Bladder-like graphical representation of p53 gene alterations in some human cancers

    International Nuclear Information System (INIS)

    Helal, N.L.; Dorrah, M.; LI, C.

    2005-01-01

    the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

  16. Alterations in the K-ras and p53 genes in rat lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

    1997-06-01

    Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

  17. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  18. Exploring a minimal two-component p53 model

    International Nuclear Information System (INIS)

    Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei

    2010-01-01

    The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

  19. p53 downregulates the Fanconi anaemia DNA repair pathway.

    Science.gov (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  20. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  1. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    Science.gov (United States)

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  2. Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination

    Directory of Open Access Journals (Sweden)

    Zhou Y

    2018-04-01

    Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had

  3. Dose selenomethionine have radio-protective effect on cell lines with wild type p53?

    International Nuclear Information System (INIS)

    Tsuji, K.; Hagihira, T.; Ohnishi, K.; Ohnishi, T.; Matsumoto, H.

    2003-01-01

    Full text: Selenium compounds are known to have cancer preventive effects. It is reported recently that selenium in the form of selenomethionine (SeMet) can protect cells with wild type p53 from UV-induced cell killing by activating the DNA repair mechanism of p53 tumor suppressor protein via redox factor Ref1 by reducing p53 cysteine residue 275 and 277. In contrast, SeMet has no protective effect on UV-induced cell killing in p53-null cells. If SeMet also has protective effect in cells with wild type p53 on cell killing by photon irradiation, SeMet can be used as normal tissue radio-protector. We examined the effect of SeMet on cell killing by X-ray irradiation in several cell lines with different p53 status at exponentially growing phase. Cell lines used in this experiment were as follows: H1299/neo; human lung cancer cell line of p53 null type tranfected with control vector with no p53, H1299/wp53; wild type p53 transfected counterpart. A172/neo; human glioblastoma cell line with wild type p53, A172/mp53-248; mp53-248 (248-mutant, ARG >TRP) transfected counterpart. SAS/neo; human tongue cancer cell line with wild type p53, and SAS/mp53-248; mp53-248 transfected counterpart. Cells were subcultured at monolayer in D-MEM containing 10% FBS. Survivals of the cells were determined by colony forming ability. Ten-MV linac X-ray was used to irradiate the cells. Exponentially growing cells were incubated with 20μM of SeMet for 15 hours before irradiation. After 24 hours exposure of SeMet, cells were incubated up to two weeks in growth medium for colony formation. Twenty-four hours exposure of 20μM of SeMet had no cytotoxicity on these cell lines. SeMet had no modification effect on cell killing by photon irradiation in H1299/neo, H1299/wp53, SAS/neo, SAS/mp53-248, and A172/mp53-248. On the other hand, SeMet sensitized A172/neo in radiation cell killing. The effects of p53 on interaction of SeMet and photon irradiation differ according to cell lines

  4. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  5. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  6. P53 autoantibodies in 1006 patients followed up for breast cancer

    International Nuclear Information System (INIS)

    Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A

    2000-01-01

    Serial plasma samples from 1006 patients with breast cancer revealed: (i) no correlation of p53 autoantibody status with disease status at the time of sample collection, or with menopausal status at time of primary diagnosis of breast cancer; (ii) 155 out of 1006 (15%) of patients were positive for p53 autoantibodies, and these patients tended to have a persistent autoantibody status throughout follow up, irrespective of disease behaviour; and (iii) where a negative autoantibody status was found at primary diagnosis of breast cancer, this negative status persisted throughout follow up, irrespective of later disease behaviour. We conclude that screening for p53 autoantibody status is not informative on residual tumour activity nor on therapeutic responsiveness. Dysfunction of the tumour-suppressor protein, p53, may be due to either mutational or epigenetic factors, each of which may lead to accumulation of cytoplasmic p53. Abnormal accumulation of p53 in breast cancer tissue is predictive of poor prognosis [1,2]. Humoral studies [3,4] have shown that cancer patients may develop immunity to abnormally expressed p53, as revealed by p53 autoantibodies in the blood. Again, prognostic correlates have been noted, with presence of circulating p53 autoantibodies at diagnosis of breast cancer being associated with reduced overall survival [5,6] and with poor prognostic factors such as high histological grade and the absence of hormone receptors [5,7,8]. Little is known of the potential value of p53 autoantibody in follow up of cancer. In lung cancer there is evidence that autoantibodies to p53 may provide a useful tool to monitor response to therapy [9,10], whereas serial measurements of autoantibodies to p53 in 40 patients with advanced ovarian cancer were not found to be clinically useful [11]. In breast cancer some 30% of node-negative patients will relapse within 5 years, but there is no current means to predict those who are at risk. We performed the present study to

  7. Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

    Science.gov (United States)

    Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

    2006-04-01

    p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

  8. Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.

    Science.gov (United States)

    Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei

    2013-07-01

    Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.

  9. p53 and the pathogenesis of skin cancer

    International Nuclear Information System (INIS)

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-01-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

  10. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia

    2001-01-01

    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  11. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2012-02-01

    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  12. HEXIM1, a New Player in the p53 Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)

    2013-07-04

    Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

  13. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    Science.gov (United States)

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.

  14. Neem oil limonoids induces p53-independent apoptosis and autophagy

    Science.gov (United States)

    Chandra, Dhyan

    2012-01-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  15. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  16. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  17. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

    2011-01-01

    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  18. Robustness of the p53 network and biological hackers.

    Science.gov (United States)

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  19. Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.

    Science.gov (United States)

    Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana

    2013-08-01

    Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.

  20. THE EXON 5, 6, 7, 8 OF P53 MUTATIONS IN ORAL SQUAMOUS CELLS CARCINOMA

    Directory of Open Access Journals (Sweden)

    Retno P Rahayu

    2012-04-01

    Full Text Available Genetic instability may underlie the etiology of multistep carcinogenesis. The altered p53 gene observed in tumors may represent the expression of such instability and may allow the accumulation of other gene alterations caused by multiple mechanism. p53 gene is the guardian of the genome, that is why we pay more attention to this gene. In this study, we evaluated the significance of p53 mutation in 55 patient with oral squamous carcinoma. Thirty among them underwent well-differentiated carcinoma, while the remaining 25 patients underwent poorly differentiated carcinoma. The mutations were detected by PCR-SSCP (Single strand Conformational Polymorphism analysis in the region between exon 5 and exon 8. The results indicated that the p53 mutation in exon 5 (40%, exon 6 (28%, exon 7 (24% and exon 8 (8% were associated with poorly differentiated carcinoma, whereas mutation in exon 5 (10%, exon 6 (30%, exon 7 (40% and exon 8 (20% were associated with well-differentiated carcinoma. These observations suggest that p53 mutation in exon 5, 6, and 7 have strong correlation with poorly differentiated in oral squamous carcinoma while well-differentiated level was related with mutation in exon 6,7 and 8.

  1. p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers

    Science.gov (United States)

    Shai, Anny; Pitot, Henry C.; Lambert, Paul F.

    2010-01-01

    Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729

  2. The expression of p53 protein in patients with multiple myeloma

    Directory of Open Access Journals (Sweden)

    Marković Olivera

    2007-01-01

    Full Text Available Introduction: Although mutations of p53 are one of the most often acquired genetic changes in malignant tumors, these mutations are rare events in patients with newly diagnosed multiple myeloma (MM. Moreover, there are a few literature data about clinical significance of p53 overexpression in multiple myeloma. Objective The aim of our study was to evaluate the clinical significance of p53 immunoexpression in multiple myeloma. Method A total of 58 patients with newly diagnosed MM (26 females and 32 males, mean age 62 years were enrolled in the study. The diagnosis of MM was made according to criteria of Chronic Leukemia-Myeloma Task Force. Clinical staging was done according to Durie and Salmon classification (4 patients had disease stage I, 15 patients stage II and 39 patients stage III. The histological grade and histological stage were determined according to predominant plasma cell morphology and volume of myeloma infiltration, respectively. Standard immunohistochemical analysis with p53 antibody in B5-fixed and paraffin- embedded bone marrow specimens was used to evaluate the expression of p53 in myeloma cells. The specimens were considered positive when ≥5% of plasma cells exhibited clear nuclear positivity. Results Out of 58 patients, p53 expression was detected in 9 (15.52%. No significant correlation was found between p53 expression and clinical stage (I+II vs. III, Я2-microglobulin level (≤6 mg/L vs. >6mg/L, histological grade (I vs. II+III, histological stage (<20% vs. 21-50% vs. >50% and the extent of osteolytic lesions (≤3 vs. >3 lesions. Median survival of patients with p53 immunoreactivity in =>5% of plasma cells was 10 months, whilst median survival of patients with p53 immunoreactivity in <5% of plasma cells was 36 months. However, such difference was not significant (p=0.2. Conclusion The frequency of p53 immunoexpression in our group of newly diagnosed MM was relatively low. Although p53 immunoexpression was not

  3. The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei

    1999-01-01

    Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53

  4. The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522 (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  5. Suberoyl bis-hydroxamic acid induces p53-dependent apoptosis of MCF-7 breast cancer cells

    Institute of Scientific and Technical Information of China (English)

    Zhi-gang ZHUANG; Fei FEI; Ying CHEN; Wei JIN

    2008-01-01

    Aim: To study the effects of suberoyl bis-hydroxamic acid (SBHA), an inhibitor of histone deacetylases, on the apoptosis of MCF-7 breast cancer cells. Meth-ods: Apoptosis in MCF-7 cells induced by SBHA was demonstrated by flow cytometric analysis, morphological observation, and DNA ladder. Mitochondrial membrane potential (△ψm) was measured using the fluorescent probe JC-1. The expressions of p53, p21, Bax, and PUMA were determined using RT-PCR or Western blotting analysis after the MCF-7 cells were treated with SBHA or p53 siRNA. Results: SBHA induced apoptosis in MCF-7 cells. The expressions of p53, p21, Bax, and PUMA were induced, and △ψm collapsed after treatment with SBHA. p53 siRNA abrogated the SBHA-induced apoptosis and the expressions of p53, p21, Bax, and PUMA. Conclusion: The activation of the p53 pathway is involved in SBHA-induced apoptosis in MCF-7 cells.

  6. The p53 inhibitor, pifithrin-α, suppresses self-renewal of embryonic stem cells

    International Nuclear Information System (INIS)

    Abdelalim, Essam Mohamed; Tooyama, Ikuo

    2012-01-01

    Highlights: ► We determine the role of p53 in ES cells under unstressful conditions. ► PFT-α suppresses ES cell proliferation. ► PFT-α induces ES cell cycle arrest. ► PFT-α downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-α, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-α resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-α caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  7. Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression

    Directory of Open Access Journals (Sweden)

    Takahiro Ebata

    2017-01-01

    Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.

  8. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

    2006-11-15

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  9. A dynamic P53-MDM2 model with time delay

    International Nuclear Information System (INIS)

    Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

    2006-01-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

  10. Role of P53 in Mammary Epithelial Cell Senescence

    National Research Council Canada - National Science Library

    Dimri, Goberdhan P

    2006-01-01

    .... We also chose several other targets of p53 that are induced by DNA damage. The RT PCR analysis aws carried out using mRNA prepared from young growing early passage and senescent late passage HMECs...

  11. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  12. ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

    Science.gov (United States)

    Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

    2001-01-01

    The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

  13. Polymorphism at codon 36 of the p53 gene.

    Science.gov (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  14. Post-translational regulation enables robust p53 regulation.

    Science.gov (United States)

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

    2013-08-30

    The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

  15. Thymocyte apoptosis induced by p53-dependent and independent pathways

    International Nuclear Information System (INIS)

    Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

    1993-01-01

    The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

  16. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  17. Pharmacological activation of tumor suppressor, wild-type p53 as a promising strategy to fight cancer

    Directory of Open Access Journals (Sweden)

    Alicja Sznarkowska

    2010-08-01

    Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.

  18. p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells

    International Nuclear Information System (INIS)

    Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.

    2003-01-01

    The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC

  19. Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.

    Science.gov (United States)

    Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald

    2017-06-01

    p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.

  20. Skeletal Muscle Fibre-Specific Knockout of p53 Does Not Reduce Mitochondrial Content or Enzyme Activity

    Directory of Open Access Journals (Sweden)

    Ben Stocks

    2017-12-01

    Full Text Available Tumour protein 53 (p53 has been implicated in the regulation of mitochondrial biogenesis in skeletal muscle, with whole-body p53 knockout mice displaying impairments in basal mitochondrial content, respiratory capacity, and enzyme activity. This study aimed to determine the effect of skeletal muscle-specific loss of p53 on mitochondrial content and enzyme activity. Mitochondrial protein content, enzyme activity and mRNA profiles were assessed in skeletal muscle of 8-week-old male muscle fibre-specific p53 knockout mice (p53 mKO and floxed littermate controls (WT under basal conditions. p53 mKO and WT mice displayed similar content of electron transport chain proteins I-V and citrate synthase enzyme activity in skeletal muscle. In addition, the content of proteins regulating mitochondrial morphology (MFN2, mitofillin, OPA1, DRP1, FIS1, fatty acid metabolism (β-HAD, ACADM, ACADL, ACADVL, carbohydrate metabolism (HKII, PDH, energy sensing (AMPKα2, AMPKβ2, and gene transcription (NRF1, PGC-1α, and TFAM were comparable in p53 mKO and WT mice (p > 0.05. Furthermore, p53 mKO mice exhibited normal mRNA profiles of targeted mitochondrial, metabolic and transcriptional proteins (p > 0.05. Thus, it appears that p53 expression in skeletal muscle fibres is not required to develop or maintain mitochondrial protein content or enzyme function in skeletal muscle under basal conditions.

  1. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    Science.gov (United States)

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  2. A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

    International Nuclear Information System (INIS)

    Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

    2011-01-01

    eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

  3. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    Science.gov (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  4. R248Q mutation--Beyond p53-DNA binding.

    Science.gov (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  5. Individual variation in p53 and Cip1 expression profiles in normal human fibroblast strains following exposure to high-let radiation

    International Nuclear Information System (INIS)

    Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D.

    1995-01-01

    Exposure to α-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of α-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to α-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G 1 portion of the cell cycle. Arrest in G 1 portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following α-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following α-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant

  6. Individual variation in p53 and Cip1 expression profiles in normal human fibroblast strains following exposure to high-let radiation

    Energy Technology Data Exchange (ETDEWEB)

    Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D. [Univ. of New Mexico, Albuquerque, NM (United States)] [and others

    1995-12-01

    Exposure to {alpha}-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of {alpha}-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to {alpha}-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G{sub 1} portion of the cell cycle. Arrest in G{sub 1} portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following {alpha}-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following {alpha}-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant.

  7. Human glioblastoma multiforme: p53 reactivation by a novel MDM2 inhibitor.

    Directory of Open Access Journals (Sweden)

    Barbara Costa

    Full Text Available Cancer development and chemo-resistance are often due to impaired functioning of the p53 tumor suppressor through genetic mutation or sequestration by other proteins. In glioblastoma multiforme (GBM, p53 availability is frequently reduced because it binds to the Murine Double Minute-2 (MDM2 oncoprotein, which accumulates at high concentrations in tumor cells. The use of MDM2 inhibitors that interfere with the binding of p53 and MDM2 has become a valid approach to inhibit cell growth in a number of cancers; however little is known about the efficacy of these inhibitors in GBM. We report that a new small-molecule inhibitor of MDM2 with a spirooxoindolepyrrolidine core structure, named ISA27, effectively reactivated p53 function and inhibited human GBM cell growth in vitro by inducing cell cycle arrest and apoptosis. In immunoincompetent BALB/c nude mice bearing a human GBM xenograft, the administration of ISA27 in vivo activated p53, inhibited cell proliferation and induced apoptosis in tumor tissue. Significantly, ISA27 was non-toxic in an in vitro normal human cell model and an in vivo mouse model. ISA27 administration in combination with temozolomide (TMZ produced a synergistic inhibitory effect on GBM cell viability in vitro, suggesting the possibility of lowering the dose of TMZ used in the treatment of GBM. In conclusion, our data show that ISA27 releases the powerful antitumor capacities of p53 in GBM cells. The use of this MDM2 inhibitor could become a novel therapy for the treatment of GBM patients.

  8. System-based strategies for p53 recovery.

    Science.gov (United States)

    Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

    2018-06-01

    The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

  9. The expanding regulatory universe of p53 in gastrointestinal cancer.

    Science.gov (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  10. Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53

    International Nuclear Information System (INIS)

    Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk; Yoo, Young A.

    2012-01-01

    p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)–Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh–Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3–p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expression of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2–p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.

  11. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chunhua [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Ma, Xa; Shi, Shangshi [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Zhao, Jianya; Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Han, Jingling; Xiao, Jing; Wang, Xiaoke [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Shengyang [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Junkang, E-mail: Jiang_junkang@163.com [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China)

    2014-12-15

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is

  12. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    International Nuclear Information System (INIS)

    Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang

    2014-01-01

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H 2 O 2 production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly

  13. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  14. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    Directory of Open Access Journals (Sweden)

    Liang Y

    2018-03-01

    Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood

  15. P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation

    International Nuclear Information System (INIS)

    Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.

    2006-01-01

    Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells

  16. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  17. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  18. Super p53 for Treatment of Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14

  19. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Comparing the mechanical influence of vinculin, focal adhesion kinase and p53 in mouse embryonic fibroblasts

    International Nuclear Information System (INIS)

    Klemm, Anna H.; Diez, Gerold; Alonso, Jose-Luis; Goldmann, Wolfgang H.

    2009-01-01

    Cytoskeletal reorganization is an ongoing process when cells adhere, move or invade extracellular substrates. The cellular force generation and transmission are determined by the intactness of the actomyosin-(focal adhesion complex)-integrin connection. We investigated the intracellular course of action in mouse embryonic fibroblasts deficient in the focal adhesion proteins vinculin and focal adhesion kinase (FAK) and the nuclear matrix protein p53 using magnetic tweezer and nanoparticle tracking techniques. Results show that the lack of these proteins decrease cellular stiffness and affect cell rheological behavior. The decrease in cellular binding strength was higher in FAK- to vinculin-deficient cells, whilst p53-deficient cells showed no effect compared to wildtype cells. The intracellular cytoskeletal activity was lowest in wildtype cells, but increased in the following order when cells lacked FAK+p53 > p53 > vinculin. In summary, cell mechanical processes are differently affected by the focal adhesion proteins vinculin and FAK than by the nuclear matrix protein, p53.

  1. 3-MCPD 1-Palmitate Induced Tubular Cell Apoptosis In Vivo via JNK/p53 Pathways

    Science.gov (United States)

    Liu, Man; Huang, Guoren; Wang, Thomas T.Y.; Sun, Xiangjun; Yu, Liangli (Lucy)

    2016-01-01

    Fatty acid esters of 3-chloro-1, 2-propanediol (3-MCPD esters) are a group of processing induced food contaminants with nephrotoxicity but the molecular mechanism(s) remains unclear. This study investigated whether and how the JNK/p53 pathway may play a role in the nephrotoxic effect of 3-MCPD esters using 3-MCPD 1-palmitate (MPE) as a probe compound in Sprague Dawley rats. Microarray analysis of the kidney from the Sprague Dawley rats treated with MPE, using Gene Ontology categories and KEGG pathways, revealed that MPE altered mRNA expressions of the genes involved in the mitogen-activated protein kinase (JNK and ERK), p53, and apoptotic signal transduction pathways. The changes in the mRNA expressions were confirmed by qRT-PCR and Western blot analyses and were consistent with the induction of tubular cell apoptosis as determined by histopathological, TUNEL, and immunohistochemistry analyses in the kidneys of the Sprague Dawley rats. Additionally, p53 knockout attenuated the apoptosis, and the apoptosis-related protein bax expression and cleaved caspase-3 activation induced by MPE in the p53 knockout C57BL/6 mice, whereas JNK inhibitor SP600125 but not ERK inhibitor U0126 inhibited MPE-induced apoptosis, supporting the conclusion that JNK/p53 might play a critical role in the tubular cell apoptosis induced by MPE and other 3-MCPD fatty acid esters. PMID:27008853

  2. A point mutation of human p53, which was not detected as a mutation by a yeast functional assay, led to apoptosis but not p21Waf1/Cip1/Sdi1 expression in response to ionizing radiation in a human osteosarcoma cell line, Saos-2

    International Nuclear Information System (INIS)

    Okaichi, Kumio; Wang Lihong; Sasaki, Ji-ichiro; Saya, Hideyuki; Tada, Mitsuhiro; Okumura, Yutaka

    1999-01-01

    Purpose: The 123A point mutation of p53 showed increased radiosensitivity, whereas other mutations (143A, 175H, and 273H) were not affected. To determine the reason for increased radiosensitivity of the 123A mutation, the response of the transformant of 123A mutation to ionizing radiation (IR) was examined and compared to those of transformants with the wild type p53 or other point mutations (143A, 175H, and 273H). Methods and Materials: Stable transformants with a mutant or wild type p53 made by introducing cDNA into the human osteosarcoma cell line, Saos-2, which lacks an endogenous p53 were used. The transcriptional activity of mutant p53 was examined using a yeast functional assay. The transformants were examined for the accumulation of p53, the induction of p21 Waf1/Cip1/Sdi1 (hereafter referred to as p21), and the other response of p53-responsive genes (MDM2, Bax, and Bcl-2) by Western blotting. Apoptosis was analyzed by detection of DNA fragmentation. Results: The 123A point mutation of p53 was detected as a wild type in the yeast functional assay. The 123A mutant accumulated p53 in response to IR. The 123A mutant did not induce p21, but normally responded to MDM2, Bax, and Bcl-2. The 123A mutant entered apoptosis earlier than the wild type p53 transformant, and induced Fas at earlier in response to IR. Conclusion: The 123A mutant led to apoptosis, but not p21 expression in response to IR. The occurrence of apoptosis, but not induction of p21, corresponded to the radiosensitivity in the transformant. The early occurrence of apoptosis in 123A transformants may depend on the early induction of Fas

  3. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    International Nuclear Information System (INIS)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook

    2009-01-01

    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference

  4. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2009-05-15

    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.

  5. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Science.gov (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  6. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  7. Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

    Science.gov (United States)

    Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

    2003-08-01

    Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

  8. The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer.

    Science.gov (United States)

    Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M

    2012-12-01

    We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. The combined status of ATM and p53 link tumor development with therapeutic response

    DEFF Research Database (Denmark)

    Jiang, Hai; Reinhardt, H Christian; Bartkova, Jirina

    2009-01-01

    commonly used by tumors to bypass early neoplastic checkpoints ultimately determine chemotherapeutic response and generate tumor-specific vulnerabilities that can be exploited with targeted therapies. Specifically, evaluation of the combined status of ATM and p53, two commonly mutated tumor suppressor...... genes, can help to predict the clinical response to genotoxic chemotherapies. We show that in p53-deficient settings, suppression of ATM dramatically sensitizes tumors to DNA-damaging chemotherapy, whereas, conversely, in the presence of functional p53, suppression of ATM or its downstream target Chk2...... actually protects tumors from being killed by genotoxic agents. Furthermore, ATM-deficient cancer cells display strong nononcogene addiction to DNA-PKcs for survival after DNA damage, such that suppression of DNA-PKcs in vivo resensitizes inherently chemoresistant ATM-deficient tumors to genotoxic...

  10. p53 protein expression versus micronucleus induction as an indicator of DNA damage

    International Nuclear Information System (INIS)

    Hickman, A.W.; Carpenter, T.R.; Johnson, N.F.

    1994-01-01

    In vitro assays for detecting DNA damage play an important role in evaluating the possible adverse health effects of chemical compounds. Exposure to many DNA-damaging agents in vitro has been shown to cause elevated levels of the tumor-suppressor protein p53. Work in our laboratory has shown that induction of the p53 protein is useful as a biodosimeter for determining the radiation dose to cells. The purpose of this investigation was to compare the sensitivity of this assay to that of micronucleus induction, which is commonly used as a marker of radiation-induced damage

  11. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  12. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Renee

    2001-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...

  13. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Rene

    2002-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...

  14. The Hunger Games: p53 regulates metabolism upon serine starvation.

    Science.gov (United States)

    Tavana, Omid; Gu, Wei

    2013-02-05

    Cancer cells reprogram their metabolism to support a high proliferative rate. A new study shows that, upon serine starvation, the tumor suppressor p53 activates p21 to shift metabolic flux from purine biosynthesis to glutathione production, which enhances cellular proliferation and viability by combating ROS (Maddocks et al., 2013). Copyright © 2013 Elsevier Inc. All rights reserved.

  15. The p53-MDM2 network: from oscillations to apoptosis

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Apoptosis; cancer; cell cycle; MDM2 overexpression; tumour suppressor .... model of the p53-MDM2 negative feedback loop included an .... MDM2 overexpression, when subjected to nutlin-3 treatment. Some aspects of the model are similar to those ... A family of proteases termed caspases .... Implications for therapy; Proc.

  16. p53 expression in colorectal carcinoma in relation to ...

    African Journals Online (AJOL)

    Haematoxylin and eosin stain was used for evaluation of histological types and degree of differentiation of the tumors. Topography of the tumors and demographic data were obtained from accompanying histological request forms. Results: Out of 109 patient\\'s tissue blocks that were studied, 61 cases (56%) expressed p53 ...

  17. Cellular inactivation of nitric oxide induces p53-dependent ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.

  18. Morphological Heterogeneity of p53 Positive and p53 Negative Nuclei in Breast Cancers Stratified by Clinicopathological Variables

    Directory of Open Access Journals (Sweden)

    Katrin Friedrich

    1997-01-01

    Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.

  19. The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

    Science.gov (United States)

    Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

    2018-03-01

    Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.

  20. Cdk5 phosphorylates non-genotoxically overexpressed p53 following inhibition of PP2A to induce cell cycle arrest/apoptosis and inhibits tumor progression

    Directory of Open Access Journals (Sweden)

    Kumari Ratna

    2010-07-01

    Full Text Available Abstract Background p53 is the most studied tumor suppressor and its overexpression may or may not cause cell death depending upon the genetic background of the cells. p53 is degraded by human papillomavirus (HPV E6 protein in cervical carcinoma. Several stress activated kinases are known to phosphorylate p53 and, among them cyclin dependent kinase 5 (Cdk5 is one of the kinase studied in neuronal cell system. Recently, the involvement of Cdk5 in phosphorylating p53 has been shown in certain cancer types. Phosphorylation at specific serine residues in p53 is essential for it to cause cell growth inhibition. Activation of p53 under non stress conditions is poorly understood. Therefore, the activation of p53 and detection of upstream kinases that phosphorylate non-genotoxically overexpressed p53 will be of therapeutic importance for cancer treatment. Results To determine the non-genotoxic effect of p53; Tet-On system was utilized and p53 inducible HPV-positive HeLa cells were developed. p53 overexpression in HPV-positive cells did not induce cell cycle arrest or apoptosis. However, we demonstrate that overexpressed p53 can be activated to upregulate p21 and Bax which causes G2 arrest and apoptosis, by inhibiting protein phosphatase 2A. Additionally, we report that the upstream kinase cyclin dependent kinase 5 interacts with p53 to phosphorylate it at Serine20 and Serine46 residues thereby promoting its recruitment on p21 and bax promoters. Upregulation and translocation of Bax causes apoptosis through intrinsic mitochondrial pathway. Interestingly, overexpressed activated p53 specifically inhibits cell-growth and causes regression in vivo tumor growth as well. Conclusion Present study details the mechanism of activation of p53 and puts forth the possibility of p53 gene therapy to work in HPV positive cervical carcinoma.

  1. Apoptosis in spermatogonia irradiated P53 null mice

    International Nuclear Information System (INIS)

    Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.

    2007-01-01

    Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after

  2. Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

    International Nuclear Information System (INIS)

    Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.

    1996-01-01

    Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in

  3. Characterisation of the p53-mediated cellular responses evoked in primary mouse cells following exposure to ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Gillian D McFeat

    Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.

  4. Dynamics of p53: A Master Decider of Cell Fate

    Directory of Open Access Journals (Sweden)

    Qingyin Luo

    2017-02-01

    Full Text Available Cellular stress‐induced temporal alterations—i.e., dynamics—are typically exemplified  by the dynamics of p53 that serve as a master to determine cell fate. p53 dynamics were initially  identified as the variations of p53 protein levels. However, a growing number of studies have  shown that p53 dynamics are also manifested in variations in the activity, spatial location, and  posttranslational modifications of p53 proteins, as well as the interplay among all p53 dynamical  features. These are essential in determining a specific outcome of cell fate. In this review, we  discuss the importance of the multifaceted features of p53 dynamics and their roles in the cell fate  decision process, as well as their potential applications in p53‐based cancer therapy. The review  provides new insights into p53 signaling pathways and their potentials in the development of new  strategies in p53‐based cancer therapy.

  5. Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer

    Directory of Open Access Journals (Sweden)

    Wen-Cheng Chung

    2017-11-01

    Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.

  6. TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

    International Nuclear Information System (INIS)

    Ding, Li; Huang, Yong; Du, Qian; Dong, Feng; Zhao, Xiaomin; Zhang, Wenlong; Xu, Xingang; Tong, Dewen

    2014-01-01

    Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressed cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence

  7. Macrophage p53 controls macrophage death in atherosclerotic lesions of apolipoprotein E deficient mice

    NARCIS (Netherlands)

    Boesten, L.S.M.; Zadelaar, A.S.M.; Nieuwkoop, A. van; Hu, L.; Teunisse, A.F.A.S.; Jochemsen, A.G.; Evers, B.; Water, B. van de; Gijbels, M.J.J.; Vlijmen, B.J.M. van; Havekes, L.M.; Winther, M.P.J. de

    2009-01-01

    The cellular composition of atherosclerotic lesions is determined by many factors including cell infiltration, proliferation and cell death. Tumor suppressor gene p53 has been shown to regulate both cell proliferation and cell death in many cell types. In the present study, we investigated the role

  8. Immortal DNA strand cosegregation requires p53/IMPDH-dependent asymmetric self-renewal associated with adult stem cells.

    Science.gov (United States)

    Rambhatla, Lakshmi; Ram-Mohan, Sumati; Cheng, Jennifer J; Sherley, James L

    2005-04-15

    Because they are long-lived and cycle continuously, adult stem cells (ASCs) are predicted as the most common precursor for cancers in adult mammalian tissues. Two unique attributes have been proposed to restrict the carcinogenic potential of ASCs. These are asymmetric self-renewal that limits their number and immortal DNA strand cosegregation that limits their accumulation of mutations due to DNA replication errors. Until recently, the molecular basis and regulation of these important ASC-specific functions were unknown. We developed engineered cultured cells that exhibit asymmetric self-renewal and immortal DNA strand cosegregation. These model cells were used to show that both ASC-specific functions are regulated by the p53 cancer gene. Previously, we proposed that IMP dehydrogenase (IMPDH) was an essential factor for p53-dependent asymmetric self-renewal. We now confirm this proposal and provide quantitative evidence that asymmetric self-renewal is acutely sensitive to even modest changes in IMPDH expression. These analyses reveal that immortal DNA strand cosegregation is also regulated by IMPDH and confirm the original implicit precept that immortal DNA strand cosegregation is specific to cells undergoing asymmetric self-renewal (i.e., ASCs). With IMPDH being the rate-determining enzyme for guanine ribonucleotide (rGNP) biosynthesis, its requirement implicates rGNPs as important regulators of ASC asymmetric self-renewal and immortal DNA strand cosegregation. An in silico analysis of global gene expression data from human cancer cell lines underscored the importance of p53-IMPDH-rGNP regulation for normal tissue cell kinetics, providing further support for the concept that ASCs are key targets for adult tissue carcinogenesis.

  9. Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

    International Nuclear Information System (INIS)

    Tong, Ying; Smith, M.A.; Tucker, S.B.

    1997-01-01

    Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

  10. Differential effects of garcinol and curcumin on histone and p53 modifications in tumour cells

    Directory of Open Access Journals (Sweden)

    Collins Hilary M

    2013-01-01

    Full Text Available Abstract Background Post-translational modifications (PTMs of histones and other proteins are perturbed in tumours. For example, reduced levels of acetylated H4K16 and trimethylated H4K20 are associated with high tumour grade and poor survival in breast cancer. Drug-like molecules that can reprogram selected histone PTMs in tumour cells are therefore of interest as potential cancer chemopreventive agents. In this study we assessed the effects of the phytocompounds garcinol and curcumin on histone and p53 modification in cancer cells, focussing on the breast tumour cell line MCF7. Methods Cell viability/proliferation assays, cell cycle analysis by flow cytometry, immunodetection of specific histone and p53 acetylation marks, western blotting, siRNA and RT-qPCR. Results Although treatment with curcumin, garcinol or the garcinol derivative LTK-14 hampered MCF7 cell proliferation, differential effects of these compounds on histone modifications were observed. Garcinol treatment resulted in a strong reduction in H3K18 acetylation, which is required for S phase progression. Similar effects of garcinol on H3K18 acetylation were observed in the osteosarcoma cells lines U2OS and SaOS2. In contrast, global levels of acetylated H4K16 and trimethylated H4K20 in MCF7 cells were elevated after garcinol treatment. This was accompanied by upregulation of DNA damage signalling markers such as γH2A.X, H3K56Ac, p53 and TIP60. In contrast, exposure of MCF7 cells to curcumin resulted in increased global levels of acetylated H3K18 and H4K16, and was less effective in inducing DNA damage markers. In addition to its effects on histone modifications, garcinol was found to block CBP/p300-mediated acetylation of the C-terminal activation domain of p53, but resulted in enhanced acetylation of p53K120, and accumulation of p53 in the cytoplasmic compartment. Finally, we show that the elevation of H4K20Me3 levels by garcinol correlated with increased expression of SUV420H2

  11. Differential effects of garcinol and curcumin on histone and p53 modifications in tumour cells

    International Nuclear Information System (INIS)

    Collins, Hilary M; Kundu, Tapas K; Heery, David M; Abdelghany, Magdy K; Messmer, Marie; Yue, Baigong; Deeves, Sian E; Kindle, Karin B; Mantelingu, Kempegowda; Aslam, Akhmed; Winkler, G Sebastiaan

    2013-01-01

    Post-translational modifications (PTMs) of histones and other proteins are perturbed in tumours. For example, reduced levels of acetylated H4K16 and trimethylated H4K20 are associated with high tumour grade and poor survival in breast cancer. Drug-like molecules that can reprogram selected histone PTMs in tumour cells are therefore of interest as potential cancer chemopreventive agents. In this study we assessed the effects of the phytocompounds garcinol and curcumin on histone and p53 modification in cancer cells, focussing on the breast tumour cell line MCF7. Cell viability/proliferation assays, cell cycle analysis by flow cytometry, immunodetection of specific histone and p53 acetylation marks, western blotting, siRNA and RT-qPCR. Although treatment with curcumin, garcinol or the garcinol derivative LTK-14 hampered MCF7 cell proliferation, differential effects of these compounds on histone modifications were observed. Garcinol treatment resulted in a strong reduction in H3K18 acetylation, which is required for S phase progression. Similar effects of garcinol on H3K18 acetylation were observed in the osteosarcoma cells lines U2OS and SaOS2. In contrast, global levels of acetylated H4K16 and trimethylated H4K20 in MCF7 cells were elevated after garcinol treatment. This was accompanied by upregulation of DNA damage signalling markers such as γH2A.X, H3K56Ac, p53 and TIP60. In contrast, exposure of MCF7 cells to curcumin resulted in increased global levels of acetylated H3K18 and H4K16, and was less effective in inducing DNA damage markers. In addition to its effects on histone modifications, garcinol was found to block CBP/p300-mediated acetylation of the C-terminal activation domain of p53, but resulted in enhanced acetylation of p53K120, and accumulation of p53 in the cytoplasmic compartment. Finally, we show that the elevation of H4K20Me3 levels by garcinol correlated with increased expression of SUV420H2, and was prevented by siRNA targeting of SUV420H2. In

  12. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or

  13. A study on the effect of Helicobacter pylori infection on p53 expression in gastric cancer and gastritis tissues.

    Science.gov (United States)

    Salih, Barik A; Gucin, Zuhal; Bayyurt, Nizamettin

    2013-09-16

    Helicobacter pylori cause damage to gastric epithelial cells and alterations in the p53 gene that lead to cancer development. This study aimed to determine the correlation of p53 expression with H. pylori using immunohistochemistry, RFLP-PCR, and histopathology. Gastric biopsy samples from gastric cancer (GC) (n = 54) and gastritis (n = 31) patients were examined for histopathological changes and expression of p53 protein by immunohistochemistry. Immunohistochemical analysis of p53 protein expression in H. pylori-positive GC sections showed an average of 44.3% positive cells in tumors and 6.9% in normal tissues, as compared to 16.4% and 4.4% in H. pylori-negative sections. P53 expression showed significant association with H. pylori (P = 0.005), invasion depth (P = 0.029) and inflammation reaction (P = 0.008). In gastritis sections, no difference in the average p53 staining in H. pylori-positive or -negative sections was seen. PCR-RFLP results also showed no difference in genotype frequencies of p53 in H. pylori-positive or -negative gastritis sections. Histopathology study of H. pylori-positive GC sections showed that 97.2% were the intestinal type and 2.8% the diffuse type, while in H. pylori-negative sections 35.2% were the intestinal type and 64.8% the diffuse type. Biopsy sections from H. pylori-positive gastritis patients revealed more severe inflammation than those of H. pylori-negative patients. Our results show that H. pylori infection affects p53 expression in GC. The average p53 expression was significantly higher in tumor than in normal tissues. In gastritis sections p53 expression was significantly associated with H. pylori.

  14. Role of wild-type p53 in apoptotic and non-apoptotic cell death induced by X-irradiation and heat treatment in p53-mutated mouse M10 cells

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio

    2010-01-01

    The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)

  15. Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

    International Nuclear Information System (INIS)

    Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

    2009-01-01

    A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

  16. p53 and the Viral Connection: Back into the Future ‡

    Directory of Open Access Journals (Sweden)

    Ronit Aloni-Grinstein

    2018-06-01

    Full Text Available The discovery of the tumor suppressor p53, through its interactions with proteins of tumor-promoting viruses, paved the way to the understanding of p53 roles in tumor virology. Over the years, accumulating data suggest that WTp53 is involved in the viral life cycle of non-tumor-promoting viruses as well. These include the influenza virus, smallpox and vaccinia viruses, the Zika virus, West Nile virus, Japanese encephalitis virus, Human Immunodeficiency Virus Type 1, Human herpes simplex virus-1, and more. Viruses have learned to manipulate WTp53 through different strategies to improve their replication and spreading in a stage-specific, bidirectional way. While some viruses require active WTp53 for efficient viral replication, others require reduction/inhibition of WTp53 activity. A better understanding of WTp53 functionality in viral life may offer new future clinical approaches, based on WTp53 manipulation, for viral infections.

  17. Phosphorylation of p53 at serine 15 in A549 pulmonary epithelial cells exposed to vanadate: Involvement of ATM pathway

    International Nuclear Information System (INIS)

    Suzuki, Katsura; Inageda, Kiyoshi; Nishitai, Gen; Matsuoka, Masato

    2007-01-01

    When A549 cells were exposed to sodium metavanadate (NaVO 3 ), the pentavalent species of vanadium (vanadate), phosphorylation of p53 protein at Ser15 was found in a time (8-48 h)- and dose (10-200 μM)-dependent manner. After the incubation with 50 or 100 μM NaVO 3 for 48 h, accumulation of p53 protein was accompanied with Ser15 phosphorylation. Among serines in p53 protein immunoprecipitated from A549 cells treated with 100 μM NaVO 3 for 48 h, only Ser15 was markedly phosphorylated. Treatment with other vanadate compounds, sodium orthovanadate (Na 3 VO 4 ) and ammonium metavanadate (NH 4 VO 3 ), also induced Ser15 phosphorylation and accumulation of p53 protein. While phosphorylation of extracellular signal-regulated protein kinase (ERK) was found in cells treated with NaVO 3 , treatment with U0126 did not suppress Ser15 phosphorylation. On the other hand, treatment with wortmannin or caffeine, the inhibitors to phosphatidylinositol 3-kinase related kinases (PIKKs), suppressed both NaVO 3 -induced Ser15 phosphorylation and accumulation of p53 protein. The silencing of ataxia telangiectasia mutated (ATM) expression using short-interference RNA resulted in the marked suppression of Ser15 phosphorylation in A549 cells exposed to NaVO 3 . However, treatment with antioxidants such as catalase and N-acetylcysteine did not suppress NaVO 3 -induced Ser15 phosphorylation. Transcriptional activation of p53 and DNA fragmentation in A549 cells treated with NaVO 3 were suppressed only slightly by S15A mutation, suggesting that Ser15 phosphorylation is not essential for these responses. The present results showed that vanadate induces the phosphorylation of p53 at Ser15 depending on ATM, one of the members of PIKK family, in this human pulmonary epithelial cell line

  18. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  19. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Ganapathy, Suthakar, E-mail: s.ganapathy@neu.edu [Center for Drug Development, Northeastern University, Boston (United States); Li, Ping [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Fagman, Johan [The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Yu, Tianqi; Lafontant, Jean [Center for Drug Development, Northeastern University, Boston (United States); Zhang, Guojun [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); Chen, Changyan [Center for Drug Development, Northeastern University, Boston (United States); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden)

    2016-09-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  20. Distinct pattern of p53 mutations in bladder cancer

    DEFF Research Database (Denmark)

    Spruck, C H; Rideout, W M; Olumi, A F

    1993-01-01

    A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...

  1. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    International Nuclear Information System (INIS)

    Ganapathy, Suthakar; Li, Ping; Fagman, Johan; Yu, Tianqi; Lafontant, Jean; Zhang, Guojun; Chen, Changyan

    2016-01-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  2. COX-2 and p53 in human sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Cyr, Diane; Luce, Danièle

    2008-01-01

    The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...

  3. Super p53 for Treatment of Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public...a lead construct. Technical skills gained in the proposal include cell culture , transfections, microscopy, apoptosis assays, transcriptional assays...experiments complete 100% (DOD) Specific Aim 2: Deliver super p53 DNA with advanced polymeric systems alone and in combination with CPTX first in vitro

  4. p53 and ARF: Unexpected players in autophagy

    OpenAIRE

    Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.

    2010-01-01

    p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino...

  5. Non-Canonical Cell Death Induced by p53

    Directory of Open Access Journals (Sweden)

    Atul Ranjan

    2016-12-01

    Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.

  6. Berberine induces p53-dependent cell cycle arrest and apoptosis of human osteosarcoma cells by inflicting DNA damage

    International Nuclear Information System (INIS)

    Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing; Guo Chun; Zhu Faliang; Yang Qiaozi; Gao Guimin; Gong Yaoqin; Shao Changshun

    2009-01-01

    Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis

  7. Berberine induces p53-dependent cell cycle arrest and apoptosis of human osteosarcoma cells by inflicting DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Guo Chun; Zhu Faliang [Institute of Immunology, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Yang Qiaozi [Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States); Gao Guimin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Gong Yaoqin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China)], E-mail: yxg8@sdu.edu.cn; Shao Changshun [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)], E-mail: shao@biology.rutgers.edu

    2009-03-09

    Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis.

  8. SCGB3A2 Inhibits Acrolein-Induced Apoptosis through Decreased p53 Phosphorylation.

    Science.gov (United States)

    Kurotani, Reiko; Shima, Reika; Miyano, Yuki; Sakahara, Satoshi; Matsumoto, Yoshie; Shibata, Yoko; Abe, Hiroyuki; Kimura, Shioko

    2015-04-28

    Chronic obstructive pulmonary disease (COPD), a major global health problem with increasing morbidity and mortality rates, is anticipated to become the third leading cause of death worldwide by 2020. COPD arises from exposure to cigarette smoke. Acrolein, which is contained in cigarette smoke, is the most important risk factor for COPD. It causes lung injury through altering apoptosis and causes inflammation by augmenting p53 phosphorylation and producing reactive oxygen species (ROS). Secretoglobin (SCGB) 3A2, a secretory protein predominantly present in the epithelial cells of the lungs and trachea, is a cytokine-like small molecule having anti-inflammatory, antifibrotic, and growth factor activities. In this study, the effect of SCGB3A2 on acrolein-related apoptosis was investigated using the mouse fibroblast cell line MLg as the first step in determining the possible therapeutic value of SCGB3A2 in COPD. Acrolein increased the production of ROS and phosphorylation of p53 and induced apoptosis in MLg cells. While the extent of ROS production induced by acrolein was not affected by SCGB3A2, p53 phosphorylation was significantly decreased by SCGB3A2. These results demonstrate that SCGB3A2 inhibited acrolein-induced apoptosis through decreased p53 phosphorylation, not altered ROS levels.

  9. SCGB3A2 Inhibits Acrolein-Induced Apoptosis through Decreased p53 Phosphorylation

    International Nuclear Information System (INIS)

    Kurotani, Reiko; Shima, Reika; Miyano, Yuki; Sakahara, Satoshi; Matsumoto, Yoshie; Shibata, Yoko; Abe, Hiroyuki; Kimura, Shioko

    2015-01-01

    Chronic obstructive pulmonary disease (COPD), a major global health problem with increasing morbidity and mortality rates, is anticipated to become the third leading cause of death worldwide by 2020. COPD arises from exposure to cigarette smoke. Acrolein, which is contained in cigarette smoke, is the most important risk factor for COPD. It causes lung injury through altering apoptosis and causes inflammation by augmenting p53 phosphorylation and producing reactive oxygen species (ROS). Secretoglobin (SCGB) 3A2, a secretory protein predominantly present in the epithelial cells of the lungs and trachea, is a cytokine-like small molecule having anti-inflammatory, antifibrotic, and growth factor activities. In this study, the effect of SCGB3A2 on acrolein-related apoptosis was investigated using the mouse fibroblast cell line MLg as the first step in determining the possible therapeutic value of SCGB3A2 in COPD. Acrolein increased the production of ROS and phosphorylation of p53 and induced apoptosis in MLg cells. While the extent of ROS production induced by acrolein was not affected by SCGB3A2, p53 phosphorylation was significantly decreased by SCGB3A2. These results demonstrate that SCGB3A2 inhibited acrolein-induced apoptosis through decreased p53 phosphorylation, not altered ROS levels

  10. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  11. Structural effects and competition mechanisms targeting the interactions between p53 and MDM2 for cancer therapy

    Science.gov (United States)

    Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei

    2017-06-01

    Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.

  12. Influence of P53 on the radiotherapy response of hepatocellular carcinoma

    Science.gov (United States)

    Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

    2015-01-01

    Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

  13. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  15. Characterization of Two Novel Oncogenic Pathways Collaborating With Loss of P53 or Activated Neu in Mouse Models of Breast Cancer

    National Research Council Canada - National Science Library

    Lu, Jianrong; Leder, Philip

    2005-01-01

    Cancer develops through accumulation of multiple genetic mutations. Loss of tumor suppressor gene p53 and activation of oncogene Neu/ErbB2 are among the most frequent genetic alterations in human breast cancer...

  16. Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.

    Science.gov (United States)

    Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D

    2017-08-01

    Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.

  17. MDM2, p53 and pRb Expression Prior to Definitive Chemoradiotherapy in Esophageal Carcinoma

    International Nuclear Information System (INIS)

    Yoon, Mee Sun; Nam, Taek Keun; Lee, Jae Hyuk; Cho, Sang Hee; Song, Ju Young; Ahn, Sung Ja; Chung, Ik Joo; Chung, Woong Ki; Nah, Byung Sik

    2007-01-01

    Purpose: This study evaluated the pretreatment expression patterns of MDM2, p53, and pRb proteins to determine if the expression patterns could predict the outcome of concurrent chemoradiotherapy (CCRT) for esophageal squamous cell carcinoma and aid in the decisions for the selection of treatment modalities. Materials and Methods: Fifty-one patients that were treated with definitive hemoradiotherapy for stage I∼ IVa esohageal squamous cell carcinoma were selected for this study. Radiotherapy was administered with daily 1.8∼2 Gy fractions up to a median dose of 54 Gy for primary tumors, and with four cycles of cisplatin/5-fluorouracil chemotherapy that was administered every 4 weeks, the first two cycles of which were administered concurrently with radiotherapy. Expression of MDM2, p53, and pRb was investigated by immunohistochemical analysis using pretreatment biopsy specimens. Results: MDM2, p53, and pRb were detected with high immunoreactivity in 19.6%, 27.5%, and 66.7% of the patients, respectively. However, there was no significant correlation between expression of these factors and clinical outcome. By the use of multivariate analysis with nine covariates-age, tumor location, tumor length, stage, pathological response, clinical response, MDM2 expression, p53 expression, and pRb expression, only pathological response and stage were significant factors for cause-specific survival. Conclusion: Expression of MDM2, p53, and pRb was not found to be clinically significant for predicting outcomes after CCRT in this study. Further studies with a larger patient population and longer follow-up periods are needed to re-evaluate the expression pattern and to identify new predictors for CCRT response

  18. Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

    Directory of Open Access Journals (Sweden)

    Ravshan Burikhanov

    2014-01-01

    Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

  19. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G

    2013-01-01

    Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches

  20. Concurrent overexpression of serum p53 mutation related with Helicobacter pylori infection

    Directory of Open Access Journals (Sweden)

    Lorenzo-Peñuelas Antonio

    2010-06-01

    Full Text Available Abstract Background & Aims In the province of Cadiz (Spain, the adjusted mortality rate for gastric cancer in the coastal town of Barbate is 10/100.000 inhabitants, whereas in the inland town of Ubrique, the rate is twice as high. The rate of Helicobacter pylori (H. pylori infection (H. pylori antibodies in the normal population was 54% in Ubrique, but only 32% in Barbate. In the two decades since its original discovery, p53 has found a singularly prominent place in our understanding of human gastric cancer and H. pylori cause accumulation of reactive oxygen species in the mucosa compartment. This study was designed to compare serum levels of p53 in a population characterized by high mortality due to stomach cancer and a high prevalence of H. pylori infection and another population in which mortality from this cause and the prevalence of H. pylori infection are low. Materials and methods 319 subjects from the low mortality population and 308 from the high mortality population were studied, as were 71 patients with stomach cancer. We measured serum immunoglobulin G antibody to H. pylori and serum mutant p53 protein and ceruloplasmin. Results The difference between the two populations in the prevalence of H. pylori infection was significant (p Conclusions There is a significant association between infection with H. pylori, elevated titers of H. pylori antibodies, and positivity for serum mutant p53 protein. Such information can significantly increase our basic knowledge in molecular pathology of gastric cancer and protection against H. pylori infection.

  1. P53-dependent antiproliferative and pro-apoptotic effects of trichostatin A (TSA) in glioblastoma cells.

    Science.gov (United States)

    Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R

    2012-05-01

    Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.

  2. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  3. Immunohistochemical Expression of P53 Protein in Cutaneous Basal Cell Carcinoma: A Clinicopathological Study of 66 Cases

    Directory of Open Access Journals (Sweden)

    Vladim and iacute;r Barto and scaron;

    2016-12-01

    Full Text Available Objective: Nuclear expression of p53 protein is associated with a biological behavior in a variety of human malignancies. In cutaneous basal cell carcinoma (BCC, however, many studies have provided conflicting results in this regard. We aimed to determine whether there is relationship between p53 expression and different histologic subtypes of BCC, and whether it may indicate tumor aggressiveness. Materials and Methods: Biopsy samples from 66 cutaneous BCCs from 57 patients were collected. P53 expression was demonstrated by immunohistochemical staining using the anti-p53 antibody. Among them, 52 cases were also evaluated for Ki-67 antigen. Results: Immunoreactivity of p53 protein varied in the range of 0 to 100% of total tumor tissue (mean value 46.0%. The expression exceeding 5% of cancer tissue (positive staining was found in 54 BCCs (81.8%. Within this group, there were 25 cases (37.9% with low and 29 cases (43.9% with high expression. In superficial, superficial-nodular, nodular, nodular-infiltrative and infiltrative BCCs, p53 protein positivity was found in 100% (8/8, 80% (8/10, 70.4% (19/27, 88.2% (15/17 and 100% (4/4, respectively. We did not reveal a significant correlation between the extent of p53 protein expression and BCC subtypes except for nodular BCC, in which a number of negative cases (8/27, 29.6% were just above the threshold of statistical significance (P = 0.04. After merging cancers into non-aggressive and aggressive growth phenotype, no association with expression of p53 protein was found. There was no relationship between p53 protein expression and topographical sites after they have been gathered into sun-exposed and sun-protected locations. We did not observe any association between expression of p53 protein and Ki-67 antigen. Conclusion: In cutaneous BCC, the expression of p53 protein does not seem to reflect a biological behavior and tumor aggressiveness. Therefore, in a routine dermatopathological practice

  4. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    Energy Technology Data Exchange (ETDEWEB)

    Nishida, Tamotsu, E-mail: nishida@gene.mie-u.ac.jp [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan); Yamada, Yoshiji [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan)

    2011-03-11

    Research highlights: {yields} SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. {yields} SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. {yields} SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. {yields} We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  5. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    International Nuclear Information System (INIS)

    Nishida, Tamotsu; Yamada, Yoshiji

    2011-01-01

    Research highlights: → SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. → SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. → SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. → We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  6. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  7. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

    Science.gov (United States)

    York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

    2017-09-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

  8. Influence of p53 (rs1625895 polymorphism in kidney transplant recipients

    Directory of Open Access Journals (Sweden)

    Negar Azarpira

    2014-01-01

    Full Text Available Reperfusion injury predisposes the kidney allograft to acute rejection. Apoptosis is a mechanism that results in graft injury, and TP53 is an important involved gene. To determine the association between single nucleotide polymorphism (SNP in the pro-apoptotic protein p53 (rs1625895 and acute rejection in renal transplants, we studied 100 recipients of kidney allografts and 100 healthy individuals served as controls. The polymorphism was determined by the polymerase chain reaction restriction-fragment length polymorphism (PCR-RFLP test. Overall, 31 recipients developed rejection. There was no difference in the genotype frequencies between the recipients and the controls. However, we found a difference of genotype and allele frequencies between recipients with and those without rejection. The WW genotype was more frequent in recipients with rejection. Although rejection is a complex immunologic event and functional importance of SNPs has not been confirmed yet, we suggest that wild type p53 may promote apoptosis during inflammation.

  9. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  10. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik

    2006-01-01

    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  11. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    NARCIS (Netherlands)

    Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.

    2013-01-01

    Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,

  12. p53-dependent non-coding RNA networks in chronic lymphocytic leukemia

    NARCIS (Netherlands)

    Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.

    2015-01-01

    Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We

  13. p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer

    DEFF Research Database (Denmark)

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F

    2014-01-01

    The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....

  14. Prognostic value of p53 mutations in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji [Showa Univ., Tokyo (Japan). School of Medicine

    2001-05-01

    A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)

  15. p53 levels, cell cycle kinetics and radiosensitivity in two SV40 transformed Wi38VA13 fibroblast strains

    International Nuclear Information System (INIS)

    Werner, F.; Zoelzer, F.; Streffer, C.

    2001-01-01

    Background: The tumor suppressor protein p53 which can mediate an ionizing radiation-induced G 1 arrest in mammalian cells, forms complexes with SV40 large T antigen (l-T-Ag). We have analyzed the p53 levels, the capability to undergo a G 1 arrest and the radiosensitivity of two SV40 transformed fibroblast strains differing in their large T antigen expression. Material and Methods: One of the two strains (VA13F) is the commercially available form of Wi38VA13, the other (VA13E) arose spontaneously from the original one in our laboratory. Their p53 levels were measured by means of flow cytometry (FCM) and Western blot (WB) with two p53 antibodies (Ab-3, clone PAb240; Ab-6, clone DO-1; both Oncogene Science). Cell cycle distributions were determined flow cytometrically after BrdU labeling at regular time intervals after exposure to 250 kV X-rays. Radiosensitivity was assessed in a clonogenicity assay. Results: The p53 levels of the two strains corresponded to their large T antigen expression, presumably due to complex formation between the two proteins. The strain with a high p53 level did not show a G 1 arrest and had a relatively high radiosensitivity, whereas the strain with a low p53 level showed a significant G 1 arrest and a lower radiosensitivity. Conclusion: These results suggest that 1. complex formation between the large T antigen and p53 reduces the latter's functionality; 2. in these two strains the G 1 arrest is one of the factors determining radiosensitivity. (orig.) [de

  16. Prognostic value of p53 mutations in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy

    International Nuclear Information System (INIS)

    Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji

    2001-01-01

    A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)

  17. Prevalence of codon 72 P53 polymorphism in Brazilian women with cervix cancer

    Directory of Open Access Journals (Sweden)

    Sylvia Michelina Fernandes Brenna

    2004-01-01

    Full Text Available The p53 codon 72 polymorphism seems to be associated with HPV-carcinogenesis, although controversial data have been reported. A series of Brazilian women with cervix carcinomas were analyzed. Ninety-nine (67% of 148 women were found to be homozygous (arg/arg for the arginine polymorphism, and 49 (33% were heterozygous (arg/pro. This polymorphism may be an important determinant of the risk for cervix cancer, but does not seem to be sufficient for carcinogenesis.

  18. The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy

    International Nuclear Information System (INIS)

    Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.

    1996-01-01

    Background and purpose: Experimental studies have implicated the normal or 'wild type' p53 protein (i.e. WTp53) in the cellular response to ionizing radiation and other DNA damaging agents. Whether altered WTp53 protein function can lead to changes in cellular radiosensitivity and/or clinical radiocurability remains an area of ongoing study. In this review, we describe the potential implications of altered WTp53 protein function in normal and tumour cells as it relates to clinical radiotherapy, and describe novel treatment strategies designed to re-institute WTp53 protein function as a means of sensitizing cells to ionizing radiation. Methods and Materials: A number of experimental and clinical studies are critically reviewed with respect to the role of the p53 protein as a determinant of cellular oncogenesis, genomic stability, apoptosis, DNA repair and radioresponse in normal and transformed mammalian cells. Results: In normal fibroblasts, exposure to ionizing radiation leads to a G1 cell cycle delay (i.e. a 'G1 checkpoint') as a result of WTp53-mediated inhibition of G1-cyclin-kinase and retinoblastoma (pRb) protein function. The G1 checkpoint response is absent in tumour cells which express a mutant form of the p53 protein (i.e. MTp53), leading to acquired radioresistance in vitro. Depending on the cell type studied, this increase in cellular radiation survival can be mediated through decreased radiation-induced apoptosis, or altered kinetics of the radiation-induced G1 checkpoint. Recent biochemical studies support an indirect role for the p53 protein in both nucleotide excision and recombinational DNA repair pathways. However, based on clinicopathologic data, it remains unclear as to whether WTp53 protein function can predict for human tumour radiocurability and normal tissue radioresponse. Conclusions: Alterations in cell cycle control secondary to aberrant WTp53 protein function may be clinically significant if they lead to the acquisition of mutant

  19. Downregulation of B-myb promotes senescence via the ROS-mediated p53/p21 pathway, in vascular endothelial cells.

    Science.gov (United States)

    Zhou, Zhihui; Yin, Yanlin; Chang, Qun; Sun, Guanqun; Lin, Jiahui; Dai, Yalei

    2017-04-01

    To reveal whether B-myb is involved in preventing senescence of vascular endothelial cells, and if so, to identify possible mechanisms for it. C57/BL6 male mice and primary human aortic endothelial cells (HAECs) were used. Bleomycin was applied to induce stress-related premature senescence. B-myb knockdown was achieved using an siRNA technique and cell senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) assay. Intracellular reactive oxygen species (ROS) production was analysed using an ROS assay kit and cell proliferation was evaluated using KFluor488 EdU kit. Capillary tube network formation was determined by Matrigel assay. Expressions of mRNA and protein levels were detected by real-time PCR and western blotting. B-myb expression significantly decreased, while p53 and p21 expressions increased in the aortas of aged mice. This expression pattern was also found in replicative senescent HAECs and senescent HAECs induced by bleomycin. B-myb knockdown resulted in upregulation of p22 phox , ROS accumulation and cell senescence of HAECs. Downregulation of B-myb significantly inhibited cell proliferation and capillary tube network formation and activated the p53/p21 signalling pathway. Blocking ROS production or inhibiting p53 activation remarkably attenuated SA-β-gal activity and delayed cell senescence induced by B-myb-silencing. Downregulation of B-myb induced senescence by upregulation of p22 phox and activation of the ROS/p53/p21 pathway, in our vascular endothelial cells, suggesting that B-myb may be a novel candidate for regulating cell senescence to protect against endothelial senescence-related cardiovascular diseases. © 2016 John Wiley & Sons Ltd.

  20. Association between p53 codon 72 polymorphism and systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Mohammad Nabavi

    2014-06-01

    Full Text Available Aim : Systemic lupus erythematosus (SLE is a systemic vasculitic disorder, with multiple genes involved in the disease pathogenesis. The p53 gene plays an important role in controlling the cell cycle. We aimed to study the prevalence of p53 polymorphism in SLE patients and analyze the relationship between the p53 polymorphism and clinical-laboratory features of the disease. Material and methods : This case-control study was conducted on patients with confirmed SLE at Namazi Hospital, Shiraz, Iran. Seventy-seven patients with SLE including 9 (11.8% men and 68 (88.2% women with mean age of 25.61 ±10.69 years and 80 healthy controls with mean age of 51.82 ±14.25 years were included. The patients’ information, including the epidemiological profile, disease history, disease symptoms and also the laboratory findings, were extracted from the hospital records. The p53 expression was determined in lyzed lymphocytes. The data were analyzed using SPSS software version 14.00 for Windows considering p < 0.05 as statistically significant. Results : The frequencies of Arg/Arg, Pro/Pro and Arg/Pro among normal controls were 38.8%, 28.8% and 37.5%, respectively, but in the patients, Arg/Arg, Pro/Pro and Arg/Pro genotypes frequencies were shown to be 29.2%, 12.3% and 58.5%, respectively. Thus, heterozygous form of this polymorphism was shown to be associated with the disease more than the homozygous alleles. There was a significant relationship between the different allele types of p53 and some clinical features of SLE. There was no association between the different allele types and any of the initial manifestations of the disease and the laboratory findings, as well. Conclusions: In an Iranian population the functional oncoprotein of p53 with codon 72 polymorphism may play an important role in the pathogenesis and clinical presentation of SLE.

  1. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    Science.gov (United States)

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  2. Preliminary study of p53 and c-erbB-2 expression in gallbladder cancer in Indian patients

    Directory of Open Access Journals (Sweden)

    Singh Usha

    2006-05-01

    Full Text Available Abstract Background The inactivation of the tumour suppressor gene and activation of the proto-oncogene are the key steps in the development of the human cancer. The p53 and c-erbB-2 are the best examples of it. In the present study, our aim was to determine the role of these genes in the carcinogenesis of gallbladder by immunohistochemistry. Methods In all 78 consecutive patients of gall bladder diseases were studied for p53 and c-erbB-2 expression immunohistochemically and their expression was correlated with the age, grades and stages of the disease and presence of stone. An informed consent was obtained in each case. Chi square and z test were applied to see the association of p53 and c-erbB-2 over expression with other clinicopathological factors. Results Eight (20% patients of gall bladder cancer were positive for p53 expression and 10 (25% patients for c-erbB-2. The p53 positivity increased with increasing grade while cerbB-2 positivity decreased with increasing grade of gall bladder cancer. Mean age in cerbB-2 positive cases were lesser as compared to negative cases while p53 did not show such association with age. Conclusion Only one case of gall bladder cancer co-expressed the p53 and c-erbB-2, thereby suggesting that p53 and c-erbB-2 may have independent role in carcinogenesis of gall bladder cancer. c-erbB-2 over expression in adenoma and younger age group indicates its role as an early event in carcinogenesis of gallbladder. However study of larger sample is required to further validate the results.

  3. p53/Surviving Ratio as a Parameter for Chemotherapy Induction Response in Children with Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Rinaldi Lenggana

    2016-11-01

    Full Text Available Acute myeloid leukemia (AML is a malignancy that is often found in children. Many studies into the failure of apoptosis function, or programmed cell death, is one of the most important regulatory mechanisms of cellular hemostasis which is closely linked to the development of cancer, are important. Also, regulation of the apoptotic (p53 and anti-apoptotic (surviving proteins influence treatment outcome. One role of p53 is to monitor cellular stress necessary to induce apoptosis. Surviving (BIRC5 is a group of proteins in the apoptosis inhibitor which works by inhibiting caspase-3. The role of surviving is considered very important in oncogenesis proliferation and cell growth regulation. Chemotherapy in childhood AML can inhibit cell growth and induce slowing as well as stopping the cell cycle. Thus, the aim of this study was to compare p53 and surviving before and after receiving induction chemotherapy in children with AML and also to determine the p53/surviving ratio. Peripheral blood mononuclear cells were collected from AML children before treatment and three months after starting their induction therapy. p53 and surviving were measured by flowcytometry using monoclonal antibodies. Data were analyzed by t-test for comparison between groups and Spearman’s test to find out the correlation between variables with a significant value of p < 0.05. A total of 8 children were evaluated. The intensity of p53 expression was not significantly increased after induction phase chemotherapy (p = 0.224, but surviving expression and the ratio of p53/surviving were significantly increased in the treatment group compared with the levels prior to chemotherapy (p = 0.002, p = 0.034, and there was a strong negative correlation between p53 and surviving after chemotherapy (r = −0.63, p = 0.049.

  4. Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

    International Nuclear Information System (INIS)

    Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

    2006-01-01

    The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

  5. Effect of p53 activation on cell growth, thymidine kinase-1 activity, and 3'-deoxy-3'fluorothymidine uptake

    International Nuclear Information System (INIS)

    Schwartz, Jeffrey L.; Tamura, Yasuko; Jordan, Robert; Grierson, John R.; Krohn, Kenneth A.

    2004-01-01

    The use of thymidine (TdR) and thymidine analogs such as 3'-deoxy-3'-fluorothymidine (FLT) as positron emission tomography (PET)-based tracers of tumor proliferation rate is based on the hypothesis that measurement of uptake of these nucleosides, a function primarily of thymidine kinase-1 (TK 1 ) activity, provides an accurate measure of cell proliferation in tumors. Tumor growth is influenced by many factors including the oxygen concentration within tumors and whether tumor cells have been exposed to cytotoxic therapies. The p53 gene plays an important role in regulating growth under both of these conditions. The goal of this study was to investigate the influence of p53 activation on cell growth, TK 1 activity, and FLT uptake. To accomplish this, TK 1 activity, S phase fraction, and the uptake of FLT were determined in plateau-phase and exponentially growing cultures of an isogenic pair of human tumor cell lines in which p53 expression was normal or inactivated by human papilloma virus type 16 E6 expression. Ionizing radiation exposure was used to stimulate p53 activity and to induce alterations in cell cycle progression. We found that exposure of cells to ionizing radiation induced dose-dependent changes in cell cycle progression in both cell lines. The relationship between S phase percentage, TK 1 activity, and FLT uptake were essentially unchanged in the p53-normal cell line. In contrast, TK 1 activity and FLT uptake remained high in the p53-deficient variant even when S phase percentage was low due to a p53-dependent G2 arrest. We conclude that a functional p53 response is required to maintain the normal relationship between TK1 activity and S phase percentage following radiation exposure

  6. Protein expression of P13K and P53 in prediction of response to radiotherapy in cervical cancer

    International Nuclear Information System (INIS)

    Teja Kisnanto; Devita Tetriana; Iin Kurnia; Sudiono S; Mellova Amir; Budiningsih Siregar; Ramli; Andrijono; Setiawan Soetopo; Irwan; Tjahya Kurjana; Bethy S Hernowo; Maringan DL Tobing

    2015-01-01

    Cervical cancer is a malignant disease that is common in women and is the first order of malignant disease in Indonesia. Radiotherapy is the main treatment on cervical cancer, especially at an advanced stage (IIB-IIB). P13K and P-53 protein plays a role in the regulation of apoptosis (programmed cell death). The purpose of this study was to determine the protein expression of P13K and P-53 in the prediction of response to radiotherapy action in patients with cervical cancer. Microscopic preparations obtained from biopsy tissue cancer (IIB-IIIB) to 20 patients from RSCM and RSHS. The method used is the method of immunohistochemistry using P13K and P-53 protein biomarkers in cervical cancer tissue preparations. P13K protein expression value obtained by the method of immuno reactive Score (IRS). P13K protein positive expression marked in blue on the cell cytoplasm and P-53 protein is characterized by brown or dark colors contained in the cell nucleus. Results showed that IRS value by 10% a negative P13K, P13K IRS weaker by 70%, IRS P13K was at 15%, and the IRS P13K stronger by 5%. While the index positive P-53 was obtained by 75% and negative P-53 index by 5%. Radiotherapy response analysis showed that there were 75% good response and 25% a bad response. The conclusion from this study is the expression of the protein P13K and P-53 for response prediction of radiotherapy IRS P13K values obtained in response to both radiotherapy is higher compared with radiotherapy response is bad, and the P-53 protein is not found differences in response to radiotherapy between positive and negative expressions. (author)

  7. The effects of combining ionizing radiation and adenovirus-mediated p53 gene transfer in human nasopharyngeal carcinoma cell lines

    International Nuclear Information System (INIS)

    Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry

    1997-01-01

    Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the

  8. Evaluation of multiple bio-pathological factors in colorectal adenocarcinomas: independent prognostic role of p53 and bcl-2.

    Science.gov (United States)

    Buglioni, S; D'Agnano, I; Cosimelli, M; Vasselli, S; D'Angelo, C; Tedesco, M; Zupi, G; Mottolese, M

    1999-12-22

    About 40% of patients with colorectal carcinoma will develop local or distant tumour recurrences. Integrated analyses of bio-pathological markers, predictive of tumour aggressiveness, may offer a more rational approach to planning adjuvant therapy. To this end, we analysed the correlation between p53 accumulation, Bcl-2 expression, DNA ploidy, cell proliferation and conventional clinico-pathological parameters by testing the prognostic significance of these variables in a series of 171 colorectal carcinoma patients with long-term follow-up. The relationships among the various bio-pathological parameters, analysed by multiple correspondence analysis, showed 2 different clinico-biological profiles. The first, characterised by p53 negativity, Bcl-2 positivity, diploidy, low percentage of cells in S-phase (%S-phase), a low Ki-67 score, is associated with Dukes' A-B stage, well differentiated tumours and lack of relapse. The second, defined by p53 positivity, Bcl-2 negativity, aneuploidy, high %S-phase and elevated Ki-67 score, correlates with Dukes' C-D stage, poorly differentiated tumours and presence of relapse. When these parameters were examined according to Kaplan-Meier's method, significantly shorter disease-free (DFS) and overall survival (OS) were also observed in patients bearing p53 positive and Bcl-2 negative tumours, in Dukes' B stage. In multivariate analysis, p53 accumulation and Bcl-2 expression emerged as independent predictors of a worse and better clinical outcome, respectively. Our results indicate that, in colorectal adenocarcinomas, a biological profile, based on the combined evaluation of p53 and Bcl-2, may be useful for identifying high risk patients to be enrolled in an adjuvant setting, mainly in an early stage of the disease. Int. J. Cancer (Pred. Oncol.) 84:545-552, 1999. Copyright 1999 Wiley-Liss, Inc.

  9. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

    2008-01-01

    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  10. Epidemiology Study on P53 (Rs1614984 C>T Mutation in Cigarette Smokers

    Directory of Open Access Journals (Sweden)

    Dilshad Ahmad

    2017-05-01

    Full Text Available ABSTRACT Epidemiology data have established that smoking is a prime threat for the cancers, largely lung cancer. Single-nucleotide polymorphisms (SNPs,P53 SNPs have been found to be associated with the predisposition of different cancers. Their decreased expression is reported in breast and lung cancer patients. p53 (rs1614984 had been reported to be linked with the SNPs found associated with breast cancer. The primary aim of this study to determine the association of p53 variant rs1614984 with the cigarette smokers and smoking related cancers in smokers. Among the smokers, 38% were found with CC genotype, 55% were heterozygous CT and 7% were TT, respectively. The homozygous TT genotype was seen in lower percentage of smokers (7% when compared to non-smokers (8% whereas; Significant difference was not observed when encompassed by CC, CT and TT genotypes (χ2 = 4.892, p=0.087. However, CC vs CT genotype showed a significant difference between smokers and non-smokers (p=0.031, OR 1.447 (1.035-2.025 and the dominant model CC vs CT+TT was also significantly different among smoker and non-smokers (p=0.047, OR 1.39 (1.004-1.924. Furthermore, smokers are at the risk of developing variety of diseases including lung cancer. Our finding suggests a higher percentage of heterozygous CT genotype in smokers when compared to non-smokers. Therefore, this finding gives a clue that the transition mutation of C>T (rs1614984 may leads to the lung diseases including cancer in smokers. However, there will be a need of more extensive and elaborated study to set down the aspect of p53(rs1614984 C>T in lung cancer among smokers.

  11. Clonal expansion to anaplasia in Wilms` tumors is associated with p53 mutations

    Energy Technology Data Exchange (ETDEWEB)

    Pelletier, J.; Beckwith, B.; Bardeesy, N. [Loma Linda Univ., CA (United States)]|[McGill Univ., Montreal (Canada)

    1994-09-01

    The genetics of Wilms` tumor (WT), a pediatric malignancy of the kidney, is complex. Three loci are implicated in WT initiation and include the WT1 tumor suppressor gene (residing at 11p13), an 11p15 locus, and a non-11p locus. As well, allelic loss at 16q24 in {approximately}20% of sporadic WTs suggests the location of (an) additional gene(s) involved in tumor progression. Initiation and progression in WTs is associated with multiple histological variants. Anaplasia is a rare WT subtype associated with poor prognosis and defined by enlarged and multipolar mitotic figures, a threefold nuclear enlargement (compared with adjacent nuclei of the same cell type), and hyperchromasia of the enlarged nuclei. We have previously demonstrated that p53 gene mutations are exclusively associated with anaplastic WTs, being absent from a large number of non-anaplastic WTs analyzed. To determine if such mutations are involved in clonal progression to anaplasia, we performed a retrospective analysis of histologically defined sections from tumor specimens. Six of ten WTs demonstrated p53 mutations by PCR-single stranded conformational polymorphism analysis. Two of these samples were paired, consisting of geographically demarcated anaplastic cells embedded within a non-anaplastic tumor bed. In these cases, p53 mutations were only present in the anaplastic region of the tumor. An overall decrease in the number of apoptotic cells was found associated with the anaplastic tumor region, compared to adjacent non-anaplastic tumor bed. These results indicate that p53 mutations arise during progression to anaplasia late in Wilms` tumor etiology and are associated with a more aggressive form of this cancer.

  12. Evaluation of Ki-67 Antigen and Protein P53 Expression in Orthokratinized and Parakratinized Odontogenic Keratocyst

    Directory of Open Access Journals (Sweden)

    F. Baghaei

    2004-06-01

    Full Text Available Statement of Problem: Odontogenic Keratocysts (OKC make up 10-12% of all developmental cysts with dental origin. OKCs are classified into parakeratotic and orthokeratotic types, with completely different clinical features. In order to investigate biological behavior of OKCs, an immunohistochemical study was designed, using Ki-67 antigen as proliferation marker and P53 protein as tumor suppressor gene.Purposes: The aim of the present study was to investigate the expression of P53 and Ki-67 markers in two types of OKCs and to determine their relationship with the biological behaviour of OKC.Materials and Methods: A total of 20 OKCs (parakeratotic n=10, orthokeratotic n=10were stained immunohistochemically for Ki-67 and P53 protein by Biotin – Streptavidine method. Then, slides were studied quantitatively through optical lense (magnification=X10and the number of positively stained cells was counted/mm BM.Results: The average number of Positively stained cells for Ki-67 were 62.30±11.96 cells/mm BM in parakeratotic, and 29.90±4.90 cells/mmBM in orthokeratotic OKCs (P<0.05. Positive cells for Ki-67 were dominantly located in parabasal layer. Mean stainedcells for P53 were 4.30± 2.21cells/mmBM in parakeratinized and 4.80±1.75 cells/mmBM in orthokeratotic types that was not statistically significant. (P<0.58Parakeratotic OKCs mostly occur in the lower jaw (90%, whereas just 50% of orthokeratotic OKCs occur in mandible (P=0.05Conclusion: Regarding other clinical features and the existence of daughter cysts, no significant statistical difference was found between two types of OKCs.

  13. Radioresistance of human glioma spheroids and expression of HSP70, p53 and EGFr

    International Nuclear Information System (INIS)

    Fedrigo, Carlos A; Rocha, Adriana B da; Grivicich, Ivana; Schunemann, Daniel P; Chemale, Ivan M; Santos, Daiane dos; Jacovas, Thais; Boschetti, Patryck S; Jotz, Geraldo P; Filho, Aroldo Braga

    2011-01-01

    Radiation therapy is routinely prescribed for high-grade malignant gliomas. However, the efficacy of this therapeutic modality is often limited by the occurrence of radioresistance, reflected as a diminished susceptibility of the irradiated cells to undergo cell death. Thus, cells have evolved an elegant system in response to ionizing radiation induced DNA damage, where p53, Hsp70 and/or EGFr may play an important role in the process. In the present study, we investigated whether the content of p53, Hsp70 and EGFr are associated to glioblastoma (GBM) cell radioresistance. Spheroids from U-87MG and MO59J cell lines as well as spheroids derived from primary culture of tumor tissue of one GBM patient (UGBM1) were irradiated (5, 10 and 20 Gy), their relative radioresistance were established and the p53, Hsp70 and EGFr contents were immunohistochemically determined. Moreover, we investigated whether EGFr-phospho-Akt and EGFr-MEK-ERK pathways can induce GBM radioresistance using inhibitors of activation of ERK (PD098059) and Akt (wortmannin). At 5 Gy irradiation UGBM1 and U-87MG spheroids showed growth inhibition whereas the MO59J spheroid was relatively radioresistant. Overall, no significant changes in p53 and Hsp70 expression were found following 5 Gy irradiation treatment in all spheroids studied. The only difference observed in Hsp70 content was the periphery distribution in MO59J spheroids. However, 5 Gy treatment induced a significant increase on the EGFr levels in MO59J spheroids. Furthermore, treatment with inhibitors of activation of ERK (PD098059) and Akt (wortmannin) leads to radiosensitization of MO59J spheroids. These results indicate that the PI3K-Akt and MEK-ERK pathways triggered by EGFr confer GBM radioresistance

  14. Genomic alterations during p53-dependent apoptosis induced by γ-irradiation of Molt-4 leukemia cells.

    Directory of Open Access Journals (Sweden)

    Rouba Hage-Sleiman

    Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes

  15. Influence of X-ray on the P53 gene in human peripheral blood lymphocytes

    International Nuclear Information System (INIS)

    Jin Wenwei; Cai Ting

    2002-01-01

    Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation

  16. Reversible p53 inhibition prevents cisplatin ototoxicity without blocking chemotherapeutic efficacy.

    Science.gov (United States)

    Benkafadar, Nesrine; Menardo, Julien; Bourien, Jérôme; Nouvian, Régis; François, Florence; Decaudin, Didier; Maiorano, Domenico; Puel, Jean-Luc; Wang, Jing

    2017-01-01

    Cisplatin is a widely used chemotherapy drug, despite its significant ototoxic side effects. To date, the mechanism of cisplatin-induced ototoxicity remains unclear, and hearing preservation during cisplatin-based chemotherapy in patients is lacking. We found activation of the ATM-Chk2-p53 pathway to be a major determinant of cisplatin ototoxicity. However, prevention of cisplatin-induced ototoxicity is hampered by opposite effects of ATM activation upon sensory hair cells: promoting both outer hair cell death and inner hair cell survival. Encouragingly, however, genetic or pharmacological ablation of p53 substantially attenuated cochlear cell apoptosis, thus preserving hearing. Importantly, systemic administration of a p53 inhibitor in mice bearing patient-derived triple-negative breast cancer protected auditory function, without compromising the anti-tumor efficacy of cisplatin. Altogether, these findings highlight a novel and effective strategy for hearing protection in cisplatin-based chemotherapy. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  17. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  18. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  19. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-01-01

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  20. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  1. Starvation-induced activation of ATM/Chk2/p53 signaling sensitizes cancer cells to cisplatin

    Directory of Open Access Journals (Sweden)

    Shi Yandong

    2012-12-01

    Full Text Available Abstract Background Optimizing the safety and efficacy of standard chemotherapeutic agents such as cisplatin (CDDP is of clinical relevance. Serum starvation in vitro and short-term food starvation in vivo both stress cells by the sudden depletion of paracrine growth stimulation. Methods The effects of serum starvation on CDDP toxicity were investigated in normal and cancer cells by assessing proliferation, cell cycle distribution and activation of DNA-damage response and of AMPK, and were compared to effects observed in cells grown in serum-containing medium. The effects of short-term food starvation on CDDP chemotherapy were assessed in xenografts-bearing mice and were compared to effects on tumor growth and/or regression determined in mice with no diet alteration. Results We observed that serum starvation in vitro sensitizes cancer cells to CDDP while protecting normal cells. In detail, in normal cells, serum starvation resulted in a complete arrest of cellular proliferation, i.e. depletion of BrdU-incorporation during S-phase and accumulation of the cells in the G0/G1-phase of the cell cycle. Further analysis revealed that proliferation arrest in normal cells is due to p53/p21 activation, which is AMPK-dependent and ATM-independent. In cancer cells, serum starvation also decreased the fraction of S-phase cells but to a minor extent. In contrast to normal cells, serum starvation-induced p53 activation in cancer cells is both AMPK- and ATM-dependent. Combination of CDDP with serum starvation in vitro increased the activation of ATM/Chk2/p53 signaling pathway compared to either treatment alone resulting in an enhanced sensitization of cancer cells to CDDP. Finally, short-term food starvation dramatically increased the sensitivity of human tumor xenografts to cisplatin as indicated not only by a significant growth delay, but also by the induction of complete remission in 60% of the animals bearing mesothelioma xenografts, and in 40% of the

  2. Conformational detection of p53's oligomeric state by FlAsH Fluorescence

    OpenAIRE

    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

    2009-01-01

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...

  3. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  4. A systematic review of p53 regulation of oxidative stress in skeletal muscle.

    Science.gov (United States)

    Beyfuss, Kaitlyn; Hood, David A

    2018-12-01

    p53 is a tumor suppressor protein involved in regulating a wide array of signaling pathways. The role of p53 in the cell is determined by the type of imposed oxidative stress, its intensity and duration. The last decade of research has unravelled a dual nature in the function of p53 in mediating the oxidative stress burden. However, this is dependent on the specific properties of the applied stress and thus requires further analysis. A systematic review was performed following an electronic search of Pubmed, Google Scholar, and ScienceDirect databases. Articles published in the English language between January 1, 1990 and March 1, 2017 were identified and isolated based on the analysis of p53 in skeletal muscle in both animal and cell culture models. Literature was categorized according to the modality of imposed oxidative stress including exercise, diet modification, exogenous oxidizing agents, tissue manipulation, irradiation, and hypoxia. With low to moderate levels of oxidative stress, p53 is involved in activating pathways that increase time for cell repair, such as cell cycle arrest and autophagy, to enhance cell survival. However, with greater levels of stress intensity and duration, such as with irradiation, hypoxia, and oxidizing agents, the role of p53 switches to facilitate increased cellular stress levels by initiating DNA fragmentation to induce apoptosis, thereby preventing aberrant cell proliferation. Current evidence confirms that p53 acts as a threshold regulator of cellular homeostasis. Therefore, within each modality, the intensity and duration are parameters of the oxidative stressor that must be analyzed to determine the role p53 plays in regulating signaling pathways to maintain cellular health and function in skeletal muscle. Acadl: acyl-CoA dehydrogenase, long chain; Acadm: acyl-CoA dehydrogenase, C-4 to C-12 straight chain; AIF: apoptosis-inducing factor; Akt: protein kinase B (PKB); AMPK: AMP-activated protein kinase; ATF-4: activating

  5. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  6. p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

    International Nuclear Information System (INIS)

    Willers, H.; Powell, S.N.; Dahm-Daphi, J.

    2003-01-01

    Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

  7. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    Science.gov (United States)

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  8. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    Science.gov (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  9. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  10. The critical role of catalase in prooxidant and antioxidant function of p53

    Science.gov (United States)

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  11. The expressions of P53 protein and proliferating cell nuclear antigen in specimens by CT-guidance percutaneous lung biopsy

    International Nuclear Information System (INIS)

    Zhuang Yiping; Shen Zongli; Zhang Jin; Kang Zheng; Zhu Yueqing; Feng Yong; Shen Wenrong; Wang Yaping

    2004-01-01

    Objective: To evaluate relations between lung cancer and the expressions of P53 protein together with proliferating cell nuclear antigen (PCNA) in specimens of lung lesions by needle biopsy. Methods: CT-guidance percutaneous biopsy of lung lesions were performed in 66 patients with the determination of expressions of p53 protein and PCNA by flow cytometer (FCM). Results: 1. The sensitivity of CT-guidance percutaneous biopsy was 94.3% in 53 cases of lung cancer with the diagnostic accuracy of 90.9% totally. The complication rate of pneumothorax was 4.6%. 2. The expression of P53 protein was (29.9 ± 2.7)% in lung cancer (53 cases), while (17.9 ± 2.8)% in benign lesions (13 cases) (t=2.0, P 2 =6.10, P 2 =9.71, P 0.05). Conclusions: FCM plays and valuable role in determining the expression of P53 protein and PCNA in the specimen of lung cancer by CT-guided percutaneous biopsy. The expression of p53 and PCNA may be useful in the diagnosis of lung cancer by providing the relation between imaging of lung cancer and the molecular mechanism, and furthermore revealing the characteristics of molecular biology of lung cancer at protein level. (authors)

  12. Cytogenetic damage, oncogenic transformation and p53 induction in human epithelial cells in response to irradiation

    Science.gov (United States)

    Armitage, Mark

    Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or

  13. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  14. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-01-01

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  15. Downregulated long non-coding RNA MEG3 in breast cancer regulates proliferation, migration and invasion by depending on p53’s transcriptional activity

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Lin [West Biostatistics and Cost-effectiveness Research Center, Medical Insurance Office, West China Hospital of Sichuan University, 610041, Sichuan (China); Li, Yu [Department of Anesthesiology, West China Hospital, Sichuan University, 610041, Sichuan (China); Yang, Bangxiang, E-mail: b19933009@qq.coom [Department of Pain Management, West China Hospital of Sichuan University, 610041, Sichuan (China)

    2016-09-09

    Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition of proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.

  16. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  17. Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres

    International Nuclear Information System (INIS)

    Ji, Qing; Hao, Xinbao; Meng, Yang; Zhang, Min; DeSano, Jeffrey; Fan, Daiming; Xu, Liang

    2008-01-01

    MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be

  18. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    Science.gov (United States)

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  19. Isolation and characterization of DUSP11, a novel p53 target gene

    DEFF Research Database (Denmark)

    Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

    2009-01-01

    target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

  20. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  1. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    NARCIS (Netherlands)

    Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent

  2. FGFR3 and P53 characterize alternative genetic pathways in the pathogenesis of urothelial cell carcinoma

    NARCIS (Netherlands)

    B.W. van Rhijn (Bas); Th.H. van der Kwast (Theo); A.N. Vis (André); W.J. Kirkels (Wim); E.R. Boeve; A.C. Jobsis; E.C. Zwarthoff (Ellen)

    2004-01-01

    textabstractFibroblast growth factor receptor 3 (FGFR3) and P53 mutations are frequently observed in bladder cancer. We here describe the distribution of FGFR3 mutations and P53 overexpression in 260 primary urothelial cell carcinomas. FGFR3 mutations were observed in 59% and P53

  3. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  4. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  5. Delayed expression of apoptosis in X-irradiated human leukemic MOLT-4 cells transfected with mutant p53

    International Nuclear Information System (INIS)

    Nakano, Hisako; Yonekawa, Hiromichi; Shinohara, Kunio

    2003-01-01

    The effects of X-rays on cell survival, apoptosis, and long-term response in the development of cell death as measured by the dye exclusion test were studied in human leukemic MOLT-4 cells (p53 wild-type) stably transfected with a mutant p53 cDNA expression vector. Cell survival, as determined from colony-forming ability, was increased in an expression level dependent manner, but the increase was partial even with the highest-expressing clone (B3). This contrasts with the prior observation that cell death and apoptosis in B3 are completely inhibited at 24 h after irradiation with 1.8 Gy of X-rays. The examination of B3 cells incubated for longer than 24 h after X-irradiation showed a delay in the induction of cell death and apoptosis. Western blot analysis revealed that the time required to reach the highest level of wild-type p53 protein in B3 was longer than the time in MOLT-4 and that the p53 may be stabilized by the phosphorylation at Ser-15. These results suggest that the introduction of mutant p53 into MOLT-4 merely delays the development of apoptosis, during which the cells could repair the damage induced by X-rays, and results in the partial increase in cell survival. (author)

  6. Association of the p53 codon 72 polymorphism to gastric cancer risk in a high risk population of Costa Rica

    International Nuclear Information System (INIS)

    Alpizar-Alpizar, Warner; Sierra, Rafaela; Cuenca, Patricia; Une, Clas; Mena, Fernando; Perez-Perez, Guillermo Ignacio

    2005-01-01

    Gastric cancer is the second most common cancer associated death cause worldwide. Several factors have been associated with higher risk to develop gastric cancer, among them genetic predisposition. The p53 gene has a polymorphism located at codon 72, which has been associated with higher risk of several types of cancer, including gastric cancer. The aim of this study was to determine the association of p53, codon 72 polymorphism, with the risk of gastric cancer and pre-malignant lesions in a high-risk population from Costa Rica. The genotyping was carried out by PCR-RFLP in a sample of 58 gastric cancer patients, 99 control persons and 41 individuals classified as group I and II, according to the Japanese histological classification. No association was found for p53, codon 72 polymorphism with neither the risk of gastric cancer nor the risk of less severe gastric lesions in the studied sample. Based on this study and taking into account other studies carried out with p53, codon 72 polymorphism, the role of this polymorphism in the development of gastric cancer remains unclear. De novo mutations on p53 gene produced during neoplastic development of this disease might play a greater role than germinal polymorphisms of this same gene. Other polymorphic genes have been associated with higher risk to develop gastric cancer. (author) [es

  7. Prognostic Value of Abnormal p53 Expression in Locally Advanced Prostate Cancer Treated With Androgen Deprivation and Radiotherapy: A Study Based on RTOG 9202

    International Nuclear Information System (INIS)

    Che Mingxin; DeSilvio, Michelle; Pollack, Alan; Grignon, David J.; Venkatesan, Varagur Mohan; Hanks, Gerald E.; Sandler, Howard M.

    2007-01-01

    Purpose: The goal of this study was to verify the significance of p53 as a prognostic factor in Radiation Therapy Oncology Group 9202, which compared short-term androgen deprivation (STAD) with radiation therapy (RT) to long-term androgen deprivation + RT in men with locally advanced prostate cancer (Pca). Methods and Materials: Tumor tissue was sufficient for p53 analysis in 777 cases. p53 status was determined by immunohistochemistry. Abnormal p53 expression was defined as 20% or more tumor cells with positive nuclei. Univariate and multivariate Cox proportional hazards models were used to evaluate the relationships of p53 status to patient outcomes. Results: Abnormal p53 was detected in 168 of 777 (21.6%) cases, and was significantly associated with cause-specific mortality (adjusted hazard ratio [HR] = 1.89; 95% confidence interval (CI) 1.14 - 3.14; p = 0.014) and distant metastasis (adjusted HR = 1.72; 95% CI 1.13-2.62; p = 0.013). When patients were divided into subgroups according to assigned treatment, only the subgroup of patients who underwent STAD + RT showed significant correlation between p53 status and cause-specific mortality (adjusted HR = 2.43; 95% CI = 1.32-4.49; p = 0.0044). When patients were divided into subgroups according to p53 status, only the subgroup of patients with abnormal p53 showed significant association between assigned treatment and cause-specific mortality (adjusted HR = 3.81; 95% CI 1.40-10.37; p = 0.0087). Conclusions: Abnormal p53 is a significant prognostic factor for patients with prostate cancer who undergo short-term androgen deprivation and radiotherapy. Long-term androgen deprivation may significantly improve the cause-specific survival for those with abnormal p53

  8. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    Science.gov (United States)

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  9. Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

    Science.gov (United States)

    Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

    2016-01-01

    Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

  10. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    Science.gov (United States)

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  11. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    Science.gov (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  12. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

    Science.gov (United States)

    Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

    2013-04-16

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

  13. p53 expression in biopsies from children with Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik

    2002-01-01

    based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....

  14. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    Science.gov (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  15. Stimulation of autophagy by the p53 target gene Sestrin2.

    Science.gov (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  16. Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation

    International Nuclear Information System (INIS)

    Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki

    2001-01-01

    We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)

  17. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    Science.gov (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  18. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

    2003-01-01

    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  19. Friend or Foe: MicroRNAs in the p53 network.

    Science.gov (United States)

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  20. Essentials in clinical application of p53 for tumors intervention-example of liver cancer

    International Nuclear Information System (INIS)

    Guan Yongsong; He Qing

    2008-01-01

    Recombinant human adenovirus p53 (Ad-p53)injection has been used for treating tumors in combination with several local therapeutic methods. Taking liver cancer as an example, this article introduces the combination of Ad-p53 in procedures of interventional therapy. Mechanisms of their effects are emphasized to pursue an optimal synergism in killing tumors. Intratumoral injection is suggested as the first choice of Ad- p53 administration with the least recommended dosage for a single tumor. The optimal time for intervention of liver cancer is supposed to be 2 to 5 days after the administration of Ad-p53. There are several theories on the therapeutic method taking p53 as a target, some of them are contradictional; therefore one has to select either activating or inhibiting the p53 pathway beforehand. For advanced malignancies, the selection should be cautious for appropriater cases from the proper candidates. (authors)

  1. Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline

    Directory of Open Access Journals (Sweden)

    Noriko Mori

    2004-10-01

    Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.

  2. Effect of the p53 gene status on the sensitivity of oral squamous cell carcinoma cells to boron neutron capture therapy

    International Nuclear Information System (INIS)

    Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.

    2006-01-01

    The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)

  3. Oral administration of an estrogen metabolite-induced potentiation of radiation antitumor effects in presence of wild-type p53 in non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Huober, Jens B.; Nakamura, Seiichi; Meyn, Ray; Roth, Jack A.; Mukhopadhyay, Tapas

    2000-01-01

    Purpose: The purpose of this study was to investigate the efficacy of 2-methoxyestradiol as an antitumor and radiosensitizing agent for the treatment of human malignancy. Methods and Materials: Two cancer cell lines with wild-type p53 status were exposed first to irradiation and then to an oral formulation of the nontoxic metabolite 2-methoxyestradiol (2ME) to stabilize p53 levels. Results: Cell growth was inhibited via G1 growth and apoptosis. Subsequent in vitro growth and Tunel assays indicated that this combination was superior to radiation alone at inducing p53 protein accumulation, stabilizing p53 protein levels, and substantially reducing long-term tumor cell growth (∼80%) and colony formation (∼95%) in vitro, and inducing apoptosis. However, harboring mutated p53, H322 cell line, was relatively insensitive to such a treatment regimen. Western blot analysis revealed that growth inhibition was associated with increased levels of p53 and p21 protein accumulation. Experiments with subcutaneous tumor in a nu/nu mouse showed the combination treatment to be superior to radiation alone at reducing tumor growth (∼50% reduction as compared to radiation alone) in vivo. Conclusion: Thus, our studies confirmed a unique strategy whereby oral administration of a nontoxic estrogen metabolite, 2ME, significantly enhanced the radiation effect on a subcutaneous tumor without any toxicity and suggesting that this strategy may be clinically useful as an adjuvant therapy

  4. P53 overexpression and outcome of radiation therapy in head and neck cancers

    International Nuclear Information System (INIS)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae

    1999-01-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers

  5. P53 overexpression and outcome of radiation therapy in head and neck cancers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)

    1999-03-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.

  6. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  7. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  8. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

    2006-02-22

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  9. High LET radiation enhances apoptosis in mutated p53 cancer cells through Caspase-9 activation

    International Nuclear Information System (INIS)

    Yamakawa, Nobuhiro; Takahashi, Akihisa; Mori, Eiichiro; Imai, Yuichiro; Ohnishi, Ken; Kirita, Tadaaki; Ohnishi, Takeo; Furusawa, Yoshiya

    2008-01-01

    Although mutations in the p53 gene can lead to resistance to radiotherapy, chemotherapy and thermotherapy, high linear energy transfer (LET) radiation induces apoptosis regardless of p53 gene status in cancer cells. The aim of this study was to clarify the mechanisms involved in high LET radiation-induced apoptosis. Human gingival cancer cells (Ca9-22 cells) containing a mutated p53 (mp53) gene were irradiated with X-rays, C-ion (13-100 KeV/μm), or Fe-ion beams (200 KeV/μm). Cellular sensitivities were determined using colony forming assays. Apoptosis was detected and quantified with Hoechst 33342 staining. The activity of Caspase-3 was analyzed with Western blotting and flow cytometry. Cells irradiated with high LET radiation showed a high sensitivity with a high frequency of apoptosis induction. The relative biological effectiveness (RBE) values for the surviving fraction and apoptosis induction increased in a LET-dependent manner. Both RBE curves reached a peak at 100 KeV/μm, and then decreased at values over 100 KeV/μm. When cells were irradiated with high LET radiation, Caspase-3 was cleaved and activated, leading to poly (ADP-ribose) polymerase (PARP) cleavage. In addition, Caspase-9 inhibitor suppressed Caspase-3 activation and apoptosis induction resulting from high LET radiation to a greater extent than Caspase-8 inhibitor. These results suggest that high LET radiation enhances apoptosis by activation of Caspase-3 through Caspase-9, even in the presence of mp53. (author)

  10. Understanding the role of p53 in adaptive response to radiation-induced germline mutations

    International Nuclear Information System (INIS)

    Langlois, N.L.; Quinn, J.S.; Somers, C.M.; Boreham, D.R.; Mitchel, R.E.J.

    2003-01-01

    Full text: Radiation-induced adaptive response is now a widely studied area of radiation biology. Studies have demonstrated reduced levels of radiation-induced biological damage when an 'adaptive dose' is given before a higher 'challenge dose' compared to when the challenge dose is given alone. It has been shown in some systems to be a result of inducible cellular repair systems. The adaptive response has been clearly demonstrated in many model systems, however its impact on heritable effects in the mammalian germline has never been studied. Expanded Simple Tandem Repeat (ESTR) loci have been used as markers demonstrating that induced heritable mutations in mice follow a dose-response relationship. Recent data in our laboratory show preliminary evidence of radiation-induced adaptive response suppressing germline mutations at ESTR loci in wild type mice. The frequency of heritable mutations was significantly reduced when a priming dose of 0.1 Gy was given 24 hours prior to a 1 Gy acute challenging dose. We are now conducting a follow-up study to attempt to understand the mechanism of this adaptive response. P53 is known to play a significant role in governing apoptosis, DNA repair and cancer induction. In order to determine what function p53 has in the adaptive response for heritable mutations, we have mated radiation treated Trp53+/- male mice (C57Bl) to untreated, normal females (C57Bl). Using DNA fingerprinting, we are investigating the rate of inherited radiation-induced mutations on pre- and post-meiotic radiation-treated gametocytes by examining mutation frequencies in offspring DNA. If p53 is integral in the mechanism of adaptive response, we should not see an adaptive response in radiation-induced heritable mutations in these mice. This research is significant in that it will provide insight to understanding the mechanism behind radiation-induced adaptive response in the mammalian germline

  11. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Taurine protects HK-2 cells from oxidized LDL-induced cytotoxicity via the ROS-mediated mitochondrial and p53-related apoptotic pathways

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chun-Yu [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Shen, Chao-Yu [School of Medical Imaging and Radiological Sciences, Chung Shan Medical University, Taichung, Taiwan (China); Department of Medical Imaging, Chung Shan Medical University Hospital, Taichung, Taiwan (China); School of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Kang, Chao-Kai [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan, (China); Sher, Yuh-Pyng [Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Center for Molecular Medicine, China Medical University Hospital, Taichung 404, Taiwan (China); Sheu, Wayne H.-H. [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Division of Endocrinology and Metabolism, Department of Internal Medicine, Taichung Veterans General Hospital, Taichung, Taiwan (China); School of Medicine, National Yang Ming University, Taipei, Taiwan (China); School of Medicine, National Defense Medical Center, Taipei, Taiwan (China); Chang, Chia-Che, E-mail: chia_che@dragon.nchu.edu.tw [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan (China); Lee, Tsung-Han, E-mail: thlee@email.nchu.edu.tw [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan, (China); Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan (China); Department of Biological Science and Technology, China Medical University, Taichung, Taiwan (China)

    2014-09-15

    Oxidized LDL (oxLDL) induces a pro-oxidative environment and promotes apoptosis, causing the progression of renal diseases in humans. Taurine is a semi-essential amino acid in mammals and has been shown to be a potent endogenous antioxidant. The kidney plays a pivotal role in maintaining the balance of taurine. However, the mechanisms underlying the protective effects of taurine against oxLDL-induced injury in renal epithelial cells have not been clarified. In the present study, we investigated the anti-apoptotic effects of taurine on human proximal tubular epithelial (HK-2) cells exposed to oxLDL and explored the related mechanisms. We observed that oxLDL increased the contents of ROS and of malondialdehyde (MDA), which is a lipid peroxidation by-product that acts as an indicator of the cellular oxidation status. In addition, oxLDL induced cell death and apoptosis in HK-2 cells. Pretreatment with taurine at 100 μM significantly attenuated the oxLDL-induced cytotoxicity. We determined that oxLDL triggered the phosphorylation of ERK and, in turn, the activation of p53 and other apoptosis-related events, including calcium accumulation, destabilization of the mitochondrial permeability and disruption of the balance between pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins. The malfunctions induced by oxLDL were effectively blocked by taurine. Thus, our results suggested that taurine exhibits potential therapeutic activity by preventing oxLDL-induced nephrotoxicity. The inhibition of oxLDL-induced epithelial apoptosis by taurine was at least partially due to its anti-oxidant activity and its ability to modulate the ERK and p53 apoptotic pathways. - Highlights: • Oxidized LDL induced cytotoxicity and apoptosis in HK-2 cells. • Pretreatment with taurine attenuated oxLDL-induced nephrotoxicity. • Taurine protected against renal damages through inhibition of ROS generation. • Taurine prevented apoptosis through modulation of the p53 phosphorylation.

  13. Taurine protects HK-2 cells from oxidized LDL-induced cytotoxicity via the ROS-mediated mitochondrial and p53-related apoptotic pathways

    International Nuclear Information System (INIS)

    Chang, Chun-Yu; Shen, Chao-Yu; Kang, Chao-Kai; Sher, Yuh-Pyng; Sheu, Wayne H.-H.; Chang, Chia-Che; Lee, Tsung-Han

    2014-01-01

    Oxidized LDL (oxLDL) induces a pro-oxidative environment and promotes apoptosis, causing the progression of renal diseases in humans. Taurine is a semi-essential amino acid in mammals and has been shown to be a potent endogenous antioxidant. The kidney plays a pivotal role in maintaining the balance of taurine. However, the mechanisms underlying the protective effects of taurine against oxLDL-induced injury in renal epithelial cells have not been clarified. In the present study, we investigated the anti-apoptotic effects of taurine on human proximal tubular epithelial (HK-2) cells exposed to oxLDL and explored the related mechanisms. We observed that oxLDL increased the contents of ROS and of malondialdehyde (MDA), which is a lipid peroxidation by-product that acts as an indicator of the cellular oxidation status. In addition, oxLDL induced cell death and apoptosis in HK-2 cells. Pretreatment with taurine at 100 μM significantly attenuated the oxLDL-induced cytotoxicity. We determined that oxLDL triggered the phosphorylation of ERK and, in turn, the activation of p53 and other apoptosis-related events, including calcium accumulation, destabilization of the mitochondrial permeability and disruption of the balance between pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins. The malfunctions induced by oxLDL were effectively blocked by taurine. Thus, our results suggested that taurine exhibits potential therapeutic activity by preventing oxLDL-induced nephrotoxicity. The inhibition of oxLDL-induced epithelial apoptosis by taurine was at least partially due to its anti-oxidant activity and its ability to modulate the ERK and p53 apoptotic pathways. - Highlights: • Oxidized LDL induced cytotoxicity and apoptosis in HK-2 cells. • Pretreatment with taurine attenuated oxLDL-induced nephrotoxicity. • Taurine protected against renal damages through inhibition of ROS generation. • Taurine prevented apoptosis through modulation of the p53 phosphorylation

  14. Expression of p53-regulated proteins in human cultured lymphoblastoid TSCE5 and WTK1 cell lines during spaceflight

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko

    2012-01-01

    The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)

  15. The usefulness of adding p53 immunocytochemistry to bile drainage cytology for the diagnosis of malignant biliary strictures.

    Science.gov (United States)

    Yeo, Min-Kyung; Kim, Kyung-Hee; Lee, Yong-Moon; Lee, Byung Seok; Choi, Song-Yi

    2017-07-01

    Obstructive jaundice is frequently caused by bile duct strictures. Determination of malignant strictures is crucial for the initiation of appropriate treatment. Cytologic examination of bile drainage fluid is an easy and reproducible method of detecting malignant cells. This method, however, frequently yields indeterminate results, such as atypia or suspicious of malignancy, due to difficulties in differentiating malignancy from benign atypia. Immunocytochemical assessment of p53 expression by cells in bile drainage fluid may enhance the ability to detect malignancy. A total of 139 samples of bile drainage fluid were obtained from 80 patients. Following cytologic examination, the samples were incubated with antibody to p53. The performance of cytology with and without p53 immunocytochemistry was evaluated, with reference to surgical or clinical findings of benign and malignant biliary strictures. Bile drainage cytology alone had a sensitivity of 31.6% and a specificity of 98.4% in the identification of malignant strictures, whereas the combination of p53 immunocytochemistry and bile drainage cytology had a sensitivity of 80.3% and a specificity of 92.1%. P53 immunocytochemistry alone had a sensitivity of 64.5% and a specificity of 92.7% for the identification of malignant strictures in bile drainage samples with atypical cytology, and a sensitivity of 85.0% and a specificity of 100.0% in samples with suspicious of malignancy. The addition of p53 immunocytochemistry to bile drainage cytology can be useful in identifying malignant strictures in samples showing indeterminate results on bile drainage cytology. Diagn. Cytopathol. 2017;45:592-597. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  16. Connection between cell phone use, p53 gene expression in different zones of glioblastoma multiforme and survival prognoses

    Directory of Open Access Journals (Sweden)

    Reza Akhavan-Sigari

    2014-08-01

    Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  18. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson

    2006-07-01

    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  19. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul

    2001-01-01

    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  20. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    Science.gov (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  1. Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

    International Nuclear Information System (INIS)

    Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko

    2015-01-01

    Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

  2. NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

    Directory of Open Access Journals (Sweden)

    Labhart Paul

    2007-05-01

    Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

  3. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    Science.gov (United States)

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  4. Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

    Science.gov (United States)

    Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

    2000-11-23

    Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

  5. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    Directory of Open Access Journals (Sweden)

    Iva Simeonova

    2013-06-01

    Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.

  6. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  7. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    International Nuclear Information System (INIS)

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.; Fu, Jian; Pinson, Barbara M.; Levin, Jeffrey; Shetty, Sreerama

    2015-01-01

    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acute and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of

  8. Evodiamine selectively targets cancer stem-like cells through the p53-p21-Rb pathway

    International Nuclear Information System (INIS)

    Han, Seula; Woo, Jong Kyu; Jung, Yuchae; Jeong, Dawoon; Kang, Minsook; Yoo, Young-Ji; Lee, Hani; Oh, Seung Hyun; Ryu, Jae-Ha; Kim, Woo-Young

    2016-01-01

    In spite of the recent improvements, the resistance to chemotherapy/radiotherapy followed by relapse is the main hurdle for the successful treatment of breast cancer, a leading cause of death in women. A small population of breast cancer cells that have stem-like characteristics (cancer stem-like cells; CSLC) may contribute to this resistance and relapse. Here, we report on a component of a traditional Chinese medicine, evodiamine, which selectively targets CSLC of breast cancer cell lines MCF7 and MDAMB 231 at a concentration that does show a little or no cytotoxic effect on bulk cancer cells. While evodiamine caused the accumulation of bulk cancer cells at the G2/M phase, it did not hold CSLC in a specific cell cycle phase but instead, selectively killed CSLC. This was not due to the culture of CSLC in suspension or without FBS. A proteomic analysis and western blotting revealed that evodiamine changed the expression of cell cycle regulating molecules more efficiently in CSLC cells than in bulk cancer cells. Surprisingly, evodiamine selectively activated p53 and p21 and decreased inactive Rb, the master molecules in G1/S checkpoint. These data collectively suggest a novel mechanism involving CSLC-specific targeting by evodiamine and its possible use to the therapy of breast cancer. - Highlights: • Evodiamine selectively kills breast cancer stem like cells at G1 phase. • Evodiamine utilizes different mechanism of cell cycle modulation in CSLC and in bulk cancer cells. • Evodiamine activate the p53, p21 and Rb pathway.

  9. Evodiamine selectively targets cancer stem-like cells through the p53-p21-Rb pathway

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seula [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Woo, Jong Kyu [College of Pharmacy, Gachon University, Incheon (Korea, Republic of); Jung, Yuchae; Jeong, Dawoon; Kang, Minsook; Yoo, Young-Ji; Lee, Hani [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Oh, Seung Hyun [College of Pharmacy, Gachon University, Incheon (Korea, Republic of); Ryu, Jae-Ha [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Kim, Woo-Young, E-mail: wykim@sookmyung.ac.kr [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of)

    2016-01-22

    In spite of the recent improvements, the resistance to chemotherapy/radiotherapy followed by relapse is the main hurdle for the successful treatment of breast cancer, a leading cause of death in women. A small population of breast cancer cells that have stem-like characteristics (cancer stem-like cells; CSLC) may contribute to this resistance and relapse. Here, we report on a component of a traditional Chinese medicine, evodiamine, which selectively targets CSLC of breast cancer cell lines MCF7 and MDAMB 231 at a concentration that does show a little or no cytotoxic effect on bulk cancer cells. While evodiamine caused the accumulation of bulk cancer cells at the G2/M phase, it did not hold CSLC in a specific cell cycle phase but instead, selectively killed CSLC. This was not due to the culture of CSLC in suspension or without FBS. A proteomic analysis and western blotting revealed that evodiamine changed the expression of cell cycle regulating molecules more efficiently in CSLC cells than in bulk cancer cells. Surprisingly, evodiamine selectively activated p53 and p21 and decreased inactive Rb, the master molecules in G1/S checkpoint. These data collectively suggest a novel mechanism involving CSLC-specific targeting by evodiamine and its possible use to the therapy of breast cancer. - Highlights: • Evodiamine selectively kills breast cancer stem like cells at G1 phase. • Evodiamine utilizes different mechanism of cell cycle modulation in CSLC and in bulk cancer cells. • Evodiamine activate the p53, p21 and Rb pathway.

  10. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

    Science.gov (United States)

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

    2017-10-15

    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

  11. miR-34 and p53: New Insights into a Complex Functional Relationship.

    Directory of Open Access Journals (Sweden)

    Francisco Navarro

    Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

  12. Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

    Science.gov (United States)

    Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

    2014-06-10

    The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

  13. The role of p53 in radiation therapy outcomes for favorable-to-intermediate-risk prostate cancer

    International Nuclear Information System (INIS)

    Ritter, Mark A.; Gilchrist, Kennedy W.; Voytovich, Marta; Chappell, Richard J.; Verhoven, Bret M.

    2002-01-01

    Purpose: Some prostate cancers may have molecular alterations that render them less responsive to radiation therapy; identification of these alterations before treatment might allow improved treatment optimization. This study investigated whether p53, a potential molecular determinant, could predict long-term radiation therapy outcome in a restricted group of relatively favorable-risk prostate cancer patients treated uniformly with irradiation alone. Methods and Materials: This study included 53 patients previously treated with radiotherapy for favorable-to-intermediate-risk prostate cancer. These patients were selected for relatively low pretreatment PSAs (≤21 ng/mL) and Gleason scores (≤7) to decrease the likelihood of nonlocalized disease, because disease localization was necessary to examine the efficacy of localized radiation therapy. The status of p53 was immunohistochemically assessed in paraffin-embedded pretreatment biopsy specimens, along with appropriate controls. This marker was selected based upon a usable mutation prevalence in early-stage prostate cancer and its potential linkage with radiation response via cell cycle, DNA repair, and cell death pathways. Correlation between p53 mutation and clinical outcome was analyzed in univariate and multivariate fashion and included conventional prognosticators, such as stage, grade, and PSA. Freedom from biochemical failure was determined using American Society for Therapeutic Radiology and Oncology criteria. Limitations of prior studies were potentially avoided by requiring adequate posttreatment follow-up (median follow-up in nonfailing patients of 5.1 years), as well as pretreatment PSA and Gleason scores that suggested localized disease, and uniformity of treatment. Results: The total group of 53 favorable-to-intermediate-risk patients demonstrated an actuarial biochemical failure rate of 35% at 5 years. Forty percent of all specimens had a greater than 10% labeling index for p53 mutation, and

  14. Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

    International Nuclear Information System (INIS)

    Hu, Duanmin; Su, Cunjin; Jiang, Min; Shen, Yating; Shi, Aiming; Zhao, Fenglun; Chen, Ruidong; Shen, Zhu; Bao, Junjie; Tang, Wen

    2016-01-01

    There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.

  15. Chorionic gonadotropin regulates the transcript level of VHL, p53, and HIF-2alpha in human granulosa lutein cells.

    Science.gov (United States)

    Herr, D; Keck, C; Tempfer, C; Pietrowski, Detlef

    2004-12-01

    The ovarian corpus luteum plays a critical role in reproduction being the primary source of circulating progesterone. After ovulation the corpus luteum is build by avascular granulosa lutein cells through rapid vascularization regulated by gonadotropic hormones. The present study was performed to investigate whether this process might be influenced by the human chorionic gonadotropin (hCG)-dependent expression of different tumor suppressor genes and hypoxia dependent transcription factors. RNA was isolated from cultured granulosa lutein cells, transcribed into cDNA, and the transcript level of following genes were determined: RB-1, VHL, NF-1, NF-2, Wt-1, p53, APC, and hypoxia inducible factor-1 (HIF-1), -2, and -3alpha. Additionally, the influence of hCG on the expression of VHL, p53, and HIf2alpha were investigated. We demonstrate that in human granulosa lutein cells the tumor suppressor genes RB-1, VHL, NF-1, NF-2, Wt-1, p53, and APC and the hypoxia dependent transcription factors HIF-1alpha, -2alpha, and -3alpha are expressed. In addition, we showed that hCG regulates the expression of p53, VHL, and HIF-2alpha. Our results indicate that hCG may determine the growth and development of the corpus luteum by mediating hypoxic and apoptotic pathways in human granulosa lutein cells. Copyright 2004 Wiley-Liss, Inc.

  16. Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Duanmin [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Su, Cunjin [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Jiang, Min [Department of Breast Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Yating [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shi, Aiming; Zhao, Fenglun [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Chen, Ruidong [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Zhu [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Bao, Junjie, E-mail: baojjsdfey@sina.com [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Tang, Wen, E-mail: sztangwen@163.com [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China)

    2016-03-04

    There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.

  17. Prognostic value of p53 in patients with muscle-invasive bladder cancer treated with preoperative radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Catherine S; Pollack, Alan; Czerniak, Bogdan A; Chyle, Valerian; Zagars, Gunar K; Dinney, Colin P; Benedict, William F

    1995-07-01

    levels, creatinine levels, or results of intravenous pyelography. In terms of actuarial 5 yr patient outcome, the rates associated with p53 positivity and negativity were 92% and 90% for local control (p=0.86, log-rank), 57% and 64% for freedom from distant metastasis (p=0.60), 50% and 61% for disease freedom (p=0.38), and 39% and 51% for overall survival (p=0.15). Although, p53 staining did not correlate significantly with outcome when the entire group was tested, significant associations were seen when these analyses were limited to patients with clinical Stage T3b disease. The rates for Stage T3b patients with p53 positivity and negativity were 56% and 92% for freedom from distant metastasis (p=0.06), 51% and 83% for disease freedom (p=0.11), and 29% and 83% for overall survival (p=0.007). The distributions of T3b patient prognostic factors by p53 positivity did not reveal any significant correlations, indicating that those with p53 positive tumors had similar prognostic features as compared to those with p53 negative tumors. Univariate actuarial analyses were done to determine which other factors were predictive of survival for Stage T3b patients; significant factors were tumor size, pathologic complete response, downstaging, and hemoglobin level. Cox proportional hazards models that included these factors revealed p53 to be independently predictive of survival for patients with Stage T3b disease. Conclusion: The prognostic value of p53 immunostaining of formalin-fixed paraffin-embedded material rested with Stage T3b patients. Whereas no correlations were found with radiation response, p53 positivity in this subgroup was associated with a higher rate of distant metastasis and reduced overall survival. Thus, p53 might be a useful marker for identifying locally advanced patients at lower risk of developing distant metastasis who would, therefore, benefit from preoperative radiotherapy.

  18. Increased Arf/p53 activity in stem cells, aging and cancer.

    Science.gov (United States)

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  19. Functions of MDMX in the Modulation of the p53-Response

    Directory of Open Access Journals (Sweden)

    Kristiaan Lenos

    2011-01-01

    Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.

  20. The role of p53 in lung macrophages following exposure to a panel of manufactured nanomaterials

    DEFF Research Database (Denmark)

    Belade, Esther; Chrusciel, Sandra; Armand, Lucie

    2015-01-01

    is a key transcription factor implicated in cellular defence and reparative responses to various stress factors. Additionally, p53 has been implicated in cellular responses following exposure to some MNMs. Here, the role of the MNM mediated p53 induction and activation and its downstream effects following...... exposure to five well-characterised materials [namely two types of TiO2, two carbon black (CB), and one single-walled carbon nanotube (SWCNT)] were investigated. MNM internalisation, cellular viability, p53 protein induction and activation, oxidative stress, inflammation and apoptosis were measured...... in murine cell line and primary pulmonary macrophage models. It was observed that p53 was implicated in the biological responses to MNMs, with oxidative stress associated with p53 activation (only following exposure to the SWCNT). We demonstrate that p53 acted as an antioxidant and anti...

  1. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang

    2013-03-01

    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  2. Determinants of iron accumulation in the normal aging brain.

    Science.gov (United States)

    Pirpamer, Lukas; Hofer, Edith; Gesierich, Benno; De Guio, François; Freudenberger, Paul; Seiler, Stephan; Duering, Marco; Jouvent, Eric; Duchesnay, Edouard; Dichgans, Martin; Ropele, Stefan; Schmidt, Reinhold

    2016-07-01

    In a recent postmortem study, R2* relaxometry in gray matter (GM) of the brain has been validated as a noninvasive measure for iron content in brain tissue. Iron a