WorldWideScience

Sample records for oxygenase-1 gene promoter

  1. Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats.

    Science.gov (United States)

    Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G

    2001-08-01

    Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.

  2. Microsatellite polymorphism in the heme oxygenase-1 gene promoter and the risk of atrial fibrillation in Taiwanese.

    Directory of Open Access Journals (Sweden)

    Lung-An Hsu

    Full Text Available Atrial fibrillation (AF is associated with increased oxidative stress. Emerging evidence suggests that heme oxygenase-1 (HO-1 is a potent antioxidant system against various oxidative stress-related diseases. The human HO-1 promoter has a GT-repeat length polymorphism that can determine the level of gene transcription.The aim of this study is to assess the role of the GT-repeat polymorphism in the promoter region of the HO-1 gene in Chinese-Taiwanese patients with AF.This study enrolled 200 AF patients and 240 controls, comparable for age and gender. In each subject, the length of GT-repeat polymorphism in the HO-1 promoter region was examined by polymerase chain reactions. The frequencies of long GT-repeat alleles (≧32 were significantly higher in AF patients than in controls. Multivariate analysis showed that the presence of long allele was significantly and independently associated with AF (odds ratio: 1.91, 95% CI 1.07-3.72; P = 0.028. Right atrial tissues from patients with chronic AF were investigated with immunoconfocal microscopy. Patients homozygous for shorter GT-repeat alleles exhibited greater HO-1 expression in their atria than those homozygous for longer alleles, which was reflected by less oxidative stress, myofibril degradation, and fibrosis in the atria of patients with shorter GT-repeat. In vitro, transient transfection assay in HL-1 atrial myocytes showed that the responsiveness of HO-1 transcriptional activity to tachypacing was inversely correlated with the length of the GT-repeats.Our results suggest that the HO-1 microsatellite polymorphism may contribute to the genetic background of AF in Chinese-Taiwanese patients.

  3. Regulation of human heme oxygenase-1 gene expression under thermal stress.

    Science.gov (United States)

    Okinaga, S; Takahashi, K; Takeda, K; Yoshizawa, M; Fujita, H; Sasaki, H; Shibahara, S

    1996-06-15

    Heme oxygenase-1 is an essential enzyme in heme catabolism, and its human gene promoter contains a putative heat shock element (HHO-HSE). This study was designed to analyze the regulation of human heme oxygenase-1 gene expression under thermal stress. The amounts of heme oxygenase-1 protein were not increased by heat shock (incubation at 42 degrees C) in human alveolar macrophages and in a human erythroblastic cell line, YN-1-0-A, whereas heat shock protein 70 (HSP70) was noticeably induced. However, heat shock factor does bind in vitro to HHO-HSE and the synthetic HHO-HSE by itself is sufficient to confer the increase in the transient expression of a reporter gene upon heat shock. The deletion of the sequence, located downstream from HHO-HSE, resulted in the activation of a reporter gene by heat shock. These results suggest that HHO-HSE is potentially functional but is repressed in vivo. Interestingly, heat shock abolished the remarkable increase in the levels of heme oxygenase-1 mRNA in YN-1-0-A cells treated with hemin or cadmium, in which HSP70 mRNA was noticeably induced. Furthermore, transient expression assays showed that heat shock inhibits the cadmium-mediated activation of the heme oxygenase-1 promoter, whereas the HSP70 gene promoter was activated upon heat shock. Such regulation of heme oxygenase-1 under thermal stress may be of physiologic significance in erythroid cells.

  4. GT-repeat polymorphism in the heme oxygenase-1 gene promoter is associated with cardiovascular mortality risk in an arsenic-exposed population in northeastern Taiwan

    International Nuclear Information System (INIS)

    Wu, Meei-Maan; Chiou, Hung-Yi; Chen, Chi-Ling; Wang, Yuan-Hung; Hsieh, Yi-Chen; Lien, Li-Ming; Lee, Te-Chang; Chen, Chien-Jen

    2010-01-01

    Inorganic arsenic has been associated with increased risk of atherosclerotic vascular disease and mortality in humans. A functional GT-repeat polymorphism in the heme oxygenase-1 (HO-1) gene promoter is inversely correlated with the development of coronary artery disease and restenosis after clinical angioplasty. The relationship of HO-1 genotype with arsenic-associated cardiovascular disease has not been studied. In this study, we evaluated the relationship between the HO-1 GT-repeat polymorphism and cardiovascular mortality in an arsenic-exposed population. A total of 504 study participants were followed up for a median of 10.7 years for occurrence of cardiovascular deaths (coronary heart disease, cerebrovascular disease, and peripheral arterial disease). Cardiovascular risk factors and DNA samples for determination of HO-1 GT repeats were obtained at recruitment. GT repeats variants were grouped into the S (< 27 repeats) or L allele (≥ 27 repeats). Relative mortality risk was estimated using Cox regression analysis, adjusted for competing risk of cancer and other causes. For the L/L, L/S, and S/S genotype groups, the crude mortalities for cardiovascular disease were 8.42, 3.10, and 2.85 cases/1000 person-years, respectively. After adjusting for conventional cardiovascular risk factors and competing risk of cancer and other causes, carriers with class S allele (L/S or S/S genotypes) had a significantly reduced risk of cardiovascular mortality compared to non-carriers (L/L genotype) [OR, 0.38; 95% CI, 0.16-0.90]. In contrast, no significant association was observed between HO-1 genotype and cancer mortality or mortality from other causes. Shorter (GT)n repeats in the HO-1 gene promoter may confer protective effects against cardiovascular mortality related to arsenic exposure.

  5. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    Science.gov (United States)

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-11-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.

  6. Short repeats in the heme oxygenase 1 gene promoter is associated with increased levels of inflammation, ferritin and higher risk of type-2 diabetes mellitus.

    Science.gov (United States)

    Andrews, Mónica; Leiva, Elba; Arredondo-Olguín, Miguel

    2016-09-01

    We evaluated the relationship between the HO1 genotype, ferritin levels and the risk of type-2 diabetes and inflammation. Eight hundred thirty-five individuals were evaluated and classified according to their nutritional status and the presence of type-2 diabetes: 153 overweight (OW); 62 obese (OB); 55 type-2 diabetes mellitus (DM); 202 OWDM; 239 OBDM and 124 controls (C). We studied biochemical (glycemia, insulin, lipid profile, liver enzyme, creatinine, hsCRP), hematological (hemoglobin, free erythrocyte protoporphyrin, transferrin receptor and serum Fe and ferritin) and oxidative stress (SOD, GHS and TBARS) parameters. We determined heme oxygenase activity and the (GT)n polymorphism in its gene promoter. Individuals with diabetes, independent of nutritional status, showed high levels of ferritin and HO activity compared to control subjects. Allelic frequency was not different between the groups (Chi(2), NS) however, genotypes were different (Chi(2), P1). The SS (short-short) genotype was higher in all DM individuals compared to controls and MM was higher in controls. SM (short-medium) genotype was an independent risk factor for DM in logistic regression analysis. We observed high risk for type-2 diabetes mellitus in the presence of SM genotype and high levels of ferritin (OR adjusted: 2.7; 1.9-3.6; p1; compared to control group). It was also significantly related to inflammation. The SM genotype in HO1 gene promoter and ferritin levels were associated with higher risk for type-2 diabetes and for having a higher marker of inflammation, which is the main risk factor for the development of chronic diseases. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. Functional imaging: monitoring heme oxygenase-1 gene expression in vivo

    Science.gov (United States)

    Zhang, Weisheng; Reilly-Contag, Pamela; Stevenson, David K.; Contag, Christopher H.

    1999-07-01

    The regulation of genetic elements can be monitored in living animals using photoproteins as reporters. Heme oxygenase (HO) is the key catabolic enzyme in the heme degradation pathway. Here, HO expression serves as a model for in vivo functional imaging of transcriptional regulation of a clinically relevant gene. HO enzymatic activity is inhibited by heme analogs, metalloporphyrins, but many members of this family of compounds also activate transcription of the HO-1 promoter. The degree of transcriptional activation by twelve metalloporphyrins, differing at the central metal and porphyrin ring substituents, was evaluated in both NIH 3T3 stable lines and transgenic animals containing HO-1 promoter-luciferase gene fusions. In the correlative cell culture assays, the metalloporphyrins increased transcription form the full length HO promoter fusion to varying degrees, but none increased transcription from a truncated HO-1 promoter. These results suggested that one or both of the two distal enhancer elements located at -4 and -10 Kb upstream from transcriptional start are required for HO-1 induction by heme and its analogs. The full-length HO-1-luc fusion was then evaluated as a transgene in mice. It was possible to monitor the effects of the metalloporphyrins, SnMP and ZnPP, in living animals over time. This spatiotemporal analyses of gene expression in vivo implied that alterations in porphyrin ring substituents and the central metal may affect the extent of gene activation. These data further indicate that using photoprotein reporters, subtle differences in gene expression can be monitored in living animals.

  8. Polymorphisms in the Haem Oxygenase-1 promoter are not associated with severity of Plasmodium falciparum malaria in Ghanaian children.

    Science.gov (United States)

    Hansson, Helle H; Maretty, Lasse; Balle, Christina; Goka, Bamenla Q; Luzon, Elisa; Nkrumah, Francis N; Schousboe, Mette L; Rodrigues, Onike P; Bygbjerg, Ib Christian; Kurtzhals, Jørgen A L; Alifrangis, Michael; Hempel, Casper

    2015-04-11

    Haem oxygenase-1 (HO-1) catabolizes haem and has both cytotoxic and cytoprotective effects. Polymorphisms in the promoter of the Haem oxygenase-1 (HMOX1) gene encoding HO-1 have been associated with several diseases including severe malaria. The objective of this study was to determine the allele and genotype frequencies of two single nucleotide polymorphisms; A(-413)T and G(-1135)A, and a (GT)n repeat length polymorphism in the HMOX1 promoter in paediatric malaria patients and controls to determine possible associations with malaria disease severity. Study participants were Ghanaian children (n=296) admitted to the emergency room at the Department of Child Health, Korle-Bu Teaching Hospital, Accra, Ghana during the malaria season from June to August in 1995, 1996 and 1997, classified as having uncomplicated malaria (n=101) or severe malaria (n=195; defined as severe anaemia (n=63) or cerebral malaria (n=132)). Furthermore, 287 individuals without a detectable Plasmodium infection or asymptomatic carriers of the parasite were enrolled as controls. Blood samples from participants were extracted for DNA and allele and genotype frequencies were determined with allele-specific PCR, restriction fragment length analysis and microsatellite analysis. The number of (GT)n repeats in the study participants varied between 21 and 46 with the majority of alleles having lengths of 26 (8.1%), 29/30 (13.2/17.9%) and 39/40 (8.0/13.8%) repeats, and was categorized into short, medium and long repeats. The (-413)T allele was very common (69.8%), while the (-1135)A allele was present in only 17.4% of the Ghanaian population. The G(-1135)A locus was excluded from further analysis after failing the Hardy-Weinberg equilibrium test. No significant differences in allele or genotype distribution of the A(-413)T and (GT)n repeat polymorphisms were found between the controls and the malaria patients, or between the disease groups, for any of the analysed polymorphisms and no associations with

  9. Over-expression of heme oxygenase-1 promotes oxidative mitochondrial damage in rat astroglia.

    Science.gov (United States)

    Song, Wei; Su, Haixiang; Song, Sisi; Paudel, Hemant K; Schipper, Hyman M

    2006-03-01

    Glial heme oxygenase-1 is over-expressed in the CNS of subjects with Alzheimer disease (AD), Parkinson disease (PD) and multiple sclerosis (MS). Up-regulation of HO-1 in rat astroglia has been shown to facilitate iron sequestration by the mitochondrial compartment. To determine whether HO-1 induction promotes mitochondrial oxidative stress, assays for 8-epiPGF(2alpha) (ELISA), protein carbonyls (ELISA) and 8-OHdG (HPLC-EC) were used to quantify oxidative damage to lipids, proteins, and nucleic acids, respectively, in mitochondrial fractions and whole-cell compartments derived from cultured rat astroglia engineered to over-express human (h) HO-1 by transient transfection. Cell viability was assessed by trypan blue exclusion and the MTT assay, and cell proliferation was determined by [3H] thymidine incorporation and total cell counts. In rat astrocytes, hHO-1 over-expression (x 3 days) resulted in significant oxidative damage to mitochondrial lipids, proteins, and nucleic acids, partial growth arrest, and increased cell death. These effects were attenuated by incubation with 1 microM tin mesoporphyrin, a competitive HO inhibitor, or the iron chelator, deferoxamine. Up-regulation of HO-1 engenders oxidative mitochondrial injury in cultured rat astroglia. Heme-derived ferrous iron and carbon monoxide (CO) may mediate the oxidative modification of mitochondrial lipids, proteins and nucleic acids in these cells. Glial HO-1 hyperactivity may contribute to cellular oxidative stress, pathological iron deposition, and bioenergetic failure characteristic of degenerating and inflamed neural tissues and may constitute a rational target for therapeutic intervention in these conditions. Copyright 2005 Wiley-Liss, Inc.

  10. Heme-Oxygenase-1 Expression Contributes to the Immunoregulation Induced by Fasciola hepatica and Promotes Infection

    Directory of Open Access Journals (Sweden)

    Paula Carasi

    2017-07-01

    Full Text Available Fasciola hepatica, also known as the liver fluke, is a trematode that infects livestock and humans causing fasciolosis, a zoonotic disease of increasing importance due to its worldwide distribution and high economic losses. This parasite immunoregulates the host immune system by inducing a strong Th2 and regulatory T immune response by immunomodulating dendritic cell (DC maturation and alternative activation of macrophages. In this paper, we show that F. hepatica infection in mice induces the upregulation of heme-oxygenase-1 (HO-1, the rate-limiting enzyme in the catabolism of free heme that regulates the host inflammatory response. We show and characterize two different populations of antigen presenting cells that express HO-1 during infection in the peritoneum of infected animals. Cells that expressed high levels of HO-1 expressed intermediate levels of F4/80 but high expression of CD11c, CD38, TGFβ, and IL-10 suggesting that they correspond to regulatory DCs. On the other hand, cells expressing intermediate levels of HO-1 expressed high levels of F4/80, CD68, Ly6C, and FIZZ-1, indicating that they might correspond to alternatively activated macrophages. Furthermore, the pharmacological induction of HO-1 with the synthetic metalloporphyrin CoPP promoted F. hepatica infection increasing the clinical signs associated with the disease. In contrast, treatment with the HO-1 inhibitor SnPP protected mice from parasite infection, indicating that HO-1 plays an essential role during F. hepatica infection. Finally, HO-1 expression during F. hepatica infection was associated with TGFβ and IL-10 levels in liver and peritoneum, suggesting that HO-1 controls the expression of these immunoregulatory cytokines during infection favoring parasite survival in the host. These results contribute to the elucidation of the immunoregulatory mechanisms induced by F. hepatica in the host and provide alternative checkpoints to control fasciolosis.

  11. Adenovirus-mediated heme oxygenase-1 gene transfer into rabbit ocular tissues.

    Science.gov (United States)

    Abraham, N G; da Silva, J L; Lavrovsky, Y; Stoltz, R A; Kappas, A; Dunn, M W; Schwartzman, M L

    1995-10-01

    Heme oxygenase-1 (HO-1) is a stress protein induced up to 100-fold within a few hours after exposure to oxidative stress, and it has been shown to counteract oxidative injury induced by ultraviolet light or free radicals. The current study was undertaken to determine whether the HO-1 gene can be introduced into adult rabbit ocular tissues by microinjection of a recombinant replication-deficient adenovirus human HO-1 cDNA (Adv-HHO). Human HO-1 gene was used for transfection studies to differentiate endogenous from transfected HO. The purified Adv-HHO construct (10(8) pfu/ml) was mixed with lipofectamine and microinjected into the anterior chamber, vitreous cavity, and subretinal space of New Zealand rabbit eyes. After 2 weeks, total RNA was extracted from different ocular tissues, reverse transcription-polymerase chain reaction was performed using specific human HO-1 primers, and amplification products were subjected to Southern hybridization. Transfection with the Adv-HHO construct into rabbit corneal epithelial cells in culture resulted in a functional expression of the human HO-1 gene; the human HO-1 mRNA was detected, and enzyme activity increased threefold. Human HO-1 mRNA was detected in the retina after microinjection of the Adv-HHO construct into the subretinal space. Microinjection into the vitreous resulted in HO-1 mRNA expression in the corneal endothelium, iris, lens, and retina; after intracameral injection of the Adv-HHO construct, human HO-1 mRNA was detected in corneal epithelium and endothelium, ciliary body, lens, and iris. Regardless of the injection site, transfected human HO-1 mRNA was undetectable in tissues outside the eye, that is, brain, liver, and kidney. These results demonstrated a tissue-selective functional transfer of the human HO-1 gene into rabbit ocular tissues in vivo. This technique may be a promising means for delivering HO-1 gene in vivo as a protective mechanism against oxidative stress that contributes to the pathogenesis of

  12. Repeat polymorphisms in the Homo sapiens heme oxygenase-1 gene in diabetic and idiopathic gastroparesis

    Science.gov (United States)

    Gibbons, Simon J.; Grover, Madhusudan; Choi, Kyoung Moo; Wadhwa, Akhilesh; Zubair, Adeel; Wilson, Laura A.; Wu, Yanhong; Abell, Thomas L.; Hasler, William L.; Koch, Kenneth L.; McCallum, Richard W.; Nguyen, Linda A. B.; Parkman, Henry P.; Sarosiek, Irene; Snape, William J.; Tonascia, James; Hamilton, Frank A.; Pasricha, Pankaj J.

    2017-01-01

    Background Idiopathic and diabetic gastroparesis in Homo sapiens cause significant morbidity. Etiology or risk factors have not been clearly identified. Failure to sustain elevated heme oxygenase-1 (HO1) expression is associated with delayed gastric emptying in diabetic mice and polymorphisms in the HO1 gene (HMOX1, NCBI Gene ID:3162) are associated with worse outcomes in other diseases. Aim Our hypothesis was that longer polyGT alleles are more common in the HMOX1 genes of individuals with gastroparesis than in controls without upper gastrointestinal motility disorders. Methods Repeat length was determined in genomic DNA. Controls with diabetes (84 type 1, 84 type 2) and without diabetes (n = 170) were compared to diabetic gastroparetics (99 type 1, 72 type 2) and idiopathic gastroparetics (n = 234). Correlations of repeat lengths with clinical symptom sub-scores on the gastroparesis cardinal symptom index (GCSI) were done. Statistical analyses of short (32) repeat alleles and differences in allele length were used to test for associations with gastroparesis. Results The distribution of allele lengths was different between groups (P = 0.016). Allele lengths were longest in type 2 diabetics with gastroparesis (29.18±0.35, mean ± SEM) and longer in gastroparetics compared to non-diabetic controls (28.50±0.14 vs 27.64±0.20 GT repeats/allele, P = 0.0008). Type 2 diabetic controls had longer alleles than non-diabetic controls. In all gastroparetic groups, allele lengths were longer in African Americans compared to other racial groups, differences in the proportion of African Americans in the groups accounted for the differences between gastroparetics and controls. Diabetic gastroparetics with 1 or 2 long alleles had worse GCSI nausea sub-scores (3.30±0.23) as compared to those with 0 long alleles (2.66±0.12), P = 0.022. Conclusions Longer poly-GT repeats in the HMOX1 gene are more common in African Americans with gastroparesis. Nausea symptoms are worse in

  13. Repeat polymorphisms in the Homo sapiens heme oxygenase-1 gene in diabetic and idiopathic gastroparesis.

    Science.gov (United States)

    Gibbons, Simon J; Grover, Madhusudan; Choi, Kyoung Moo; Wadhwa, Akhilesh; Zubair, Adeel; Wilson, Laura A; Wu, Yanhong; Abell, Thomas L; Hasler, William L; Koch, Kenneth L; McCallum, Richard W; Nguyen, Linda A B; Parkman, Henry P; Sarosiek, Irene; Snape, William J; Tonascia, James; Hamilton, Frank A; Pasricha, Pankaj J; Farrugia, Gianrico

    2017-01-01

    Idiopathic and diabetic gastroparesis in Homo sapiens cause significant morbidity. Etiology or risk factors have not been clearly identified. Failure to sustain elevated heme oxygenase-1 (HO1) expression is associated with delayed gastric emptying in diabetic mice and polymorphisms in the HO1 gene (HMOX1, NCBI Gene ID:3162) are associated with worse outcomes in other diseases. Our hypothesis was that longer polyGT alleles are more common in the HMOX1 genes of individuals with gastroparesis than in controls without upper gastrointestinal motility disorders. Repeat length was determined in genomic DNA. Controls with diabetes (84 type 1, 84 type 2) and without diabetes (n = 170) were compared to diabetic gastroparetics (99 type 1, 72 type 2) and idiopathic gastroparetics (n = 234). Correlations of repeat lengths with clinical symptom sub-scores on the gastroparesis cardinal symptom index (GCSI) were done. Statistical analyses of short (32) repeat alleles and differences in allele length were used to test for associations with gastroparesis. The distribution of allele lengths was different between groups (P = 0.016). Allele lengths were longest in type 2 diabetics with gastroparesis (29.18±0.35, mean ± SEM) and longer in gastroparetics compared to non-diabetic controls (28.50±0.14 vs 27.64±0.20 GT repeats/allele, P = 0.0008). Type 2 diabetic controls had longer alleles than non-diabetic controls. In all gastroparetic groups, allele lengths were longer in African Americans compared to other racial groups, differences in the proportion of African Americans in the groups accounted for the differences between gastroparetics and controls. Diabetic gastroparetics with 1 or 2 long alleles had worse GCSI nausea sub-scores (3.30±0.23) as compared to those with 0 long alleles (2.66±0.12), P = 0.022. Longer poly-GT repeats in the HMOX1 gene are more common in African Americans with gastroparesis. Nausea symptoms are worse in subjects with longer alleles.

  14. Repeat polymorphisms in the Homo sapiens heme oxygenase-1 gene in diabetic and idiopathic gastroparesis.

    Directory of Open Access Journals (Sweden)

    Simon J Gibbons

    Full Text Available Idiopathic and diabetic gastroparesis in Homo sapiens cause significant morbidity. Etiology or risk factors have not been clearly identified. Failure to sustain elevated heme oxygenase-1 (HO1 expression is associated with delayed gastric emptying in diabetic mice and polymorphisms in the HO1 gene (HMOX1, NCBI Gene ID:3162 are associated with worse outcomes in other diseases.Our hypothesis was that longer polyGT alleles are more common in the HMOX1 genes of individuals with gastroparesis than in controls without upper gastrointestinal motility disorders.Repeat length was determined in genomic DNA. Controls with diabetes (84 type 1, 84 type 2 and without diabetes (n = 170 were compared to diabetic gastroparetics (99 type 1, 72 type 2 and idiopathic gastroparetics (n = 234. Correlations of repeat lengths with clinical symptom sub-scores on the gastroparesis cardinal symptom index (GCSI were done. Statistical analyses of short (32 repeat alleles and differences in allele length were used to test for associations with gastroparesis.The distribution of allele lengths was different between groups (P = 0.016. Allele lengths were longest in type 2 diabetics with gastroparesis (29.18±0.35, mean ± SEM and longer in gastroparetics compared to non-diabetic controls (28.50±0.14 vs 27.64±0.20 GT repeats/allele, P = 0.0008. Type 2 diabetic controls had longer alleles than non-diabetic controls. In all gastroparetic groups, allele lengths were longer in African Americans compared to other racial groups, differences in the proportion of African Americans in the groups accounted for the differences between gastroparetics and controls. Diabetic gastroparetics with 1 or 2 long alleles had worse GCSI nausea sub-scores (3.30±0.23 as compared to those with 0 long alleles (2.66±0.12, P = 0.022.Longer poly-GT repeats in the HMOX1 gene are more common in African Americans with gastroparesis. Nausea symptoms are worse in subjects with longer alleles.

  15. Adenoviral transfer of the heme oxygenase-1 gene protects striatal astrocytes from heme-mediated oxidative injury.

    Science.gov (United States)

    Teng, Zhi-Ping; Chen, Jing; Chau, Lee-Young; Galunic, Nicholas; Regan, Raymond F

    2004-11-01

    Heme oxygenase-1 (HO-1) is induced in the CNS after hemorrhage, and may have an effect on injury to surrounding tissue. Hemin, the preferred substrate of HO, is a neurotoxin that is present in intracranial hematomas. In a prior study, we observed that HO inhibitors increased the vulnerability of cultured cortical astrocytes to heme-mediated oxidative injury. To investigate the effect of HO more specifically, we used an adenoviral vector encoding the human HO-1 gene to specifically increase HO-1 expression. Incubation with 100 MOI of the HO-1 adenovirus (Adv-HHO-1) for 24 h increased both HO-1 protein and HO activity; a control adenovirus lacking the HO-1 gene had no effect. Using a DNA probe that was specific for human HO-1, 80.5 +/- 7.2% of astrocytes were observed to be infected by in situ hybridization. The cell death produced by 30-60 microM hemin was significantly reduced by pretreatment with 100 MOI Adv-HHO-1, as assessed by LDH release, propidium iodide exclusion, and MTT reduction assay. The threefold increase in cell protein oxidation produced by hemin was also attenuated in cultures pretreated with Adv-HHO-1. These results support the hypothesis that HO-1 protects astrocytes from heme-mediated oxidative injury. Specifically increasing astrocytic HO-1 by gene transfer may have a beneficial effect on hemorrhagic CNS injury.

  16. Fetal Microsatellite in the Heme Oxygenase 1 Promoter Is Associated With Severe and Early-Onset Preeclampsia.

    Science.gov (United States)

    Kaartokallio, Tea; Utge, Siddheshwar; Klemetti, Miira M; Paananen, Jussi; Pulkki, Kari; Romppanen, Jarkko; Tikkanen, Ilkka; Heinonen, Seppo; Kajantie, Eero; Kere, Juha; Kivinen, Katja; Pouta, Anneli; Lakkisto, Päivi; Laivuori, Hannele

    2018-01-01

    Preeclampsia is a vascular pregnancy disorder that often involves impaired placental development. HO-1 (heme oxygenase 1, encoded by HMOX1 ) is a stress response enzyme crucial for endothelial and placental function. Long version of the guanine-thymine (GT n ) microsatellite in the HMOX1 promoter decreases HO-1 expression, and the long maternal repeat is associated with late-onset preeclampsia. Our aim was to study whether the length of fetal repeat is associated with mother's preeclampsia, whether the length of fetal and maternal repeats affect HO-1 levels in placenta and maternal serum, and whether HO-1 levels are altered in preeclampsia. We genotyped the repeat in the cord blood of 609 preeclamptic and 745 nonpreeclamptic neonates. HO-1 levels were measured in 36 placental samples, and in the first (222 cases/243 controls) and third (176 cases/53 controls) pregnancy trimester serum samples using enzyme-linked immunosorbent assay. The long fetal GT n repeat was associated with preeclampsia and its severe and early-onset subtypes. Interaction analysis suggested the maternal and fetal effects to be independent. Placental or serum HO-1 levels were not altered in preeclamptics, possibly reflecting heterogeneity of preeclampsia. Carriers of the long fetal and maternal repeats had lower placental and serum HO-1 levels, respectively, providing functional evidence for the association. We conclude that the long fetal GT n repeat may increase mother's risk for especially severe and early-onset preeclampsia. The fetal and maternal risk alleles likely predispose to different disease subtypes. © 2017 American Heart Association, Inc.

  17. Heme oxygenase-1 and abscisic acid effects MAPK´s gene expression in soybean seeds

    International Nuclear Information System (INIS)

    Giacometti, R.; Santa Cruz, D.; Noriega, G.; Balestrasse, K.

    2012-01-01

    In soybean previous studies enabled the identification of MAPK3 and 6 whose activity is enhanced within the signaling pathway leading to defense reactions. In this study the effects of different compounds related to hemeoxygenase (HO-1) biosynthesis on mitogen-activated protein kinase (MAPK’s) genes expression in soybean seeds were tested. To this end, 20μM hemine, 22μM ZnPPIX, 0.5mM furidine or 100μM 8-bromoguanosine 3',5'-cyclic monophosphate (8Br) were added to pre-hydrated seeds for 5 days. MAPK’s genes expression was enhanced in seeds treated with hemine. This result indicates that heme catabolism could be involved in the signaling mediated by this cascade pathway. To confirm this hypothesis experiments were carried out in the precsence of ZnPPIX, a potent irreversible HO-1 inhibitor. In this case, no gene induction was observed. On the other hand, 8Br, a cGMP analog, induced HO-1 gene expression but did not modulate MAPK’s, indicating that this effect could not be mediated by cGMP. When the action of furidine, an abscisic acid inhibitor, was tested a diminution of HO-1 gene expression was observed. In this regard, MAPK’s showed a different response, being MAPK6 the only transcript that showed a diminished respect to controls, while MAPK3 mRNA as well as MAPKK1 was enhanced. These results were confirmed by western blotting and activity determinations. (authors)

  18. [Gene transfer-induced human heme oxygenase-1 over-expression protects kidney from ischemia-reperfusion injury in rats].

    Science.gov (United States)

    Lü, Jin-xing; Yan, Chun-yin; Pu, Jin-xian; Hou, Jian-quan; Yuan, He-xing; Ping, Ji-gen

    2010-12-14

    To study the protection of gene transfer-induced human heme oxygenase-1 over-expression against renal ischemia reperfusion injury in rats. The model of kidney ischemia-reperfusion injury was established with Sprague-Dawley rats. In the therapy group (n=18), the left kidney was perfused and preserved with Ad-hHO-1 at 2.5×10(9) pfu/1.0 ml after flushed with 0-4°C HC-A organ storage solution via donor renal aorta. The rats in control groups were perfused with 0.9% saline solution (n=12) or the vector carrying no interest gene Ad-EGFP 2.5×10(9) pfu/1.0 ml (n=18) instead of Ad-hHO-1. BUN and Cr in serum were measured by slide chemical methods. The kidney samples of rats were harvested for assay of histology, immunohistochemistry and quantification of HO enzymatic activity. Apoptosis cells in the kidney were measured by TUNEL. Ad-hHO-1 via donor renal aorta could transfect renal cells of rats effectively, enzymatic activity of HO in treated group [(1.62±0.07) nmol×mg(-1)×min(-1)] is higher than in control groups treated with saline solution team [(1.27±0.07) nmol×mg(-1)×min(-1)] and vector EGFP team [(1.22±0.06) nmol×mg(-1)×min(-1)] (PhHO-1 expressed hHO-1 in kidneys at a high level. Corresponding to this, the level of BUN and Cr, as well as the number of apoptosis cells, were decreased, and the damage in histology by HE staining was ameliorated. Over-expression of human HO-1 can protect the kidney from ischemia/reperfusion injury in rats.

  19. Effects of heme oxygenase-1 gene modulated mesenchymal stem cells on vasculogenesis in ischemic swine hearts.

    Science.gov (United States)

    Jiang, Yi-Bo; Zhang, Xiao-Li; Tang, Yao-Liang; Ma, Gen-Shan; Shen, Cheng-Xing; Wei, Qin; Zhu, Qi; Yao, Yu-Yu; Liu, Nai-Feng

    2011-02-01

    Mesenchymal stem cells (MSCs) transplantation may partially restore heart function in the treatment of acute myocardial infarction (AMI). The aim of this study was to explore the beneficial effects of MSCs modified with heme xygenase-1 (HO-1) on post-infarct swine hearts to determine whether the induction of therapeutic angiogenesis is modified by the angiogenic cytokines released from the implanted cells. In vitro, MSCs were divided into four groups: (1) non-transfected MSCs (MSCs group), (2) MSCs transfected with the pcDNA3.1-Lacz plasmid (Lacz-MSCs group), (3) MSCs transfected with pcDNA3.1-hHO-1 (HO-1-MSCs group), and (4) MSCs transfected with pcDNA3.1-hHO-1 and pretreatment with an HO inhibitor, tin protoporphyrin (SnPP) (HO-1-MSCs + SnPP group). Cells were cultured in an airtight incubation bottle for 24 hours, in which the oxygen concentration was maintained at < 1%, followed by 12 hours of reoxygenation. After hypoxia/reoxygen treatment, ELISA was used to measure transforming growth factor (TGF-β) and fibroblast growth factor (FGF-2) in the supernatant. In vivo, 28 Chinese mini-pigs were randomly allocated to the following treatment groups: (1) control group (saline), (2) Lacz-MSCs group, (3) HO-1-MSCs group, and (4) HO-1-MSCs + SnPP group. About 1 × 10(7) of autologous stem cells or an identical volume of saline was injected intracoronary into porcine hearts 1 hour after MI. Magnetic resonance imaging (MRI) assay and postmortem analysis were assessed four weeks after stem cell transplantation. Post hypoxia/reoxygenation in vitro, TGF-β in the supernatant was significantly increased in the HO-1-MSCs ((874.88 ± 68.23) pg/ml) compared with Lacz-MSCs ((687.81 ± 57.64) pg/ml, P < 0.001). FGF-2 was also significantly increased in the HO-1-MSCs ((1106.48 ± 107.06) pg/ml) compared with the Lacz-MSCs ((853.85 ± 74.44) pg/ml, P < 0.001). In vivo, at four weeks after transplantation, HO-1 gene transfer increased the capillary density in the peri-infarct area

  20. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    International Nuclear Information System (INIS)

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  1. Effect of a heme oxygenase-1 inducer on NADPH oxidase ...

    African Journals Online (AJOL)

    Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...

  2. Heme Oxygenase-1 Gene Therapy Provides Cardioprotection Via Control of Post-Ischemic Inflammation: An Experimental Study in a Pre-Clinical Pig Model.

    Science.gov (United States)

    Hinkel, Rabea; Lange, Philipp; Petersen, Björn; Gottlieb, Elena; Ng, Judy King Man; Finger, Stefanie; Horstkotte, Jan; Lee, Seungmin; Thormann, Michael; Knorr, Maike; El-Aouni, Chiraz; Boekstegers, Peter; Reichart, Bruno; Wenzel, Philip; Niemann, Heiner; Kupatt, Christian

    2015-07-14

    Heme oxygenase-1 (HO-1) is an inducible stress-responsive enzyme converting heme to bilirubin, carbon monoxide, and free iron, which exerts anti-inflammatory and antiapoptotic effects. Although efficient cardioprotection after HO-1 overexpression has been reported in rodents, its role in attenuating post-ischemic inflammation is unclear. This study assessed the efficacy of recombinant adenoassociated virus (rAAV)-encoding human heme oxygenase-1 (hHO-1) in attenuating post-ischemic inflammation in a murine and a porcine ischemia/reperfusion model. Murine ischemia was induced by 45 min of left anterior descending occlusion, followed by 24 h of reperfusion and functional as well as fluorescent-activated cell sorting analysis. Porcine hearts were subjected to 60 min of ischemia and 24h of reperfusion before hemodynamic and histologic analyses were performed. Human microvascular endothelial cells transfected with hHO-1 displayed an attenuated interleukin-6 and intercellular adhesion molecule 1 expression, resulting in reduced monocytic THP-1 cell recruitment in vitro. In murine left anterior descending occlusion and reperfusion, the post-ischemic influx of CD45(+) leukocytes, Ly-6G(+) neutrophils, and Ly-6C(high) monocytes was further exacerbated in HO-1-deficient hearts and reversed by rAAV.hHO-1 treatment. Conversely, in our porcine model of ischemia, the post-ischemic influx of myeloperoxidase-positive neutrophils and CD14(+) monocytes was reduced by 49% and 87% after rAAV.hHO-1 transduction, similar to hHO-1 transgenic pigs. Functionally, rAAV.hHO-1 and hHO-1 transgenic left ventricles displayed a smaller loss of ejection fraction than control animals. Whereas HO-1 deficiency exacerbates post-ischemic cardiac inflammation in mice, hHO-1 gene therapy attenuates inflammation after ischemia and reperfusion in murine and porcine hearts. Regional hHO-1 gene therapy provides cardioprotection in a pre-clinical porcine ischemia/reperfusion model. Copyright © 2015 American

  3. A vigilant, hypoxia-regulated heme oxygenase-1 gene vector in the heart limits cardiac injury after ischemia-reperfusion in vivo.

    Science.gov (United States)

    Tang, Yao Liang; Qian, Keping; Zhang, Y Clare; Shen, Leping; Phillips, M Ian

    2005-12-01

    The effect of a cardiac specific, hypoxia-regulated, human heme oxygenase-1 (hHO-1) vector to provide cardioprotection from ischemia-reperfusion injury was assessed. When myocardial ischemia and reperfusion is asymptomatic, the damaging effects are cumulative and patients miss timely treatment. A gene therapy approach that expresses therapeutic genes only when ischemia is experienced is a desirable strategy. We have developed a cardiac-specific, hypoxia-regulated gene therapy "vigilant vector'' system that amplifies cardioprotective gene expression. Vigilant hHO-1 plasmids, LacZ plasmids, or saline (n = 40 per group) were injected into mouse heart 2 days in advance of ischemia-reperfusion injury. Animals were exposed to 60 minutes of ischemia followed by 24 hours of reperfusion. For that term (24 hours) effects, the protein levels of HO-1, inflammatory responses, apoptosis, and infarct size were determined. For long-term (3 week) effects, the left ventricular remodeling and recovery of cardiac function were assessed. Ischemia-reperfusion resulted in a timely overexpression of HO-1 protein. Infarct size at 24 hours after ischemia-reperfusion was significantly reduced in the HO-1-treated animals compared with the LacZ-treated group or saline-treated group (P < .001). The reduction of infarct size was accompanied by a decrease in lipid peroxidant activity, inflammatory cell infiltration, and proapoptotic protein level in ischemia-reperfusion-injured myocardium. The long-term study demonstrated that timely, hypoxia-induced HO-1 overexpression is beneficial in conserving cardiac function and attenuating left ventricle remodelling. The vigilant HO-1 vector provides a protective therapy in the heart for reducing cellular damage during ischemia-reperfusion injury and preserving heart function.

  4. Kidney injury and heme oxygenase-1

    Directory of Open Access Journals (Sweden)

    Hai-xing MAI

    2012-02-01

    Full Text Available     Heme oxygenase-1 (HO-1 is one of the main pathways to degrade heme in mammals, and the main degradation products are free iron (Fe2+, carbon monoxide (CO, and bilirubin. Heme plays an important role in promoting cell survival, circulation of intracellular substrates, and immune regulation. Previous studies suggest that HO-1 pathway is an important internal factor in determining the susceptibility and severity of acute kidney injury (AKI. The induction of HO-1 expression can attenuate the severity of renal ischemia-reperfusion injury (IRI, and the inhibition of HO-1 expression will aggravate IRI. The present article summarizes the latest advances in research abroad and at home on protective mechanism by which HO-1 prevents AKI to further deepen our understanding of the role of HO-1 in the treatment of AKI.   

  5. High Glucose Promotes Tumor Invasion and Increases Metastasis-Associated Protein Expression in Human Lung Epithelial Cells by Upregulating Heme Oxygenase-1 via Reactive Oxygen Species or the TGF-β1/PI3K/Akt Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Xiaowen Kang

    2015-02-01

    Full Text Available Background: Growing evidence indicates that heme oxygenase-1 (HO-1 is up-regulated in malignancies and subsequently alters tumor aggressiveness and various cancer-related factors, such as high glucose (HG levels. HO-1 expression can be induced when glucose concentrations are above 25 mM; however, the role of HO-1 in lung cancer patients with diabetes remains unknown. Therefore, in this study we investigated the promotion of tumor cell invasion and the expression of metastasis-associated proteins by inducing the up-regulation of HO-1 expression by HG treatment in A549 human lung epithelial cells. Methods: The expression of HO-1and metastasis-associated protein expression was explored by western blot analysis. HO-1 enzymatic activity, reactive oxygen species (ROS production and TGF-β1 production were examined by ELISA. Invasiveness was analyzed using a Transwell chamber. Results: HG treatment of A549 cells induced an increase in HO-1 expression, which was mediated by the HG-induced generation of reactive oxygen species (ROS and transforming growth factor-β1 (TGF-β1 in a concentration- and time-dependent manner. Following the increase in HO-1 expression, the enzymatic activity of HO-1 also increased in HG-treated cells. Pretreatment with N-acetyl-L-cysteine (NAC or with phosphatidylinositol 3-kinase (PI3K/Akt inhibitors attenuated the HG-induced increase in HO-1 expression. HG treatment of A549 cells enhanced the invasion potential of these cells, as shown with a Transwell assay, and increased metastasis-associated protein expression. However, HO-1 siRNA transfection significantly decreased these capabilities. Conclusion: this study is the first to demonstrate that HG treatment of A549 human lung epithelial cells promotes tumor cell invasion and increases metastasis-associated protein expression by up-regulating HO-1 expression via ROS or the TGF-β1/PI3K/Akt signaling pathway.

  6. Heme oxygenase-1, oxidation, inflammation and atherosclerosis

    Directory of Open Access Journals (Sweden)

    Jesus A Araujo

    2012-07-01

    Full Text Available Atherosclerosis is an inflammatory process of the vascular wall characterized by the infiltration of lipids and inflammatory cells. Oxidative modifications of infiltrating low density lipoproteins and induction of oxidative stress play a major role in lipid retention in the vascular wall, uptake by macrophages and generation of foam cells, a hallmark of this disorder. The vasculature has a plethora of protective resources against oxidation and inflammation, many of them regulated by the Nrf2 transcription factor. Heme oxygenase-1 (HO-1 is a Nrf2-regulated gene that plays a critical role in the prevention of vascular inflammation. It is the inducible isoform of heme oxygenase, responsible for the oxidative cleavage of heme groups leading to the generation of biliverdin, carbon monoxide and release of ferrous iron. HO-1 has important antioxidant, antiinflammatory, antiapoptotic, antiproliferative and immunomodulatory effects in vascular cells, most of which play a significant role in the protection against atherogenesis. HO-1 may also be an important feature in macrophage differentiation and polarization to certain subtypes. The biological effects of HO-1 are largely attributable to its enzymatic activity, which can be conceived as a system with three arms of action, corresponding to its three enzymatic byproducts. HO-1 mediated vascular protection may be due to a combination of systemic and vascular local effects. It is usually expressed at low levels but can be highly upregulated in the presence of several proatherogenic stimuli. The HO-1 system is amenable for use in the development of new therapies, some of them currently under experimental and clinical trials. Interestingly, in contrast to the HO-1 antiatherogenic actions, the expression of its transcriptional regulator Nrf2 leads to proatherogenic effects instead. This article reviews the evidence that supports the antiatherogenic role of HO-1, potential pathways and mechanisms mediating

  7. A Heme Oxygenase-1 Transducer Model of Degenerative and Developmental Brain Disorders

    Directory of Open Access Journals (Sweden)

    Hyman M. Schipper

    2015-03-01

    Full Text Available Heme oxygenase-1 (HO-1 is a 32 kDa protein which catalyzes the breakdown of heme to free iron, carbon monoxide and biliverdin. The Hmox1 promoter contains numerous consensus sequences that render the gene exquisitely sensitive to induction by diverse pro-oxidant and inflammatory stimuli. In “stressed” astroglia, HO-1 hyperactivity promotes mitochondrial iron sequestration and macroautophagy and may thereby contribute to the pathological iron deposition and bioenergetic failure documented in Alzheimer disease, Parkinson disease and certain neurodevelopmental conditions. Glial HO-1 expression may also impact neuroplasticity and cell survival by modulating brain sterol metabolism and the proteasomal degradation of neurotoxic proteins. The glial HO-1 response may represent a pivotal transducer of noxious environmental and endogenous stressors into patterns of neural damage and repair characteristic of many human degenerative and developmental CNS disorders.

  8. Ascorbic acid deficiency decreases hepatic cytochrome P-450, especially CYP2B1/2B2, and simultaneously induces heme oxygenase-1 gene expression in scurvy-prone ODS rats.

    Science.gov (United States)

    Kobayashi, Misato; Hoshinaga, Yukiko; Miura, Natsuko; Tokuda, Yuki; Shigeoka, Shigeru; Murai, Atsushi; Horio, Fumihiko

    2014-01-01

    The mechanisms underlying the decrease in hepatic cytochrome P-450 (CYP) content in ascorbic acid deficiency was investigated in scurvy-prone ODS rats. First, male ODS rats were fed a diet containing sufficient ascorbic acid (control) or a diet without ascorbic acid (deficient) for 18 days, with or without the intraperitoneal injection of phenobarbital. Ascorbic acid deficiency decreased hepatic microsomal total CYP content, CYP2B1/2B2 protein, and mitochondrial cytochrome oxidase (COX) complex IV subunit I protein, and simultaneously increased heme oxygenase-1 protein in microsomes and mitochondria. Next, heme oxygenase-1 inducers, that is lipopolysaccharide and hemin, were administered to phenobaribital-treated ODS rats fed sufficient ascorbic acid. The administration of these inducers decreased hepatic microsomal total CYP content, CYP2B1/2B2 protein, and mitochondrial COX complex IV subunit I protein. These results suggested that the stimulation of hepatic heme oxygenase-1 expression by ascorbic acid deficiency caused the decrease in CYP content in liver.

  9. Heme oxygenase-1 accelerates tumor angiogenesis of human pancreatic cancer.

    Science.gov (United States)

    Sunamura, Makoto; Duda, Dan G; Ghattas, Maivel H; Lozonschi, Lucian; Motoi, Fuyuhiko; Yamauchi, Jun-Ichiro; Matsuno, Seiki; Shibahara, Shigeki; Abraham, Nader G

    2003-01-01

    Angiogenesis is necessary for the continued growth of solid tumors, invasion and metastasis. Several studies clearly showed that heme oxygenase-1 (HO-1) plays an important role in angiogenesis. In this study, we used the vital microscope system, transparent skinfold model, lung colonization model and transduced pancreatic cancer cell line (Panc-1)/human heme oxygenase-1 (hHO-1) cells, to precisely analyze, for the first time, the effect of hHO-1 gene on tumor growth, angiogenesis and metastasis. Our results revealed that HO-1 stimulates angiogenesis of pancreatic carcinoma in severe combined immune deficient mice. Overexpression of human hHO-1 after its retroviral transfer into Panc-1 cells did not interfere with tumor growth in vitro. While in vivo the development of tumors was accelerated upon transfection with hHO-1. On the other hand, inhibition of heme oxygenase (HO) activity by stannous mesoporphyrin was able transiently to delay tumor growth in a dose dependent manner. Tumor angiogenesis was markedly increased in Panc-1/hHO-1 compared to mock transfected and wild type. Lectin staining and Ki-67 proliferation index confirmed these results. In addition hHO-1 stimulated in vitro tumor angiogenesis and increased endothelial cell survival. In a lung colonization model, overexpression of hHO-1 increased the occurrence of metastasis, while inhibition of HO activity by stannous mesoporphyrin completely inhibited the occurrence of metastasis. In conclusion, overexpression of HO-1 genes potentiates pancreatic cancer aggressiveness, by increasing tumor growth, angiogenesis and metastasis and that the inhibition of the HO system may be of useful benefit for the future treatment of the disease.

  10. Heme oxygenase-1: a metabolic nike.

    Science.gov (United States)

    Wegiel, Barbara; Nemeth, Zsuzsanna; Correa-Costa, Matheus; Bulmer, Andrew C; Otterbein, Leo E

    2014-04-10

    Heme degradation, which was described more than 30 years ago, is still very actively explored with many novel discoveries on its role in various disease models every year. The heme oxygenases (HO) are metabolic enzymes that utilize NADPH and oxygen to break apart the heme moiety liberating biliverdin (BV), carbon monoxide (CO), and iron. Heme that is derived from hemoproteins can be toxic to the cells and if not removed immediately, it causes cell apoptosis and local inflammation. Elimination of heme from the milieu enables generation of three products that influences numerous metabolic changes in the cell. CO has profound effects on mitochondria and cellular respiration and other hemoproteins to which it can bind and affect their function, while BV and bilirubin (BR), the substrate and product of BV, reductase, respectively, are potent antioxidants. Sequestration of iron into ferritin and its recycling in the tissues is a part of the homeodynamic processes that control oxidation-reduction in cellular metabolism. Further, heme is an important component of a number of metabolic enzymes, and, therefore, HO-1 plays an important role in the modulation of cellular bioenergetics. In this review, we describe the cross-talk between heme oxygenase-1 (HO-1) and its products with other metabolic pathways. HO-1, which we have labeled Nike, the goddess who personified victory, dictates triumph over pathophysiologic conditions, including diabetes, ischemia, and cancer.

  11. Molecular mechanism and functional consequences of lansoprazole-mediated heme oxygenase-1 induction

    Science.gov (United States)

    Schulz-Geske, Stephanie; Erdmann, Kati; Wong, Ronald J; Stevenson, David K; Schröder, Henning; Grosser, Nina

    2009-01-01

    AIM: To investigate the molecular mechanism and functional consequences of heme oxygenase-1 (HO-1) activation by lansoprazole in endothelial cells and macrophages. METHODS: Expression of HO-1 mRNA was analyzed by Northern blotting. Western blotting was used to determine the HO-1 and ferritin protein levels. NADPH-dependent reactive oxygen species (ROS) formation was measured with lucigenin-enhanced chemiluminescence. HO-1 promoter activity in mouse fibroblasts, stably transfected with a 15-kb HO-1 gene that drives expression of the reporter gene luciferase, was assessed using in vivo bioluminescence imaging. RESULTS: Lansoprazole increased HO-1 mRNA levels in endothelial cells and HO-1 protein levels in macrophages. In addition, lansoprazole-induced ferritin protein levels in both cell systems. Moreover, induction of the antioxidant proteins HO-1 and ferritin by lansoprazole was followed by a decrease in NADPH-mediated ROS formation. The radical scavenging properties of lansoprazole were diminished in the presence of the HO inhibitor, chromium mesoporphyrin IX. Induction of HO-1 gene expression by lansoprazole was not related to oxidative stress or to the activation of the mitogen-activated protein kinase pathway. However, the phosphatidylinositol 3-kinase inhibitor LY294002 showed a concentration-dependent inhibition of HO-1 mRNA and promoter activity. CONCLUSION: Activation of HO-1 and ferritin may account for the gastric protection of lansoprazole and is dependent on a pathway blocked by LY294002. PMID:19764090

  12. Heme oxygenase-1 deletion affects stress erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Yu-An Cao

    Full Text Available Homeostatic erythropoiesis leads to the formation of mature red blood cells under non-stress conditions, and the production of new erythrocytes occurs as the need arises. In response to environmental stimuli, such as bone marrow transplantation, myelosuppression, or anemia, erythroid progenitors proliferate rapidly in a process referred to as stress erythropoiesis. We have previously demonstrated that heme oxygenase-1 (HO-1 deficiency leads to disrupted stress hematopoiesis. Here, we describe the specific effects of HO-1 deficiency on stress erythropoiesis.We used a transplant model to induce stress conditions. In irradiated recipients that received hmox(+/- or hmox(+/+ bone marrow cells, we evaluated (i the erythrocyte parameters in the peripheral blood; (ii the staining intensity of CD71-, Ter119-, and CD49d-specific surface markers during erythroblast differentiation; (iii the patterns of histological iron staining; and (iv the number of Mac-1(+-cells expressing TNF-α. In the spleens of mice that received hmox(+/- cells, we show (i decreases in the proerythroblast, basophilic, and polychromatophilic erythroblast populations; (ii increases in the insoluble iron levels and decreases in the soluble iron levels; (iii increased numbers of Mac-1(+-cells expressing TNF-α; and (iv decreased levels of CD49d expression in the basophilic and polychromatophilic erythroblast populations.As reflected by effects on secreted and cell surface proteins, HO-1 deletion likely affects stress erythropoiesis through the retention of erythroblasts in the erythroblastic islands of the spleen. Thus, HO-1 may serve as a therapeutic target for controlling erythropoiesis, and the dysregulation of HO-1 may be a predisposing condition for hematologic diseases.

  13. Immunolocalization of heme oxygenase-1 in periodontal diseases

    Directory of Open Access Journals (Sweden)

    G Gayathri

    2014-01-01

    Conclusion: The results of our study is an increasing evidence of involvement of antioxidant enzymes like heme oxygenase-1 in periodontal inflammation and their implication for treatment of chronic periodontitis.

  14. Involvement of heme oxygenase-1 in β-cyclodextrin-hemin complex-induced cucumber adventitious rooting process.

    Science.gov (United States)

    Lin, Yuting; Li, Meiyue; Huang, Liqin; Shen, Wenbiao; Ren, Yong

    2012-09-01

    Our previous results showed that β-cyclodextrin-hemin complex (CDH) exhibited a vital protective role against cadmium-induced oxidative damage and toxicity in alfalfa seedling roots by the regulation of heme oxygenase-1 (HO-1) gene expression. In this report, we further test whether CDH exhibited the hormonal-like response. The application of CDH and an inducer of HO-1, hemin, were able to induce the up-regulation of cucumber HO-1 gene (CsHO1) expression and thereafter the promotion of adventitious rooting in cucumber explants. The effect is specific for HO-1 since the potent HO-1 inhibitor zinc protoporphyrin IX (ZnPP) blocked the above responses triggered by CDH, and the inhibitory effects were reversed further when 30% saturation of CO aqueous solution was added together. Further, molecular evidence showed that CDH triggered the increases of the HO-1-mediated target genes responsible for adventitious rooting, including one DnaJ-like gene (CsDNAJ-1) and two calcium-dependent protein kinase (CDPK) genes (CsCDPK1 and CsCDPK5), and were inhibited by ZnPP and reversed by CO. The calcium (Ca2+) chelator ethylene glycol-bis (2-aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA) and the Ca2+ channel blocker lanthanum chloride (LaCl3) not only compromised the induction of adventitious rooting induced by CDH but also decreased the transcripts of above three target genes. However, the application of ascorbic acid (AsA), a well-known antioxidant in plants, failed to exhibit similar inducible effect on adventitious root formation. In short, above results illustrated that the response of CDH in the induction of cucumber adventitious rooting might be through HO-1-dependent mechanism and calcium signaling. Physiological, pharmacological and molecular evidence showed that β-cyclodextrin-hemin complex (CDH) was able to induce cucumber adventitious rooting through heme oxygenase-1 (HO-1)-dependent mechanism and calcium signaling.

  15. Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis.

    Science.gov (United States)

    Chang, Ling-Chu; Chiang, Shih-Kai; Chen, Shuen-Ei; Yu, Yung-Luen; Chou, Ruey-Hwang; Chang, Wei-Chao

    2018-03-01

    Ferroptosis is a form of oxidative cell death and has become a chemotherapeutic target for cancer treatment. BAY 11-7085 (BAY), which is a well-known IκBα inhibitor, suppressed viability in cancer cells via induction of ferroptotic death in an NF-κB-independent manner. Reactive oxygen species scavenging, relief of lipid peroxidation, replenishment of glutathione and thiol-containing agents, as well as iron chelation, rescued BAY-induced cell death. BAY upregulated a variety of Nrf2 target genes related to redox regulation, particularly heme oxygenase-1 (HO-1). Studies with specific inhibitors and shRNA interventions suggested that the hierarchy of induction is Nrf2-SLC7A11-HO-1. SLC7A11 inhibition by erastin, sulfasalazine, or shRNA interference sensitizes BAY-induced cell death. Overexperession of SLC7A11 attenuated BAY-inhibited cell viability. The ferroptotic process induced by hHO-1 overexpression further indicated that HO-1 is a key mediator of BAY-induced ferroptosis that operates through cellular redox regulation and iron accumulation. BAY causes compartmentalization of HO-1 into the nucleus and mitochondrion, and followed mitochondrial dysfunctions, leading to lysosome targeting for mitophagy. In this study, we first discovered that BAY induced ferroptosis via Nrf2-SLC7A11-HO-1 pathway and HO-1 is a key mediator by responding to the cellular redox status. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Protection from ischemic heart injury by a vigilant heme oxygenase-1 plasmid system.

    Science.gov (United States)

    Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian

    2004-04-01

    Although human heme oxygenase-1 (hHO-1) could provide a useful approach for cellular protection in the ischemic heart, constitutive overexpression of hHO-1 may lead to unwanted side effects. To avoid this, we designed a hypoxia-regulated hHO-1 gene therapy system that can be switched on and off. This vigilant plasmid system is composed of myosin light chain-2v promoter and a gene switch that is based on an oxygen-dependent degradation domain from the hypoxia inducible factor-1-alpha. The vector can sense ischemia and switch on the hHO-1 gene system, specifically in the heart. In an in vivo experiment, the vigilant hHO-1 plasmid or saline was injected intramyocardially into myocardial infarction mice or sham operation mice. After gene transfer, expression of hHO-1 was only detected in the ischemic heart treated with vigilant hHO-1 plasmids. Masson trichrome staining showed significantly fewer fibrotic areas in vigilant hHO-1 plasmids-treated mice compared with saline control (43.0%+/-4.8% versus 62.5%+/-3.3%, PhHO-1 expression in peri-infarct border areas, concomitant with higher Bcl-2 levels and lower Bax, Bak, and caspase 3 levels in the ischemic myocardium compared with saline control. By use of a cardiac catheter, heart from vigilant hHO-1 plasmids-treated mice showed improved recovery of contractile and diastolic performance after myocardial infarction compared with saline control. This study documents the beneficial regulation and therapeutic potential of vigilant plasmid-mediated hHO-1 gene transfer. This novel gene transfer strategy can provide cardiac-specific protection from future repeated bouts of ischemic injury.

  17. Generation and characterization of human heme oxygenase-1 transgenic pigs.

    Directory of Open Access Journals (Sweden)

    Hye-Jung Yeom

    Full Text Available Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1, an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs. Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

  18. Generation and characterization of human heme oxygenase-1 transgenic pigs.

    Science.gov (United States)

    Yeom, Hye-Jung; Koo, Ok Jae; Yang, Jaeseok; Cho, Bumrae; Hwang, Jong-Ik; Park, Sol Ji; Hurh, Sunghoon; Kim, Hwajung; Lee, Eun Mi; Ro, Han; Kang, Jung Taek; Kim, Su Jin; Won, Jae-Kyung; O'Connell, Philip J; Kim, Hyunil; Surh, Charles D; Lee, Byeong-Chun; Ahn, Curie

    2012-01-01

    Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1), an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs). Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

  19. 4-Hydroxyestradiol induces mammary epithelial cell transformation through Nrf2-mediated heme oxygenase-1 overexpression

    OpenAIRE

    Park, Sin-Aye; Lee, Mee-Hyun; Na, Hye-Kyung; Surh, Young-Joon

    2016-01-01

    Estrogen (17?-estradiol, E2) undergoes oxidative metabolism by CYP1B1 to form 4-hydroxyestradiol (4-OHE2), a putative carcinogenic metabolite of estrogen. Our previous study showed that 4-OHE2-induced production of reactive oxygen species contributed to neoplastic transformation of human breast epithelial (MCF-10A) cells. In this study, 4-OHE2, but not E2, increased the expression of heme oxygenase-1 (HO-1), a sensor and regulator of oxidative stress, in MCF-10A cells. Silencing the HO-1 gene...

  20. Heme Oxygenase-1/Carbon Monoxide System and Embryonic Stem Cell Differentiation and Maturation into Cardiomyocytes

    Science.gov (United States)

    Suliman, Hagir B.; Zobi, Fabio

    2016-01-01

    Abstract Aims: The differentiation of embryonic stem (ES) cells into energetically efficient cardiomyocytes contributes to functional cardiac repair and is envisioned to ameliorate progressive degenerative cardiac diseases. Advanced cell maturation strategies are therefore needed to create abundant mature cardiomyocytes. In this study, we tested whether the redox-sensitive heme oxygenase-1/carbon monoxide (HO-1/CO) system, operating through mitochondrial biogenesis, acts as a mechanism for ES cell differentiation and cardiomyocyte maturation. Results: Manipulation of HO-1/CO to enhance mitochondrial biogenesis demonstrates a direct pathway to ES cell differentiation and maturation into beating cardiomyocytes that express adult structural markers. Targeted HO-1/CO interventions up- and downregulate specific cardiogenic transcription factors, transcription factor Gata4, homeobox protein Nkx-2.5, heart- and neural crest derivatives-expressed protein 1, and MEF2C. HO-1/CO overexpression increases cardiac gene expression for myosin regulatory light chain 2, atrial isoform, MLC2v, ANP, MHC-β, and sarcomere α-actinin and the major mitochondrial fusion regulators, mitofusin 2 and MICOS complex subunit Mic60. This promotes structural mitochondrial network expansion and maturation, thereby supporting energy provision for beating embryoid bodies. These effects are prevented by silencing HO-1 and by mitochondrial reactive oxygen species scavenging, while disruption of mitochondrial biogenesis and mitochondrial DNA depletion by loss of mitochondrial transcription factor A compromise infrastructure. This leads to failure of cardiomyocyte differentiation and maturation and contractile dysfunction. Innovation: The capacity to augment cardiomyogenesis via a defined mitochondrial pathway has unique therapeutic potential for targeting ES cell maturation in cardiac disease. Conclusion: Our findings establish the HO-1/CO system and redox regulation of mitochondrial biogenesis as

  1. Epalrestat increases glutathione, thioredoxin, and heme oxygenase-1 by stimulating Nrf2 pathway in endothelial cells

    Directory of Open Access Journals (Sweden)

    Kaori Yama

    2015-04-01

    Full Text Available Epalrestat (EPS is the only aldose reductase inhibitor that is currently available for the treatment of diabetic neuropathy. Recently, we found that EPS at near-plasma concentration increases the intracellular levels of glutathione (GSH in rat Schwann cells. GSH plays a crucial role in protecting endothelial cells from oxidative stress, thereby preventing vascular diseases. Here we show that EPS increases GSH levels in not only Schwann cells but also endothelial cells. Treatment of bovine aortic endothelial cells (BAECs, an in vitro model of the vascular endothelium, with EPS caused a dramatic increase in intracellular GSH levels. This was concomitant with the up-regulation of glutamate cysteine ligase, an enzyme catalyzing the first and rate-limiting step in de novo GSH synthesis. Moreover, EPS stimulated the expression of thioredoxin and heme oxygenase-1, which have important redox regulatory functions in endothelial cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a key transcription factor that regulates the expression of antioxidant genes. EPS increased nuclear Nrf2 levels in BAECs. Nrf2 knockdown by siRNA suppressed the EPS-induced glutamate cysteine ligase, thioredoxin-1, and heme oxygenase-1 expression. Interestingly, LY294002, an inhibitor of phosphatidylinositol 3-kinase, abolished the EPS-stimulated GSH synthesis, suggesting that the kinase is associated with Nrf2 activation induced by EPS. Furthermore, EPS reduced the cytotoxicity induced by H2O2 and tert-butylhydroperoxide, indicating that EPS plays a role in protecting cells from oxidative stress. Taken together, the results provide evidence that EPS exerts new beneficial effects on endothelial cells by increasing GSH, thioredoxin, and heme oxygenase-1 levels through the activation of Nrf2. We suggest that EPS has the potential to prevent several vascular diseases caused by oxidative stress.

  2. Non-coding RNAs and heme oxygenase-1 in vaccinia virus infection

    International Nuclear Information System (INIS)

    Meseda, Clement A.; Srinivasan, Kumar; Wise, Jasen; Catalano, Jennifer; Yamada, Kenneth M.; Dhawan, Subhash

    2014-01-01

    Highlights: • Heme oxygenase-1 (HO-1) induction inhibited vaccinia virus infection of macrophages. • Reduced infectivity inversely correlated with increased expression of non-coding RNAs. • The regulation of HO-1 and ncRNAs suggests a novel host defense response against vaccinia virus infection. - Abstract: Small nuclear RNAs (snRNAs) are <200 nucleotide non-coding uridylate-rich RNAs. Although the functions of many snRNAs remain undetermined, a population of snRNAs is produced during the early phase of infection of cells by vaccinia virus. In the present study, we demonstrate a direct correlation between expression of the cytoprotective enzyme heme oxygenase-1 (HO-1), suppression of selective snRNA expression, and inhibition of vaccinia virus infection of macrophages. Hemin induced HO-1 expression, completely reversed virus-induced host snRNA expression, and suppressed vaccinia virus infection. This involvement of specific virus-induced snRNAs and associated gene clusters suggests a novel HO-1-dependent host-defense pathway in poxvirus infection

  3. Serum heme oxygenase-1 levels in patients with primary dysmenorrhea.

    Science.gov (United States)

    Aksoy, Ayse Nur; Laloglu, Esra; Ozkaya, Alev Lazoglu; Yilmaz, Emsal Pınar Topdagi

    2017-04-01

    Primary dysmenorrhea effects the life-quality of women negatively. The aim of this study was to evaluate heme oxygenase-1 (HO1) activity together with malondialdehyde (MDA) and nitric oxide (NO) levels in patients with primary dysmenorrhea. A total of 28 nulliparous women with the diagnosis of primary dysmenorrhea and 26 healthy controls were included in this study. On the first day of menstruation, all patients underwent ultrasound examination to exclude pelvic pathology and the visual analogue scale was applied to patients. Patient's visual analogue scale (VAS) scores, age, body mass index (BMI), menstrual cycle length (day), length of bleeding (day) were recorded. In the same day, fasting blood samples were taken from each patient for biochemical analysis. Serum MDA, NO and HO1 levels were found to be higher in women with primary dysmenorrhea compared to healthy controls (p = 0.012, p = 0.009, p dysmenorrhea. Antioxidant support might be helpful to reduce pain severity in primary dysmenorrhea.

  4. The cytoprotective enzyme heme oxygenase-1 suppresses Ebola virus replication.

    Science.gov (United States)

    Hill-Batorski, Lindsay; Halfmann, Peter; Neumann, Gabriele; Kawaoka, Yoshihiro

    2013-12-01

    Ebola virus (EBOV) is the causative agent of a severe hemorrhagic fever in humans with reported case fatality rates as high as 90%. There are currently no licensed vaccines or antiviral therapeutics to combat EBOV infections. Heme oxygenase-1 (HO-1), an enzyme that catalyzes the rate-limiting step in heme degradation, has antioxidative properties and protects cells from various stresses. Activated HO-1 was recently shown to have antiviral activity, potently inhibiting the replication of viruses such as hepatitis C virus and human immunodeficiency virus. However, the effect of HO-1 activation on EBOV replication remains unknown. To determine whether the upregulation of HO-1 attenuates EBOV replication, we treated cells with cobalt protoporphyrin (CoPP), a selective HO-1 inducer, and assessed its effects on EBOV replication. We found that CoPP treatment, pre- and postinfection, significantly suppressed EBOV replication in a manner dependent upon HO-1 upregulation and activity. In addition, stable overexpression of HO-1 significantly attenuated EBOV growth. Although the exact mechanism behind the antiviral properties of HO-1 remains to be elucidated, our data show that HO-1 upregulation does not attenuate EBOV entry or budding but specifically targets EBOV transcription/replication. Therefore, modulation of the cellular enzyme HO-1 may represent a novel therapeutic strategy against EBOV infection.

  5. Heme oxygenase-1 comes back to endoplasmic reticulum

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hong Pyo [School of Biological Sciences, Ulsan University (Korea, Republic of); Pae, Hyun-Ock [Department of Immunology, Wonkwang University School of Medicine (Korea, Republic of); Back, Sung Hun; Chung, Su Wol [School of Biological Sciences, Ulsan University (Korea, Republic of); Woo, Je Moon [Department of Opthalmology, Ulasn University Hospital (Korea, Republic of); Son, Yong [Department of Anesthesiology and Pain Medicine, Wonkwang University School of Medicine (Korea, Republic of); Chung, Hun-Taeg, E-mail: chung@ulsan.ac.kr [School of Biological Sciences, Ulsan University (Korea, Republic of)

    2011-01-07

    Research highlights: {yields} Although multiple compartmentalization of HO-1 has been documented, the functional implication of this enzyme at these subcellular organelles is only partially elucidated. {yields} HO-1 expression at ER is induced by a diverse set of conditions that cause ER stressors. {yields} CO may induce HO-1 expression in human ECs by activating Nrf2 through PERK phosphorylation in a positive-feedback manner. {yields} ER-residing HO-1 and its cytoprotective activity against ER stress is discussed. -- Abstract: Originally identified as a rate-limiting enzyme for heme catabolism, heme oxygenase-1 (HO-1) has expanded its roles in anti-inflammation, anti-apoptosis and anti-proliferation for the last decade. Regulation of protein activity by location is well appreciated. Even though multiple compartmentalization of HO-1 has been documented, the functional implication of this enzyme at these subcellular organelles is only partially elucidated. In this review we discuss the endoplasmic reticulum (ER)-residing HO-1 and its cytoprotective activity against ER stress.

  6. Increased Plasma Levels of Heme Oxygenase-1 in Human Brucellosis.

    Science.gov (United States)

    Chen, Zhe; Zhang, Yu-Xue; Fu, Dong-Wei; Gao, Qing-Feng; Ge, Feng-Xia; Liu, Wei-Hua

    2016-08-01

    Brucellosis is associated with inflammation and the oxidative stress response. Heme oxygenase-1 (HO-1) is a cytoprotective stress-responsive enzyme that has anti-inflammatory and anti-oxidant effects. Nevertheless, the role of HO-1 in human brucellosis has not yet been studied. The aim of this study was to examine the plasma levels of HO-1 in patients with brucellosis and to evaluate the ability of plasma HO-1 levels as an auxiliary diagnosis, a severity predictor, and a monitor for brucellosis treatments. A total of 75 patients with brucellosis were divided into the acute, subacute, chronic active, and chronic stable groups. An additional 20 volunteers were included as the healthy control group. The plasma HO-1 levels and other laboratory parameters were measured in all groups. Furthermore, the plasma levels of HO-1 in the acute group were compared before and after treatment. The plasma HO-1 levels were considerably increased in the acute (4.97 ± 3.55), subacute (4.98 ± 3.23), and chronic active groups (4.43 ± 3.00) with brucellosis compared to the healthy control group (1.03 ± 0.63) (p brucellosis (r = 0.707, p brucellosis status and may be used as a supplementary plasma marker for diagnosing brucellosis and monitoring its treatment.

  7. Heme Oxygenase-1 Induction by Carbon Monoxide Releasing Molecule-3 Suppresses Interleukin-1β-Mediated Neuroinflammation

    Directory of Open Access Journals (Sweden)

    Chih-Chung Lin

    2017-11-01

    Full Text Available Neurodegenerative disorders and brain damage are initiated by excessive production of reactive oxygen species (ROS, which leads to tissue injury, cellular death and inflammation. In cellular anti-oxidant systems, heme oxygenase-1 (HO-1 is an oxidative-sensor protein induced by ROS generation or carbon monoxide (CO release. CO releasing molecules (CORMs, including CORM-3, exert anti-oxidant and anti-inflammatory effects. However, the molecular mechanisms of CORM-3-induced HO-1 expression and protection against interleukin (IL-1β-induced inflammatory responses have not been fully elucidated in rat brain astrocytes (RBA-1. To study the regulation of CORM-3-induced HO-1 expression, signaling pathways, promoter activity, mRNA and protein expression were assessed following treatment with pharmacological inhibitors and gene-specific siRNA knockdown. We found that CORM-3 mediated HO-1 induction via transcritional and translational processes. Furthermore, CORM-3-induced HO-1 expression was mediated by phosphorylation of several protein kinases, such as c-Src, Pyk2, protein kinase Cα (PKCα and p42/p44 mitogen-activated protein kinase (MAPK, which were inhibited by respective pharmacological inhibitors or by gene-specific knockdown with siRNA transfections. Next, we found that CORM-3 sequentially activated the c-Src/Pyk2/PKCα/p42/p44 MAPK pathway, thereby up-regulating mRNA for the activator protein (AP-1 components c-Jun and c-Fos; these effects were attenuated by an AP-1 inhibitor (Tanshinone IIA; TSIIA and other relevant inhibitors. Moreover, CORM-3-induced upregulation of HO-1 attenuated the IL-1β-induced cell migration and matrix metallopeptidase-9 mRNA expression in RBA-1 cells. These effects were reversed by an matrix metalloproteinase (MMP2/9 inhibitor or by transfection with HO-1 siRNA.

  8. Therapeutic Roles of Heme Oxygenase-1 in Metabolic Diseases: Curcumin and Resveratrol Analogues as Possible Inducers of Heme Oxygenase-1

    Directory of Open Access Journals (Sweden)

    Yong Son

    2013-01-01

    Full Text Available Metabolic diseases, such as insulin resistance, type II diabetes, and obesity, are associated with a low-grade chronic inflammation (inflammatory stress, oxidative stress, and endoplasmic reticulum (ER stress. Because the integration of these stresses is critical to the pathogenesis of metabolic diseases, agents and cellular molecules that can modulate these stress responses are emerging as potential targets for intervention and treatment of metabolic diseases. It has been recognized that heme oxygenase-1 (HO-1 plays an important role in cellular protection. Because HO-1 can reduce inflammatory stress, oxidative stress, and ER stress, in part by exerting antioxidant, anti-inflammatory, and antiapoptotic effects, HO-1 has been suggested to play important roles in pathogenesis of metabolic diseases. In the present review, we will explore our current understanding of the protective mechanisms of HO-1 in metabolic diseases and present some emerging therapeutic options for HO-1 expression in treating metabolic diseases, together with the therapeutic potential of curcumin and resveratrol analogues that have their ability to induce HO-1 expression.

  9. Interaction of nitric oxide with human heme oxygenase-1.

    Science.gov (United States)

    Wang, Jinling; Lu, Shen; Moënne-Loccoz, Pierre; Ortiz de Montellano, Paul R

    2003-01-24

    NO and CO may complement each other as signaling molecules in some physiological situations. We have examined the binding of NO to human heme oxygenase-1 (hHO-1), an enzyme that oxidizes heme to biliverdin, CO, and free iron, to determine whether inhibition of hHO-1 by NO can contribute to the signaling interplay of NO and CO. An Fe(3+)-NO hHO-1-heme complex is formed with NO or the NO donors NOC9 or 2-(N,N-diethylamino)-diazenolate-2-oxide.sodium salt. Resonance Raman spectroscopy shows that ferric hHO-1-heme forms a 6-coordinated, low spin complex with NO. The nu(N-O) vibration of this complex detected by Fourier transform IR is only 4 cm(-1) lower than that of the corresponding metmyoglobin (met-Mb) complex but is broader, suggesting a greater degree of ligand conformational freedom. The Fe(3+)-NO complex of hHO-1 is much more stable than that of met-Mb. Stopped-flow studies indicate that k(on) for formation of the hHO-1-heme Fe(3+)-NO complex is approximately 50-times faster, and k(off) 10 times slower, than for met-Mb, resulting in K(d) = 1.4 microm for NO. NO thus binds 500-fold more tightly to ferric hHO-1-heme than to met-Mb. The hHO-1 mutations E29A, G139A, D140A, S142A, G143A, G143F, and K179A/R183A do not significantly diminish the tight binding of NO, indicating that NO binding is not highly sensitive to mutations of residues that normally stabilize the distal water ligand. As expected from the K(d) value, the enzyme is reversibly inhibited upon exposure to pathologically, and possibly physiologically, relevant concentrations of NO. Inhibition of hHO-1 by NO may contribute to the pleiotropic responses to NO and CO.

  10. Effect of heme oxygenase-1 on radiation-induced skin injury

    International Nuclear Information System (INIS)

    Song Chuanjun; Meng Xingjun; Xie Ling; Chen Qing; Zhou Jundong; Zhang Shuyu; Wu Jinchang

    2012-01-01

    Objective: To investigate the effect of heme oxygenase-1 (HO-1) on the acute radiation-induced skin injury by gene transfer. Methods: Thirty-three male SD rats were randomly divided into three groups as PBS-injected group, Ad-EGFP-injected group and Ad-HO-1-injected group (n=11). In each group, three rats were used for determining the expression of target gene and the other rats were irradiated on the buttock skin with 40 Gy electron beam generated by a linear accelerator. Immediately after irradiation, rats were administered with a subcutaneous injection of PBS, Ad-EGFP or Ad-HO-1, respectively. Subsequently, the skin reactions were measured twice a week using the semi-quantitative skin injury scale. Results: The strong positive expression of HO-1 was observed in subcutaneous dermal tissue after injection of Ad-HO-1. Compared to the PBS-injected group or the Ad-EGFP-injected group, a significant mitigation of skin injury was observed in Ad-HO-1-injected mice 14 d after irradiation (q=0.000-0.030, P<0.05). Conclusions: HO-1 could significantly mitigate radiation-induced acute skin injury and Ad-HO-1 could be used to treat radiation-induced skin injury. (authors)

  11. Heme oxygenase-1 (HO-1) inhibits postmyocardial infarct remodeling and restores ventricular function.

    Science.gov (United States)

    Liu, Xiaoli; Pachori, Alok S; Ward, Christopher A; Davis, J Paul; Gnecchi, Massimiliano; Kong, Deling; Zhang, Lunan; Murduck, Jared; Yet, Shaw-Fang; Perrella, Mark A; Pratt, Richard E; Dzau, Victor J; Melo, Luis G

    2006-02-01

    We reported previously that predelivery of the anti-oxidant gene heme oxygenase-1 (HO-1) to the heart by adeno associated virus (AAV) markedly reduces injury after acute myocardial infarction (MI). However, the effect of HO-1 gene delivery on postinfarction recovery has not been investigated. In the current study, we assessed the effect of HO-1 gene delivery on post-MI left ventricle (LV) remodeling and function using echocardiographic imaging and histomorphometric approaches. Two groups of Sprague-Dawley rats were injected with 4 x 10(11) particles of AAV-LacZ (control) or AAV-hHO-1 in the LV wall. Eight wk after gene transfer, the animals were subjected to 30 min of ischemia by ligation of left anterior descending artery (LAD) followed by reperfusion. Echocardiographic measurements were obtained in a blinded fashion prior and at 1.5 and 3 months after I/R. Ejection fraction (EF) was reduced by 13% and 40% in the HO-1 and LacZ groups, respectively at 1.5 months after MI. Three months after MI, EF recovered fully in the HO-1, but only partially in the LacZ-treated animals. Post-MI LV dimensions were markedly increased and the anterior wall was markedly thinned in the LacZ-treated animals compared with the HO-1-treated animals. Significant myocardial scarring and fibrosis were observed in the LacZ-group in association with elevated levels of interstitial collagen I and III and MMP-2 activity. Post-MI myofibroblast accumulation was reduced in the HO-1-treated animals, and retroviral overexpression of HO-1 reduced proliferation of isolated cardiac fibroblasts. Our data indicate that rAAV-HO-1 gene transfer markedly reduces fibrosis and ventricular remodeling and restores LV function and chamber dimensions after myocardial infarction.

  12. Heme oxygenase-1 prevents non-alcoholic steatohepatitis through suppressing hepatocyte apoptosis in mice

    Directory of Open Access Journals (Sweden)

    Fu Na

    2010-10-01

    Full Text Available Abstract Objective Heme oxygenase-1 (HO-1, the rate-limiting enzyme in heme catabolism, has been reported to have potential antioxidant properties. However, the role of HO-1 on hepatocyte apoptosis remains unclear. We aim to elucidate the effects of HO-1 on oxidative stress related hepatocellular apoptosis in nutritional steatohepatitis in mice. Methods C57BL/6J mice were fed with methionine-choline deficient (MCD diet for four weeks to induce hepatic steatohepatitis. HO-1 chemical inducer (hemin, HO-1 chemical inhibitor zinc protoporphyrin IX (ZnPP-IX and/or adenovirus carrying HO-1 gene (Ad-HO-1 were administered to mice, respectively. Hepatocyte apoptosis was evaluated by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL assay, the mRNA and protein expression of apoptosis related genes were assayed by quantitative real-time PCR and Western blot. Results Hepatocyte signs of oxidative related apoptotic injury were presented in mice fed with MCD diet for 4 weeks. Induction of HO-1 by hemin or Ad-HO-1 significantly attenuated the severity of liver histology, which was associated with decreased hepatic lipid peroxidation content, reduced number of apoptotic cells by TUNEL staining, down-regulated expression of pro-apoptosis related genes including Fas/FasL, Bax, caspase-3 and caspase-9, reduced expression of cytochrome p4502E1 (CYP2E1, inhibited cytochrome c (Cyt-c release, and up-regulated expression of anti-apoptosis gene Bcl-2. Whereas, inhibition of HO-1 by ZnPP-IX caused oxidative stress related hepatic injury, which concomitant with increased number of TUNEL positive cells and up-regulated expression of pro-apoptosis related genes. Conclusions The present study provided evidences for the protective role of HO-1 in preventing nutritional steatohepatitis through suppressing hepatocyte apoptosis in mice.

  13. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Food and Drug Administration, Silver Spring, MD (United States)

    2017-03-15

    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  14. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    International Nuclear Information System (INIS)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash

    2017-01-01

    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  15. Fructose during pregnancy provokes fetal oxidative stress: The key role of the placental heme oxygenase-1.

    Science.gov (United States)

    Rodrigo, Silvia; Rodríguez, Lourdes; Otero, Paola; Panadero, María I; García, Antonia; Barbas, Coral; Roglans, Núria; Ramos, Sonia; Goya, Luis; Laguna, Juan C; Álvarez-Millán, Juan J; Bocos, Carlos

    2016-12-01

    One of the features of metabolic syndrome caused by liquid fructose intake is an impairment of redox status. We have investigated whether maternal fructose ingestion modifies the redox status in pregnant rats and their fetuses. Fructose (10% wt/vol) in the drinking water of rats throughout gestation, leads to maternal hepatic oxidative stress. However, this change was also observed in glucose-fed rats and, in fact, both carbohydrates produced a decrease in antioxidant enzyme activity. Surprisingly, mothers fed carbohydrates displayed low plasma lipid oxidation. In contrast, fetuses from fructose-fed mothers showed elevated levels of plasma lipoperoxides versus fetuses from control or glucose-fed mothers. Interestingly, a clearly augmented oxidative stress was observed in placenta of fructose-fed mothers, accompanied by a lower expression of the transcription factor Nuclear factor-erythroid 2-related factor-2 (Nrf2) and its target gene, heme oxygenase-1 (HO-1), a potent antioxidant molecule. Moreover, histone deacetylase 3 (HDAC3) that has been proposed to upregulate HO-1 expression by stabilizing Nrf2, exhibited a diminished expression in placenta of fructose-supplemented mothers. Maternal fructose intake provoked an imbalanced redox status in placenta and a clear diminution of HO-1 expression, which could be responsible for the augmented oxidative stress found in their fetuses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Critical role of heme oxygenase-1 in Foxp3-mediated immune suppression

    International Nuclear Information System (INIS)

    Choi, Byung-Min; Pae, Hyun-Ock; Jeong, Young-Ran; Kim, Young-Myeong; Chung, Hun-Taeg

    2005-01-01

    Foxp3, which encodes the transcription factor scurfin, is indispensable for the development and function of CD4 + CD25 + regulatory T cells (Treg). Recent data suggest conversion of peripheral CD4 + CD25 - naive T cells to CD4 + CD25 + Treg by acquisition of Foxp3 through costimulation with TCR and TGF-β or forced expression of the gene. One critical question is how Foxp3 causes T cells to become regulatory. In the present work, we demonstrate that Foxp3 can induce heme oxygenase-1 (HO-1) expression and subsequently such regulatory phenotypes as the suppression of nontransfected cells in a cell-cell contact-dependent manner as well as impaired proliferation and production of cytokines upon stimulation in Jurkat T cells. Moreover, we confirm the expression of both Foxp3 and HO-1 in peripheral CD4 + CD25 + Treg and suppressive function of the cells are relieved by the inhibition of HO-1 activity. In summary, we demonstrate that Foxp3 induces HO-1 expression and HO-1 engages in Foxp3-mediated immune suppression

  17. Hormonal fluctuations during the estrous cycle modulate Heme Oxygenase-1 expression in the uterus

    Directory of Open Access Journals (Sweden)

    Maria Laura Zenclussen

    2014-03-01

    Full Text Available Deletion of the Heme Oxygenase-1 (Hmox1 locus in mice results in intrauterine lethality. The expression of the heme catabolyzing enzyme encoded by this gene, namely HO 1, is required to successfully support reproductive events. We have previously observed that HO-1 acts at several key events in reproduction ensuring pregnancy. HO-1 defines ovulation, positively influences implantation and placentation and ensures fetal growth and survival. Here, we embarked on a study aimed to determine whether hormonal changes during the estrous cycle in the mouse define HO-1 expression, thus influencing receptivity. We analyzed the serum levels of progesterone and estrogen by ELISA and HO-1 mRNA expression in uterus by real time RT-PCR at the metestrus, proestrus, estrus and diestrus phases of the estrous cycle. Further, we studied the HO-1 protein expression by Western Blot upon hormone addition to cultured uterine AN3 cells. We observed that HO-1 variations in uterine tissue correlated to changes in hormonal levels at different phases of the estrus cycle. In vitro, HO-1 protein levels in AN3 cells augmented after the addition of physiological concentrations of progesterone and estradiol, which confirmed our in vivo observations. Our data suggest an important role for hormones in HO-1 regulation in uterus that has a significant impact in receptivity and later on blastocyst implantation.

  18. Characterization of Nrf2 activation and heme oxygenase-1 expression in NIH3T3 cells exposed to aqueous extracts of cigarette smoke.

    Science.gov (United States)

    Knörr-Wittmann, Constanze; Hengstermann, Arnd; Gebel, Stephan; Alam, Jawed; Müller, Thomas

    2005-12-01

    Cigarette smoke (CS) is a complex chemical mixture estimated to be composed of up to 5000 different chemicals, many of which are prooxidant. Here we show that, at least in vitro, the cellular response designed to combat oxidative stress resulting from CS exposure is primarily controlled by the transcription factor Nrf2, a principal inducer of antioxidant and phase II-related genes. The prominent role of Nrf2 in the cellular response to CS is substantiated by the following observations: In NIH3T3 cells exposed to aqueous extracts of CS (i) Nrf2 is strongly stabilized and becomes detectable in nuclear extracts. (ii) Nuclear localization of Nrf2 coincides with increased DNA binding of a putative Nrf2/MafK heterodimer to its cognate cis-regulatory site, i.e., the antioxidant-responsive element (ARE). (iii) Studies on the regulatory elements of the oxidative stress-inducible gene heme oxygenase-1 (hmox1) using various hmox1 promoter/luciferase reporter constructs revealed that the strong CS-dependent expression of this gene is primarily governed by the distal enhancers 1 ("E1") and 2 ("E2"), which both contain three canonical ARE-like stress-responsive elements (StREs). Notably, depletion of Nrf2 levels caused by RNA interference significantly compromised CS-induced hmox1 promoter activation, based on the distinct Nrf2 sensitivity exhibited by E1 and E2. Finally, (iv) siRNA-dependent knock-down of Nrf2 completely abrogated CS-induced expression of phase II-related genes. Taken together, these results confirm the outstanding role of Nrf2 both in sensing (oxidant) stress and in orchestrating an efficient transcriptional response aimed at resolving the stressing conditions.

  19. Iron depletion in HCT116 cells diminishes the upregulatory effect of phenethyl isothiocyanate on heme oxygenase-1

    International Nuclear Information System (INIS)

    Bolloskis, Michael P.; Carvalho, Fabiana P.; Loo, George

    2016-01-01

    Some of the health-promoting properties of cruciferous vegetables are thought to be partly attributed to isothiocyanates. These phytochemicals can upregulate the expression of certain cytoprotective stress genes, but it is unknown if a particular nutrient is involved. Herein, the objective was to ascertain if adequate iron is needed for enabling HCT116 cells to optimally express heme oxygenase-1 (HO-1) when induced by phenethyl isothiocyanate (PEITC). PEITC increased HO-1 expression and also nuclear translocation of Nrf2, which is a transcription factor known to activate the HO-1 gene. However, in HCT116 cells that were made iron-deficient by depleting intracellular iron with deferoxamine (DFO), PEITC was less able to increase HO-1 expression and nuclear translocation of Nrf2. These suppressive effects of DFO were overcome by replenishing the iron-deficient cells with the missing iron. To elucidate these findings, it was found that PEITC-induced HO-1 upregulation can be inhibited with thiol antioxidants (glutathione and N-acetylcysteine). Furthermore, NADPH oxidase inhibitors (diphenyleneiodonium and apocynin) and a superoxide scavenger (Tiron) each inhibited PEITC-induced HO-1 upregulation. In doing so, diphenyleneiodonium was the most potent and also inhibited nuclear translocation of redox-sensitive Nrf2. Collectively, the results imply that the HO-1 upregulation by PEITC involves an iron-dependent, oxidant signaling pathway. Therefore, it is concluded that ample iron is required to enable PEITC to fully upregulate HO-1 expression in HCT116 cells. As such, it is conceivable that iron-deficient individuals may not reap the full health benefits of eating PEITC-containing cruciferous vegetables that via HO-1 may help protect against multiple chronic diseases. - Highlights: • PEITC increased HO-1 expression in HCT116 cells. • PEITC-induced HO-1 upregulation was impaired in iron-depleted HCT116 cells. • Impairment of PEITC-induced HO-1 upregulation was

  20. Galantamine and carbon monoxide protect brain microvascular endothelial cells by heme oxygenase-1 induction

    International Nuclear Information System (INIS)

    Nakao, Atsunori; Kaczorowski, David J.; Zuckerbraun, Brian S.; Lei Jing; Faleo, Gaetano; Deguchi, Kentaro; McCurry, Kenneth R.; Billiar, Timothy R.; Kanno, Shinichi

    2008-01-01

    Galantamine, a reversible inhibitor of acetylcholine esterase (AChE), is a novel drug treatment for mild to moderate Alzheimer's disease and vascular dementia. Interestingly, it has been suggested that galantamine treatment is associated with more clinical benefit in patients with mild-to-moderate Alzheimer disease compared to other AChE inhibitors. We hypothesized that the protective effects of galantamine would involve induction of the protective gene, heme oxygenase-1 (HO-1), in addition to enhancement of the cholinergic system. Brain microvascular endothelial cells (mvECs) were isolated from spontaneous hypertensive rats. Galantamine significantly reduced H 2 O 2 -induced cell death of mvECs in association with HO-1 induction. These protective effects were completely reversed by nuclear factor-κB (NF-κB) inhibition or HO inhibition. Furthermore, galantamine failed to induce HO-1 in mvECs which lack inducible nitric oxide synthase (iNOS), supplementation of a nitric oxide (NO) donor or iNOS gene transfection on iNOS-deficient mvECs resulted in HO-1 induction with galantamine. These data suggest that the protective effects of galantamine require NF-κB activation and iNOS expression, in addition to HO-1. Likewise, carbon monoxide (CO), one of the byproducts of HO, up-regulated HO-1 and protected mvECs from oxidative stress in a similar manner. Our data demonstrate that galantamine mediates cytoprotective effects on mvECs through induction HO-1. This pharmacological action of galantamine may, at least in part, account for the superior clinical efficacy of galantamine in vascular dementia and Alzheimer disease

  1. Upregulation of endothelial heme oxygenase-1 expression through the activation of the JNK pathway by sublethal concentrations of acrolein.

    Science.gov (United States)

    Wu, C C; Hsieh, C W; Lai, P H; Lin, J B; Liu, Y C; Wung, B S

    2006-08-01

    Acrolein is a highly electrophilic alpha,beta-unsaturated aldehyde that is present in cigarette smoke. Heme oxygenase-1 (HO-1) is a cytoprotective enzyme activated by various such electrophilic compounds. In this study, the regulatory effects of acrolein upon the expression of HO-1 were investigated in endothelial cells (ECs). We demonstrate that acrolein induces the elevation of HO-1 protein levels, and subsequent enzyme activity, at non-cytotoxic concentrations. An additional alpha,beta-unsaturated aldehyde, cinnamaldehyde, was also found to increase HO-1 expression and have less cytotoxicity than acrolein. Moreover, acrolein-mediated HO-1 induction is abrogated in the presence of actinomycin D and cycloheximide. Nrf2 is a transcription factor involved in the induction of HO-1 through an antioxidant response element (ARE) in the promoter region of the HO-1 gene. We show that acrolein induces Nrf2 translocation and ARE-luciferase reporter activity. Acrolein was also found to induce the production of both superoxide and H2O2 at levels greater than 100 microM. However, with the exception of NAC, no antioxidant generated any effect upon acrolein-dependent HO-1 expression in ECs. Our present findings suggest that reactive oxygen species (ROS) may not be a major modulator for HO-1 induction. Using buthionine sulfoximine to deplete the intracellular GSH levels further enhanced the effects of acrolein. We also found that cellular GSH level was rapidly reduced after both 10 and 100 microM acrolein treatment. However, after 6 h of exposure to ECs, only 10 microM acrolein treatment increases GSH level. In addition, only the JNK inhibitor SP600125 and tyrosine kinase inhibitor genistein had any significant inhibitory impact upon the upregulation of HO-1 by acrolein. Pretreatment with a range of other PI3 kinase inhibitors, including wortmannin and LY294002, showed no effects. Hence, we show in our current experiments that a sublethal concentration of acrolein is in fact a

  2. Upregulation of endothelial heme oxygenase-1 expression through the activation of the JNK pathway by sublethal concentrations of acrolein

    International Nuclear Information System (INIS)

    Wu, C.C.; Hsieh, C.W.; Lai, P.H.; Lin, J.B.; Liu, Y.C.; Wung, B.S.

    2006-01-01

    Acrolein is a highly electrophilic α,β-unsaturated aldehyde that is present in cigarette smoke. Heme oxygenase-1 (HO-1) is a cytoprotective enzyme activated by various such electrophilic compounds. In this study, the regulatory effects of acrolein upon the expression of HO-1 were investigated in endothelial cells (ECs). We demonstrate that acrolein induces the elevation of HO-1 protein levels, and subsequent enzyme activity, at non-cytotoxic concentrations. An additional α,β-unsaturated aldehyde, cinnamaldehyde, was also found to increase HO-1 expression and have less cytotoxicity than acrolein. Moreover, acrolein-mediated HO-1 induction is abrogated in the presence of actinomycin D and cycloheximide. Nrf2 is a transcription factor involved in the induction of HO-1 through an antioxidant response element (ARE) in the promoter region of the HO-1 gene. We show that acrolein induces Nrf2 translocation and ARE-luciferase reporter activity. Acrolein was also found to induce the production of both superoxide and H 2 O 2 at levels greater than 100 μM. However, with the exception of NAC, no antioxidant generated any effect upon acrolein-dependent HO-1 expression in ECs. Our present findings suggest that reactive oxygen species (ROS) may not be a major modulator for HO-1 induction. Using buthionine sulfoximine to deplete the intracellular GSH levels further enhanced the effects of acrolein. We also found that cellular GSH level was rapidly reduced after both 10 and 100 μM acrolein treatment. However, after 6 h of exposure to ECs, only 10 μM acrolein treatment increases GSH level. In addition, only the JNK inhibitor SP600125 and tyrosine kinase inhibitor genistein had any significant inhibitory impact upon the upregulation of HO-1 by acrolein. Pretreatment with a range of other PI3 kinase inhibitors, including wortmannin and LY294002, showed no effects. Hence, we show in our current experiments that a sublethal concentration of acrolein is in fact a novel HO-1 inducer

  3. Methane-rich water induces cucumber adventitious rooting through heme oxygenase1/carbon monoxide and Ca(2+) pathways.

    Science.gov (United States)

    Cui, Weiti; Qi, Fang; Zhang, Yihua; Cao, Hong; Zhang, Jing; Wang, Ren; Shen, Wenbiao

    2015-03-01

    Methane-rich water triggered adventitious rooting by regulating heme oxygenase1/carbon monoxide and calcium pathways in cucumber explants. Heme oxygenase1/carbon monoxide (HO1/CO) and calcium (Ca(2+)) were reported as the downstream signals in auxin-induced cucumber adventitious root (AR) formation. Here, we observed that application of methane-rich water (MRW; 80% saturation) obviously induced AR formation in IAA-depleted cucumber explants. To address the universality, we checked adventitious rooting in soybean and mung bean explants, and found that MRW (50 and 10% saturation, respectively) exhibited the similar inducing results. To further determine if the HO1/CO system participated in MRW-induced adventitious rooting, MRW, HO1 inducer hemin, its activity inhibitor zinc protoporphyrin IX (ZnPP), and its catalytic by-products CO, bilirubin, and Fe(2+) were used to detect their effects on cucumber adventitious rooting in IAA-depleted explants. Subsequent results showed that MRW-induced adventitious rooting was blocked by ZnPP and further reversed by 20% saturation CO aqueous solution. However, the other two by-products of HO1, bilirubin and Fe(2+), failed to induce AR formation. Above responses were consistent with the MRW-induced increases of HO1 transcript and corresponding protein level. Further molecular evidence indicted that expression of marker genes, including auxin signaling-related genes and cell cycle regulatory genes, were modulated by MRW alone but blocked by the cotreatment with ZnPP, the latter of which could be significantly rescued by the addition of CO. By using the Ca(2+)-channel blocker and Ca(2+) chelator, the involvement of Ca(2+) pathway in MRW-induced adventitious rooting was also suggested. Together, our results indicate that MRW might serve as a stimulator of adventitious rooting, which was partially mediated by HO1/CO and Ca(2+) pathways.

  4. Genetic analyses of heme oxygenase 1 (HMOX1 in different forms of pancreatitis.

    Directory of Open Access Journals (Sweden)

    Sebastian Weis

    Full Text Available Heme oxygenase 1 (HMOX1 is the rate limiting enzyme in heme degradation and a key regulator of inflammatory processes. In animal models the course of pancreatitis was ameliorated by up-regulation of HMOX1 expression. Additionally, carbon monoxide released during heme breakdown inhibited proliferation of pancreatic stellate cells and might thereby prevent the development of chronic pancreatitis (CP. Transcription of HMOX1 in humans is influenced by a GT-repeat located in the promoter. As such, HMOX1 variants might be of importance in the pathogenesis of pancreatitis.The GT-repeat and SNP rs2071746 were investigated with fluorescence labelled primers and by melting curve analysis in 285 patients with acute pancreatitis, 208 patients with alcoholic CP, 207 patients with idiopathic/hereditary CP, 147 patients with alcoholic liver cirrhosis, and in 289 controls, respectively. GT-repeat analysis was extended to a total of 446 alcoholic CP patients. In addition, we performed DNA sequencing in 145 patients with alcoholic CP, 138 patients with idiopathic/hereditary CP, 147 patients with alcoholic liver cirrhosis, and 151 controls. Exon 3 screening was extended to additional patients and controls.S- and L-alleles of the GT-repeat, genotypes and alleles of SNP rs2071746 and non-synonymous variants detected by sequencing were found with similar frequencies in all groups.Although functional data implicate a potential influence of HMOX1 variants on the pathogenesis of pancreatitis, we did not find any association. As rare non-synonymous HMOX1 variants were found in patients and controls, it is rather unlikely that they will have functional consequences essential for pancreatitis development.

  5. Heme oxygenase-1: A new druggable target in the management of chronic and acute myeloid leukemia.

    Science.gov (United States)

    Salerno, Loredana; Romeo, Giuseppe; Modica, Maria N; Amata, Emanuele; Sorrenti, Valeria; Barbagallo, Ignazio; Pittalà, Valeria

    2017-12-15

    Heme oxygenase-1 (HO-1) is the enzyme catalyzing the rate-limiting oxidative degradation of cellular heme into free iron, carbon monoxide (CO), and biliverdin, which is then rapidly converted into bilirubin. By means of these catabolic end-products and by removal of pro-oxidant heme, HO-1 exerts antioxidant, antiapoptotic, and immune-modulating effects, leading to overall cytoprotective and beneficial functions in mammalian cells. Therefore, HO-1 is considered a survival molecule in various stress-related conditions. By contrast, growing evidence suggests that HO-1 is a survival-enhancing molecule also in various solid and blood cancers, such as various types of leukemia, promoting carcinogenesis, tumor progression, and chemo-resistance. Among leukemias, chronic myeloid leukemia (CML) is currently therapeutically well treated with tyrosine kinase inhibitors (TKIs) such as Imatinib (IM) and its congeners; nevertheless, resistance to all kinds of current drugs persist in a number of patients. Moreover, treatment outcomes for acute myeloid leukemia (AML) remain unsatisfactory, despite progress in chemotherapy and hematopoietic stem cell transplantation. Therefore, identification of new eligible targets that may improve leukemias therapy is of general interest. Several recent papers prove that inhibition of HO-1 through HO-1 inhibitors as well as modulation of other pathways involving HO-1 by a number of different new or known molecules, are critical for leukemia treatment. This review summarizes the current understanding of the pro-tumorigenic role of HO-1 and its potential as a molecular target for the treatment of leukemias. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Orthodontic Forces Induce the Cytoprotective Enzyme Heme Oxygenase-1 in Rats

    Science.gov (United States)

    Suttorp, Christiaan M.; Xie, Rui; Lundvig, Ditte M. S.; Kuijpers-Jagtman, Anne Marie; Uijttenboogaart, Jasper Tom; Van Rheden, René; Maltha, Jaap C.; Wagener, Frank A. D. T. G.

    2016-01-01

    Orthodontic forces disturb the microenvironment of the periodontal ligament (PDL), and induce craniofacial bone remodeling which is necessary for tooth movement. Unfortunately, orthodontic tooth movement is often hampered by ischemic injury and cell death within the PDL (hyalinization) and root resorption. Large inter-individual differences in hyalinization and root resorption have been observed, and may be explained by differential protection against hyalinization. Heme oxygenase-1 (HO-1) forms an important protective mechanism by breaking down heme into the strong anti-oxidants biliverdin/bilirubin and the signaling molecule carbon monoxide. These versatile HO-1 products protect against ischemic and inflammatory injury. We postulate that orthodontic forces induce HO-1 expression in the PDL during experimental tooth movement. Twenty-five 6-week-old male Wistar rats were used in this study. The upper three molars at one side were moved mesially using a Nickel-Titanium coil spring, providing a continuous orthodontic force of 10 cN. The contralateral side served as control. After 6, 12, 72, 96, and 120 h groups of rats were killed. On parasagittal sections immunohistochemical staining was performed for analysis of HO-1 expression and quantification of osteoclasts. Orthodontic force induced a significant time-dependent HO-1 expression in mononuclear cells within the PDL at both the apposition- and resorption side. Shortly after placement of the orthodontic appliance HO-1 expression was highly induced in PDL cells but dropped to control levels within 72 h. Some osteoclasts were also HO-1 positive but this induction was shown to be independent of time- and mechanical stress. It is tempting to speculate that differential induction of tissue protecting- and osteoclast activating genes in the PDL determine the level of bone resorption and hyalinization and, subsequently, “fast” and “slow” tooth movers during orthodontic treatment. PMID:27486402

  7. Pharmacological Induction of Heme Oxygenase-1 Impairs Nuclear Accumulation of Herpes Simplex Virus Capsids upon Infection

    Directory of Open Access Journals (Sweden)

    Francisco J. Ibáñez

    2017-10-01

    Full Text Available Heme oxygenase-1 (HO-1 is an inducible enzyme that is expressed in response to physical and chemical stresses, such as ultraviolet radiation, hyperthermia, hypoxia, reactive oxygen species (ROS, as well as cytokines, among others. Its activity can be positively modulated by cobalt protoporphyrin (CoPP and negatively by tin protoporphirin (SnPP. Once induced, HO-1 degrades iron-containing heme into ferrous iron (Fe2+, carbon monoxide (CO and biliverdin. Importantly, numerous products of HO-1 are cytoprotective with anti-apoptotic, anti-oxidant, anti-inflammatory, and anti-cancer effects. The products of HO-1 also display antiviral properties against several viruses, such as the human immunodeficiency virus (HIV, influenza, hepatitis B, hepatitis C, and Ebola virus. Here, we sought to assess the effect of modulating HO-1 activity over herpes simplex virus type 2 (HSV-2 infection in epithelial cells and neurons. There are no vaccines against HSV-2 and treatment options are scarce in the immunosuppressed, in which drug-resistant variants emerge. By using HSV strains that encode structural and non-structural forms of the green fluorescent protein (GFP, we found that pharmacological induction of HO-1 activity with CoPP significantly decreases virus plaque formation and the expression of virus-encoded genes in epithelial cells as determined by flow cytometry and western blot assays. CoPP treatment did not affect virus binding to the cell surface or entry into the cytoplasm, but rather downstream events in the virus infection cycle. Furthermore, we observed that treating cells with a CO-releasing molecule (CORM-2 recapitulated some of the anti-HSV effects elicited by CoPP. Taken together, these findings indicate that HO-1 activity interferes with the replication cycle of HSV and that its antiviral effects can be recapitulated by CO.

  8. Heme oxygenase-1 regulates the progression of K/BxN serum transfer arthritis.

    Directory of Open Access Journals (Sweden)

    Rita Brines

    Full Text Available Heme oxygenase-1 (HO-1 is induced in many cell types as a defense mechanism against stress. We have investigated the possible role of endogenous HO-1 in the effector phase of arthritis using the K/BxN serum transfer model of arthritis in HO-1 heterozygous and homozygous knock-out mice.Arthritis was induced in C57/Black-6 xFVB (HO-1(+/+, HO-1(+/- and HO-1(-/- mice by intraperitoneal injection of 150 µl serum from arthritic K/BxN mice at days 0 and 2. Blood was collected and animals were sacrificed at day 10. Histological analysis was performed in ankle sections. The levels of inflammatory mediators were measured in serum and paw homogenates by enzyme-linked immunosorbent assay or Multiplex technology. The incidence of arthritis was higher in HO-1(+/- and HO-1(-/- groups compared with HO-1(+/+. The inflammatory response was aggravated in HO-1(+/- mice as shown by arthritic score and the migration of inflammatory cells that could be related to the enhancement of CXCL-1 production. In addition, the HO-1(+/- group showed proteoglycan depletion significantly higher than HO-1(+/+ mice. Serum levels of matrix metalloproteinase-3, monocyte chemotactic protein-1, plasminogen activator inhibitor-1, E-selectin and intercellular adhesion molecule-1 were increased in arthritic HO-1(-/- mice, whereas vascular endothelial growth factor and some cytokines such as interferon-γ showed a reduction compared to HO-1(+/+ or HO-1(+/- mice. In addition, down-regulated gene expression of ferritin, glutathione S-reductase A1 and superoxide dismutase-2 was observed in the livers of arthritic HO-1(+/- animals.Endogenous HO-1 regulates the production of systemic and local inflammatory mediators and plays a protective role in K/BxN serum transfer arthritis.

  9. Orthodontic Forces Induce the Cytoprotective Enzyme Heme Oxygenase-1 in Rats.

    Science.gov (United States)

    Suttorp, Christiaan M; Xie, Rui; Lundvig, Ditte M S; Kuijpers-Jagtman, Anne Marie; Uijttenboogaart, Jasper Tom; Van Rheden, René; Maltha, Jaap C; Wagener, Frank A D T G

    2016-01-01

    Orthodontic forces disturb the microenvironment of the periodontal ligament (PDL), and induce craniofacial bone remodeling which is necessary for tooth movement. Unfortunately, orthodontic tooth movement is often hampered by ischemic injury and cell death within the PDL (hyalinization) and root resorption. Large inter-individual differences in hyalinization and root resorption have been observed, and may be explained by differential protection against hyalinization. Heme oxygenase-1 (HO-1) forms an important protective mechanism by breaking down heme into the strong anti-oxidants biliverdin/bilirubin and the signaling molecule carbon monoxide. These versatile HO-1 products protect against ischemic and inflammatory injury. We postulate that orthodontic forces induce HO-1 expression in the PDL during experimental tooth movement. Twenty-five 6-week-old male Wistar rats were used in this study. The upper three molars at one side were moved mesially using a Nickel-Titanium coil spring, providing a continuous orthodontic force of 10 cN. The contralateral side served as control. After 6, 12, 72, 96, and 120 h groups of rats were killed. On parasagittal sections immunohistochemical staining was performed for analysis of HO-1 expression and quantification of osteoclasts. Orthodontic force induced a significant time-dependent HO-1 expression in mononuclear cells within the PDL at both the apposition- and resorption side. Shortly after placement of the orthodontic appliance HO-1 expression was highly induced in PDL cells but dropped to control levels within 72 h. Some osteoclasts were also HO-1 positive but this induction was shown to be independent of time- and mechanical stress. It is tempting to speculate that differential induction of tissue protecting- and osteoclast activating genes in the PDL determine the level of bone resorption and hyalinization and, subsequently, "fast" and "slow" tooth movers during orthodontic treatment.

  10. In vitro studies on heme oxygenase-1 and P24 antigen HIV-1 level ...

    African Journals Online (AJOL)

    Background: Heme oxygenase-1 (HO-1) is a protein secreted by immune cells as a part of immune response mechanism.HO-1 can be induced by variety agents that causingoxidative stress, such as exposure to 100% oxygenat2,4 ATA pressure.It plays a vital role in maintaining cellular homeostasis.This study was ...

  11. Rapamycin Induces Heme Oxygenase-1 in Liver but Inhibits Bile Flow Recovery after Ischemia

    NARCIS (Netherlands)

    Kist, Alwine; Wakkie, Joris; Madu, Max; Versteeg, Ruth; ten Berge, Judith; Nikolic, Andrej; Nieuwenhuijs, Vincent B.; Porte, Robert J.; Padbury, Robert T. A.; Barritt, Greg J.

    Background/Aims. Rapamycin, which is employed in the management of patients undergoing liver surgery, induces the synthesis of heme oxygenase-1 (HO-1) in some non-liver cell types. The aim was to investigate whether rapamycin can induce HO-1 expression in the liver, and to test the effects of

  12. The haptoglobin-CD163-heme oxygenase-1 pathway for hemoglobin scavenging

    DEFF Research Database (Denmark)

    Thomsen, Jens Haugbølle; Etzerodt, Anders; Svendsen, Pia

    2013-01-01

    The haptoglobin- (Hp-) CD163-heme oxygenase-1 (HO-1) pathway is an efficient captor-receptor-enzyme system to circumvent the hemoglobin (Hb)/heme-induced toxicity during physiological and pathological hemolyses. In this pathway, Hb tightly binds to Hp leading to CD163-mediated uptake of the complex...

  13. Heme oxygenase-1 protects endothelial cells from the toxicity of air pollutant chemicals

    International Nuclear Information System (INIS)

    Lawal, Akeem O.; Zhang, Min; Dittmar, Michael; Lulla, Aaron; Araujo, Jesus A.

    2015-01-01

    Diesel exhaust particles (DEPs) are a major component of diesel emissions, responsible for a large portion of their toxicity. In this study, we examined the toxic effects of DEPs on endothelial cells and the role of DEP-induced heme oxygenase-1 (HO-1) expression. Human microvascular endothelial cells (HMECs) were treated with an organic extract of DEPs from an automobile engine (A-DEP) or a forklift engine (F-DEP) for 1 and 4 h. ROS generation, cell viability, lactate dehydrogenase leakage, expression of HO-1, inflammatory genes, cell adhesion molecules and unfolded protein respone (UPR) gene were assessed. HO-1 expression and/or activity were inhibited by siRNA or tin protoporphyrin (Sn PPIX) and enhanced by an expression plasmid or cobalt protoporphyrin (CoPPIX). Exposure to 25 μg/ml of A-DEP and F-DEP significantly induced ROS production, cellular toxicity and greater levels of inflammatory and cellular adhesion molecules but to a different degree. Inhibition of HO-1 enzymatic activity with SnPPIX and silencing of the HO-1 gene by siRNA enhanced DEP-induced ROS production, further decreased cell viability and increased expression of inflammatory and cell adhesion molecules. On the other hand, overexpression of the HO-1 gene by a pcDNA 3.1D/V5-HO-1 plasmid significantly mitigated ROS production, increased cell survival and decreased the expression of inflammatory genes. HO-1 expression protected HMECs from DEP-induced prooxidative and proinflammatory effects. Modulation of HO-1 expression could potentially serve as a therapeutic target in an attempt to inhibit the cardiovascular effects of ambient PM. - Highlights: • We examined the role of HO-1 expression on diesel exhaust particle (DEP) in endothelial cells. • DEPs exert cytotoxic and inflammatory effects on human microvascular endothelial cells (HMECs). • DEPs induce HO-1 expression in HMECs. • HO-1 protects against the oxidative stress induced by DEps. • HO-1 attenuates the proinflammatory effects

  14. Heme oxygenase-1 protects endothelial cells from the toxicity of air pollutant chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Lawal, Akeem O.; Zhang, Min; Dittmar, Michael [Division of Cardiology, David Geffen School of Medicine, University of California, Los Angeles, 10833 Le Conte Avenue, CHS 43-264, Los Angeles, CA 90095 (United States); Lulla, Aaron [Division of Cardiology, David Geffen School of Medicine, University of California, Los Angeles, 10833 Le Conte Avenue, CHS 43-264, Los Angeles, CA 90095 (United States); Molecular Toxicology Interdepartmental Program, University of California, Los Angeles (United States); Araujo, Jesus A., E-mail: JAraujo@mednet.ucla.edu [Division of Cardiology, David Geffen School of Medicine, University of California, Los Angeles, 10833 Le Conte Avenue, CHS 43-264, Los Angeles, CA 90095 (United States); Molecular Toxicology Interdepartmental Program, University of California, Los Angeles (United States); Molecular Biology Institute, University of California, Los Angeles (United States)

    2015-05-01

    Diesel exhaust particles (DEPs) are a major component of diesel emissions, responsible for a large portion of their toxicity. In this study, we examined the toxic effects of DEPs on endothelial cells and the role of DEP-induced heme oxygenase-1 (HO-1) expression. Human microvascular endothelial cells (HMECs) were treated with an organic extract of DEPs from an automobile engine (A-DEP) or a forklift engine (F-DEP) for 1 and 4 h. ROS generation, cell viability, lactate dehydrogenase leakage, expression of HO-1, inflammatory genes, cell adhesion molecules and unfolded protein respone (UPR) gene were assessed. HO-1 expression and/or activity were inhibited by siRNA or tin protoporphyrin (Sn PPIX) and enhanced by an expression plasmid or cobalt protoporphyrin (CoPPIX). Exposure to 25 μg/ml of A-DEP and F-DEP significantly induced ROS production, cellular toxicity and greater levels of inflammatory and cellular adhesion molecules but to a different degree. Inhibition of HO-1 enzymatic activity with SnPPIX and silencing of the HO-1 gene by siRNA enhanced DEP-induced ROS production, further decreased cell viability and increased expression of inflammatory and cell adhesion molecules. On the other hand, overexpression of the HO-1 gene by a pcDNA 3.1D/V5-HO-1 plasmid significantly mitigated ROS production, increased cell survival and decreased the expression of inflammatory genes. HO-1 expression protected HMECs from DEP-induced prooxidative and proinflammatory effects. Modulation of HO-1 expression could potentially serve as a therapeutic target in an attempt to inhibit the cardiovascular effects of ambient PM. - Highlights: • We examined the role of HO-1 expression on diesel exhaust particle (DEP) in endothelial cells. • DEPs exert cytotoxic and inflammatory effects on human microvascular endothelial cells (HMECs). • DEPs induce HO-1 expression in HMECs. • HO-1 protects against the oxidative stress induced by DEps. • HO-1 attenuates the proinflammatory effects

  15. Heme oxygenase-1 delays gibberellin-induced programmed cell death of rice aleurone layers subjected to drought stress by interacting with nitric oxide

    Directory of Open Access Journals (Sweden)

    Huangming eWu

    2016-01-01

    Full Text Available Cereal aleurone layers undergo a gibberellin (GA-regulated process of programmed cell death (PCD following germination. Heme oxygenase-1 (HO-1 is known as a rate-liming enzyme in the degradation of heme to biliverdin IXα (BV, carbon monoxide (CO, and free iron ions (Fe2+. It is a critical component in plant development and adaptation to environment stresses. Our previous studies confirmed that HO-1 inducer hematin (Ht promotes the germination of rice seeds in drought (20% polyethylene glycol-6000, PEG conditions, but the corresponding effects of HO-1 on the alleviation of germination-triggered PCD in GA-treated rice aleurone layers remain unknown. The present study has determined that GA co-treated with PEG results in lower HO-1 transcript levels and HO activity, which in turn results in the development of vacuoles in aleurone cells, followed by PCD. The pharmacology approach illustrated that up- or down-regulated HO-1 gene expression and HO activity delayed or accelerated GA-induced PCD. Furthermore, the application of the HO-1 inducer hematin and nitric oxide (NO donor sodium nitroprusside (SNP not only activated HO-1 gene expression, HO activity, and endogenous NO content, but also blocked GA-induced rapid vacuolation and accelerated aleurone layers PCD under drought stress. However, both HO-1 inhibitor zinc protoporphyrin IX (ZnPPIX and NO scavenger 2-(4-carboxyphenyl0-4, 4, 5, 5-tetramethylimidazoline-l-oxyl-3-oxide potassium salt (cPTIO reserved the effects of hematin and SNP on rice aleurone layer PCD under drought stress by down-regulating endogenous HO-1 and NO, respectively. The inducible effects of hematin and SNP on HO-1 gene expression, HO activity, and NO content were blocked by cPTIO. Together, these results clearly suggest that HO-1 is involved in the alleviation of GA-induced PCD of drought-triggered rice aleurone layers by associating with NO.

  16. Characterization of docosahexaenoic acid (DHA)-induced heme oxygenase-1 (HO-1) expression in human cancer cells: the importance of enhanced BTB and CNC homology 1 (Bach1) degradation.

    Science.gov (United States)

    Wang, Shuai; Hannafon, Bethany N; Wolf, Roman F; Zhou, Jundong; Avery, Jori E; Wu, Jinchang; Lind, Stuart E; Ding, Wei-Qun

    2014-05-01

    The effect of docosahexaenoic acid (DHA) on heme oxygenase-1 (HO-1) expression in cancer cells has never been characterized. This study examines DHA-induced HO-1 expression in human cancer cell model systems. DHA enhanced HO-1 gene expression in a time- and concentration-dependent manner, with maximal induction at 21 h of treatment. This induction of HO-1 expression was confirmed in vivo using a xenograft nude mouse model fed a fish-oil-enriched diet. The increase in HO-1 gene transcription induced by DHA was significantly attenuated by the antioxidant N-acetyl cysteine, suggesting the involvement of oxidative stress. This was supported by direct measurement of lipid peroxide levels after DHA treatment. Using a human HO-1 gene promoter reporter construct, we identified two antioxidant response elements (AREs) that mediate the DHA-induced increase in HO-1 gene transcription. Knockdown of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression compromised the DHA-induced increase in HO-1 gene transcription, indicating the importance of the Nrf2 pathway in this event. However, the nuclear protein levels of Nrf2 remained unchanged upon DHA treatment. Further studies demonstrated that DHA reduces nuclear Bach1 protein expression by promoting its degradation and attenuates Bach1 binding to the AREs in the HO-1 gene promoter. In contrast, DHA enhanced Nrf2 binding to the AREs without affecting nuclear Nrf2 expression levels, indicating a new cellular mechanism that mediates DHA's induction of HO-1 gene transcription. To our knowledge, this is the first characterization of DHA-induced HO-1 expression in human malignant cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. The Anti-Inflammatory Effects of Dimethyl Fumarate in Astrocytes Involve Glutathione and Haem Oxygenase-1

    Directory of Open Access Journals (Sweden)

    Shao Xia Lin

    2011-03-01

    Full Text Available DMF (dimethyl fumarate exerts anti-inflammatory and prometabolic effects in a variety of cell types, and a formulation (BG-12 is being evaluated for monotherapy in multiple sclerosis patients. DMF modifies glutathione (GSH levels that can induce expression of the anti-inflammatory protein HO-1 (haem oxygenase-1. In primary astrocytes and C6 glioma cells, BG-12 dose-dependently suppressed nitrite production induced by either LI [LPS (lipopolysaccharide at 1 μg/ml plus IFNγ (interferon γ at 20 units/ml] or a mixture of proinflammatory cytokines, with greater efficacy in C6 cells. BG-12 reduced NOS2 (nitric oxide synthase 2 mRNA levels and activation of a NOS2 promoter, reduced nuclear levels of NF-κB (nuclear factor κB p65 subunit and attenuated loss of |κBα (inhibitory κBα in both cell types, although with greater effects in astrocytes. In astrocytes, LI decreased mRNA levels for GSHr (GSH reductase and GCL (c-glutamylcysteine synthetase, and slightly suppressed GSHs (GSH synthetase mRNAs. Co-treatment with BG-12 prevented those decreased and increased levels above control values. In contrast, LI reduced GSHp (GSH peroxidase and GCL in C6 cells, and BG-12 had no effect on those levels. BG-12 increased nuclear levels of Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2, an inducer of GSH-related enzymes, in astrocytes but not C6 cells. In astrocytes, GSH was decreased by BG-12 at 2 h and increased at 24 h. Prior depletion of GSH using buthionine-sulfoximine increased the ability of BG-12 to reduce nitrites. In astrocytes, BG-12 increased HO-1 mRNA levels and effects on nitrite levels were blocked by an HO-1 inhibitor. These results demonstrate that BG-12 suppresses inflammatory activation in astrocytes and C6 glioma cells, but with distinct mechanisms, different dependence on GSH and different effects on transcription factor activation.

  18. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    International Nuclear Information System (INIS)

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung

    2012-01-01

    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  19. Andrographolide exerts anti-hepatitis C virus activity by up-regulating haeme oxygenase-1 via the p38 MAPK/Nrf2 pathway in human hepatoma cells.

    Science.gov (United States)

    Lee, Jin-Ching; Tseng, Chin-Kai; Young, Kung-Chia; Sun, Hung-Yu; Wang, Shainn-Wei; Chen, Wei-Chun; Lin, Chun-Kuang; Wu, Yu-Hsuan

    2014-01-01

    This study aimed to evaluate the anti-hepatitis C virus (HCV) activity of andrographolide, a diterpenoid lactone extracted from Andrographis paniculata, and to identify the signalling pathway involved in its antiviral action. Using HCV replicon and HCVcc infectious systems, we identified anti-HCV activity of andrographolide by measuring protein and RNA levels. A reporter activity assay was used to determine transcriptional regulation of anti-HCV agents. A specific inhibitor and short hairpin RNAs were used to investigate the mechanism responsible for the effect of andrographolide on HCV replication. In HCV replicon and HCVcc infectious systems, andrographolide time- and dose-dependently suppressed HCV replication. When combined with IFN-α, an inhibitor targeting HCV NS3/4A protease (telaprevir), or NS5B polymerase (PSI-7977), andrographolide exhibited a significant synergistic effect. Andrographolide up-regulated the expression of haeme oxygenase-1 (HO-1), leading to increased amounts of its metabolite biliverdin, which was found to suppress HCV replication by promoting the antiviral IFN responses and inhibiting NS3/4A protease activity. Significantly, these antiviral effects were attenuated by an HO-1-specific inhibitor or HO-1 gene knockdown, indicating that HO-1 contributed to the anti-HCV activity of andrographolide. Andrographolide activated p38 MAPK phosphorylation, which stimulated nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated HO-1 expression, and this was found to be associated with its anti-HCV activity. Our results demonstrate that andrographolide has the potential to control HCV replication and suggest that targeting the Nrf2-HO-1 signalling pathway might be a promising strategy for drug development. © 2013 The British Pharmacological Society.

  20. Relationship of Heme Oxygenase-1 (HO-1 Level with Onset and Severity in Normotensive Pregnancy and Severe Preeclampsia

    Directory of Open Access Journals (Sweden)

    John Johannes Wantania

    2016-08-01

    Full Text Available Background: Preeclampsia still becomes a major problem in pregnancies. Various evidences showed that heme oxygenase-1 (HO-1 is very important in pregnancy. This study aims to understand the relationship of heme oxygenase-1 level with onset and severity in normotensive pregnancy and severe preeclampsia. Methods: This is a cross sectional analytic comparative study, the subjects consisted of 26 patients with normotensive pregnancies and 26 patients with severe preeclampsia. Blood samples from women with < 34 / ≥ 34 weeks’ normotensive pregnancies and women with severe preeclampsia were taken. HO-1 ELISA kit used to quantitate heme oxygenase-1 level in samples. Results: The level of heme oxygenase-1 in normotensive pregnant women < 34 weeks lower than severe preeclampsia pregnant women < 34 weeks (3.28 ± 0.46 ng/mL vs 4.20 ± 0.64 ng/mL, p=0.003, respectively. The median level of heme oxygenase-1 in normotensive pregnant women ≥ 34 weeks was 2.96 (2.41–4.39 ng/mL, while severe preeclampsia pregnant women ≥ 34 weeks was 3.52 (2.88–5.43 ng/mL, (p=0.040. The median level of heme oxygenase-1 in normotensive pregnant women was 3.04 (2.41–4.39 ng/mL, while severe preeclampsia pregnant women was 3.68 (2.88–5.67 ng/mL, (p=0.001. Conclusions: There is correlation between the incidence of severe preeclampsia with heme oxygenase-1 level in < 34 and ≥ 34 weeks of pregnancy. There is a significant difference between the level of heme oxygenase-1 in pregnant women with severe preeclampsia and in women with normotensive pregnancy. 

  1. Andrographolide induces Nrf2 and heme oxygenase 1 in astrocytes by activating p38 MAPK and ERK.

    Science.gov (United States)

    Wong, Siew Ying; Tan, Michelle G K; Wong, Peter T H; Herr, Deron R; Lai, Mitchell K P

    2016-09-23

    Andrographolide is the major labdane diterpenoid originally isolated from Andrographis paniculata and has been shown to have anti-inflammatory and antioxidative effects. However, there is a dearth of studies on the potential therapeutic utility of andrographolide in neuroinflammatory conditions. Here, we aimed to investigate the mechanisms underlying andrographolide's effect on the expression of anti-inflammatory and antioxidant heme oxygenase-1 (HO-1) in primary astrocytes. Measurements of the effects of andrograholide on antioxidant HO-1 and its transcription factor, Nrf2, include gene expression, protein turnover, and activation of putative signaling regulators. Andrographolide potently activated Nrf2 and also upregulated HO-1 expression in primary astrocytes. Andrographolide's effects on Nrf2 seemed to be biphasic, with acute (within 1 h) reductions in Nrf2 ubiquitination efficiency and turnover rate, followed by upregulation of Nrf2 mRNA between 8 and 24 h. The acute regulation of Nrf2 by andrographolide seemed to be independent of Keap1 and partly mediated by p38 MAPK and ERK signaling. These data provide further insights into the mechanisms underlying andrographolide's effects on astrocyte-mediated antioxidant, and anti-inflammatory responses and support the further assessment of andrographolide as a potential therapeutic for neurological conditions in which oxidative stress and neuroinflammation are implicated.

  2. Extratumoral Heme Oxygenase-1 (HO-1 Expressing Macrophages Likely Promote Primary and Metastatic Prostate Tumor Growth.

    Directory of Open Access Journals (Sweden)

    Sofia Halin Bergström

    Full Text Available Aggressive tumors induce tumor-supporting changes in the benign parts of the prostate. One factor that has increased expression outside prostate tumors is hemoxygenase-1 (HO-1. To investigate HO-1 expression in more detail, we analyzed samples of tumor tissue and peritumoral normal prostate tissue from rats carrying cancers with different metastatic capacity, and human prostate cancer tissue samples from primary tumors and bone metastases. In rat prostate tumor samples, immunohistochemistry and quantitative RT-PCR showed that the main site of HO-1 synthesis was HO-1+ macrophages that accumulated in the tumor-bearing organ, and at the tumor-invasive front. Small metastatic tumors were considerably more effective in attracting HO-1+ macrophages than larger non-metastatic ones. In clinical samples, accumulation of HO-1+ macrophages was seen at the tumor invasive front, almost exclusively in high-grade tumors, and it correlated with the presence of bone metastases. HO-1+ macrophages, located at the tumor invasive front, were more abundant in bone metastases than in primary tumors. HO-1 expression in bone metastases was variable, and positively correlated with the expression of macrophage markers but negatively correlated with androgen receptor expression, suggesting that elevated HO-1 could be a marker for a subgroup of bone metastases. Together with another recent observation showing that selective knockout of HO-1 in macrophages reduced prostate tumor growth and metastatic capacity in animals, the results of this study suggest that extratumoral HO-1+ macrophages may have an important role in prostate cancer.

  3. Beyond gastric acid reduction: Proton pump inhibitors induce heme oxygenase-1 in gastric and endothelial cells

    International Nuclear Information System (INIS)

    Becker, Jan C.; Grosser, Nina; Waltke, Christian; Schulz, Stephanie; Erdmann, Kati; Domschke, Wolfram; Schroeder, Henning; Pohle, Thorsten

    2006-01-01

    Proton pump inhibitors (PPIs) have been demonstrated to prevent gastric mucosal injury by mechanisms independent of acid inhibition. Here we demonstrate that both omeprazole and lansoprazole protect human gastric epithelial and endothelial cells against oxidative stress. This effect was abrogated in the presence of the heme oxygenase-1 (HO-1) inhibitor ZnBG. Exposure to either PPI resulted in a strong induction of HO-1 expression on mRNA and protein level, and led to an increased activity of this enzyme. Expression of cyclooxygenase isoforms 1 and 2 remained unaffected, and COX-inhibitors did not antagonize HO-1 induction by PPIs. Our results suggest that the antioxidant defense protein HO-1 is a target of PPIs in both endothelial and gastric epithelial cells. HO-1 induction might account for the gastroprotective effects of PPIs independently of acid inhibition, especially in NSAID gastropathy. Moreover, our findings provide additional perspectives for a possible but yet unexplored use of PPIs in vasoprotection

  4. Beyond gastric acid reduction: Proton pump inhibitors induce heme oxygenase-1 in gastric and endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Becker, Jan C [Department of Medicine B, University of Muenster, 48149 Muenster (Germany); Grosser, Nina [Department of Pharmacology and Toxicology, School of Pharmacy, Martin Luther University, Halle-Wittenberg, 06099 Halle (Saale) (Germany); Waltke, Christian [Department of Medicine B, University of Muenster, 48149 Muenster (Germany); Schulz, Stephanie [Department of Pharmacology and Toxicology, School of Pharmacy, Martin Luther University, Halle-Wittenberg, 06099 Halle (Saale) (Germany); Erdmann, Kati [Department of Pharmacology and Toxicology, School of Pharmacy, Martin Luther University, Halle-Wittenberg, 06099 Halle (Saale) (Germany); Domschke, Wolfram [Department of Medicine B, University of Muenster, 48149 Muenster (Germany); Schroeder, Henning [Department of Pharmacology and Toxicology, School of Pharmacy, Martin Luther University, Halle-Wittenberg, 06099 Halle (Saale) (Germany); Pohle, Thorsten [Department of Medicine B, University of Muenster, 48149 Muenster (Germany)

    2006-07-07

    Proton pump inhibitors (PPIs) have been demonstrated to prevent gastric mucosal injury by mechanisms independent of acid inhibition. Here we demonstrate that both omeprazole and lansoprazole protect human gastric epithelial and endothelial cells against oxidative stress. This effect was abrogated in the presence of the heme oxygenase-1 (HO-1) inhibitor ZnBG. Exposure to either PPI resulted in a strong induction of HO-1 expression on mRNA and protein level, and led to an increased activity of this enzyme. Expression of cyclooxygenase isoforms 1 and 2 remained unaffected, and COX-inhibitors did not antagonize HO-1 induction by PPIs. Our results suggest that the antioxidant defense protein HO-1 is a target of PPIs in both endothelial and gastric epithelial cells. HO-1 induction might account for the gastroprotective effects of PPIs independently of acid inhibition, especially in NSAID gastropathy. Moreover, our findings provide additional perspectives for a possible but yet unexplored use of PPIs in vasoprotection.

  5. Structure prediction and activity analysis of human heme oxygenase-1 and its mutant.

    Science.gov (United States)

    Xia, Zhen-Wei; Zhou, Wen-Pu; Cui, Wen-Jun; Zhang, Xue-Hong; Shen, Qing-Xiang; Li, Yun-Zhu; Yu, Shan-Chang

    2004-08-15

    To predict wild human heme oxygenase-1 (whHO-1) and hHO-1 His25Ala mutant (delta hHO-1) structures, to clone and express them and analyze their activities. Swiss-PdbViewer and Antheprot 5.0 were used for the prediction of structure diversity and physical-chemical changes between wild and mutant hHO-1. hHO-1 His25Ala mutant cDNA was constructed by site-directed mutagenesis in two plasmids of E. coli DH5alpha. Expression products were purified by ammonium sulphate precipitation and Q-Sepharose Fast Flow column chromatography, and their activities were measured. rHO-1 had the structure of a helical fold with the heme sandwiched between heme-heme oxygenase-1 helices. Bond angle, dihedral angle and chemical bond in the active pocket changed after Ala25 was replaced by His25, but Ala25 was still contacting the surface and the electrostatic potential of the active pocket was negative. The mutated enzyme kept binding activity to heme. Two vectors pBHO-1 and pBHO-1(M) were constructed and expressed. Ammonium sulphate precipitation and column chromatography yielded 3.6-fold and 30-fold higher purities of whHO-1, respectively. The activity of delta hHO-1 was reduced 91.21% after mutation compared with whHO-1. Proximal His25 ligand is crucial for normal hHO-1 catalytic activity. delta hHO-1 is deactivated by mutation but keeps the same binding site as whHO-1. delta hHO-1 might be a potential inhibitor of whHO-1 for preventing neonatal hyperbilirubinemia.

  6. Fibroblast growth factor 10 protects neuron against oxygen–glucose deprivation injury through inducing heme oxygenase-1

    International Nuclear Information System (INIS)

    Li, Yong-Hua; Yang, Li-Ye; Chen, Wei; Li, Ying-Ke; Yuan, Hong-Bin

    2015-01-01

    Highlights: • FGF10 attenuates OGD induced injury in cortical neuron. • FGF10 reduces OGD triggered ROS level in cortical neuron. • FGF10 induces HO-1 expression upon OGD stimuli in cortical neuron. • Knockdown of HO-1 impairs the neuroprotection of FGF10 in OGD model. - Abstract: Fibroblast growth factors (FGFs) are a family of structurally related heparin-binding proteins with diverse biological functions. FGFs participate in mitogenesis, angiogenesis, cell proliferation, development, differentiation and cell migration. Here, we investigated the potential effect of FGF10, a member of FGFs, on neuron survival in oxygen–glucose deprivation (OGD) model. In primary cultured mouse cortical neurons upon OGD, FGF10 treatment (100 and 1000 ng/ml) attenuated the decrease of cell viability and rescued the LDH release. Tuj-1 immunocytochemistry assay showed that FGF10 promoted neuronal survival. Apoptosis assay with Annexin V + PI by flow cytometry demonstrated that FGF10 treatment reduced apoptotic cell proportion. Moreover, immunoblotting showed that FGF10 alleviated the cleaved caspase-3 upregulation caused by OGD. FGF10 treatment also depressed the OGD-induced increase of caspase-3, -8 and -9 activities. At last, we found FGF10 triggered heme oxygenase-1 (HO-1) protein expression rather than hypoxia-inducible factor-1 (HIF-1), AMP-activated protein kinase (AMPK) signaling and extracellular signal-regulated kinases 1/2 (ERK1/2) signaling. Knockdown of HO-1 by siRNA partly abolished the neuroprotection of FGF10 in OGD model. In summary, our observations provide the first evidence for the neuroprotective function of FGF10 against ischemic neuronal injury and suggest that FGF10 may be a promising agent for treatment of ischemic stroke

  7. Fibroblast growth factor 10 protects neuron against oxygen–glucose deprivation injury through inducing heme oxygenase-1

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yong-Hua; Yang, Li-Ye; Chen, Wei; Li, Ying-Ke, E-mail: liyingke6f@126.com; Yuan, Hong-Bin, E-mail: yuanhongbin6f@126.com

    2015-01-02

    Highlights: • FGF10 attenuates OGD induced injury in cortical neuron. • FGF10 reduces OGD triggered ROS level in cortical neuron. • FGF10 induces HO-1 expression upon OGD stimuli in cortical neuron. • Knockdown of HO-1 impairs the neuroprotection of FGF10 in OGD model. - Abstract: Fibroblast growth factors (FGFs) are a family of structurally related heparin-binding proteins with diverse biological functions. FGFs participate in mitogenesis, angiogenesis, cell proliferation, development, differentiation and cell migration. Here, we investigated the potential effect of FGF10, a member of FGFs, on neuron survival in oxygen–glucose deprivation (OGD) model. In primary cultured mouse cortical neurons upon OGD, FGF10 treatment (100 and 1000 ng/ml) attenuated the decrease of cell viability and rescued the LDH release. Tuj-1 immunocytochemistry assay showed that FGF10 promoted neuronal survival. Apoptosis assay with Annexin V + PI by flow cytometry demonstrated that FGF10 treatment reduced apoptotic cell proportion. Moreover, immunoblotting showed that FGF10 alleviated the cleaved caspase-3 upregulation caused by OGD. FGF10 treatment also depressed the OGD-induced increase of caspase-3, -8 and -9 activities. At last, we found FGF10 triggered heme oxygenase-1 (HO-1) protein expression rather than hypoxia-inducible factor-1 (HIF-1), AMP-activated protein kinase (AMPK) signaling and extracellular signal-regulated kinases 1/2 (ERK1/2) signaling. Knockdown of HO-1 by siRNA partly abolished the neuroprotection of FGF10 in OGD model. In summary, our observations provide the first evidence for the neuroprotective function of FGF10 against ischemic neuronal injury and suggest that FGF10 may be a promising agent for treatment of ischemic stroke.

  8. Heme oxygenase-1 (HO-1 expression in prostate cancer cells modulates the oxidative response in bone cells.

    Directory of Open Access Journals (Sweden)

    Mercedes Ferrando

    Full Text Available Prostate cancer (PCa is a leading cause of death among males. It is currently estimated that inflammatory responses are linked to 15-20% of all deaths from cancer worldwide. PCa is dominated by complications arising from metastasis to the bone where the tumor cells interact with the bone microenvironment impairing the balance between bone formation and degradation. However, the molecular nature of this interaction is not completely understood. Heme oxygenase-1 (HO-1 counteracts oxidative damage and inflammation. Previous studies from our laboratory showed that HO-1 is implicated in PCa, demonstrating that endogenous HO-1 inhibits bone derived-prostate cancer cells proliferation, invasion and migration and decreases tumor growth and angiogenesis in vivo. The aim of this work was to analyze the impact of HO-1 modulated PCa cells on osteoblasts proliferation in vitro and on bone remodeling in vivo. Using a co-culture system of PC3 cells with primary mice osteoblasts (PMOs, we demonstrated that HO-1 pharmacological induction (hemin treatment abrogated the diminution of PMOs proliferation induced by PCa cells and decreased the expression of osteoclast-modulating factors in osteoblasts. No changes were detected in the expression of genes involved in osteoblasts differentiation. However, co-culture of hemin pre-treated PC3 cells (PC3 Hem with PMOs provoked an oxidative status and activated FoxO signaling in osteoblasts. The percentage of active osteoblasts positive for HO-1 increased in calvarias explants co-cultured with PC3 Hem cells. Nuclear HO-1 expression was detected in tumors generated by in vivo bone injection of HO-1 stable transfected PC3 (PC3HO-1 cells in the femur of SCID mice. These results suggest that HO-1 has the potential to modify the bone microenvironment impacting on PCa bone metastasis.

  9. Heme oxygenase-1 prevents cardiac dysfunction in streptozotocin-diabetic mice by reducing inflammation, oxidative stress, apoptosis and enhancing autophagy.

    Directory of Open Access Journals (Sweden)

    Yanli Zhao

    Full Text Available Heme oxygenase-1 (HO-1 has been implicated in cardiac dysfunction, oxidative stress, inflammation, apoptosis and autophagy associated with heart failure, and atherosclerosis, in addition to its recognized role in metabolic syndrome and diabetes. Numerous studies have presented contradictory findings about the role of HO-1 in diabetic cardiomyopathy (DCM. In this study, we explored the role of HO-1 in myocardial dysfunction, myofibril structure, oxidative stress, inflammation, apoptosis and autophagy using a streptozotocin (STZ-induced diabetes model in mice systemically overexpressing HO-1 (Tg-HO-1 or mutant HO-1 (Tg-mutHO-1. The diabetic mouse model was induced by multiple peritoneal injections of STZ. Two months after injection, left ventricular (LV function was measured by echocardiography. In addition, molecular biomarkers related to oxidative stress, inflammation, apoptosis and autophagy were evaluated using classical molecular biological/biochemical techniques. Mice with DCM exhibited severe LV dysfunction, myofibril structure disarray, aberrant cardiac oxidative stress, inflammation, apoptosis, autophagy and increased levels of HO-1. In addition, we determined that systemic overexpression of HO-1 ameliorated left ventricular dysfunction, myofibril structure disarray, oxidative stress, inflammation, apoptosis and autophagy in DCM mice. Furthermore, serine/threonine-specific protein kinase (Akt and AMP-activated protein kinase (AMPK phosphorylation is normally inhibited in DCM, but overexpression of the HO-1 gene restored the phosphorylation of these kinases to normal levels. In contrast, the functions of HO-1 in DCM were significantly reversed by overexpression of mutant HO-1. This study underlines the unique roles of HO-1, including the inhibition of oxidative stress, inflammation and apoptosis and the enhancement of autophagy, in the pathogenesis of DCM.

  10. Spatiotemporal expression of heme oxygenase-1 detected by in vivo bioluminescence after hepatic ischemia in HO-1/luc mice

    NARCIS (Netherlands)

    Su, Huawei; van Dam, Gooitzen M.; Buis, Carlijn I.; Visser, Dorien S.; Hesselink, Jan Willem; Schuurs, Theo A.; Leuvenink, Henri G. D.; Contag, Christopher H.; Porte, Robert J.

    Upregulation of heme oxygenase-1 (HO-1) has been proposed as a critical mechanism protecting against cellular stress during liver transplantation, providing a potential target for new therapeutic interventions. We investigated the feasibility of in vivo bioluminescence imaging (BLI) to noninvasively

  11. Oxidative stress suppression by luteolin-induced heme oxygenase-1 expression

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Gui-bo; Sun, Xiao; Wang, Min [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100193 (China); Ye, Jing-xue [Jilin Agricultural University, No.2888, Xincheng Street, Changchun, 130021, Jilin (China); Si, Jian-yong [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100193 (China); Xu, Hui-bo [Academy of Chinese Medical Sciences of Jilin Province, Gongnongda road 1745, Changchun, 130021, Jiblin (China); Meng, Xiang-bao; Qin, Meng; Sun, Jing [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100193 (China); Wang, Hong-wei, E-mail: hwang@nju.edu.cn [Center for Translational Medicine and Jiangsu Key Laboratory of Molecular Medicine, Medical School of Nanjing University, Nanjing 210093 (China); Sun, Xiao-bo, E-mail: sunsubmit@163.com [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100193 (China)

    2012-12-01

    Luteolin, a flavonoid that exhibits antioxidative properties, exerts myocardial protection effects. However, the underlying molecular mechanisms are not yet fully understood. To investigate the effects of luteolin on myocardial injury protection and its possible mechanisms, a myocardial injury model was established with intragastric administration of 4 mg/kg isoproterenol (ISO) to male Sprague–Dawley rats (200–220 g) daily for 2 days. We found that pretreatment of luteolin (160, 80 and 40 mg/kg, i.g., respectively) daily for 15 days can prevent ISO-induced myocardial damage, including decrease of serum cardiac enzymes, improvement electrocardiography and heart vacuolation. Luteolin also improved the free radical scavenging and antioxidant potential, suggesting one possible mechanism of luteolin-induced cardio-protection is mediated by blocking the oxidative stress. To clarify the mechanisms, we performed the in vitro study by hydrogen peroxide (H{sub 2}O{sub 2})-induced cytotoxicty model in H9c2 cells. We found that luteolin pretreatment prevented apoptosis, increased the expression of heme oxygenase-1 (HO-1), and enhanced the binding of Nrf2 to the antioxidant response element, providing an adaptive survival response against H{sub 2}O{sub 2}-derived oxidative cytotoxicity. The addition of Znpp, a selective HO-1 competitive inhibitor, reduced the cytoprotective ability of luteolin, indicating the vital role of HO-1 on these effects. Luteolin also activated Akt and ERK, whereas the addition of LY294002 and U0126, the pharmacologic inhibitors of PI3K and ERK, attenuated luteolin-induced HO-1 expression and cytoprotective effect. Taken together, the above findings suggest that luteolin protects against myocardial injury and enhances cellular antioxidant defense capacity through the activation of Akt and ERK signal pathways that leads to Nrf2 activation, and subsequently HO-1 induction. -- Highlights: ► Luteolin prevents isoproterenol-induced myocardial damage.

  12. Oxidative stress suppression by luteolin-induced heme oxygenase-1 expression

    International Nuclear Information System (INIS)

    Sun, Gui-bo; Sun, Xiao; Wang, Min; Ye, Jing-xue; Si, Jian-yong; Xu, Hui-bo; Meng, Xiang-bao; Qin, Meng; Sun, Jing; Wang, Hong-wei; Sun, Xiao-bo

    2012-01-01

    Luteolin, a flavonoid that exhibits antioxidative properties, exerts myocardial protection effects. However, the underlying molecular mechanisms are not yet fully understood. To investigate the effects of luteolin on myocardial injury protection and its possible mechanisms, a myocardial injury model was established with intragastric administration of 4 mg/kg isoproterenol (ISO) to male Sprague–Dawley rats (200–220 g) daily for 2 days. We found that pretreatment of luteolin (160, 80 and 40 mg/kg, i.g., respectively) daily for 15 days can prevent ISO-induced myocardial damage, including decrease of serum cardiac enzymes, improvement electrocardiography and heart vacuolation. Luteolin also improved the free radical scavenging and antioxidant potential, suggesting one possible mechanism of luteolin-induced cardio-protection is mediated by blocking the oxidative stress. To clarify the mechanisms, we performed the in vitro study by hydrogen peroxide (H 2 O 2 )-induced cytotoxicty model in H9c2 cells. We found that luteolin pretreatment prevented apoptosis, increased the expression of heme oxygenase-1 (HO-1), and enhanced the binding of Nrf2 to the antioxidant response element, providing an adaptive survival response against H 2 O 2 -derived oxidative cytotoxicity. The addition of Znpp, a selective HO-1 competitive inhibitor, reduced the cytoprotective ability of luteolin, indicating the vital role of HO-1 on these effects. Luteolin also activated Akt and ERK, whereas the addition of LY294002 and U0126, the pharmacologic inhibitors of PI3K and ERK, attenuated luteolin-induced HO-1 expression and cytoprotective effect. Taken together, the above findings suggest that luteolin protects against myocardial injury and enhances cellular antioxidant defense capacity through the activation of Akt and ERK signal pathways that leads to Nrf2 activation, and subsequently HO-1 induction. -- Highlights: ► Luteolin prevents isoproterenol-induced myocardial damage. ► Luteolin

  13. Heme oxygenase-1 gene expression modulates angiotensin II-induced increase in blood pressure.

    Science.gov (United States)

    Yang, Liming; Quan, Shuo; Nasjletti, Alberto; Laniado-Schwartzman, Michal; Abraham, Nader G

    2004-06-01

    The heme-heme oxygenase (HO) system has been implicated in the regulation of vascular reactivity and blood pressure. This study examines the notion that overexpression of HO decreases pressor responsiveness to angiotensin II (Ang II). Five-day-old Sprague-Dawley rats received an intraleft ventricular injection of approximately 5x10(9) cfu/mL of retroviruses containing human HO-1 sense (LSN-HHO-1), rat HO-1 antisense (LSN-RHO-1-AS), or control retrovirus (LXSN). Three months later, rats were instrumented with femoral arterial and venous catheters for mean arterial pressure (MAP) determination and Ang II administration, respectively. Rats injected with LSN-HHO-1, but not with LXSN, expressed human HO-1 mRNA and protein in several tissues. BP increased with administration of Ang II in rats expressing and not expressing human HO-1. However, the Ang II-induced pressor response (mm Hg) in LSN-HHO-1 rats (16+/-3, 27+/-3, and 38+/-3 at 0.5, 2, and 10 ng) was surpassed (PHHO-1 rats with the HO inhibitor tin mesoporphyrin (SnMP) enhanced (P<0.05) the Ang II-induced pressor response to a level not different from that observed in LXSN rats. Rats injected with LSN-RHO-1-AS showed a decrease in renal HO-1 protein expression and HO activity relative to control LXSN rats. Administration of Ang II (0.1 to 2 ng) caused small (4 to 5 mm Hg) but significant increases in MAP in rats injected with LSN-RHO-1-AS (P<0.05) compared with rats injected with LXSN. These data demonstrate that overexpression of HO-1 brings about a reduction in pressor responsiveness to Ang II, which is most likely due to increased generation of an HO-1 product, presumably CO, with the ability to inhibit vascular reactivity to constrictor stimuli.

  14. The Haptoglobin-CD163-Heme Oxygenase-1 Pathway for Hemoglobin Scavenging

    Directory of Open Access Journals (Sweden)

    Jens Haugbølle Thomsen

    2013-01-01

    Full Text Available The haptoglobin- (Hp- CD163-heme oxygenase-1 (HO-1 pathway is an efficient captor-receptor-enzyme system to circumvent the hemoglobin (Hb/heme-induced toxicity during physiological and pathological hemolyses. In this pathway, Hb tightly binds to Hp leading to CD163-mediated uptake of the complex in macrophages followed by lysosomal Hp-Hb breakdown and HO-1-catalyzed conversion of heme into the metabolites carbon monoxide (CO, biliverdin, and iron. The plasma concentration of Hp is a limiting factor as evident during accelerated hemolysis, where the Hp depletion may cause serious Hb-induced toxicity and put pressure on backup protecting systems such as the hemopexin-CD91-HO pathway. The Hp-CD163-HO-1 pathway proteins are regulated by the acute phase mediator interleukin-6 (IL-6, but other regulatory factors indicate that this upregulation is a counteracting anti-inflammatory response during inflammation. The heme metabolites including bilirubin converted from biliverdin have overall an anti-inflammatory effect and thus reinforce the anti-inflammatory efficacy of the Hp-CD163-HO-1 pathway. Future studies of animal models of inflammation should further define the importance of the pathway in the anti-inflammatory response.

  15. Expression of nerve growth factor and heme oxygenase-1 predict poor survival of breast carcinoma patients

    International Nuclear Information System (INIS)

    Noh, Sang Jae; Chung, Myoung Ja; Moon, Woo Sung; Kang, Myoung Jae; Jang, Kyu Yun; Bae, Jun Sang; Jamiyandorj, Urangoo; Park, Ho Sung; Kwon, Keun Sang; Jung, Sung Hoo; Youn, Hyun Jo; Lee, Ho; Park, Byung-Hyun

    2013-01-01

    Nerve growth factor (NGF) is a neurotrophin and has been suggested to induce heme oxygenase-1 (HO1) expression. Although the role of HO1 in tumorigenesis remains controversial, recent evidence suggests NGF and HO1 as tumor-progressing factors. However, the correlative role of NGF and HO1 and their prognostic impact in breast carcinoma is unknown. We investigated the expression and prognostic significance of the expression of NGF and HO1 in 145 cases of breast carcinoma. Immunohistochemical expression of NGF and HO1 was observed in 31% and 49% of breast carcinoma, respectively. The expression of NGF and HO1 significantly associated with each other, and both have a significant association with histologic grade, HER2 expression, and latent distant metastasis. The expression of NGF and HO1 predicted shorter overall survival of breast carcinoma by univariate and multivariate analysis. NGF expression was an independent prognostic indicator for relapse-free survival by multivariate analysis. The combined expression pattern of NGF and HO1 was also an independent prognostic indicator of overall survival and relapse-free survival. The patients with tumors expressing NGF had the shortest survival and the patients with tumor, which did not express NGF or HO1 showed the longest survival time. This study has demonstrated that individual expression of NGF or HO1, and the combined NGF/HO1 expression pattern could be prognostic indicators for breast carcinoma patients

  16. Targeted expression of heme oxygenase-1 prevents the pulmonary inflammatory and vascular responses to hypoxia

    Science.gov (United States)

    Minamino, Tohru; Christou, Helen; Hsieh, Chung-Ming; Liu, Yuxiang; Dhawan, Vijender; Abraham, Nader G.; Perrella, Mark A.; Mitsialis, S. Alex; Kourembanas, Stella

    2001-07-01

    Chronic hypoxia causes pulmonary hypertension with smooth muscle cell proliferation and matrix deposition in the wall of the pulmonary arterioles. We demonstrate here that hypoxia also induces a pronounced inflammation in the lung before the structural changes of the vessel wall. The proinflammatory action of hypoxia is mediated by the induction of distinct cytokines and chemokines and is independent of tumor necrosis factor- signaling. We have previously proposed a crucial role for heme oxygenase-1 (HO-1) in protecting cardiomyocytes from hypoxic stress, and potent anti-inflammatory properties of HO-1 have been reported in models of tissue injury. We thus established transgenic mice that constitutively express HO-1 in the lung and exposed them to chronic hypoxia. HO-1 transgenic mice were protected from the development of both pulmonary inflammation as well as hypertension and vessel wall hypertrophy induced by hypoxia. Significantly, the hypoxic induction of proinflammatory cytokines and chemokines was suppressed in HO-1 transgenic mice. Our findings suggest an important protective function of enzymatic products of HO-1 activity as inhibitors of hypoxia-induced vasoconstrictive and proinflammatory pathways.

  17. Heme oxygenase-1 prevents hyperthyroidism induced hepatic damage via an antioxidant and antiapoptotic pathway.

    Science.gov (United States)

    Giriş, Murat; Erbil, Yeşim; Depboylu, Bilge; Mete, Ozgür; Türkoğlu, Umit; Abbasoğlu, Semra Doğru; Uysal, Müjdat

    2010-12-01

    The exact pathogenesis of hepatic dysfunction in hyperthyroidism is still unknown. We aimed to investigate the pathogenesis of liver dysfunction caused by hyperthyroidism through inducing heme oxygenase-1 (HO-1) expression, which has antioxidant and anti-apoptotic properties. Rats were divided into six groups: untreated (group 1), treated with zinc protoporphyrin (ZnPP) (group 2), treated with hemin (group 3), treated with tri-iodothyronine (T3) (group 4), treated with T3 and ZnPP (group 5), and treated with T3 and hemin (group 6). After 22 d, oxidative stress and antioxidant enzymes and the expression of HO-1, mitochondrial permeability transition, cytochrome c, Bax, Bcl-2, caspase-3, caspase-8, and caspase-3 activity, and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay were examined. Hyperthyroidism induced oxidative stress of liver tissue was ameliorated by HO-1 induction. Administration of hemin (HO-1 inducer) increased Bcl-2 expression. Decreased expression of cytochrome c was accompanied by a decrease in caspase-3, caspase-8, Bax expression, and caspase-3 activity. The apoptotic activity and oxidative damage were found to be increased by the administration of ZnPP (HO-1 inhibitor). Immunohistochemistry findings supported these results. HO-1 induction plays a protective role in the pathogenesis of the liver dysfunction in hyperthyroidism. This effect is dependent on modulation of the antiapoptotic and antioxidative pathways by HO-1 expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. The role of heme oxygenase-1 in systemic-onset juvenile idiopathic arthritis.

    Science.gov (United States)

    Takahashi, Akitaka; Mori, Masaaki; Naruto, Takuya; Nakajima, Shoko; Miyamae, Takako; Imagawa, Tomoyuki; Yokota, Shumpei

    2009-01-01

    We have determined the serum levels of heme oxygenase-1 (HO-1) in 56 patients with systemic-onset juvenile idiopathic arthritis (s-JIA) and compared these with serum HO-1 levels in healthy controls and patients with other pediatric rheumatic diseases. Serum HO-1 levels were measured by the sandwich enzyme-linked immunosorbent assay. The mean serum HO-1 level in s-JIA patients during the active phase was 123.6 +/- 13.83 ng/ml, which was significantly higher than that in patients with polyarticular juvenile idiopathic arthritis (p-JIA), Kawasaki disease, systemic lupus erythematosus or mixed connective tissue disease (P < 0.0005). The serum levels of HO-1, cytokines and cytokine receptors in patients with s-JIA were also assessed at both the active and inactive phases. The serum HO-1 level in patients with s-JIA in the active phase was found to be significantly greater than that in patients with the disease in the inactive phase (P < 0.0001). An assessment of the relationships between serum HO-1 levels and other laboratory parameters or cytokines in patients with s-JIA did not reveal any strong correlations. These results suggest that the serum level of HO-1 may be a useful marker for the differential diagnosis of s-JIA. Further study will be necessary to elucidate the mechanism of HO-1 production and to clarify the role of HO-1 in the disease process.

  19. Impact of heme oxygenase-1 on cholesterol synthesis, cholesterol efflux and oxysterol formation in cultured astroglia.

    Science.gov (United States)

    Hascalovici, Jacob R; Song, Wei; Vaya, Jacob; Khatib, Soliman; Fuhrman, Bianca; Aviram, Michael; Schipper, Hyman M

    2009-01-01

    Up-regulation of heme oxygenase-1 (HO-1) and altered cholesterol (CH) metabolism are characteristic of Alzheimer-diseased neural tissues. The liver X receptor (LXR) is a molecular sensor of CH homeostasis. In the current study, we determined the effects of HO-1 over-expression and its byproducts iron (Fe(2+)), carbon monoxide (CO) and bilirubin on CH biosynthesis, CH efflux and oxysterol formation in cultured astroglia. HO-1/LXR interactions were also investigated in the context of CH efflux. hHO-1 over-expression for 3 days ( approximately 2-3-fold increase) resulted in a 30% increase in CH biosynthesis and a two-fold rise in CH efflux. Both effects were abrogated by the competitive HO inhibitor, tin mesoporphyrin. CO, released from administered CORM-3, significantly enhanced CH biosynthesis; a combination of CO and iron stimulated CH efflux. Free iron increased oxysterol formation three-fold. Co-treatment with LXR antagonists implicated LXR activation in the modulation of CH homeostasis by heme degradation products. In Alzheimer's disease and other neuropathological states, glial HO-1 induction may transduce ambient noxious stimuli (e.g. beta-amyloid) into altered patterns of glial CH homeostasis. As the latter may impact synaptic plasticity and neuronal repair, modulation of glial HO-1 expression (by pharmacological or other means) may confer neuroprotection in patients with degenerative brain disorders.

  20. Overexpressed human heme Oxygenase-1 decreases adipogenesis in pigs and porcine adipose-derived stem cells.

    Science.gov (United States)

    Park, Eun Jung; Koo, Ok Jae; Lee, Byeong Chun

    2015-11-27

    Adipose-derived mesenchymal stem cells (ADSC) are multipotent, which means they are able to differentiate into several lineages in vivo and in vitro under proper conditions. This indicates it is possible to determine the direction of differentiation of ADSC by controlling the microenvironment. Heme oxygenase 1 (HO-1), a type of antioxidant enzyme, attenuates adipogenicity and obesity. We produced transgenic pigs overexpressing human HO-1 (hHO-1-Tg), and found that these animals have little fatty tissue when autopsied. To determine whether overexpressed human HO-1 suppresses adipogenesis in pigs, we analyzed body weight increases of hHO-1-Tg pigs and wild type (WT) pigs of the same strain, and induced adipogenic differentiation of ADSC derived from WT and hHO-1-Tg pigs. The hHO-1-Tg pigs had lower body weights than WT pigs from 16 weeks of age until they died. In addition, hHO-1-Tg ADSC showed reduced adipogenic differentiation and expression of adipogenic molecular markers such as PPARγ and C/EBPα compared to WT ADSC. These results suggest that HO-1 overexpression reduces adipogenesis both in vivo and in vitro, which could support identification of therapeutic targets of obesity and related metabolic diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Effects of combined mesenchymal stem cells and heme oxygenase-1 therapy on cardiac performance.

    Science.gov (United States)

    Zeng, Bin; Chen, Honglei; Zhu, Chengang; Ren, Xiaofeng; Lin, Guosheng; Cao, Feng

    2008-10-01

    Bone marrow mesenchymal stem cells (MSCs) have the potential to repair the infarcted myocardium and improve cardiac function. However, this approach is limited by its poor viability after transplantation, and controversy still exists over the mechanism by which MSCs contribute to the tissue repair. The human heme oxygenase-1 (hHO-1) was transfected into cultured MSCs using an adenoviral vector. 1 x 10(6) Ad-hHO-1-transfected MSCs (HO-1-MSCs) or Ad-Null-transfected MSCs (Null-MSCs) or PBS only (PBS group) were injected intramyocardially into rat hearts 1h after myocardial infarction. HO-1-MSCs survived in the infarcted myocardium, and expressed hHO-1 mRNA. The expression of basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) was significantly enhanced in HO-1-MSCs-treated hearts. At the same time, there were significant reduction of TNF-alpha, IL-1-beta and IL-6 mRNA, and marked increase of IL-10 mRNA in HO-1-MSCs-treated hearts. Moreover, a further downregulation of proapoptotic protein, Bax, and a marked increase in microvessel density were observed in HO-1-MSCs-treated hearts. The infarct size and cardiac performance were also significantly improved in HO-1-MSCs-treated hearts. The combined approach improves MSCs survival and is superior to MSCs injection alone.

  2. The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

    Science.gov (United States)

    Wang, Jinling; de Montellano, Paul R Ortiz

    2003-05-30

    Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

  3. Myeloid Heme Oxygenase-1 Regulates the Acute Inflammatory Response to Zymosan in the Mouse Air Pouch

    Directory of Open Access Journals (Sweden)

    Rita Brines

    2018-01-01

    Full Text Available Heme oxygenase-1 (HO-1 is induced by many stimuli to modulate the activation and function of different cell types during innate immune responses. Although HO-1 has shown anti-inflammatory effects in different systems, there are few data on the contribution of myeloid HO-1 and its role in inflammatory processes is not well understood. To address this point, we have used HO-1M-KO mice with myeloid-restricted deletion of HO-1 to specifically investigate its influence on the acute inflammatory response to zymosan in vivo. In the mouse air pouch model, we have shown an exacerbated inflammation in HO-1M-KO mice with increased neutrophil infiltration accompanied by high levels of inflammatory mediators such as interleukin-1β, tumor necrosis factor-α, and prostaglandin E2. The expression of the degradative enzyme matrix metalloproteinase-3 (MMP-3 was also enhanced. In addition, we observed higher levels of serum MMP-3 in HO-1M-KO mice compared with control mice, suggesting the presence of systemic inflammation. Altogether, these findings demonstrate that myeloid HO-1 plays an anti-inflammatory role in the acute response to zymosan in vivo and suggest the interest of this target to regulate inflammatory processes.

  4. Carbon monoxide mediates heme oxygenase 1 induction via Nrf2 activation in hepatoma cells

    International Nuclear Information System (INIS)

    Lee, Bok-Soo; Heo, JungHee; Kim, Yong-Man; Shim, Sang Moo; Pae, Hyun-Ock; Kim, Young-Myeong; Chung, Hun-Taeg

    2006-01-01

    Carbon monoxide (CO) and nitric oxide (NO) are two gas molecules which have cytoprotective functions against oxidative stress and inflammatory responses in many cell types. Currently, it is known that NO produced by nitric oxide synthase (NOS) induces heme oxygenase 1 (HO1) expression and CO produced by the HO1 inhibits inducible NOS expression. Here, we first show CO-mediated HO1 induction and its possible mechanism in human hepatocytes. Exposure of HepG2 cells or primary hepatocytes to CO resulted in dramatic induction of HO1 in dose- and time-dependent manner. The CO-mediated HO1 induction was abolished by MAP kinase inhibitors (MAPKs) but not affected by inhibitors of PI3 kinase or NF-κB. In addition, CO induced the nuclear translocation and accumulation of Nrf2, which suppressed by MAPKs inhibitors. Taken together, we suggest that CO induces Nrf2 activation via MAPKs signaling pathways, thereby resulting in HO1 expression in HepG2 cells

  5. UVA-induced protection of skin through the induction of heme oxygenase-1.

    Science.gov (United States)

    Xiang, Yuancai; Liu, Gang; Yang, Li; Zhong, Julia Li

    2011-12-01

    UVA (320-400 nm) and UVB (290-320 nm) are the major components of solar UV irradiation, which is associated with various pathological conditions. UVB causes direct damage to DNA of epidermal cells and is mainly responsible for erythema, immunosuppression, photoaging, and skin cancer. UVA has oxidizing properties that can cause damage or enhance UVB damaging effects on skin. On the other hand, UVA can also lead to high levels of heme oxygenase-1 (HO-1) expression of cells that can provide an antioxidant effect on skin as well as anti-inflammatory properties in mammals and rodents. Therefore, this review focuses on the potential protection of UVA wavebands for the skin immune response, instead of mechanisms that underlie UVA-induced damage. Also, the role of HO-1 in UVA-mediated protection against UVB-induced immunosuppression in skin will be summarized. Thus, this review facilitates further understanding of potential beneficial mechanisms of UVA irradiation, and using the longer UVA (UVA1, 340-400 nm) in combination with HO-1 for phototherapy and skin protection against sunlight exposure.

  6. Duodenal ulcer promoting gene of Helicobacter pylori.

    Science.gov (United States)

    Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio

    2005-04-01

    Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.

  7. Methamphetamine induces heme oxygenase-1 expression in cortical neurons and glia to prevent its toxicity

    International Nuclear Information System (INIS)

    Huang, Y.-N.; Wu, C.-H.; Lin, T.-C.; Wang, J.-Y.

    2009-01-01

    The impairment of cognitive and motor functions in humans and animals caused by methamphetamine (METH) administration underscores the importance of METH toxicity in cortical neurons. The heme oxygenase-1 (HO-1) exerts a cytoprotective effect against various neuronal injures; however, it remains unclear whether HO-1 is involved in METH-induced toxicity. We used primary cortical neuron/glia cocultures to explore the role of HO-1 in METH-induced toxicity. Exposure of cultured cells to various concentrations of METH (0.1, 0.5, 1, 3, 5, and 10 mM) led to cytotoxicity in a concentration-dependent manner. A METH concentration of 5 mM, which caused 50% of neuronal death and glial activation, was chosen for subsequent experiments. RT-PCR and Western blot analysis revealed that METH significantly induced HO-1 mRNA and protein expression, both preceded cell death. Double and triple immunofluorescence staining further identified HO-1-positive cells as activated astrocytes, microglia, and viable neurons, but not dying neurons. Inhibition of the p38 mitogen-activated protein kinase pathway significantly blocked HO-1 induction by METH and aggravated METH neurotoxicity. Inhibition of HO activity using tin protoporphyrine IX significantly reduced HO activity and exacerbated METH neurotoxicity. However, prior induction of HO-1 using cobalt protoporphyrine IX partially protected neurons from METH toxicity. Taken together, our results suggest that induction of HO-1 by METH via the p38 signaling pathway may be protective, albeit insufficient to completely protect cortical neurons from METH toxicity.

  8. Beneficial effect of prolonged heme oxygenase 1 activation in a rat model of chronic heart failure

    Directory of Open Access Journals (Sweden)

    Massimo Collino

    2013-07-01

    We and others have previously demonstrated that heme oxygenase 1 (HO-1 induction by acute hemin administration exerts cardioprotective effects. Here, we developed a rat model of heart failure to investigate whether a long-term induction of HO-1 by chronic hemin administration exerted protective effects. Sprague Dawley rats that underwent permanent ligation of the left coronary artery were closely monitored for survival rate analysis and sacrificed on day 28 post-operation. Administration of hemin (4 mg/kg body weight every other day for 4 weeks induced a massive increase in HO-1 expression and activity, as shown by the increased levels of the two main metabolic products of heme degradation, bilirubin and carbon monoxide (CO. These effects were associated with significant improvement in survival and reduced the extension of myocardial damage. The ischemic hearts of the hemin-treated animals displayed reduced oxidative stress and apoptosis in comparison with the non-treated rats, as shown by the decreased levels of lipid peroxidation, free-radical-induced DNA damage, caspase-3 activity and Bax expression. Besides, chronic HO-1 activation suppressed the elevated levels of myeloperoxidase (MPO activity, interleukin 1β (IL-1β production and tumor necrosis factor-α (TNFα production that were evoked by the ischemic injury, and increased the plasma level of the anti-inflammatory cytokine IL-10. Interestingly, HO-1 inhibitor zinc protoporphyrin IX (ZnPP-IX; 1 mg/kg lowered bilirubin and CO concentrations to control values, thus abolishing all the cardioprotective effects of hemin. In conclusion, the results demonstrate that chronic HO-1 activation by prolonged administration of hemin improves survival and exerts protective effects in a rat model of myocardial ischemia by exerting a potent antioxidant activity and disrupting multiple levels of the apoptotic and inflammatory cascade.

  9. Beneficial effect of prolonged heme oxygenase 1 activation in a rat model of chronic heart failure.

    Science.gov (United States)

    Collino, Massimo; Pini, Alessandro; Mugelli, Niccolò; Mastroianni, Rosanna; Bani, Daniele; Fantozzi, Roberto; Papucci, Laura; Fazi, Marilena; Masini, Emanuela

    2013-07-01

    We and others have previously demonstrated that heme oxygenase 1 (HO-1) induction by acute hemin administration exerts cardioprotective effects. Here, we developed a rat model of heart failure to investigate whether a long-term induction of HO-1 by chronic hemin administration exerted protective effects. Sprague Dawley rats that underwent permanent ligation of the left coronary artery were closely monitored for survival rate analysis and sacrificed on day 28 post-operation. Administration of hemin (4 mg/kg body weight) every other day for 4 weeks induced a massive increase in HO-1 expression and activity, as shown by the increased levels of the two main metabolic products of heme degradation, bilirubin and carbon monoxide (CO). These effects were associated with significant improvement in survival and reduced the extension of myocardial damage. The ischemic hearts of the hemin-treated animals displayed reduced oxidative stress and apoptosis in comparison with the non-treated rats, as shown by the decreased levels of lipid peroxidation, free-radical-induced DNA damage, caspase-3 activity and Bax expression. Besides, chronic HO-1 activation suppressed the elevated levels of myeloperoxidase (MPO) activity, interleukin 1β (IL-1β) production and tumor necrosis factor-α (TNFα) production that were evoked by the ischemic injury, and increased the plasma level of the anti-inflammatory cytokine IL-10. Interestingly, HO-1 inhibitor zinc protoporphyrin IX (ZnPP-IX; 1 mg/kg) lowered bilirubin and CO concentrations to control values, thus abolishing all the cardioprotective effects of hemin. In conclusion, the results demonstrate that chronic HO-1 activation by prolonged administration of hemin improves survival and exerts protective effects in a rat model of myocardial ischemia by exerting a potent antioxidant activity and disrupting multiple levels of the apoptotic and inflammatory cascade.

  10. Effect of dimethyl fumarate on heme oxygenase-1 expression in experimental allergic encephalomyelitis in rats

    Directory of Open Access Journals (Sweden)

    Kaja Kasarełło

    2017-12-01

    Full Text Available Multiple sclerosis (MS is an autoimmunological disease leading to neurodegeneration. The etiology of the disease remains unknown, which strongly impedes the development of effective therapy. Most MS treatments focus on modulating the activity of the immune system. Dimethyl fumarate (DMF exerts a broad spectrum of action, such as modulating immune cell differentiation towards anti-inflammatory subtypes, influencing cytokine production, regulating immune cell migration into the central nervous system, and activating intracellular antioxidant mechanisms. It is well established that activation of the nuclear factor E2 (Nrf2-dependent pathway, leading to expression of the second-phase antioxidant enzymes, is influenced by DMF. In our experiments we used female Lewis rats in an animal model of MS – experimental allergic encephalomyelitis (EAE. The rats were fed with dimethyl fumarate to test the expression of heme oxygenase-1 (HO-1, one of the second-phase antioxidant enzymes, at specific time points of the symptomatic phases of the disease: on the first day of the occurrence of clinical symptoms (10th day post immunization, DPI; at the peak of clinical symptoms (14th DPI; and at the end of the relapse (21st DPI. The results showed that HO-1 expression, at both the mRNA and protein level, is influenced by DMF administration only at the very beginning of the symptomatic phase of EAE, and not at the peak of clinical symptoms, nor at the end of the relapse. This indicates that the regulation of the Nrf2-dependent antioxidant pathway by DMF occurs at a certain time interval (early EAE/MS and strongly underlines the importance of the earliest introduction of the therapy to the patient.

  11. Orthodontic forces induce the cytoprotective enzyme heme oxygenase-1 in rats

    Directory of Open Access Journals (Sweden)

    Christiaan M. Suttorp

    2016-07-01

    Full Text Available Orthodontic forces disturb the microenvironment of the periodontal ligament (PDL, and induce craniofacial bone remodeling which is necessary for tooth movement. Unfortunately, orthodontic tooth movement is often hampered by ischemic injury and cell death within the PDL (hyalinization and root resorption. Large inter-individual differences in hyalinization and root resorption have been observed, and may be explained by differential protection against hyalization. Heme oxygenase-1 (HO-1 forms an important protective mechanism by breaking down heme into the strong anti-oxidants biliverdin/bilirubin and the signaling molecule carbon monoxide. These versatile HO-products protect against ischemic and inflammatory injury. We postulate that orthodontic forces induce HO-1 expression in the PDL during experimental tooth movement. Twenty-five 6-week-old male Wistar rats were used in this study. The upper three molars at one side were moved mesially using a Ni-Ti 10 cN coil spring. The contralateral side served as control. After 6, 12, 72, 96 and 120 hrs rats were killed. On parasagittal sections immunohistochemical staining was performed for analysis of HO-1 expression and quantification of multinuclear osteoclasts. Orthodontic force induced a significant time-dependent HO-1 expression in the mononuclear cell population within the PDL at both the apposition- and resorption side. Shortly after appliance placement HO-1 expression was highly induced in PDL cells but dropped to control levels within 72 hours. Some osteoclasts were HO-1 positive but this induction was shown to be independent of time- and mechanical stress. It is tempting to speculate that differential induction of cytoprotective enzymes as HO-1 in the PDL determines the level of hyalinization and, subsequently, fast and slow tooth movers during orthodontic treatment.

  12. Heme oxygenase-1 modulates degeneration of the intervertebral disc after puncture in Bach 1 deficient mice.

    Science.gov (United States)

    Ohta, Ryo; Tanaka, Nobuhiro; Nakanishi, Kazuyoshi; Kamei, Naosuke; Nakamae, Toshio; Izumi, Bunichiro; Fujioka, Yuki; Ochi, Mitsuo

    2012-09-01

    Intervertebral disc degeneration is considered to be a major feature of low back pain. Furthermore, oxidative stress has been shown to be an important factor in degenerative diseases such as osteoarthritis and is considered a cause of intervertebral disc degeneration. The purpose of this study was to clarify the correlation between oxidative stress and intervertebral disc degeneration using Broad complex-Tramtrack-Bric-a-brac and cap'n'collar homology 1 deficient (Bach 1-/-) mice which highly express heme oxygenase-1 (HO-1). HO-1 protects cells from oxidative stress. Caudal discs of 12-week-old and 1-year-old mice were evaluated as age-related models. Each group and period, 5 mice (a total of 20 mice, a total of 20 discs) were evaluated as age-related model. C9-C10 caudal discs in 12-week-old Bach 1-/- and wild-type mice were punctured using a 29-gauge needle as annulus puncture model. Each group and period, 5 mice (a total of 60 mice, a total of 60 discs) were evaluated. The progress of disc degeneration was evaluated at pre-puncture, 1, 2, 4, 8 and 12 weeks post-puncture. Radiographic, histologic and immunohistologic analysis were performed to compare between Bach 1-/- and wild-type mice. In the age-related model, there were no significant differences between Bach 1-/- and wild-type mice radiologically and histologically. However, in the annulus puncture model, histological scoring revealed significant difference at 8 and 12 weeks post-puncture. The number of HO-1 positive cells was significantly greater in Bach 1-/- mice at every period. The apoptosis rate was significantly lower at 1 and 2 weeks post-puncture in Bach 1-/- mice. Oxidative stress prevention may avoid the degenerative process of the intervertebral disc after puncture, reducing the number of apoptosis cells. High HO-1 expression may also inhibit oxidative stress and delay the process of intervertebral disc degeneration.

  13. Plasma heme oxygenase-1 concentration is elevated in individuals with type 2 diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Wei Bao

    Full Text Available BACKGROUND: Circulating concentrations of heme oxygenase-1 (HO-1 have been recently reported to be elevated in several chronic disorders. However, no study has ever examined the association between circulating HO-1 concentrations and type 2 diabetes mellitus (T2DM. METHODS AND FINDINGS: 581 cases with newly-diagnosed T2DM (New-T2DM and 611 comparison controls were recruited in this two-phase case-control study, comprising 420 cases and 429 controls collected in the first phase study and 161 cases and 182 controls in the second phase replication study. Analyses, using both separated data and combined data from the two-phase studies, show that plasma HO-1 concentrations were significantly increased in New-T2DM cases compared to controls (P<0.001. Plasma HO-1 concentrations were significantly correlated with plasma glucose concentrations, HOMA-beta and HOMA-IR (P<0.001. After adjustment for age, sex, BMI and family history of diabetes, the ORs for New-T2DM in the highest quartile of plasma HO-1 concentrations, compared with the lowest, was 8.23 (95% CI 5.55-12.21; P for trend <0.001. The trend remained significant after additional adjustment for fasting plasma glucose/insulin, HOMA-beta/HOMA-IR, TC/TG, smoking, drinking and history of hypertension, and even in further stratification analysis by age, sex, BMI, smoking, drinking and history of hypertension. CONCLUSIONS: Elevated plasma HO-1 concentrations are associated with higher ORs for New-T2DM, which add more knowledge regarding the important role of oxidative stress in T2DM. More consequent studies were warranted to confirm the clinical utility of plasma HO-1, especially in diagnosis and prognosis of T2DM and its complications.

  14. Astroglia overexpressing heme oxygenase-1 predispose co-cultured PC12 cells to oxidative injury.

    Science.gov (United States)

    Song, Linyang; Song, Wei; Schipper, Hyman M

    2007-08-01

    The mechanisms responsible for the progressive degeneration of dopaminergic neurons and pathologic iron deposition in the substantia nigra pars compacta of patients with Parkinson's disease (PD) remain unclear. Heme oxygenase-1 (HO-1), the rate-limiting enzyme in the oxidative degradation of heme to ferrous iron, carbon monoxide, and biliverdin, is upregulated in affected PD astroglia and may contribute to abnormal mitochondrial iron sequestration in these cells. To determine whether glial HO-1 hyper-expression is toxic to neuronal compartments, we co-cultured dopaminergic PC12 cells atop monolayers of human (h) HO-1 transfected, sham-transfected, or non-transfected primary rat astroglia. We observed that PC12 cells grown atop hHO-1 transfected astrocytes, but not the astroglia themselves, were significantly more susceptible to dopamine (1 microM) + H(2)O(2) (1 microM)-induced death (assessed by nuclear ethidium monoazide bromide staining and anti-tyrosine hydroxylase immunofluorescence microscopy) relative to control preparations. In the experimental group, PC12 cell death was attenuated significantly by the administration of the HO inhibitor, SnMP (1.5 microM), the antioxidant, ascorbate (200 microM), or the iron chelators, deferoxamine (400 microM), and phenanthroline (100 microM). Exposure to conditioned media derived from HO-1 transfected astrocytes also augmented PC12 cell killing in response to dopamine (1 microM) + H(2)O(2) (1 microM) relative to control media. In PD brain, overexpression of HO-1 in nigral astroglia and accompanying iron liberation may facilitate the bioactivation of dopamine to neurotoxic free radical intermediates and predispose nearby neuronal constituents to oxidative damage. (c) 2007 Wiley-Liss, Inc.

  15. Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.

    Science.gov (United States)

    Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li

    2007-04-01

    Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.

  16. Heme oxygenase-1 expression protects the heart from acute injury caused by inducible Cre recombinase.

    Science.gov (United States)

    Hull, Travis D; Bolisetty, Subhashini; DeAlmeida, Angela C; Litovsky, Silvio H; Prabhu, Sumanth D; Agarwal, Anupam; George, James F

    2013-08-01

    The protective effect of heme oxygenase-1 (HO-1) expression in cardiovascular disease has been previously demonstrated using transgenic animal models in which HO-1 is constitutively overexpressed in the heart. However, the temporal requirements for protection by HO-1 induction relative to injury have not been investigated, but are essential to employ HO-1 as a therapeutic strategy in human cardiovascular disease states. Therefore, we generated mice with cardiac-specific, tamoxifen (TAM)-inducible overexpression of a human HO-1 (hHO-1) transgene (myosin heavy chain (MHC)-HO-1 mice) by breeding mice with cardiac-specific expression of a TAM-inducible Cre recombinase (MHC-Cre mice), with mice containing an hHO-1 transgene preceded by a floxed-stop signal. MHC-HO-1 mice overexpress HO-1 mRNA and the enzymatically active protein following TAM administration (40 mg/kg body weight on 2 consecutive days). In MHC-Cre controls, TAM administration leads to severe, acute cardiac toxicity, cardiomyocyte necrosis, and 80% mortality by day 3. This cardiac toxicity is accompanied by a significant increase in inflammatory cells in the heart that are predominantly neutrophils. In MHC-HO-1 mice, HO-1 overexpression ameliorates the depression of cardiac function and high mortality rate observed in MHC-Cre mice following TAM administration and attenuates cardiomyocyte necrosis and neutrophil infiltration. These results highlight that HO-1 induction is sufficient to prevent the depression of cardiac function observed in mice with TAM-inducible Cre recombinase expression by protecting the heart from necrosis and neutrophil infiltration. These findings are important because MHC-Cre mice are widely used in cardiovascular research despite the limitations imposed by Cre-induced cardiac toxicity, and also because inflammation is an important pathological component of many human cardiovascular diseases.

  17. Effect of heme oxygenase-1 transduced bone marrow mesenchymal stem cells on damaged intestinal epithelial cells in vitro.

    Science.gov (United States)

    Cao, Yi; Wu, Ben-Juan; Zheng, Wei-Ping; Yin, Ming-Li; Liu, Tao; Song, Hong-Li

    2017-07-01

    In this study, we explored the effects of mesenchymal stem cells (MSCs) from bone marrow overexpressing heme oxygenase-1 (HO-1) on the damaged human intestinal epithelial barrier in vitro. Rat MSCs were isolated from bone marrow and transduced with rat HO-1 recombinant adenovirus (HO-MSCs) for stable expression of HO-1. Colorectal adenocarinoma 2 (Caco2) cells were treated with tumor necrosis factor-α (TNF-α) to establish a damaged colon epithelial model. Damaged Caco2 were cocultured with MSCs, Ad-MSCs, Ad-HO + MSCs or HO-MSCs. mRNA and protein expression of Zona occludens-1 (ZO-1) and human HO-1 and the release of cytokines were measured. ZO-1 and human HO-1 in Caco2 were significantly decreased after treatment with TNF-α; and this effect was reduced when coculture with MSCs from bone marrow. Expression of ZO-1 was not significantly affected by Caco2 treatment with TNF-α, Ad-HO, and MSCs. In contrast, ZO-1 and human HO-1 increased significantly when the damaged Caco2 was treated with HO-MSCs. HO-MSCs showed the strongest effect on the expression of ZO-1 in colon epithelial cells. Coculture with HO-MSCs showed the most significant effects on reducing the expression of IL-2, IL-6, IFN-γ and increasing the expression of IL-10. HO-MSCs protected the intestinal epithelial barrier, in which endogenous HO-1 was involved. HO-MSCs play an important role in the repair process by reducing the release of inflammatory cytokines and increasing the release of anti-inflammatory factors. These results suggested that HO-MSCs from bone marrow were more effective in repairing the damaged intestinal epithelial barrier, and the effectiveness of MSCs was improved by HO-1 gene transduction, which provides favorable support for the application of stem cell therapy in the intestinal diseases. © 2017 The Authors. Cell Biology International Published by John Wiley & Sons Ltd on behalf of International Federation of Cell Biology.

  18. The role of heme oxygenase-1 in drug metabolizing dysfunction in the alcoholic fatty liver exposed to ischemic injury

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sang Won [Department of Pharmacology, Institute of Health Sciences, Gyeongsang National University School of Medicine, Jinju 52727 (Korea, Republic of); Kang, Jung-Woo [School of Pharmacy, Sungkyunkwan University, Suwon, Gyeonggi-do 16419 (Korea, Republic of); Lee, Sun-Mee, E-mail: sunmee@skku.edu [School of Pharmacy, Sungkyunkwan University, Suwon, Gyeonggi-do 16419 (Korea, Republic of)

    2016-02-01

    This study was designed to investigate the role of heme oxygenase-1 (HO-1) in hepatic drug metabolizing dysfunction after ischemia/reperfusion (IR) in alcoholic fatty liver (AFL). Rats were fed a Lieber–DeCarli diet for five weeks to allow for development of AFL and were then subjected to 90 min of hepatic ischemia and 5 h of reperfusion. Rats were pretreated with hemin (HO-1 inducer) or ZnPP (HO-1 inhibitor) for 16 h and 3 h before hepatic ischemia. After hepatic IR, ethanol diet (ED)-fed rats had higher serum aminotransferase activities and more severe hepatic necrosis compared to the control diet (CD)-fed rats. These changes were attenuated by hemin and exacerbated by ZnPP. The activity and gene expression of HO-1 and its transcription factor (Nrf2) level increased significantly after 5 h of reperfusion in CD-fed rats but not in ED-fed rats. After reperfusion, cytochrome P450 (CYP) 1A1, 1A2, and 2B1 activities were reduced to levels lower than those observed in sham group, whereas CYP2E1 activity increased. The decrease in CYP2B1 activity and the increase in CYP2E1 activity were augmented after hepatic IR in ED-fed animals. These changes were significantly attenuated by hemin but aggravated by ZnPP. Finally, CHOP expression and PERK phosphorylation, microsomal lipid peroxidation, and levels of proinflammatory mediators increased in ED-fed rats compared to CD-fed rats after reperfusion. These increases were attenuated by hemin. Our results suggest that AFL exacerbates hepatic drug metabolizing dysfunction during hepatic IR via endoplasmic reticulum stress and lipid peroxidation and this is associated with impaired HO-1 induction. - Highlights: • Endogenous HO-1 is generated in insufficient quantities in steatotic ischemic injury. • Impaired HO-1 induction leads to excessive ER stress response and lipid peroxidation. • Alcoholic steatosis exacerbates IR-induced hepatic drug-metabolizing dysfunction. • HO-1 induction is required for appropriate medication

  19. Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...

  20. Identification of heme oxygenase-1 stimulators by a convenient ELISA-based bilirubin quantification assay.

    Science.gov (United States)

    Rücker, Hannelore; Amslinger, Sabine

    2015-01-01

    The upregulation of heme oxygenase-1 (HO-1) has proven to be a useful tool for fighting inflammation. In order to identify new HO-1 inducers, an efficient screening method was developed which can provide new lead structures for drug research. We designed a simple ELISA-based HO-1 enzyme activity assay, which allows for the screening of 12 compounds in parallel in the setting of a 96-well plate. The well-established murine macrophage cell line RAW264.7 is used and only about 26µg of protein from whole cell lysates is needed for the analysis of HO-1 activity. The quantification of HO-1 activity is based on an indirect ELISA using the specific anti-bilirubin antibody 24G7 to quantify directly bilirubin in the whole cell lysate, applying a horseradish peroxidase-tagged antibody together with ortho-phenylenediamine and H2O2 for detection. The bilirubin is produced on the action of HO enzymes by converting their substrate heme to biliverdin and additional recombinant biliverdin reductase together with NADPH at pH 7.4 in buffer. This sensitive assay allows for the detection of 0.57-82pmol bilirubin per sample in whole cell lysates. Twenty-three small molecules, mainly natural products with an α,β-unsaturated carbonyl unit such as polyphenols, including flavonoids and chalcones, terpenes, an isothiocyanate, and the drug oltipraz were tested at typically 6 or 24h incubation with RAW264.7 cells. The activity of known HO-1 inducers was confirmed, while the chalcones cardamonin, flavokawain A, calythropsin, 2',3,4'-trihydroxy-4-methoxychalcone (THMC), and 2',4'-dihydroxy-3,4-dimethoxychalcone (DHDMC) were identified as new potent HO-1 inducers. The highest inductive power after 6h incubation was found at 10µM for DHDMC (6.1-fold), carnosol (3.9-fold), butein (3.1-fold), THMC (2.9-fold), and zerumbone (2.5-fold). Moreover, the time dependence of HO-1 protein production for DHDMC was compared to its enzyme activity, which was further evaluated in the presence of

  1. Heme oxygenase-1 induction improves cardiac function following myocardial ischemia by reducing oxidative stress.

    Directory of Open Access Journals (Sweden)

    Yossi Issan

    Full Text Available Oxidative stress plays a key role in exacerbating diabetes and cardiovascular disease. Heme oxygenase-1 (HO-1, a stress response protein, is cytoprotective, but its role in post myocardial infarction (MI and diabetes is not fully characterized. We aimed to investigate the protection and the mechanisms of HO-1 induction in cardiomyocytes subjected to hypoxia and in diabetic mice subjected to LAD ligation.In vitro: cultured cardiomyocytes were treated with cobalt-protoporphyrin (CoPP and tin protoporphyrin (SnPP prior to hypoxic stress. In vivo: CoPP treated streptozotocin-induced diabetic mice were subjected to LAD ligation for 2/24 h. Cardiac function, histology, biochemical damage markers and signaling pathways were measured.HO-1 induction lowered release of lactate dehydrogenase (LDH and creatine phospho kinase (CK, decreased propidium iodide staining, improved cell morphology and preserved mitochondrial membrane potential in cardiomyocytes. In diabetic mice, Fractional Shortening (FS was lower than non-diabetic mice (35±1%vs.41±2, respectively p<0.05. CoPP-treated diabetic animals improved cardiac function (43±2% p<0.01, reduced CK, Troponin T levels and infarct size compared to non-treated diabetic mice (P<0.01, P<0.001, P<0.01 respectively. CoPP-enhanced HO-1 protein levels and reduced oxidative stress in diabetic animals, as indicated by the decrease in superoxide levels in cardiac tissues and plasma TNFα levels (p<0.05. The increased levels of HO-1 by CoPP treatment after LAD ligation led to a shift of the Bcl-2/bax ratio towards the antiapoptotic process (p<0.05. CoPP significantly increased the expression levels of pAKT and pGSK3β (p<0.05 in cardiomyocytes and in diabetic mice with MI. SnPP abolished CoPP's cardioprotective effects.HO-1 induction plays a role in cardioprotection against hypoxic damage in cardiomyocytes and in reducing post ischemic cardiac damage in the diabetic heart as proved by the increased levels of pAKT with

  2. Heme oxygenase-1 enhances autophagy in podocytes as a protective mechanism against high glucose-induced apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Chenglong [Department of Endocrinology, The Second Affiliated Hospital of Nanjing Medical University, Nanjing (China); Zheng, Haining [Department of Hyperbaric Oxygen, Nanjing General Hospital of Nanjing Military Command, Nanjing (China); Huang, Shanshan; You, Na; Xu, Jiarong; Ye, Xiaolong; Zhu, Qun; Feng, Yamin; You, Qiang; Miao, Heng [Department of Endocrinology, The Second Affiliated Hospital of Nanjing Medical University, Nanjing (China); Ding, Dafa, E-mail: dingdafa2004@aliyun.com [Department of Endocrinology, The Second Affiliated Hospital of Nanjing Medical University, Nanjing (China); Lu, Yibing, E-mail: luyibing2004@126.com [Department of Endocrinology, The Second Affiliated Hospital of Nanjing Medical University, Nanjing (China)

    2015-10-01

    Injury and loss of podocytes play vital roles in diabetic nephropathy progression. Emerging evidence suggests autophagy, which is induced by multiple stressors including hyperglycemia, plays a protective role. Meanwhile, heme oxygenase-1 (HO-1) possesses powerful anti-apoptotic properties. Therefore, we investigated the impact of autophagy on podocyte apoptosis under diabetic conditions and its association with HO-1. Mouse podocytes were cultured in vitro; apoptosis was detected by flow cytometry. Transmission electron microscopy and biochemical autophagic flux assays were used to measure the autophagy markers microtubule-associated protein 1 light chain 3-II (LC3-II) and beclin-1. LC3-II and beclin-1 expression peaked 12–24 h after exposing podocytes to high glucose. Inhibition of autophagy with 3-methyladenine or Beclin-1 siRNAs or Atg 5 siRNAs sensitized cells to apoptosis, suggesting autophagy is a survival mechanism. HO-1 inactivation inhibited autophagy, which aggravated podocyte injury in vitro. Hemin-induced autophagy also protected podocytes from hyperglycemia in vitro and was abrogated by HO-1 siRNA. Adenosine monophosphate-activated protein kinase phosphorylation was higher in hemin-treated and lower in HO-1 siRNA-treated podocytes. Suppression of AMPK activity reversed HO-1-mediated Beclin-1 upregulation and autophagy, indicating HO-1-mediated autophagy is AMPK dependent. These findings suggest HO-1 induction and regulation of autophagy are potential therapeutic targets for diabetic nephropathy. - Highlights: • High glucose leads to increased autophagy in podocytes at an early stage. • The early autophagic response protects against high glucose-induced apoptosis. • Heme oxygenase-1 enhances autophagy and decreases high glucose -mediated apoptosis. • Heme oxygenase-1 induces autophagy through the activation of AMPK.

  3. Heme oxygenase-1 enhances autophagy in podocytes as a protective mechanism against high glucose-induced apoptosis

    International Nuclear Information System (INIS)

    Dong, Chenglong; Zheng, Haining; Huang, Shanshan; You, Na; Xu, Jiarong; Ye, Xiaolong; Zhu, Qun; Feng, Yamin; You, Qiang; Miao, Heng; Ding, Dafa; Lu, Yibing

    2015-01-01

    Injury and loss of podocytes play vital roles in diabetic nephropathy progression. Emerging evidence suggests autophagy, which is induced by multiple stressors including hyperglycemia, plays a protective role. Meanwhile, heme oxygenase-1 (HO-1) possesses powerful anti-apoptotic properties. Therefore, we investigated the impact of autophagy on podocyte apoptosis under diabetic conditions and its association with HO-1. Mouse podocytes were cultured in vitro; apoptosis was detected by flow cytometry. Transmission electron microscopy and biochemical autophagic flux assays were used to measure the autophagy markers microtubule-associated protein 1 light chain 3-II (LC3-II) and beclin-1. LC3-II and beclin-1 expression peaked 12–24 h after exposing podocytes to high glucose. Inhibition of autophagy with 3-methyladenine or Beclin-1 siRNAs or Atg 5 siRNAs sensitized cells to apoptosis, suggesting autophagy is a survival mechanism. HO-1 inactivation inhibited autophagy, which aggravated podocyte injury in vitro. Hemin-induced autophagy also protected podocytes from hyperglycemia in vitro and was abrogated by HO-1 siRNA. Adenosine monophosphate-activated protein kinase phosphorylation was higher in hemin-treated and lower in HO-1 siRNA-treated podocytes. Suppression of AMPK activity reversed HO-1-mediated Beclin-1 upregulation and autophagy, indicating HO-1-mediated autophagy is AMPK dependent. These findings suggest HO-1 induction and regulation of autophagy are potential therapeutic targets for diabetic nephropathy. - Highlights: • High glucose leads to increased autophagy in podocytes at an early stage. • The early autophagic response protects against high glucose-induced apoptosis. • Heme oxygenase-1 enhances autophagy and decreases high glucose -mediated apoptosis. • Heme oxygenase-1 induces autophagy through the activation of AMPK

  4. Insulators form gene loops by interacting with promoters in Drosophila.

    Science.gov (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  5. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  6. Involvement of Nrf2-Mediated Upregulation of Heme Oxygenase-1 in Mollugin-Induced Growth Inhibition and Apoptosis in Human Oral Cancer Cells

    Directory of Open Access Journals (Sweden)

    Young-Man Lee

    2013-01-01

    Full Text Available Although previous studies have shown that mollugin, a bioactive phytochemical isolated from Rubia cordifolia L. (Rubiaceae, exhibits antitumor effects, its biological activity in oral cancer has not been reported. We thus investigated the effects and putative mechanism of apoptosis induced by mollugin in human oral squamous cell carcinoma cells (OSCCs. Results show that mollugin induces cell death in a dose-dependent manner in primary and metastatic OSCCs. Mollugin-induced cell death involved apoptosis, characterized by the appearance of nuclear shrinkage, flow cytometric analysis of sub-G1 phase arrest, and annexin V-FITC and propidium iodide staining. Western blot analysis and RT-PCR revealed that mollugin suppressed activation of NF-κB and NF-κB-dependent gene products involved in antiapoptosis (Bcl-2 and Bcl-xl, invasion (MMP-9 and ICAM-1, and angiogenesis (FGF-2 and VEGF. Furthermore, mollugin induced the activation of p38, ERK, and JNK and the expression of heme oxygenase-1 (HO-1 and nuclear factor E2–related factor 2 (Nrf2. Mollugin-induced growth inhibition and apoptosis of HO-1 were reversed by an HO-1 inhibitor and Nrf2 siRNA. Collectively, this is the first report to demonstrate the effectiveness of mollugin as a candidate for a chemotherapeutic agent in OSCCs via the upregulation of the HO-1 and Nrf2 pathways and the downregulation of NF-κB.

  7. The in vitro protection of human decay accelerating factor and hDAF/heme oxygenase-1 transgenes in porcine aortic endothelial cells against sera of Formosan macaques.

    Science.gov (United States)

    Tu, C-F; Tai, H-C; Wu, C-P; Ho, L-L; Lin, Y-J; Hwang, C-S; Yang, T-S; Lee, J-M; Tseng, Y-L; Huang, C-C; Weng, C-N; Lee, P-H

    2010-01-01

    To mitigate hyperacute rejection, pigs have been generated with alpha-Gal transferase gene knockout and transgenic expression of human decay accelerating factor (hDAF), MCP, and CD59. Additionally, heme-oxygenase-1 (HO-1) has been suggested to defend endothelial cells. Sera (MS) (0%, 1%, 5%, 10%, and 15%) from Formosan macaques (Macaca cyclopis, MC), an Old World monkey wildly populated in Taiwan, was used to test the protective in vitro, effects of hDAF or hDAF/hHO-1 on porcine aortic endothelial cells (pAEC) derived from hDAF(+), hDAF(+)/hHO-1(+), and hDAF(+)/hHO-1(-) and 1 nontransgenic pAEC. Ten percent human serum (HS) served as a positive control. When MS addition increased to 10% or 15%, all transgenic pAEC exhibited a greater survival than nontransgenic pAEC. Noticeably, 15% MS reduced survived to 40% in nontransgenic and transgenic pAEC, respectively. These results revealed that hDAF exerted protective effects against MC complement activation. However, comparing with 10% MS and HS in pAEC of nontransgenic pigs, the survivability was higher in HS, suggesting that complement activation by MS was more toxic than that by HS. Furthermore, hDAF(+)/hHO-1(+) showed no further protection against effects of MS on transgenic pAEC. Copyright 2010 Elsevier Inc. All rights reserved.

  8. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  9. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  10. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  11. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  12. Kidneys From α1,3-Galactosyltransferase Knockout/Human Heme Oxygenase-1/Human A20 Transgenic Pigs Are Protected From Rejection During Ex Vivo Perfusion With Human Blood.

    Science.gov (United States)

    Ahrens, Hellen E; Petersen, Björn; Ramackers, Wolf; Petkov, Stoyan; Herrmann, Doris; Hauschild-Quintern, Janet; Lucas-Hahn, Andrea; Hassel, Petra; Ziegler, Maren; Baars, Wiebke; Bergmann, Sabine; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

    2015-07-01

    Multiple modifications of the porcine genome are required to prevent rejection after pig-to-primate xenotransplantation. Here, we produced pigs with a knockout of the α1,3-galactosyltransferase gene (GGTA1-KO) combined with transgenic expression of the human anti-apoptotic/anti-inflammatory molecules heme oxygenase-1 and A20, and investigated their xenoprotective properties. The GGTA1-KO/human heme oxygenase-1 (hHO-1)/human A20 (hA20) transgenic pigs were produced in a stepwise approach using zinc finger nuclease vectors targeting the GGTA1 gene and a Sleeping Beauty vector coding for hA20. Two piglets were analyzed by quantitative reverse-transcription polymerase chain reaction, flow cytometry, and sequencing. The biological function of the genetic modifications was tested in a (51)Chromium release assay and by ex vivo kidney perfusions with human blood. Disruption of the GGTA1 gene by deletion of few basepairs was demonstrated in GGTA1-KO/hHO-1/hA20 transgenic pigs. The hHO-1 and hA20 mRNA expression was confirmed by quantitative reverse-transcription polymerase chain reaction. Ex vivo perfusion of 2 transgenic kidneys was feasible for the maximum experimental time of 240 minutes without symptoms of rejection. Results indicate that GGTA1-KO/hHO-1/hA20 transgenic pigs are a promising model to alleviate rejection and ischemia-reperfusion damage in porcine xenografts and could serve as a background for further genetic modifications toward the production of a donor pig that is clinically relevant for xenotransplantation.

  13. Firefly luciferase gene contains a cryptic promoter

    Czech Academy of Sciences Publication Activity Database

    Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.

    2008-01-01

    Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008

  14. Transforming growth factor β1 enhances heme oxygenase 1 expression in human synovial fibroblasts by inhibiting microRNA 519b synthesis.

    Directory of Open Access Journals (Sweden)

    Shu-Jui Kuo

    Full Text Available Osteoarthritis (OA is manifested by synovial inflammation and cartilage destruction that is directly linked to synovitis, joint swelling and pain. In the light of the role of synovium in the pathogenesis and the symptoms of OA, synovium-targeted therapy is a promising strategy to mitigate the symptoms and progression of OA. Transforming growth factor beta 1 (TGF-β1, a secreted homodimeric protein, possesses unique and potent anti-inflammatory and immune-regulatory properties in many cell types. Heme oxygenase 1 (HO-1 is an inducible anti-inflammatory and stress responsive enzyme that has been proven to prevent injuries caused by many diseases. Despite the similar anti-inflammatory profile and their involvement in the pathogenesis of arthritic diseases, no studies have as yet explored the possibility of any association between the expression of TGF-β1 and HO-1.TGF-β1-induced HO-1 expression was examined by HO-1 promoter assay, qPCR, and Western blotting. The siRNAs and enzyme inhibitors were utilized to determine the intermediate involved in the signal transduction pathway. We showed that TGF-β1 stimulated the synthesis of HO-1 in a concentration- and time-dependent manner, which can be mitigated by blockade of the phospholipase (PLCγ/protein kinase C alpha (PKCα pathway. We also showed that the expression of miRNA-519b, which blocks HO-1 transcription, is inhibited by TGF-β1, and the suppression of miRNA 519b could be reversed via blockade of the PLCγ/PKCα pathway.TGF-β1 stimulated the expression of HO-1 via activating the PLCγ/PKCα pathway and suppressing the downstream expression of miRNA-519b. These results may shed light on the pathogenesis and treatment of OA.

  15. Diabetes Impairs the Vascular Recruitment of Normal Stem Cells by Oxidant Damage, Reversed by Increases in pAMPK, Heme Oxygenase-1, and Adiponectin

    Science.gov (United States)

    Sambuceti, Gianmario; Morbelli, Silvia; Vanella, Luca; Kusmic, Claudia; Marini, Cecilia; Massollo, Michela; Augeri, Carla; Corselli, Mirko; Ghersi, Chiara; Chiavarina, Barbara; Rodella, Luigi F; L'Abbate, Antonio; Drummond, George; Abraham, Nader G; Frassoni, Francesco

    2009-01-01

    Background Atherosclerosis progression is accelerated in diabetes mellitus (DM) by either direct endothelial damage or reduced availability and function of endothelial progenitor cells (EPCs). Both alterations are related to increased oxidant damage. Aim We examined if DM specifically impairs vascular signaling, thereby reducing the recruitment of normal EPCs, and if increases in antioxidant levels by induction of heme oxygenase-1 (HO-1) can reverse this condition. Methods Control and diabetic rats were treated with the HO-1 inducer cobalt protoporphyrin (CoPP) once a week for 3 weeks. Eight weeks after the development of diabetes, EPCs harvested from the aorta of syngenic inbred normal rats and labeled with technetium-99m-exametazime were infused via the femoral vein to estimate their blood clearance and aortic recruitment. Circulating endothelial cells (CECs) and the aortic expression of thrombomodulin (TM), CD31, and endothelial nitric oxide synthase (eNOS) were used to measure endothelial damage. Results DM reduced blood clearance and aortic recruitment of EPCs. Both parameters were returned to control levels by CoPP treatment without affecting EPC kinetics in normal animals. These abnormalities of EPCs in DM were paralleled by reduced serum adiponectin levels, increased numbers of CECs, reduced endothelial expression of phosphorylated eNOS, and reduced levels of TM, CD31, and phosphorylated AMP-activated protein kinase (pAMPK). CoPP treatment restored all of these parameters to normal levels. Conclusion Type II DM and its related oxidant damage hamper the interaction between the vascular wall and normal EPCs by mechanisms that are, at least partially, reversed by the induction of HO-1 gene expression, adiponectin, and pAMPK levels. PMID:19038792

  16. Opposite effect of oxidative stress on inducible nitric oxide synthase and haem oxygenase-1 expression in intestinal inflammation: anti-inflammatory effect of carbon monoxide

    NARCIS (Netherlands)

    Dijkstra, Gerard; Blokzijl, Hans; Bok, Lisette; Homan, Manon; van Goor, Harry; Faber, Klaas Nico; Jansen, Peter L. M.; Moshage, Han

    2004-01-01

    Inducible nitric oxide synthase (iNOS) is expressed in intestinal epithelial cells (IEC) of patients with active inflammatory bowel disease (IBD) and in IEC of endotoxaemic rats. The induction of iNOS in IEC is an element of the NF-kappaB-mediated survival pathway. Haem oxygenase-1 (HO-1) is an

  17. Reduced caveolin-1 promotes hyper-inflammation due to abnormal heme oxygenase-1 localizationin LPS challenged macrophages with dysfunctional CFTR

    Science.gov (United States)

    Zhang, Ping-Xia; Murray, Thomas S.; Villella, Valeria Rachela; Ferrari, Eleonora; Esposito, Speranza; D'Souza, Anthony; Raia, Valeria; Maiuri, Luigi; Krause, Diane S.; Egan, Marie E.; Bruscia, Emanuela M.

    2013-01-01

    We have previously reported that TLR4 signaling is increased in lipopolysaccharide (LPS) -stimulated Cystic Fibrosis (CF) macrophages (MΦs), contributing to the robust production of pro-inflammatory cytokines. The heme oxygenase (HO-1)/carbon monoxide (CO) pathway modulates cellular redox status, inflammatory responses, and cell survival. The HO-1 enzyme, together with the scaffold protein caveolin 1 (CAV-1), also acts as a negative regulator of TLR4 signaling in MΦs. Here, we demonstrate that in LPS-challenged CF MΦs, HO-1 does not compartmentalize normally to the cell surface and instead accumulates intracellularly. The abnormal HO-1 localization in CF MΦs in response to LPS is due to decreased CAV-1 expression, which is controlled by the cellular oxidative state, and is required for HO-1 delivery to the cell surface. Overexpression of HO-1 or stimulating the pathway with CO-releasing molecules (CORM2)enhancesCAV-1 expression in CF MΦs, suggesting a positive-feed forward loop between HO-1/CO induction and CAV-1 expression. These manipulations reestablished HO-1 and CAV-1 cell surface localization in CF MΦ's. Consistent with restoration of HO-1/CAV-1 negative regulation of TLR4 signaling, genetic or pharmacological (CORM2)-induced enhancement of this pathway decreased the inflammatory response of CF MΦs and CF mice treated with LPS. In conclusion, our results demonstrate that the counter-regulatory HO-1/CO pathway, which is critical in balancing and limiting the inflammatory response, is defective in CF MΦs through a CAV-1-dependent mechanism, exacerbating the CF MΦ's response to LPS. This pathway could be a potential target for therapeutic intervention for CF lung disease. PMID:23606537

  18. A novel BDNF gene promoter directs expression to skeletal muscle

    Directory of Open Access Journals (Sweden)

    Heinrich Gerhard

    2003-06-01

    Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are

  19. Heme oxygenase-1 dependant pathway contributes to protection by tetramethylpyrazine against chronic hypoxic injury on medulla oblongata in rats.

    Science.gov (United States)

    Ding, Yan; Hou, Xuefei; Chen, Li; Zhou, Hua; Gong, Yanju; Dai, Liqun; Zheng, Yu

    2016-02-15

    Tetramethylpyrazine (TMP), one of the active ingredients of the Chinese herb Lingusticum Wallichii (Chuan Xiong) has been proved to protect the medulla oblongata from chronic hypoxia injury. However, the underlying mechanism remains unclear. The purpose of this study was to determine whether the protective effects of TMP are associated with the heme oxygenase-1 (HO-1) dependant pathway in adult rats. The morphological changes of neurons in the hypoglossal nucleus (12N), the nucleus ambiguus (Amb), the nucleus tractus solitarius (NTS), and the pre-Bötzinger complex (pre-BötC) were investigated by Nissl staining; the malondialdehyde (MDA) content and superoxide dismutase (SOD) activity were measured to evaluate the anti-oxidant effect; some apoptosis parameters, Bax mRNA and Bcl-2 mRNA, were tested; and the double immunochemistry staining of active caspase-3/NeuN was performed. Meanwhile, the HO-1 protein expression and heme oxygenase (HO) activity were examined. Tin-protoporphyrin (SnPP), a potent inhibitor of HO, was used to further confirm the effect of HO-1. We found that TMP ameliorated the neuron loss in 12N, Amb and NTS, the decrease in SOD activity and the increase in MDA content, the decrease in Bcl-2 mRNA of medulla oblongata (Pmedulla oblongata in the rats. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Involvement of Heme Oxygenase-1 Participates in Anti-Inflammatory and Analgesic Effects of Aqueous Extract of Hibiscus taiwanensis.

    Science.gov (United States)

    Liu, Shu-Ling; Deng, Jeng-Shyan; Chiu, Chuan-Sung; Hou, Wen-Chi; Huang, Shyh-Shyun; Lin, Wang-Ching; Liao, Jung-Chun; Huang, Guan-Jhong

    2012-01-01

    Anti-inflammatory effects of the aqueous extract of Hibiscus taiwanensis (AHT) were used in lipopolysaccharide (LPS-)stimulated mouse macrophage RAW264.7 cells and carrageenan (Carr-)induced mouse paw edema model. When RAW264.7 macrophages were treated with AHT together with LPS, a concentration-dependent inhibition of nitric oxide (NO), tumor necrosis factor (TNF-α), and prostaglandin E2 (PGE(2)) levels productions were detected. Western blotting revealed that AHT blocked protein expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2), and elevated heme oxygenase-1 (HO-1), significantly. In the animal test, AHT decreased the paw edema at the 4th and the 5th h after Carr administration, and it increased the activities of catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPx) in the paw tissue. We also demonstrated AHT decreased the NO, TNF-α, and PGE2 levels on the serum level at the 5th h after the Carr injection. Western blotting revealed that AHT decreased Carr-induced iNOS, and COX-2, and increased HO-1 expressions at the 5th h in the edema paw. These findings demonstrated that AHT has excellent anti-inflammatory activities in vitro and in vivo and thus it has great potential to be used as a source for natural health products.

  1. Involvement of Heme Oxygenase-1 Participates in Anti-Inflammatory and Analgesic Effects of Aqueous Extract of Hibiscus taiwanensis

    Directory of Open Access Journals (Sweden)

    Shu-Ling Liu

    2012-01-01

    Full Text Available Anti-inflammatory effects of the aqueous extract of Hibiscus taiwanensis (AHT were used in lipopolysaccharide (LPS-stimulated mouse macrophage RAW264.7 cells and carrageenan (Carr-induced mouse paw edema model. When RAW264.7 macrophages were treated with AHT together with LPS, a concentration-dependent inhibition of nitric oxide (NO, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2 levels productions were detected. Western blotting revealed that AHT blocked protein expression of inducible nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2, and elevated heme oxygenase-1 (HO-1, significantly. In the animal test, AHT decreased the paw edema at the 4th and the 5th h after Carr administration, and it increased the activities of catalase (CAT, superoxide dismutase (SOD, and glutathione peroxidase (GPx in the paw tissue. We also demonstrated AHT decreased the NO, TNF-α, and PGE2 levels on the serum level at the 5th h after the Carr injection. Western blotting revealed that AHT decreased Carr-induced iNOS, and COX-2, and increased HO-1 expressions at the 5th h in the edema paw. These findings demonstrated that AHT has excellent anti-inflammatory activities in vitro and in vivo and thus it has great potential to be used as a source for natural health products.

  2. Pharmacological Inhibition of Host Heme Oxygenase-1 Suppresses Mycobacterium tuberculosis Infection In Vivo by a Mechanism Dependent on T Lymphocytes

    Directory of Open Access Journals (Sweden)

    Diego L. Costa

    2016-10-01

    Full Text Available Heme oxygenase-1 (HO-1 is a stress response antioxidant enzyme which catalyzes the degradation of heme released during inflammation. HO-1 expression is upregulated in both experimental and human Mycobacterium tuberculosis infection, and in patients it is a biomarker of active disease. Whether the enzyme plays a protective versus pathogenic role in tuberculosis has been the subject of debate. To address this controversy, we administered tin protoporphyrin IX (SnPPIX, a well-characterized HO-1 enzymatic inhibitor, to mice during acute M. tuberculosis infection. These SnPPIX-treated animals displayed a substantial reduction in pulmonary bacterial loads comparable to that achieved following conventional antibiotic therapy. Moreover, when administered adjunctively with antimycobacterial drugs, the HO-1 inhibitor markedly enhanced and accelerated pathogen clearance. Interestingly, both the pulmonary induction of HO-1 expression and the efficacy of SnPPIX treatment in reducing bacterial burden were dependent on the presence of host T lymphocytes. Although M. tuberculosis expresses its own heme-degrading enzyme, SnPPIX failed to inhibit its enzymatic activity or significantly restrict bacterial growth in liquid culture. Together, the above findings reveal mammalian HO-1 as a potential target for host-directed monotherapy and adjunctive therapy of tuberculosis and identify the immune response as a critical regulator of this function.

  3. Covalent heme attachment to the protein in human heme oxygenase-1 with selenocysteine replacing the His25 proximal iron ligand.

    Science.gov (United States)

    Jiang, Yongying; Trnka, Michael J; Medzihradszky, Katalin F; Ouellet, Hugues; Wang, Yongqiang; Ortiz de Montellano, Paul R

    2009-03-01

    To characterize heme oxygenase with a selenocysteine (SeCys) as the proximal iron ligand, we have expressed truncated human heme oxygenase-1 (hHO-1) His25Cys, in which Cys-25 is the only cysteine, in the Escherichia coli cysteine auxotroph strain BL21(DE3)cys. Selenocysteine incorporation into the protein was demonstrated by both intact protein mass measurement and mass spectrometric identification of the selenocysteine-containing tryptic peptide. One selenocysteine was incorporated into approximately 95% of the expressed protein. Formation of an adduct with Ellman's reagent (DTNB) indicated that the selenocysteine in the expressed protein was in the reduced state. The heme-His25SeCys hHO-1 complex could be prepared by either (a) supplementing the overexpression medium with heme, or (b) reconstituting the purified apoprotein with heme. Under reducing conditions in the presence of imidazole, a covalent bond is formed by addition of the selenocysteine residue to one of the heme vinyl groups. No covalent bond is formed when the heme is replaced by mesoheme, in which the vinyls are replaced by ethyl groups. These results, together with our earlier demonstration that external selenolate ligands can transfer an electron to the iron [Y. Jiang, P.R. Ortiz de Montellano, Inorg. Chem. 47 (2008) 3480-3482 ], indicate that a selenyl radical is formed in the hHO-1 His25SeCys mutant that adds to a heme vinyl group.

  4. Comparison of the crystal structure and function to wild-type and His25Ala mutant human heme oxygenase-1.

    Science.gov (United States)

    Zhou, Wen-Pu; Zhong, Wen-Wei; Zhang, Xue-Hong; Ding, Jian-Ping; Zhang, Zi-Li; Xia, Zhen-Wei

    2009-03-01

    Human heme oxygenase-1 (hHO-1) is a rate-limiting enzyme in heme metabolism. It regulates serum bilirubin level. Site-directed mutagenesis studies indicate that the proximal residue histidine 25 (His25) plays a key role in hHO-1 activity. A highly purified hHO-1 His25Ala mutant was generated and crystallized with a new expression system. The crystal structure of the mutant was determined by X-ray diffraction technology and molecular replacement at the resolution of 2.8 A, and the model of hHO-1 His25Ala mutant was refined. The final crystallographic and free R factors were 0.245 and 0.283, respectively. The standard bond length deviation was 0.007 A, and the standard bond angle deviation was 1.3 degrees . The mutation of His25 to Ala led to an empty pocket underneath the ferric ion in the heme, leading to loss of binding iron ligand. Although this did not cause an overall structural change, the enzymatic activity of the mutant hHO-1 was reduced by 90%. By supplementing imidazole, the HO-1 activity was restored approximately 90% to its normal level. These data suggest that Ala25 remains unchanged in the structure compared to His25, but the important catalytic function of hHO-1 is lost. Thus, it appears that His25 is a crucial residue for proper hHO-1 catalysis.

  5. An improved method for purification of recombinant truncated heme oxygenase-1 by expanded bed adsorption and gel filtration.

    Science.gov (United States)

    Hu, Hong-Bo; Wang, Wei; Han, Ling; Zhou, Wen-Pu; Zhang, Xue-Hong

    2007-03-01

    Recombinant truncated human heme oxygenase-1 (hHO-1) expressed in Escherichia coli was efficiently separated and purified from feedstock by DEAE-ion exchange expanded bed adsorption. Protocol optimization of hHO-1 on DEAE adsorbent resulted in adsorption in 0 M NaCl and elution in 150 mM NaCl at a pH of 8.5. The active enzyme fractions separated from the expanded bed column were further purified by a Superdex 75 gel filtration step. The specific hHO-1 activity increased from 0.82 +/- 0.05 to 24.8 +/- 1.8 U/mg during the whole purification steps. The recovery and purification factor of truncated hHO-1 of the whole purification were 72.7 +/- 4.7 and 30.2 +/- 2.3%, respectively. This purification process can decrease the demand on the preparation of feedstock and simplify the purification process.

  6. Alpha-7 nicotinic acetylcholine receptor agonist treatment in a rat model of Huntington's disease and involvement of heme oxygenase-1

    Directory of Open Access Journals (Sweden)

    Laura Foucault-Fruchard

    2018-01-01

    Full Text Available Neuroinflammation is a common element involved in the pathophysiology of neurodegenerative diseases. We recently reported that repeated alpha-7 nicotinic acetylcholine receptor (α7nAChR activations by a potent agonist such as PHA 543613 in quinolinic acid-injured rats exhibited protective effects on neurons. To further investigate the underlying mechanism, we established rat models of early-stage Huntington's disease by injection of quinolinic acid into the right striatum and then intraperitoneally injected 12 mg/kg PHA 543613 or sterile water, twice a day during 4 days. Western blot assay results showed that the expression of heme oxygenase-1 (HO-1, the key component of the cholinergic anti-inflammatory pathway, in the right striatum of rat models of Huntington's disease subjected to intraperitoneal injection of PHA 543613 for 4 days was significantly increased compared to the control rats receiving intraperitoneal injection of sterile water, and that the increase in HO-1 expression was independent of change in α7nAChR expression. These findings suggest that HO-1 expression is unrelated to α7nAChR density and the increase in HO-1 expression likely contributes to α7nAChR activation-related neuroprotective effect in early-stage Huntington's disease.

  7. Epigallocatechin-3-gallate (EGCG) protects skin cells from ionizing radiation via heme oxygenase-1 (HO-1) overexpression

    International Nuclear Information System (INIS)

    Zhu Wei; Xu Jing; Ge Yangyang

    2014-01-01

    Epigallocatechin-3-gallate (EGCG), the major polyphenolic constituent of green tea, is a potent antioxidant and free radical scavenger that may have therapeutic applications for the treatment of many disorders. Radiation therapy is widely used for the treatment of various types of cancers; however, radiation-induced skin injury remains a serious concern. EGCG has not yet been reported as protecting skin cells against ionizing radiation. In the present study, we investigated whether EGCG confers cytoprotection against ionizing radiation. We found that, compared with the control, pretreatment with EGCG significantly enhanced the viability of human skin cells that were irradiated with X-rays, and decreased apoptosis induced by X-ray irradiation. Mito-Tracker assay showed that EGCG suppressed the damage to mitochondria induced by ionizing radiation via upregulation of SOD2. Reactive oxygen species (ROS) in HaCaT cells were significantly reduced when pretreated with EGCG before irradiation. Radiation-induced γH2AX foci, which are representative of DNA double-strand breaks, were decreased by pretreatment with EGCG. Furthermore, EGCG induced the expression of the cytoprotective molecule heme oxygenase-1 (HO-1) in a dose-dependent manner via transcriptional activation. HO-1 knockdown or treatment with the HO-1 inhibitor tin protoporphyrin (SnPPIX) reversed the protective role of EGCG, indicating an important role for HO-1. These results suggest that EGCG offers a new strategy for protecting skin against ionizing radiation. (author)

  8. Heme oxygenase-1 affects generation and spontaneous cardiac differentiation of induced pluripotent stem cells.

    Science.gov (United States)

    Stepniewski, Jacek; Pacholczak, Tomasz; Skrzypczyk, Aniela; Ciesla, Maciej; Szade, Agata; Szade, Krzysztof; Bidanel, Romain; Langrzyk, Agnieszka; Grochowski, Radoslaw; Vandermeeren, Felix; Kachamakova-Trojanowska, Neli; Jez, Mateusz; Drabik, Grazyna; Nakanishi, Mahito; Jozkowicz, Alicja; Dulak, Jozef

    2018-02-01

    Cellular stress can influence efficiency of iPSCs generation and their differentiation. However, the role of intracellular cytoprotective factors in these processes is still not well known. Therefore, we investigated the effect of HO-1 (Hmox1) or Nrf2 (Nfe2l2), two major cytoprotective genes. Hmox1 -/- fibroblasts demonstrated decreased reprogramming efficiency in comparison to Hmox1 +/+ cells. Reversely, pharmacological enhancement of HO-1 resulted in higher number of iPSCs colonies. Importantly, elevated level of both p53 and p53-regulated miR-34a and 14-3-3σ was observed in HO-1-deficient fibroblasts whereas downregulation of p53 in these cells markedly increased their reprogramming efficiency. In human fibroblasts HO-1 silencing also induced p53 expression and affected reprogramming outcome. Hmox1 +/+ and Hmox1 -/- iPSCs similarly differentiated in vitro to cells originating from three germ layers, however, lower number of contracting cells was observed during this process in HO-1-deficient cells indicating attenuated cardiac differentiation. Importantly, silencing of Hmox1 in murine ESC using CRISPR/Cas-9 editing also impaired their spontaneous cardiac differentiation. Decreased reprogramming efficiency was also observed in Nrf2-lacking fibroblasts. Reversely, sulforaphane, a Nrf2 activator, increased the number of iPSCs colonies. However, both Nfe2l2 +/+ and Nfe2l2 -/- iPSCs showed similar pluripotency and differentiation capacity. These results indicate that regulation of HO-1 expression can further optimize generation and cardiac differentiation of iPSCs. © 2018 IUBMB Life, 70(2):129-142, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

  9. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  10. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  11. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  12. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  13. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

    Science.gov (United States)

    Mishra, Avinash; Tanna, Bhakti

    2017-01-01

    Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  14. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-05-01

    Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  15. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  16. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  17. Heme oxygenase-1-mediated autophagy protects against pulmonary endothelial cell death and development of emphysema in cadmium-treated mice

    Science.gov (United States)

    Surolia, Ranu; Karki, Suman; Kim, Hyunki; Yu, Zhihong; Kulkarni, Tejaswini; Mirov, Sergey B.; Carter, A. Brent; Rowe, Steven M.; Matalon, Sadis; Thannickal, Victor J.; Agarwal, Anupam

    2015-01-01

    Pulmonary exposure to cadmium, a major component of cigarette smoke, has a dramatic impact on lung function and the development of emphysema. Cigarette smoke exposure induces heme oxygenase-1 (HO-1), a cytoprotective enzyme. In this study, we employed a truncated mouse model of emphysema by intratracheal instillation of cadmium (CdCl2) solution (0.025% per 1 mg/kg body wt) in HO-1+/+, HO-1−/−, and overexpressing humanized HO-1 bacterial artificial chromosome (hHO-1BAC) mice. We evaluated the role of HO-1 in cadmium-induced emphysema in mice by analyzing histopathology, micro-computed tomography scans, and lung function tests. CdCl2-exposed HO-1−/− mice exhibited more severe emphysema compared with HO-1+/+ or hHO-1BAC mice. Loss of pulmonary endothelial cells (PECs) from the alveolar capillary membrane is recognized to be a target in emphysema. PECs from HO-1+/+, HO-1−/−, and hHO-1BAC were employed to define the underlying molecular mechanism for the protection from emphysema by HO-1. Electron microscopy, expression of autophagic markers (microtubule-associated protein 1B-light chain 3 II, autophagy protein 5, and Beclin1) and apoptotic marker (cleaved caspase 3) suggested induction of autophagy and apoptosis in PECs after CdCl2 treatment. CdCl2-treated HO-1−/− PECs exhibited downregulation of autophagic markers and significantly increased cleaved caspase 3 expression and activity (∼4-fold higher). Moreover, hHO-1BAC PECs demonstrated upregulated autophagy and absence of cleaved caspase 3 expression or activity. Pretreatment of HO-1+/+ PECs with rapamycin induced autophagy and resulted in reduced cell death upon cadmium treatment. Induction of autophagy following CdCl2 treatment was found to be protective from apoptotic cell death. HO-1 induced protective autophagy in PECs and mitigated cadmium-induced emphysema. PMID:26071551

  18. Impact of Bariatric Surgery on Heme Oxygenase-1, Inflammation, and Insulin Resistance in Morbid Obesity with Obstructive Sleep Apnea.

    Science.gov (United States)

    Tirado, Raquel; Masdeu, Maria José; Vigil, Laura; Rigla, Mercedes; Luna, Alexis; Rebasa, Pere; Pareja, Rocío; Hurtado, Marta; Caixàs, Assumpta

    2017-09-01

    Morbid obesity and obstructive sleep apnea (OSA) interact at an inflammatory level. Bariatric surgery reduces inflammatory responses associated with obesity. Heme oxygenase-1 (HO-1) is an enzyme with anti-inflammatory properties, which might be increased in morbid obesity or OSA. We studied morbidly obese patients with OSA to determine: (a) HO-1 plasma concentrations according to OSA severity and their relationship with insulin resistance and inflammation and (b) the impact of bariatric surgery on HO-1 and parameters of insulin resistance and inflammation. We analyzed the homeostasis model insulin resistance index (HOMA) and plasma concentrations of HO-1, tumor necrosis factor alpha, interleukin-6, interleukin-1-beta, C reactive protein (CRP), and adiponectin according to polysomnography findings in 66 morbidly obese patients before bariatric surgery and 12 months after surgery. Before surgery, HO-1 plasma concentrations were similar in three groups of patients with mild, moderate, and severe OSA, and correlated with HOMA (r = 0.27, p = 0.02). Twelve months after surgery, low-grade inflammation and insulin resistance had decreased in all the groups, but HO-1 plasma concentration had decreased only in the severe OSA group (p = 0.02). In this group, the reduction in HO-1 correlated with a reduction in CRP concentrations (r = 0.43, p = 0.04) and with improved HOMA score (r = 0.37, p = 0.03). Bariatric surgery decreases HO-1 concentrations in morbid obesity with severe OSA, and this decrease is associated with decreases in insulin resistance and in inflammation.

  19. Identification of Heme Oxygenase-1 as a Novel Predictor of Hematopoietic Stem Cell Transplantation Outcomes in Acute Leukemia

    Directory of Open Access Journals (Sweden)

    Yinghao Lu

    2016-09-01

    Full Text Available Objective: The main aim of this study was to determine the correlation between clinical outcome and heme oxygenase-1 (HO-1 expression before and after hematopoietic stem cell transplantation (HSCT in acute leukemia. Methods: HO-1 mRNA levels in 83 patients were measured using qRT-PCR. In a comparative analysis of HO-1 levels in relation to different post-transplant outcomes, the HO-1 threshold, determined via the receiver operating characteristic (ROC curve, was effectively used to predict clinical relapse and acute graft-versus-host disease (aGVHD. The correlations among clinical relapse, aGVHD and HO-1 expression were analyzed based on this threshold. Results: Leukemia risk stratification and relative expression of HO-1 before pretreatment had significant effects on clinical relapse. Leukemia risk stratification, relative expression of HO-1 after HSCT and the interval from diagnosis to transplantation had a significant influence on aGVHD. Both relapse and aGVHD appeared to be associated with relative HO-1 expression. The relative expression rate of HO-1 was 1.131-1.186 before pretreatment, and strongly associated with post-transplantation relapse. The relative expression rate of HO-1 was 1.102-1.144 after transplantation, and closely related to aGVHD. ROC curve analysis revealed high specificity and sensitivity of HO-1 expression in predicting relapse and aGVHD after allo-HSCT. Conclusions: HO-1 expression can be effectively used as a predictor of relapse as well as a diagnostic factor of aGVHD after transplantation for allo-HSCT patients with acute leukemia.

  20. Effect of heme oxygenase-1 on the protection of ischemia reperfusion injury of bile duct in rats after liver transplantation.

    Science.gov (United States)

    Zhan, Xi; Zhang, Zhiqing; Huang, Hanfei; Zhang, Yujun; Zeng, Zhong

    2018-06-01

    To investigate the effect of heme oxygenase-1 (HO-1) on the ischemic reperfusion injury (IRI) of bile duct in rat models after liver transplantation. 320 SD rats were equally and randomly divided into 5 groups, which were group A receiving injection of 3×10 8 /pfu/ml adenovirus (adv), group B with donor receiving Adv-HO-1 and recipient receiving Adv-HO-1-siRNA, group C with donor and recipient both receiving Adv-HO-1, group D with donor receiving Adv-HO-1-siRNA and recipient receiving Adv-HO-1, and group E with donor and recipient both receiving Adv-HO-1-siRNA at 24h before liver transplantation. Donor liver was stored in UW liquid at 4°C followed by measuring HO-1 level by western blot before transplantation. On d1, d3, d7 and d14, serum and liver was isolated for analysis of liver function, inflammatory cell infiltration by H&E staining, ultrastructure of liver by transmission electron microscopy as well as the expression of HO-1, Bsep, Mrp2 and Ntcp by western blot. Compared with group D and E, group B and C displayed improved liver function as demonstrated by lower level of ALT, AST, LDH, TBIL, ALP and GGT, increased secretion of TBA and PL as well as expression of transporter proteins (Bsep, Mrp2 and Ntcp), reduced inflammatory cells infiltration and liver injury. Our study demonstrated that overexpression of HO-1 in donor liver can ameliorate the damage to bile duct and liver, and improved liver function, suggesting HO-1 might be a new therapeutic target in the treatment of IRI after liver transplantation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. Omega-3 fatty acids protect the brain against ischemic injury by activating Nrf2 and upregulating heme oxygenase 1.

    Science.gov (United States)

    Zhang, Meijuan; Wang, Suping; Mao, Leilei; Leak, Rehana K; Shi, Yejie; Zhang, Wenting; Hu, Xiaoming; Sun, Baoliang; Cao, Guodong; Gao, Yanqin; Xu, Yun; Chen, Jun; Zhang, Feng

    2014-01-29

    Ischemic stroke is a debilitating clinical disorder that affects millions of people, yet lacks effective neuroprotective treatments. Fish oil is known to exert beneficial effects against cerebral ischemia. However, the underlying protective mechanisms are not fully understood. The present study tests the hypothesis that omega-3 polyunsaturated fatty acids (n-3 PUFAs) attenuate ischemic neuronal injury by activating nuclear factor E2-related factor 2 (Nrf2) and upregulating heme oxygenase-1 (HO-1) in both in vitro and in vivo models. We observed that pretreatment of rat primary neurons with docosahexaenoic acid (DHA) significantly reduced neuronal death following oxygen-glucose deprivation. This protection was associated with increased Nrf2 activation and HO-1 upregulation. Inhibition of HO-1 activity with tin protoporphyrin IX attenuated the protective effects of DHA. Further studies showed that 4-hydroxy-2E-hexenal (4-HHE), an end-product of peroxidation of n-3 PUFAs, was a more potent Nrf2 inducer than 4-hydroxy-2E-nonenal derived from n-6 PUFAs. In an in vivo setting, transgenic mice overexpressing fatty acid metabolism-1, an enzyme that converts n-6 PUFAs to n-3 PUFAs, were remarkably resistant to focal cerebral ischemia compared with their wild-type littermates. Regular mice fed with a fish oil-enhanced diet also demonstrated significant resistance to ischemia compared with mice fed with a regular diet. As expected, the protection was associated with HO-1 upregulation, Nrf2 activation, and 4-HHE generation. Together, our data demonstrate that n-3 PUFAs are highly effective in protecting the brain, and that the protective mechanisms involve Nrf2 activation and HO-1 upregulation by 4-HHE. Further investigation of n-3 PUFA neuroprotective mechanisms may accelerate the development of stroke therapies.

  2. Heme oxygenase-1-mediated autophagy protects against pulmonary endothelial cell death and development of emphysema in cadmium-treated mice.

    Science.gov (United States)

    Surolia, Ranu; Karki, Suman; Kim, Hyunki; Yu, Zhihong; Kulkarni, Tejaswini; Mirov, Sergey B; Carter, A Brent; Rowe, Steven M; Matalon, Sadis; Thannickal, Victor J; Agarwal, Anupam; Antony, Veena B

    2015-08-01

    Pulmonary exposure to cadmium, a major component of cigarette smoke, has a dramatic impact on lung function and the development of emphysema. Cigarette smoke exposure induces heme oxygenase-1 (HO-1), a cytoprotective enzyme. In this study, we employed a truncated mouse model of emphysema by intratracheal instillation of cadmium (CdCl2) solution (0.025% per 1 mg/kg body wt) in HO-1(+/+), HO-1(-/-), and overexpressing humanized HO-1 bacterial artificial chromosome (hHO-1BAC) mice. We evaluated the role of HO-1 in cadmium-induced emphysema in mice by analyzing histopathology, micro-computed tomography scans, and lung function tests. CdCl2-exposed HO-1(-/-) mice exhibited more severe emphysema compared with HO-1(+/+) or hHO-1BAC mice. Loss of pulmonary endothelial cells (PECs) from the alveolar capillary membrane is recognized to be a target in emphysema. PECs from HO-1(+/+), HO-1(-/-), and hHO-1BAC were employed to define the underlying molecular mechanism for the protection from emphysema by HO-1. Electron microscopy, expression of autophagic markers (microtubule-associated protein 1B-light chain 3 II, autophagy protein 5, and Beclin1) and apoptotic marker (cleaved caspase 3) suggested induction of autophagy and apoptosis in PECs after CdCl2 treatment. CdCl2-treated HO-1(-/-) PECs exhibited downregulation of autophagic markers and significantly increased cleaved caspase 3 expression and activity (∼4-fold higher). Moreover, hHO-1BAC PECs demonstrated upregulated autophagy and absence of cleaved caspase 3 expression or activity. Pretreatment of HO-1(+/+) PECs with rapamycin induced autophagy and resulted in reduced cell death upon cadmium treatment. Induction of autophagy following CdCl2 treatment was found to be protective from apoptotic cell death. HO-1 induced protective autophagy in PECs and mitigated cadmium-induced emphysema. Copyright © 2015 the American Physiological Society.

  3. Management of oxidative stress by heme oxygenase-1 in cisplatin-induced toxicity in renal tubular cells.

    Science.gov (United States)

    Schaaf, G J; Maas, R F M; de Groene, E M; Fink-Gremmels, J

    2002-08-01

    Induction of heme oxygenase-1 (HO-1) may serve as an immediate protective response during treatment with the cytostatic drug cisplatin (CDDP). Oxidative pathways participate in the characteristic nephrotoxicity of CDDP. In the present study, cultured tubular cells (LLC-PK1) were used to investigate whether induction of HO provided protection against CDDP by maintaining the cellular redox balance. The antioxidants, alpha-tocopherol (TOCO) and N-acetylcysteine (NAC), were used to demonstrate that elevation of ROS levels contribute to the development of CDDP-induced cytotoxicity. Chemical modulators of HO activity were used to investigate the role of HO herein. Hemin was used to specifically induce HO-1, while exposure of the cells to tin-protoporphyrin (SnPP) was shown to inhibit HO activity. Hemin treatment prior to CDDP-exposure significantly decreased the generation of ROS to control levels, while inhibition of HO increased the ROS levels beyond the levels measured in cells treated with CDDP alone. Furthermore, HO induction protected significantly against the cytotoxicity of CDDP, although this protection was limited. Similar results were obtained when the cells were preincubated with TOCO, suggesting that mechanisms other than impairment of the redox ratio are important in CDDP-induced loss of cell viability in vitro. In addition, SnPP treatment exacerbated the oxidative response and cytotoxicity of CDDP, especially at low CDDP concentrations. We therefore conclude that HO is able to directly limit the CDDP-induced oxidative stress response and thus serves as safeguard of the cellular redox balance.

  4. Mycobacterium tuberculosis Induction of Heme Oxygenase-1 Expression Is Dependent on Oxidative Stress and Reflects Treatment Outcomes

    Directory of Open Access Journals (Sweden)

    Neesha Rockwood

    2017-05-01

    Full Text Available The antioxidant enzyme heme oxygenase-1 (HO-1 is implicated in the pathogenesis of tuberculosis (TB and has been proposed as a biomarker of active disease. Nevertheless, the mechanisms by which Mycobacterium tuberculosis (Mtb induces HO-1 as well as how its expression is affected by HIV-1 coinfection and successful antitubercular therapy (ATT are poorly understood. We found that HO-1 expression is markedly increased in rabbits, mice, and non-human primates during experimental Mtb infection and gradually decreased during ATT. In addition, we examined circulating concentrations of HO-1 in a cohort of 130 HIV-1 coinfected and uninfected pulmonary TB patients undergoing ATT to investigate changes in expression of this biomarker in relation to HIV-1 status, radiological disease severity, and treatment outcome. We found that plasma levels of HO-1 were elevated in untreated HIV-1 coinfected TB patients and correlated positively with HIV-1 viral load and negatively with CD4+ T cell count. In both HIV-1 coinfected and Mtb monoinfected patients, HO-1 levels were substantially reduced during successful TB treatment but not in those who experienced treatment failure or subsequently relapsed. To further delineate the molecular mechanisms involved in induction of HO-1 by Mtb, we performed a series of in vitro experiments using mouse and human macrophages. We found that Mtb-induced HO-1 expression requires NADPH oxidase-dependent reactive oxygen species production induced by the early-secreted antigen ESAT-6, which in turn triggers nuclear translocation of the transcription factor NRF-2. These observations provide further insight into the utility of HO-1 as a biomarker of both disease and successful therapy in TB monoinfected and HIV-TB coinfected patients and reveal a previously undocumented pathway linking expression of the enzyme with oxidative stress.

  5. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Genes that cooperate with tumor promoters in transformation

    International Nuclear Information System (INIS)

    Colburn, N.H.; Smith, B.M.

    1988-01-01

    Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation

  7. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  8. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential

  9. The altered promoter methylation of oxytocin receptor gene in autism.

    Science.gov (United States)

    Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak

    Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.

  10. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  11. Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Victoria Gonzalo

    Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant

  12. Promoter Methylation Analysis of IDH Genes in Human Gliomas

    International Nuclear Information System (INIS)

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  13. Intrinsically bent DNA in replication origins and gene promoters.

    Science.gov (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

    2008-06-24

    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  14. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

    Science.gov (United States)

    Meng, C X; Wei, W; Su, Z- L; Qin, S

    2006-10-01

    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  15. 50 Hz electric field effects on protein carbonyl (PCO), heme oxygenase-1 (HO-1) and hydroxyproline levels

    International Nuclear Information System (INIS)

    Ozgur, Elcin; Goknur, Guler; Seyhan, Nesrin

    2008-01-01

    Full text: Non-ionizing electromagnetic field (EMF) radiation sources, such as power lines and other Extremely Low Frequency (ELF) sources have become one of the most ubiquitous components of the spectrum of the human environment, and the possibility that they may have hazardous effects on human health is a major a public concern. Although it is well documented that EMFs have biological effects, the degree to which these exposures constitute a human health hazard is not clear yet. Today relation between production of oxidative stress resulted by reactive oxygen species and electrical stimulus, also the protective effects of antioxidant treatments are mentioned in many researches. In this study, it was aimed to determine both oxidation of proteins and protein collagen levels under 50 Hz 12 kV/m vertical Electric (E) Field exposure and the N-Acetylcysteine (NAC) administration which is a well-known antioxidant. To this end, protein carbonyl levels (PCO) as bio-markers of oxidative stress and Heme oxygenase-1 (HO-1), an enzyme that catalyzes the degradation of heme analyzed to figure out the protein oxidation. Hydroxyproline level, a major component of the protein collagen was measured in order to express the level of collagen in lung tissue. Guinea pigs, weighted 250-300 g, were used in the study. A total forty male guinea pigs were randomly divided into four groups which are composed of 10 guinea pigs each for groups: 1) Group I (Sham); 2) Group II (NAC-administrated group); 3) Group III (E Field Exposure group); 4) Group IV (NAC administrated + E Field exposed group). One week exposure period for 8 hours per daily was conducted for each exposure groups (Group III, Group IV ). The electric field exposure period was from 9 a.m. to 5 p.m. After the last exposure day, the guinea pigs were anesthetized by the injection of ketamine and xylazine. The guinea pigs were killed by decapitation. Statistical analyses were carried out using SPSS software (SPSS 11.5 for windows

  16. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    Science.gov (United States)

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  18. Psidium guajava extract inhibits thymus and activation-regulated chemokine (TARC/CCL17) production in human keratinocytes by inducing heme oxygenase-1 and blocking NF-κB and STAT1 activation.

    Science.gov (United States)

    Han, Eun Hee; Hwang, Yong Pil; Choi, Jae Ho; Yang, Ji Hye; Seo, Jong Kwon; Chung, Young Chul; Jeong, Hye Gwang

    2011-09-01

    Psidium guajava (P. guajava) is a food and medicinal plant with antioxidant, anti-inflammatory, and anti-allergic activities that support its traditional uses. The aim of this study was to determine the effects of P. guajava ethyl acetate extract (PGEA) on atopic dermatitis and to investigate the possible mechanisms by which PGEA inhibits cytokine-induced Th2 chemokine expression in HaCaT human keratinocyte cells. We found that PGEA suppressed the IFN-γ/TNF-α-co-induced production of thymus and activation-regulated chemokine (TARC) protein and mRNA in HaCaT cells. Additionally, PGEA inhibited the TNF-α/IFN-γ-co-induced activation of NF-κB and STAT1 and increased the expression of heme oxygenase-1 (HO-1) protein and mRNA. HO-1 inhibitor enhanced the suppressive effects of PGEA on TNF-α/IFN-γ-co-induced TARC production and gene expression. Collectively, these data demonstrate that PGEA inhibits chemokine expression in keratinocytes by inducing HO-1 expression and it suggests a possible therapeutic application in atopic dermatitis and other inflammatory skin diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Heme oxygenase-1 induction alters chemokine regulation and ameliorates human immunodeficiency virus-type-1 infection in lipopolysaccharide-stimulated macrophages

    International Nuclear Information System (INIS)

    Zhou, Zhao-Hua; Kumari, Namita; Nekhai, Sergei; Clouse, Kathleen A.; Wahl, Larry M.; Yamada, Kenneth M.; Dhawan, Subhash

    2013-01-01

    Highlights: •Lipopolysaccharide stimulation of heme oxygenase-1 (HO-1) ameliorated HIV-1 infection of primary human macrophages. •The partial protection by HO-1 against HIV infection was associated with induction of chemokines such as MIP1α and MIP1β. •This mechanism explains lipopolysaccharide-stimulated HO-1-mediated inhibition of HIV-1 infection of macrophages. -- Abstract: We have elucidated a putative mechanism for the host resistance against HIV-1 infection of primary human monocyte-derived macrophages (MDM) stimulated with lipopolysaccharide (LPS). We show that LPS-activated MDM both inhibited HIV-1 entry into the cells and were refractory to post-entry productive viral replication. LPS-treated cells were virtually negative for mature virions as revealed by transmission electron microscopy. LPS activation of MDM markedly enhanced the expression of heme oxygenase-1 (HO-1), a potent inducible cytoprotective enzyme. Increased HO-1 expression was accompanied by elevated production of macrophage inflammatory chemokines (MIP1α and MIP1β) by LPS-activated MDM, significantly decreased surface chemokine receptor-5 (CCR-5) expression, and substantially reduced virus replication. Treatment of cells with HO-1 inhibitor SnPP IX (tin protoporphyrin IX) attenuated the LPS-mediated responses, HIV-1 replication and secretion of MIP1α, MIP1β, and LD78β chemokines with little change in surface CCR-5 expression. These results identify a novel role for HO-1 in the modulation of host immune response against HIV infection of MDM

  20. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Science.gov (United States)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  1. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  2. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  3. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  4. Study on association between genetic polymorphisms of haem oxygenase-1, tumour necrosis factor, cadmium exposure and malaria pathogenicity and severity

    Directory of Open Access Journals (Sweden)

    Ruangweerayut Ronnatrai

    2010-09-01

    Full Text Available Abstract Background Malaria is the most important public health problems in tropical and sub-tropical countries. Haem oxygenase (HO enzyme and the pro-inflammatory cytokine tumour necrosis factor (TNF have been proposed as one of the factors that may play significant role in pathogenicity/severity of malaria infection. HO is the enzyme of the microsomal haem degradation pathway that yields biliverdin, carbon monoxide, and iron. In this study, the association between malaria disease pathogenicity/severity and (GTn repeat polymorphism in the promoter region of the inducible HO-1 including the effect of cadmium exposure (potent inducer of HO-1 transcription as well as polymorphism of TNF were investigated. Methods Blood samples were collected from 329 cases non-severe malaria with acute uncomplicated Plasmodium falciparum malaria (UM and 80 cases with Plasmodium vivax malaria (VM, and 77 cases with severe or cerebral malaria (SM for analysis of genetic polymorphisms of HO-1 and TNF and cadmium levels. These patients consisted of 123 (25.3% Thai, 243 (50.0% Burmese and 120 (24.7% Karen who were present at Mae Sot General Hospital, Mae Sot, Tak Province, Thailand. Results The number of (GTn repeats of the HO-1 gene in all patients varied between 16 and 39 and categorized to short (S, medium (M and long (L GTn repeats. The genotype of (GTn repeat of HO-1 was found to be significantly different among the three ethnic groups of patients. Significantly higher frequency of S/L genotype was found in Burmese compared with Thai patients, while significantly lower frequencies of S/S and M/L but higher frequency of M/M genotype was observed in Burmese compared with Karen patients. No significant association between HO-1 and TNF polymorphisms including the inducing effect of cadmium and malaria pathogenicity/severity was observed. Conclusions Difference in the expression of HO-1 genotype in different ethnic groups may contribute to different severity of malaria

  5. Altered gene-expression profile in rat plasma and promoted body ...

    African Journals Online (AJOL)

    Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...

  6. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    International Nuclear Information System (INIS)

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  7. Hyperglycemia in Streptozotocin-Induced Diabetes Leads to Persistent Inflammation and Tissue Damage Following Uveitis Due to Reduced Levels of Ciliary Body Heme Oxygenase-1

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available This study investigated the heme oxygenase-1 (HO-1 and the endotoxin-induced uveitis (EIU in diabetic streptozotocin (STZ-hyperglycemic rats. STZ-hyperglycemic rats had impaired levels of the enzyme HO-1 within the ciliary bodies if compared with the nondiabetic rats. STZ-hyperglycemic rats also predisposed the eye to produce high levels of both the cytokines IL-1 β and CXCL8. Subsequent EIU further and significantly P<.01 increased the cytokines production, an effect partly prevented by hemin treatment. Most importantly, hemin, an inducer of heme oxygenase expression and activity, recovered the huge number of infiltrated polymorphonuclear leukocytes PMN within the ciliary bodies associated with STZ-hyperglycemic state and EIU damage. Impairment of the stress-sensitive enzyme HO-1 in STZ-hyperglycemic rats increases and prolongs the inflammatory response to EIU.

  8. Edaravone protected PC12 cells against MPP(+)-cytoxicity via inhibiting oxidative stress and up-regulating heme oxygenase-1 expression.

    Science.gov (United States)

    Cheng, Baohua; Guo, Yunliang; Li, Chuangang; Ji, Bingyuan; Pan, Yanyou; Chen, Jing; Bai, Bo

    2014-08-15

    Oxidative stress is involved in the pathogenesis of Parkinson's disease (PD). Edaravone has been shown to have a neuroprotective effect. In the present work, we investigated the effect of edaravone on 1-methyl-4-phenylpyridinium (MPP(+))-treated PC12 cells. Edaravone inhibited the decrease of cell viability and apoptosis induced by MPP(+) in PC12 cells. In addition, edaravone alleviated intracellular reactive oxygen species (ROS) production. MPP(+) induced heme oxygenase-1 (HO-1) expression, which was further enhanced by edaravone. The inhibitor of HO-1 zinc protoporphyrin-IX attenuated the neuroprotection of edaravone. So edaravone protected PC12 cells against MPP(+)-cytoxicity via inhibiting oxidative stress and up-regulating HO-1 expression. The data showed that edaravone was neuroprotective and could be potentially therapeutics for PD in future. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Anti-inflammatory effect of transduced PEP-1-heme oxygenase-1 in Raw 264.7 cells and a mouse edema model

    International Nuclear Information System (INIS)

    Kwon, Soon Won; Sohn, Eun Jeong; Kim, Dae Won; Jeong, Hoon Jae; Kim, Mi Jin; Ahn, Eun Hee; Kim, Young Nam; Dutta, Suman; Kim, Duk-Soo; Park, Jinseu; Eum, Won Sik; Hwang, Hyun Sook; Choi, Soo Young

    2011-01-01

    Highlights: → Recombinant PEP-1 heme oxygenase-1 expression vector was constructed and overexpressed. → We investigated transduction efficiency of PEP-1-HO-1 protein in Raw 264.7 cells. → PEP-1-HO-1 was efficiently transduced into Raw 264.7 cells in a dose and time dependent manner. → PEP-1-HO-1 exerted anti-inflammatory activity in Raw 264.7 cells and in a mice edema model. → PEP-1-HO-1 could be used as a therapeutic drug against inflammatory diseases. -- Abstract: Heme oxygenase-1 (HO-1), which catalyzes the degradation of free heme to biliverdin, carbon monoxide (CO), and free iron (Fe 2+ ), is up-regulated by several cellular stress and cell injuries, including inflammation, ischemia and hypoxia. In this study, we examined whether fusion of HO-1 with PEP-1, a protein transduction domain that is able to deliver exogenous molecules to living cells or tissues, would facilitate HO-1 delivery to target cells and tissues, and thereby effectively exert a therapeutically useful response against inflammation. Western blot analysis demonstrated that PEP-1-HO-1 fusion proteins were transduced into Raw 264.7 cells in time- and dose-dependent manners, and were stably maintained in the cells for about 60 h. In addition, fluorescence analysis revealed that only PEP-1-HO-1 fusion proteins were significantly transduced into the cytoplasm of cells, while HO-1 proteins failed to be transduced. In lipopolysaccharide (LPS)-stimulated Raw 264.7 cells and 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced mouse edema model, transduced PEP-1-HO-1 fusion proteins effectively inhibited the overexpression of pro-inflammatory mediators and cytokines. Also, histological analysis demonstrated that PEP-1-HO-1 remarkably suppressed ear edema. The results suggest that the PEP-1-HO-1 fusion protein can be used as a therapeutic molecule against reactive oxygen species-related inflammatory diseases.

  10. ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS

    Directory of Open Access Journals (Sweden)

    O. I. Kit

    2016-01-01

    Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.

  11. Cytoprotection of Human Endothelial Cells From Menadione Cytotoxicity by Caffeic Acid Phenethyl Ester: The Role of Heme Oxygenase-1

    Science.gov (United States)

    2008-06-08

    cells (HUVEC) to evaluate potential gene expression involvement. CAPE exhibited dose- dependent cytoprotection of HUVEC. A gene screen with...highly induced (8.25-fold) by CAPE compared to DMSO control. To validate this particular microarray screening result, quantitative real-time RT-PCR was...the Nrf2 transcription factor in response to the antioxidant phytochemical carnosol. The Journal of Biological Chemistry 279, 8919–8929. Minami, T

  12. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jacob Daniela

    2005-06-01

    Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

  13. Cadmium-induced heme-oxygenase-1 expression plays dual roles in autophagy and apoptosis and is regulated by both PKC-δ and PKB/Akt activation in NRK52E kidney cells

    International Nuclear Information System (INIS)

    So, Keum-Young; Oh, Seon-Hee

    2016-01-01

    Heme oxygenase-1 (HO-1) protects cells against cadmium (Cd)-induced oxidative stress. However, the mechanism underlying this protection is not well understood. In this study, we elucidated the role of HO-1 in Cd-induced cytotoxicity. Exposure of NRK52E cells to Cd induced protein kinase B (PKB)/Akt, protein kinase C (PKC)-δ, and glycogen synthase kinase (GSK) 3αb phosphorylation, and eukaryotic initiation factor (eIF) 2α dephosphorylation. Pharmacological inhibition of Akt resulted in HO-1 suppression and eIF2α activation, which partially suppressed CHOP and PARP-1 cleavage, but promoted autophagy and decreased cell viability. Pharmacological inactivation of PKC-δ markedly suppressed Cd-induced phospho-serine (p-Ser) GSK3αβ, and HO-1, and partially inhibited PARP-1 cleavage, but massively induced autophagy and decreased cell viability. Pharmacological upregulation of p-Ser GSK3αβ enhanced Cd-induced HO-1, CHOP, and PARP-1 cleavage, but decreased autophagy. Genetic deficiency of GSK3β suppressed HO-1 and PARP-1 cleavage and increased autophagy. Genetic suppression of HO-1 reduced Cd-induced PARP-1 cleavage, but increased LC3-II. Cd exposure led to accumulation of p-PKC-δ, p-Ser GSK3αβ, and HO-1 in the nucleus and particulate fractions, suggesting that they have dual functions in response to Cd. N-acetylcysteine treatment suppressed Cd-induced activation of PKC-δ and Akt. These results indicate that HO-1 induced by Cd exposure is regulated by PKC-δ, p-Ser GSK3αβ, and PKB/Akt, which restrain autophagic cell death, but mildly induce apoptosis in NRK52E cells. Together, the results suggest that HO-1 expression in response to Cd maintains cellular homeostasis during oxidative stress.

  14. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    Directory of Open Access Journals (Sweden)

    Gagniuc Paul

    2012-09-01

    Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on

  15. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga

    2010-10-01

    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  17. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

    Directory of Open Access Journals (Sweden)

    Jianqing Pan

    Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

  18. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  19. The progress of tumor gene-radiotherapy induced by Egr-1 promoter

    International Nuclear Information System (INIS)

    Guo Rui; Li Biao

    2010-01-01

    The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)

  20. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  1. Transgenic expression of human heme oxygenase-1 in pigs confers resistance against xenograft rejection during ex vivo perfusion of porcine kidneys.

    Science.gov (United States)

    Petersen, Björn; Ramackers, Wolf; Lucas-Hahn, Andrea; Lemme, Erika; Hassel, Petra; Queisser, Anna-Lisa; Herrmann, Doris; Barg-Kues, Brigitte; Carnwath, Joseph W; Klose, Johannes; Tiede, Andreas; Friedrich, Lars; Baars, Wiebke; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

    2011-01-01

    The major immunological hurdle to successful porcine-to-human xenotransplantation is the acute vascular rejection (AVR), characterized by endothelial cell (EC) activation and perturbation of coagulation. Heme oxygenase-1 (HO-1) and its derivatives have anti-apoptotic, anti-inflammatory effects and protect against reactive oxygen species, rendering HO-1 a promising molecule to control AVR. Here, we report the production and characterization of pigs transgenic for human heme oxygenase-1 (hHO-1) and demonstrate significant protection in porcine kidneys against xenograft rejection in ex vivo perfusion with human blood and transgenic porcine aortic endothelial cells (PAEC) in a TNF-α-mediated apoptosis assay. Transgenic and non-transgenic PAEC were tested in a TNF-α-mediated apoptosis assay. Expression of adhesion molecules (ICAM-1, VCAM-1, and E-selectin) was measured by real-time PCR. hHO-1 transgenic porcine kidneys were perfused with pooled and diluted human AB blood in an ex vivo perfusion circuit. MHC class-II up-regulation after induction with IFN-γ was compared between wild-type and hHO-1 transgenic PAEC. Cloned hHO-1 transgenic pigs expressed hHO-1 in heart, kidney, liver, and in cultured ECs and fibroblasts. hHO-1 transgenic PAEC were protected against TNF-α-mediated apoptosis. Real-time PCR revealed reduced expression of adhesion molecules like ICAM-1, VCAM-1, and E-selectin. These effects could be abrogated by the incubation of transgenic PAECs with the specific HO-1 inhibitor zinc protoporphorine IX (Zn(II)PPIX, 20 μm). IFN-γ induced up-regulation of MHC class-II molecules was significantly reduced in PAECs from hHO-1 transgenic pigs. hHO-1 transgenic porcine kidneys could successfully be perfused with diluted human AB-pooled blood for a maximum of 240 min (with and without C1 inh), while in wild-type kidneys, blood flow ceased after ∼60 min. Elevated levels of d-Dimer and TAT were detected, but no significant consumption of fibrinogen and

  2. Anti-inflammatory and heme oxygenase-1 inducing activities of lanostane triterpenes isolated from mushroom Ganoderma lucidum in RAW264.7 cells

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Solip [Department of Biochemistry, College of Natural Sciences, Kangwon National University, Chuncheon, Gangwon-Do 200-701 (Korea, Republic of); Nguyen, Van Thu [College of Pharmacy, Catholic University of Daegu, Gyeongsan 712-702 (Korea, Republic of); Tae, Nara; Lee, Suhyun [Department of Biochemistry, College of Natural Sciences, Kangwon National University, Chuncheon, Gangwon-Do 200-701 (Korea, Republic of); Ryoo, Sungwoo [Department of Biological Sciences, College of Natural Sciences, Kangwon National University, Chuncheon, Gangwon-Do 200-701 (Korea, Republic of); Min, Byung-Sun [College of Pharmacy, Catholic University of Daegu, Gyeongsan 712-702 (Korea, Republic of); Lee, Jeong-Hyung, E-mail: jhlee36@kangwon.ac.kr [Department of Biochemistry, College of Natural Sciences, Kangwon National University, Chuncheon, Gangwon-Do 200-701 (Korea, Republic of)

    2014-11-01

    Ganoderma lucidum is a popular medicinal mushroom used in traditional medicine for preventing or treating a variety of diseases. In the present study, we investigated the anti-inflammatory and heme oxygenase (HO)-1 inducing effects of 12 lanostane triterpenes from G. lucidum in RAW264.7 cells. Of these, seven triterpenes, butyl lucidenateE{sub 2}, butyl lucidenateD{sub 2} (GT-2), butyl lucidenate P, butyl lucidenateQ, Ganoderiol F, methyl ganodenate J and butyl lucidenate N induced HO-1 expression and suppressed lipopolysaccharide (LPS)-induced nitric oxide (NO) production. Inhibiting HO-1 activity abrogated the inhibitory effects of these triterpenes on the production of NO in LPS-stimulated RAW264.7 cells, suggesting the involvement of HO-1 in the anti-inflammatory effects of these triterpenes. We further studied the anti-inflammatory and HO-1 inducing effects of GT-2. Mitogen-activated protein kinase inhibitors or N-acetylcysteine, an antioxidant, did not suppress GT-2-mediated HO-1 induction; however, LY294002, a phosphoinositide 3-kinase (PI3K) inhibitor, blocked GT-2-induced HO-1 mRNA and protein expression. GT-2 increased nuclear translocation of nuclear factor-E2-related factor 2 (Nrf2) and knockdown of Nrf2 by small interfering RNA blocked GT-2-mediated HO-1 induction, suggesting that GT-2 induced HO-1 expression via the PI3K/AKT-Nrf2 pathway. Consistent with the notion that HO-1 has anti-inflammatory properties, GT-2 inhibited the production of tumor necrosis factor-α and interleukin-6, as well as inducible nitric oxide synthase and cyclooxygenase-2 expression. These findings suggest that HO-1 inducing activities of these lanostane triterpenes may be important in the understanding of a novel mechanism for the anti-inflammatory activity of G. lucidum. - Highlights: • The anti-inflammatory effects of selected triterpenes from Ganoderma lucidum are demonstrated. • Heme oxygenase-1 induction is attributable to the anti-inflammatory properties of these

  3. Anti-inflammatory and heme oxygenase-1 inducing activities of lanostane triterpenes isolated from mushroom Ganoderma lucidum in RAW264.7 cells

    International Nuclear Information System (INIS)

    Choi, Solip; Nguyen, Van Thu; Tae, Nara; Lee, Suhyun; Ryoo, Sungwoo; Min, Byung-Sun; Lee, Jeong-Hyung

    2014-01-01

    Ganoderma lucidum is a popular medicinal mushroom used in traditional medicine for preventing or treating a variety of diseases. In the present study, we investigated the anti-inflammatory and heme oxygenase (HO)-1 inducing effects of 12 lanostane triterpenes from G. lucidum in RAW264.7 cells. Of these, seven triterpenes, butyl lucidenateE 2 , butyl lucidenateD 2 (GT-2), butyl lucidenate P, butyl lucidenateQ, Ganoderiol F, methyl ganodenate J and butyl lucidenate N induced HO-1 expression and suppressed lipopolysaccharide (LPS)-induced nitric oxide (NO) production. Inhibiting HO-1 activity abrogated the inhibitory effects of these triterpenes on the production of NO in LPS-stimulated RAW264.7 cells, suggesting the involvement of HO-1 in the anti-inflammatory effects of these triterpenes. We further studied the anti-inflammatory and HO-1 inducing effects of GT-2. Mitogen-activated protein kinase inhibitors or N-acetylcysteine, an antioxidant, did not suppress GT-2-mediated HO-1 induction; however, LY294002, a phosphoinositide 3-kinase (PI3K) inhibitor, blocked GT-2-induced HO-1 mRNA and protein expression. GT-2 increased nuclear translocation of nuclear factor-E2-related factor 2 (Nrf2) and knockdown of Nrf2 by small interfering RNA blocked GT-2-mediated HO-1 induction, suggesting that GT-2 induced HO-1 expression via the PI3K/AKT-Nrf2 pathway. Consistent with the notion that HO-1 has anti-inflammatory properties, GT-2 inhibited the production of tumor necrosis factor-α and interleukin-6, as well as inducible nitric oxide synthase and cyclooxygenase-2 expression. These findings suggest that HO-1 inducing activities of these lanostane triterpenes may be important in the understanding of a novel mechanism for the anti-inflammatory activity of G. lucidum. - Highlights: • The anti-inflammatory effects of selected triterpenes from Ganoderma lucidum are demonstrated. • Heme oxygenase-1 induction is attributable to the anti-inflammatory properties of these triterpenes

  4. Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

    International Nuclear Information System (INIS)

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-01-01

    Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

  5. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  6. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    2014-12-23

    Dec 23, 2014 ... antimalarial drugs from plants that were used in traditional. Chinese medicine ...... ogy of eukaryotic promoter prediction-a review. Comput. Chem. ... Main J. J. 2006 Antiviral effect of artemisinin from Artemisia annua against a ...

  7. Heme Oxygenase-1 Activity as a Correlate to Exercise-Mediated Amelioration of Cognitive Decline and Neuropathological Alterations in an Aging Rat Model of Dementia

    Directory of Open Access Journals (Sweden)

    Andrea Kurucz

    2018-01-01

    Full Text Available Alzheimer’s disease (AD is a neurodegenerative disorder with cognitive impairment. Physical exercise has long been proven to be beneficial in the disorder. The present study was designed to examine the effect of voluntary exercise on spatial memory, imaging, and pathological abnormalities. Particular focus has been given to the role of heme oxygenase-1 (HO-1—an important cellular cytoprotectant in preserving mental acuity—using an aging rat model of dementia. Male and female Wistar rats were segregated into six groups—namely, (i aged sedentary (control females (ASF, n=8; (ii aged sedentary (control males (ASM, n=8; (iii aged running females (ARF, n=8; (iv aged running males (ARM, n=8; (v young control females (YCF, n=8; and (vi young control males (YCM, n=8. Rats in the ARF and ARM groups had free access to a standardized inbuilt running wheel during the 3-month evaluation period. Spatial memory was investigated using the Morris Water Test, imaging and pathological alterations were assessed using positron emission tomography (PET imaging and histopathological examinations (H&E, Congo red staining, respectively, and HO-1 enzyme activity assays were also conducted. The outcomes suggest that voluntary physical exercise mitigates impaired spatial memory and neuropathological changes exhibited by the aging sedentary group, via elevated HO-1 activity, contributing to the antioxidant capacity in the aging brain.

  8. Involvement of Heme Oxygenase-1 Induction in the Cytoprotective and Immunomodulatory Activities of Viola patrinii in Murine Hippocampal and Microglia Cells

    Directory of Open Access Journals (Sweden)

    Bin Li

    2012-01-01

    Full Text Available A number of diseases that lead to injury of the central nervous system are caused by oxidative stress and inflammation in the brain. In this study, NNMBS275, consisting of the ethanol extract of Viola patrinii, showed potent antioxidative and anti-inflammatory activity in murine hippocampal HT22 cells and BV2 microglia. NNMBS275 increased cellular resistance to oxidative injury caused by glutamate-induced neurotoxicity and reactive oxygen species generation in HT22 cells. In addition, the anti-inflammatory effects of NNMBS275 were demonstrated by the suppression of proinflammatory mediators, including proinflammatory enzymes (inducible nitric oxide synthase and cyclooxygenase-2 and cytokines (tumor necrosis factor-α and interleukin-1β. Furthermore, we found that the neuroprotective and anti-inflammatory effects of NNMBS275 were linked to the upregulation of nuclear transcription factor-E2-related factor 2-dependent expression of heme oxygenase-1 in HT22 and BV2 cells. These results suggest that NNMBS275 possesses therapeutic potential against neurodegenerative diseases that are induced by oxidative stress and neuroinflammation.

  9. Effects of Nuclear Factor-E2-related factor 2/Heme Oxygenase 1 on splanchnic hemodynamics in experimental cirrhosis with portal hypertension.

    Science.gov (United States)

    Qin, Jun; He, Yue; Duan, Ming; Luo, Meng

    2017-05-01

    We explored the effects of Nuclear Factor-E2-related factor 2 (Nrf2) and Heme Oxygenase 1 (HO-1) on splanchnic hemodynamics in portal hypertensive rats. Experimental cirrhosis with portal hypertension was induced by intraperitoneal injection of carbon tetrachloride. The expression of proteins was examined by immunoblotting. Hemodynamic studies were performed by radioactive microspheres. The vascular perfusion system was used to measure the contractile response of mesentery arterioles in rats. Nrf2 expression in the nucleus and HO-1 expression in cytoplasm was significantly enhanced in portal hypertensive rats. Portal pressure, as well as regional blood flow, increased significantly in portal hypertension and can be blocked by tin protoporphyrin IX. The expression of endogenous nitric oxide synthase and vascular endothelial growth factors increased significantly compared to normal rats, while HO-1 inhibition decreased the expression of these proteins significantly. The contractile response of mesenteric arteries decreased in portal hypertension, but can be partially recovered through tin protoporphyrin IX treatment. The expression of Nrf2/HO-1 increased in mesenteric arteries of portal hypertensive rats, which was related to oxidative stress. HO-1was involved in increased portal pressure and anomaly splanchnic hemodynamics in portal hypertensive rats. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Red Yeast Rice Protects Circulating Bone Marrow-Derived Proangiogenic Cells against High-Glucose-Induced Senescence and Oxidative Stress: The Role of Heme Oxygenase-1

    Directory of Open Access Journals (Sweden)

    Jung-Tung Liu

    2017-01-01

    Full Text Available The inflammation and oxidative stress of bone marrow-derived proangiogenic cells (PACs, also named endothelial progenitor cells, triggered by hyperglycemia contributes significantly to vascular dysfunction. There is supporting evidence that the consumption of red yeast rice (RYR; Monascus purpureus-fermented rice reduces the vascular complications of diabetes; however, the underlying mechanism remains unclear. This study aimed to elucidate the effects of RYR extract in PACs, focusing particularly on the role of a potent antioxidative enzyme, heme oxygenase-1 (HO-1. We found that treatment with RYR extract induced nuclear factor erythroid-2-related factor nuclear translocation and HO-1 mRNA and protein levels in PACs. RYR extract inhibited high-glucose-induced (30 mM PAC senescence and the development of reactive oxygen species (ROS in a dose-dependent manner. The HO-1 inducer cobalt protoporphyrin IX also decreased high-glucose-induced cell senescence and oxidative stress, whereas the HO-1 enzyme inhibitor zinc protoporphyrin IX and HO-1 small interfering RNA significantly reversed RYR extract-caused inhibition of senescence and reduction of oxidative stress in high-glucose-treated PACs. These results suggest that RYR extract serves as alternative and complementary medicine in the treatment of these diseases, by inducing HO-1, thereby decreasing the vascular complications of diabetes.

  11. Edaravone protects rats and human pulmonary alveolar epithelial cells against hyperoxia injury: heme oxygenase-1 and PI3K/Akt pathway may be involved.

    Science.gov (United States)

    Cao, Huifang; Feng, Ying; Ning, Yunye; Zhang, Zinan; Li, Weihao; Li, Qiang

    2015-01-01

    Hyperoxic acute lung injury (HALI) is a clinical syndrome as a result of prolonged supplement of high concentrations of oxygen. As yet, no specific treatment is available for HALI. The present study aims to investigate the effects of edaravone on hyperoxia-induced oxidative injury and the underlying mechanism. We treated rats and human pulmonary alveolar epithelial cells with hyperoxia and different concentration of edaravone, then examined the effects of edaravone on cell viability, cell injury and two oxidative products. The roles of heme oxygenase-1 (HO-1) and PI3K/Akt pathway were explored using Western blot and corresponding inhibitors. The results showed that edaravone reduced lung biochemical alterations induced by hyperoxia and mortality of rats, dose-dependently alleviated cell mortality, cell injury, and peroxidation of cellular lipid and DNA oxidative damage. It upregulated cellular HO-1 expression and activity, which was reversed by PI3K/Akt pathway inhibition. The administration of zinc protoporphyrin-IX, a HO-1 inhibitor, and LY249002, a PI3K/Akt pathway inhibitor, abolished the protective effects of edaravone in cells. This study indicates that edaravone protects rats and human pulmonary alveolar epithelial cells against hyperoxia-induced injury and the antioxidant effect may be related to upregulation of HO-1, which is regulated by PI3K/Akt pathway.

  12. Crocin Suppresses LPS-Stimulated Expression of Inducible Nitric Oxide Synthase by Upregulation of Heme Oxygenase-1 via Calcium/Calmodulin-Dependent Protein Kinase 4

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim

    2014-01-01

    Full Text Available Crocin is a water-soluble carotenoid pigment that is primarily used in various cuisines as a seasoning and coloring agent, as well as in traditional medicines for the treatment of edema, fever, and hepatic disorder. In this study, we demonstrated that crocin markedly induces the expression of heme oxygenase-1 (HO-1 which leads to an anti-inflammatory response. Crocin inhibited inducible nitric oxide synthase (iNOS expression and nitric oxide production via downregulation of nuclear factor kappa B activity in lipopolysaccharide- (LPS- stimulated RAW 264.7 macrophages. These effects were abrogated by blocking of HO-1 expression or activity. Crocin also induced Ca2+ mobilization from intracellular pools and phosphorylation of Ca2+/calmodulin-dependent protein kinase 4 (CAMK4. CAMK4 knockdown and kinase-dead mutant inhibited crocin-mediated HO-1 expression, Nrf2 activation, and phosphorylation of Akt, indicating that HO-1 expression is mediated by CAMK4 and that Akt is a downstream mediator of CAMK4 in crocin signaling. Moreover, crocin-mediated suppression of iNOS expression was blocked by CAMK4 inhibition. Overall, these results suggest that crocin suppresses LPS-stimulated expression of iNOS by inducing HO-1 expression via Ca2+/calmodulin-CAMK4-PI3K/Akt-Nrf2 signaling cascades. Our findings provide a novel molecular mechanism for the inhibitory effects of crocin against endotoxin-mediated inflammation.

  13. Postneonatal Mortality and Liver Changes in Cloned Pigs Associated with Human Tumor Necrosis Factor Receptor I-Fc and Human Heme Oxygenase-1 Overexpression.

    Science.gov (United States)

    Kim, Geon A; Jin, Jun-Xue; Lee, Sanghoon; Taweechaipaisankul, Anukul; Oh, Hyun Ju; Hwang, Joing-Ik; Ahn, Curie; Saadeldin, Islam M; Lee, Byeong Chun

    2017-01-01

    Soluble human tumor necrosis factor (shTNFRI-Fc) and human heme oxygenase 1 (hHO-1) are key regulators for protection against oxidative and inflammatory injury for xenotransplantation. Somatic cells with more than 10 copy numbers of shTNFRI-Fc and hHO-1 were employed in somatic cell nuclear transfer to generate cloned pigs, thereby resulting in seven cloned piglets. However, produced piglets were all dead within 24 hours after birth. Obviously, postnatal death with liver apoptosis was reported in the higher copy number of shTNFRI-Fc and hHO-1 piglets. In liver, the transcript levels of ferritin heavy chain, light chain, transferrin, and inducible nitric oxide synthase were significantly highly expressed compared to those of lower copy number of shTNFRI-Fc and hHO-1 piglets ( P hHO-1 piglets ( P hHO-1 overexpression may apparently induce free iron in the liver and exert oxidative stress by enhancing reactive oxygen species production and block normal postneonatal liver metabolism.

  14. Postneonatal Mortality and Liver Changes in Cloned Pigs Associated with Human Tumor Necrosis Factor Receptor I-Fc and Human Heme Oxygenase-1 Overexpression

    Directory of Open Access Journals (Sweden)

    Geon A. Kim

    2017-01-01

    Full Text Available Soluble human tumor necrosis factor (shTNFRI-Fc and human heme oxygenase 1 (hHO-1 are key regulators for protection against oxidative and inflammatory injury for xenotransplantation. Somatic cells with more than 10 copy numbers of shTNFRI-Fc and hHO-1 were employed in somatic cell nuclear transfer to generate cloned pigs, thereby resulting in seven cloned piglets. However, produced piglets were all dead within 24 hours after birth. Obviously, postnatal death with liver apoptosis was reported in the higher copy number of shTNFRI-Fc and hHO-1 piglets. In liver, the transcript levels of ferritin heavy chain, light chain, transferrin, and inducible nitric oxide synthase were significantly highly expressed compared to those of lower copy number of shTNFRI-Fc and hHO-1 piglets (P<0.05. Also, H2O2 contents were increased, and superoxide dismutase was significantly lower in the higher copy number of shTNFRI-Fc and hHO-1 piglets (P<0.05. These results indicate that TNFRI-Fc and hHO-1 overexpression may apparently induce free iron in the liver and exert oxidative stress by enhancing reactive oxygen species production and block normal postneonatal liver metabolism.

  15. Eriodictyol Protects Endothelial Cells against Oxidative Stress-Induced Cell Death through Modulating ERK/Nrf2/ARE-Dependent Heme Oxygenase-1 Expression.

    Science.gov (United States)

    Lee, Seung Eun; Yang, Hana; Son, Gun Woo; Park, Hye Rim; Park, Cheung-Seog; Jin, Young-Ho; Park, Yong Seek

    2015-06-26

    The pathophysiology of cardiovascular diseases is complex and may involve oxidative stress-related pathways. Eriodictyol is a flavonoid present in citrus fruits that demonstrates anti-inflammatory, anti-cancer, neurotrophic, and antioxidant effects in a range of pathophysiological conditions including vascular diseases. Because oxidative stress plays a key role in the pathogenesis of cardiovascular disease, the present study was designed to verify whether eriodictyol has therapeutic potential. Upregulation of heme oxygenase-1 (HO-1), a phase II detoxifying enzyme, in endothelial cells is considered to be helpful in cardiovascular disease. In this study, human umbilical vein endothelial cells (HUVECs) treated with eriodictyol showed the upregulation of HO-1 through extracellular-regulated kinase (ERK)/nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathways. Further, eriodictyol treatment provided protection against hydrogen peroxide-provoked cell death. This protective effect was eliminated by treatment with a specific inhibitor of HO-1 and RNA interference-mediated knockdown of HO-1 expression. These data demonstrate that eriodictyol induces ERK/Nrf2/ARE-mediated HO-1 upregulation in human endothelial cells, which is directly associated with its vascular protection against oxidative stress-related endothelial injury, and propose that targeting the upregulation of HO-1 is a promising approach for therapeutic intervention in cardiovascular disease.

  16. A role for heme oxygenase-1 in the antioxidant and antiapoptotic effects of erythropoietin: the start of a good news/bad news story?

    Science.gov (United States)

    Calò, Lorenzo A; Davis, Paul A; Piccoli, Antonio; Pessina, Achille C

    2006-01-01

    Erythropoietin (EPO) is the major regulator of erythropoiesis. EPO's actions have been shown to be antiapoptotic and dependent on JAK2 signaling and Akt phosphorylation. These effects serve as link between EPO and heme oxygenase-1 (HO-1). HO-1 is an inducible enzyme with potent antioxidant and antiapoptotic activities which are regulated by Akt signaling. EPO's ability to alter cellular systems that involve apoptosis and oxidants suggests that EPO treatments are likely to have multiple and different effects which may start a good news/bad news story. Recombinant human EPO is the recognized treatment of choice to address anemia and to stimulate erythropoiesis in chronic renal failure patients, through its antiapoptotic action which likely involves HO-1. On the other hand, EPO treatment to address anemia in cancer patients, while providing significant improvements in cancer patients' quality of life, its effects on survival are equivocal, likely due to its linkage with HO-1. Two clinical trials of EPO in patients with solid tumors have, in fact, shown specific negative effects on survival. However, EPO's effect on tumor growth and survival is not uniformily pro growth and pro survival, as EPO may act synergistically with chemotherapy to induce apoptosis. Finally, compounds have been synthesized that do not trigger EPO receptor and thus may allow experimental distinction and, therefore, at least potentially affect at the clinical level the tissue-protective effects of EPO (e.g., antiapoptosis) without provoking its other potentially detrimental effects. Copyright 2006 S. Karger AG, Basel

  17. Chinese herbal medicine compound Yi-Zhi-Hao pellet inhibits replication of influenza virus infection through activation of heme oxygenase-1

    Directory of Open Access Journals (Sweden)

    Jinqiu Yin

    2017-11-01

    Full Text Available As a leading cause of respiratory disease, influenza A virus (IAV presents a pandemic threat in annual seasonal outbreaks. Given the limitation of existing anti-influenza therapies, there remains to be a requirement for new drugs. Compound Yi-Zhi-Hao pellet (CYZH is a famous traditional Chinese medicine (TCM used in the clinic, whose formula has been recorded in Complication of National Standard for Traditional Chinese Medicine to treat common cold. In this study, we found that CYZH exhibited a broad-spectrum anti-influenza activity and inhibited the expression of viral RNA and proteins in vitro. Mechanistically, CYZH had no inhibitory activities against viral protein hemagglutinin and IAV RNA-dependent RNA polymerase. Instead, it induced activation of erythroid 2-related factor 2 (Nrf2 and nuclear factor kappa B (NF-κB, which subsequently upregulated heme oxygenase-1 (HO-1 expression. Also, CYZH protected cells from oxidative damage induced by reactive oxygen series. In conclusions, CYZH inhibits IAV replication in vitro, at least partly by activating expression of the Nrf2/HO-1 pathway.

  18. Epigallocatechin Gallate Attenuates Proliferation and Oxidative Stress in Human Vascular Smooth Muscle Cells Induced by Interleukin-1β via Heme Oxygenase-1

    Directory of Open Access Journals (Sweden)

    Po-Len Liu

    2014-01-01

    Full Text Available Proliferation of vascular smooth muscle cells (VSMCs triggered by inflammatory stimuli and oxidative stress contributes importantly to atherogenesis. The association of green tea consumption with cardiovascular protection has been well documented in epidemiological observations, however, the underlying mechanisms remain unclear. This study aimed to elucidate the effects of the most active green tea catechin derivative, (−-epigallocatechin-3-gallate (EGCG, in human aortic smooth muscle cells (HASMCs, focusing particularly on the role of a potent anti-inflammatory and antioxidative enzyme heme oxygenase-1 (HO-1. We found that pretreatment of EGCG dose- and time-dependently induced HO-1 protein levels in HASMCs. EGCG inhibited interleukin- (IL-1β-induced HASMC proliferation and oxidative stress in a dose-dependent manner. The HO-1 inducer CoPPIX decreased IL-1β-induced cell proliferation, whereas the HO-1 enzyme inhibitor ZnPPIX significantly reversed EGCG-caused growth inhibition in IL-1β-treated HASMCs. At the molecular level, EGCG treatment significantly activated nuclear factor erythroid-2-related factor (Nrf2 transcription activities. These results suggest that EGCG might serve as a complementary and alternative medicine in the treatment of these pathologies by inducing HO-1 expression and subsequently decreasing VSMC proliferation.

  19. Physalis peruviana L. inhibits airway inflammation induced by cigarette smoke and lipopolysaccharide through inhibition of extracellular signal-regulated kinase and induction of heme oxygenase-1.

    Science.gov (United States)

    Park, Hyun Ah; Lee, Jae-Won; Kwon, Ok-Kyoung; Lee, Gilhye; Lim, Yourim; Kim, Jung Hee; Paik, Jin-Hyub; Choi, Sangho; Paryanto, Imam; Yuniato, Prasetyawan; Kim, Doo-Young; Ryu, Hyung Won; Oh, Sei-Ryang; Lee, Seung Jin; Ahn, Kyung-Seop

    2017-11-01

    Physalis peruviana L. (PP) is a medicinal herb that has been confirmed to have several biological activities, including anticancer, antioxidant and anti-inflammatory properties. The aim of the present study was to evaluate the protective effect of PP on cigarette smoke (CS)- and lipopolysaccharide (LPS)-induced pulmonary inflammation. Treatment with PP significantly reduced the influx of inflammatory cells in the bronchoalveolar lavage fluid (BALF) and lung of mice with CS- and LPS-induced pulmonary inflammation. PP also decreased the levels of reactive oxygen species (ROS) and pro-inflammatory cytokines, such as tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) in the BALF. PP effectively attenuated the expression of monocyte chemoattractant protein-1 (MCP-1) and the activation of extracellular signal-regulated kinase (ERK) in the lung. In addition, nuclear factor erythroid 2-related factor 2 (Nrf2) activation and heme oxygenase-1 (HO-1) expression were increased by PP treatment. In an in vitro experiment, PP reduced the mRNA expression of TNF-α and MCP-1, and the activation of ERK in CS extract-stimulated A549 epithelial cells. Furthermore, PP increased the activation of Nrf2 and the expression of HO-1 in A549 cells. These findings suggest that PP has a therapeutic potential for the treatment of pulmonary inflammatory diseases, such as chronic obstructive pulmonary disease.

  20. Regulation of heme oxygenase-1 expression and MAPK pathways in response to kaempferol and rhamnocitrin in PC12 cells

    International Nuclear Information System (INIS)

    Hong, J.-T.; Yen, J.-H.; Wang Lisu; Lo, Y.-H.; Chen, Z.-T.; Wu, M.-J.

    2009-01-01

    Oxidative stress has been considered as a major cause of cellular injuries in a variety of clinical abnormalities, especially neural diseases. Our aim of research is to investigate the protective effects and mechanisms of kaempferol and rhamnocitrin (kaempferol-7-methyl ether) on oxidative damage in rat pheochromocytoma PC12 cells induced by a limited supply of serum and hydrogen peroxide (H 2 O 2 ). The current result demonstrated that kaempferol protected PC12 cells from serum deprivation-induced apoptosis. Pretreatment of cells with kaempferol also diminished intracellular generation of reactive oxygen species (ROS) in response to H 2 O 2 and strongly elevated cell viability. RT-Q-PCR and Western blotting revealed that kaempferol and rhamnocitrin significantly induced heme oxygenase (HO)-1 gene expression. Addition of zinc protoporphyrin (Znpp), a HO-1 competitive inhibitor, significantly attenuated their protective effects in H 2 O 2 -treated cells, indicating the vital role of HO-1 in cell resistance to oxidative injury. While investigating the signaling pathways responsible for HO-1 induction, we observed that kaempferol induced sustained extracellular signal-regulated protein kinase 1/2 (ERK1/2) in PC12 cells grown in low serum medium; while rhamnocitrin only stimulated transient ERK cascade. Addition of U0126, a highly selective inhibitor of MEK1/2, which is upstream of ERK1/2, had no effect on kaempferol- or rhamnocitrin-induced HO-1 mRNA expression, indicating no direct cross-talk between these two pathways. Furthermore, both kaempferol and rhamnocitrin were able to persistently attenuate p38 phosphorylation. Taking together, the above findings suggest that kaempferol and rhamnocitrin can augment cellular antioxidant defense capacity, at least in part, through regulation of HO-1 expression and MAPK signal transduction.

  1. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  2. Transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans

    CSIR Research Space (South Africa)

    Crampton, Michael C

    2010-07-01

    Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...

  3. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  4. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  5. Polymorphisms in the Haem Oxygenase-1 promoter are not associated with severity of Plasmodium falciparum malaria in Ghanaian children

    DEFF Research Database (Denmark)

    Hansson, Helle H; Sørensen, Lasse Maretty; Balle, Christina

    2015-01-01

    , medium and long repeats. The (-413)T allele was very common (69.8%), while the (-1135)A allele was present in only 17.4% of the Ghanaian population. The G(-1135)A locus was excluded from further analysis after failing the Hardy-Weinberg equilibrium test. No significant differences in allele or genotype...

  6. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  7. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  8. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  9. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  10. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    International Nuclear Information System (INIS)

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  11. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  12. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  13. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

    Directory of Open Access Journals (Sweden)

    Andrea Degl'Innocenti

    Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings

  14. Engineered promoters enable constant gene expression at any copy number in bacteria.

    Science.gov (United States)

    Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

    2018-04-01

    The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

  15. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

    DEFF Research Database (Denmark)

    Mortensen, O V; Thomassen, M; Larsen, M B

    1999-01-01

    were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

  16. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  17. Computational design and application of endogenous promoters for transcriptionally targeted gene therapy for rheumatoid arthritis.

    NARCIS (Netherlands)

    Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de

    2009-01-01

    The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define

  18. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  19. The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

    NARCIS (Netherlands)

    Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

    1990-01-01

    The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

  20. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    ... were more in the high artemisinin producer species, A. annua, than the other species. We have reported that the light-responsive elements, W-box, CAAT-box, 5′-UTR py-rich stretch, TATA-box sequence and tandem repeat sequences have been identified as important factors in the increased expression of ADS gene.

  1. A cII-dependent promoter is located within the Q gene of bacteriophage lambda.

    OpenAIRE

    Hoopes, B C; McClure, W R

    1985-01-01

    We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...

  2. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  3. Tissue specific promoters improve the localization of radiation-inducible gene expression

    International Nuclear Information System (INIS)

    Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

    1996-01-01

    Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

  4. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  5. Heme oxygenase-1 mediates the protective effects of ischemic preconditioning on mitigating lung injury induced by lower limb ischemia-reperfusion in rats.

    Science.gov (United States)

    Peng, Tsui-Chin; Jan, Woan-Ching; Tsai, Pei-Shan; Huang, Chun-Jen

    2011-05-15

    Lower limb ischemia-reperfusion (I/R) imposes oxidative stress, elicits inflammatory response, and subsequently induces acute lung injury. Ischemic preconditioning (IP), a process of transient I/R, mitigates the acute lung injury induced by I/R. We sought to elucidate whether the protective effects of IP involve heme oxygenase-1 (HO-1). Adult male rats were randomized to receive I/R, I/R plus IP, I/R plus IP plus the HO-1 inhibitor tin protoporphyrin (SnPP) (n = 12 in each group). Control groups were run simultaneously. I/R was induced by applying rubber band tourniquet high around each thigh for 3 h followed by reperfusion for 3 h. To achieve IP, three cycles of bilateral lower limb I/R (i.e., ischemia for 10 min followed by reperfusion for 10 min) were performed. IP was performed immediately before I/R. After sacrifice, degree of lung injury was determined. Histologic findings, together with assays of leukocyte infiltration (polymorphonuclear leukocytes/alveoli ratio and myeloperoxidase activity) and lung water content (wet/dry weight ratio), confirmed that I/R induced acute lung injury. I/R also caused significant inflammatory response (increases in chemokine, cytokine, and prostaglandin E(2) concentrations), imposed significant oxidative stress (increases in nitric oxide and malondialdehyde concentrations), and up-regulated HO-1 expression in lung tissues. IP significantly enhanced HO-1 up-regulation and, in turn, mitigated oxidative stress, inflammatory response, and acute lung injury induced by I/R. In addition, the protective effects of IP were counteracted by SnPP. The protective effects of IP on mitigating acute lung injury induced by lower limb I/R are mediated by HO-1. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. IN VITRO STUDIES ON HEME OXYGENASE-1 AND P24 ANTIGEN HIV-1 LEVEL AFTERHYPERBARIC OXYGEN TREATMENTOFHIV-1 INFECTED ON PERIPHERAL BLOOD MONONUCLEAR CELLS (PBMCS).

    Science.gov (United States)

    Budiarti, Retno; Kuntaman; Nasronudin; Suryokusumo; Khairunisa, Siti Qamariyah

    2018-01-01

    Heme oxygenase-1 (HO-1) is a protein secreted by immune cells as a part of immune response mechanism.HO-1 can be induced by variety agents that causingoxidative stress, such as exposure to 100% oxygenat2,4 ATA pressure.It plays a vital role in maintaining cellular homeostasis.This study was conducted to identify the effect of hyperbaric oxygen exposure in cultured ofPBMCthat infected by HIV-1. Primary culture of PBMCs were isolated from 16 healthy volunteers and HIV-1 infected MT4 cell line by co-culture. The PBMCs were aliquoted into two wells as control group and treatment group. The 16 samples of HIV-1 infected PBMCwere exposed to oxygen at 2,4 ATA in animal hyperbaric chamber forthree times in 30 minutes periods with 5 minutes spacing period, that called 1 session.The Treatment done on 5 sessions within 5 days. 16 samples of HIV-1 infected PMBCs that have no hyperbaric treatment became control group.The supernatant were measured the HO-1 production by ELISA andmRNA expression of HO-1 by real time PCR and the number ofantigen p24 HIV-1by ELISA. The result showed that there was no increasing of HO-1 at both mRNA level and protein level, there was a decreasing number of antigen p24 HIV-1 at the treatment group. In addition, hyperbaric exposure could not increase the expression of HO-1, more over the viral replication might be reduced by other mechanism. Hyperbaric oxygen could increases cellular adaptive response of PBMCs infected HIV-1 through increased expression of proteins that can inhibit HIV viralreplication.

  7. A novel compound derived from danshensu inhibits apoptosis via upregulation of heme oxygenase-1 expression in SH-SY5Y cells.

    Science.gov (United States)

    Pan, Li-Long; Liu, Xin-Hua; Jia, Yao-Ling; Wu, Dan; Xiong, Qing-Hui; Gong, Qi-Hai; Wang, Yang; Zhu, Yi-Zhun

    2013-04-01

    Heme oxygenase-1 (HO-1) has potential anti-apoptotic properties. A novel compound [4-(2-acetoxy-3-((R)-3-(benzylthio)-1-methoxy-1-oxopropan-2- ylamino)-3-oxopropyl)-1,2-phenylene diacetate (DSC)] was synthesized by joining danshensu and cysteine through an appropriate linker. This study investigated if the cytoprotective properties of DSC involved the induction of HO-1. We evaluated the cytoprotective effects of DSC on H2O2-induced cell damage, apoptosis, intracellular and mitochondrial reactive oxygen species (ROS) production, mitochondrial membrane potential (ΔΨm) loss, and apoptosis-related proteins expression and its underlying mechanisms. DSC concentration-dependently attenuated cell death, lactate dehydrogenase release, intracellular and mitochondrial ROS production, and ΔΨm collapse, modulated apoptosis-related proteins (Bcl-2, Bax, caspase-3, p53, and cleaved PARP) expression, and inhibited phosphorylation of extracellular signal-regulated kinase 1/2 in SH-SY5Y cells induced by H2O2. In addition, DSC concentration-dependently induced HO-1 expression associated with nuclear translocation of nuclear factor-erythroid 2 related factor 2 (Nrf-2), while the effect of DSC was inhibited by a phosphoinositide 3-kinase (PI3K) inhibitor LY294002. Furthermore, the protective effect of DSC on H2O2-induced cell death was abolished by HO-1 inhibitor ZnPP, but was mimicked by carbon monoxide-releasing moiety CORM-3 or HO-1 by-product bilirubin. Finally, DSC inhibited H2O2-induced changes of Bcl-2, Bax, and caspase-3 expression, and all of these effects were reversed by HO-1 silencing. Induction of HO-1 may be, at least in part, responsible for the anti-apoptotic property of DSC, an effect that involved the activation of PI3K/Akt/Nrf-2 axis. DSC might have the potential for beneficial therapeutic interventions for neurodegenerative diseases. Copyright © 2013. Published by Elsevier B.V.

  8. Glomerular Epithelial Cells-Targeted Heme Oxygenase-1 Over Expression in the Rat: Attenuation of Proteinuria in Secondary But Not Primary Injury.

    Science.gov (United States)

    Atsaves, Vassilios; Makri, Panagiota; Detsika, Maria G; Tsirogianni, Alexandra; Lianos, Elias A

    2016-01-01

    Induction of heme oxygenase 1 (HO-1) in glomerular epithelial cells (GEC) in response to injury is poor and this may be a disadvantage. We, therefore, explored whether HO-1 overexpression in GEC can reduce proteinuria induced by puromycin aminonucleoside (PAN) or in anti-glomerular basement membrane (GBM) antibody (Ab)-mediated glomerulonephritis (GN). HO-1 overexpression in GEC (GECHO-1) of Sprague-Dawley rats was achieved by targeting a FLAG-human (h) HO-1 using transposon-mediated transgenesis. Direct GEC injury was induced by a single injection of PAN. GN was induced by administration of an anti-rat GBM Ab and macrophage infiltration in glomeruli was assessed by immunohistochemistry and western blot analysis, which was also used to assess glomerular nephrin expression. In GECHO-1 rats, FLAG-hHO-1 transprotein was co-immunolocalized with nephrin. Baseline glomerular HO-1 protein levels were higher in GECHO-1 compared to wild type (WT) rats. Administration of either PAN or anti-GBM Ab to WT rats increased glomerular HO-1 levels. Nephrin expression markedly decreased in glomeruli of WT or GECHO-1 rats treated with PAN. In anti-GBM Ab-treated WT rats, nephrin expression also decreased. In contrast, it was preserved in anti-GBM Ab-treated GECHO-1 rats. In these, macrophage infiltration in glomeruli and the ratio of urine albumin to urine creatinine (Ualb/Ucreat) were markedly reduced. There was no difference in Ualb/Ucreat between WT and GECHO-1 rats treated with PAN. Depending on the type of injury, HO-1 overexpression in GEC may or may not reduce proteinuria. Reduced macrophage infiltration and preservation of nephrin expression are putative mechanisms underlying the protective effect of HO-1 overexpression following immune injury. © 2016 S. Karger AG, Basel.

  9. BTB and CNC homolog 1 (Bach1) deficiency ameliorates TNBS colitis in mice: role of M2 macrophages and heme oxygenase-1.

    Science.gov (United States)

    Harusato, Akihito; Naito, Yuji; Takagi, Tomohisa; Uchiyama, Kazuhiko; Mizushima, Katsura; Hirai, Yasuko; Higashimura, Yasuki; Katada, Kazuhiro; Handa, Osamu; Ishikawa, Takeshi; Yagi, Nobuaki; Kokura, Satoshi; Ichikawa, Hiroshi; Muto, Akihiko; Igarashi, Kazuhiko; Yoshikawa, Toshikazu

    2013-01-01

    BTB and CNC homolog 1 (Bach1) is a transcriptional repressor of heme oxygenase-1 (HO-1), which plays an important role in the protection of cells and tissues against acute and chronic inflammation. However, the role of Bach1 in the gastrointestinal mucosal defense system remains little understood. HO-1 supports the suppression of experimental colitis and localizes mainly in macrophages in colonic mucosa. This study was undertaken to elucidate the Bach1/HO-1 system's effects on the pathogenesis of experimental colitis. This study used C57BL/6 (wild-type) and homozygous Bach1-deficient C57BL/6 mice in which colonic damage was induced by the administration of an enema of 2,4,6-trinitrobenzene sulfonic acid (TNBS). Subsequently, they were evaluated macroscopically, histologically, and biochemically. Peritoneal macrophages from the respective mice were isolated and analyzed. Then, wild-type mice were injected with peritoneal macrophages from the respective mice. Acute colitis was induced similarly. TNBS-induced colitis was inhibited in Bach1-deficient mice. TNBS administration increased the expression of HO-1 messenger RNA and protein in colonic mucosa in Bach1-deficient mice. The expression of HO-1 mainly localized in F4/80-immunopositive and CD11b-immunopositive macrophages. Isolated peritoneal macrophages from Bach1-deficient mice highly expressed HO-1 and also manifested M2 macrophage markers, such as Arginase-1, Fizz-1, Ym1, and MRC1. Furthermore, TNBS-induced colitis was inhibited by the transfer of Bach1-deficient macrophages into wild-type mice. Deficiency of Bach1 ameliorated TNBS-induced colitis. Bach1-deficient macrophages played a key role in protection against colitis. Targeting of this mechanism is applicable to cell therapy for human inflammatory bowel disease.

  10. MAPK/JNK1 activation protects cells against cadmium-induced autophagic cell death via differential regulation of catalase and heme oxygenase-1 in oral cancer cells.

    Science.gov (United States)

    So, Keum-Young; Kim, Sang-Hun; Jung, Ki-Tae; Lee, Hyun-Young; Oh, Seon-Hee

    2017-10-01

    Antioxidant enzymes are related to oral diseases. We investigated the roles of heme oxygenase-1 (HO-1) and catalase in cadmium (Cd)-induced oxidative stress and the underlying molecular mechanism in oral cancer cells. Exposing YD8 cells to Cd reduced the expression levels of catalase and superoxide dismutase 1/2 and induced the expression of HO-1 as well as autophagy and apoptosis, which were reversed by N-acetyl-l-cysteine (NAC). Cd-exposed YD10B cells exhibited milder effects than YD8 cells, indicating that Cd sensitivity is associated with antioxidant enzymes and autophagy. Autophagy inhibition via pharmacologic and genetic modulations enhanced Cd-induced HO-1 expression, caspase-3 cleavage, and the production of reactive oxygen species (ROS). Ho-1 knockdown increased autophagy and apoptosis. Hemin treatment partially suppressed Cd-induced ROS production and apoptosis, but enhanced autophagy and CHOP expression, indicating that autophagy induction is associated with cellular stress. Catalase inhibition by pharmacological and genetic modulations increased Cd-induced ROS production, autophagy, and apoptosis, but suppressed HO-1, indicating that catalase is required for HO-1 induction. p38 inhibition upregulated Cd-induced phospho-JNK and catalase, but suppressed HO-1, autophagy, apoptosis. JNK suppression exhibited contrary results, enhancing the expression of phospho-p38. Co-suppression of p38 and JNK1 failed to upregulate catalase and procaspase-3, which were upregulated by JNK1 overexpression. Overall, the balance between the responses of p38 and JNK activation to Cd appears to have an important role in maintaining cellular homeostasis via the regulation of antioxidant enzymes and autophagy induction. In addition, the upregulation of catalase by JNK1 activation can play a critical role in cell protection against Cd-induced oxidative stress. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Lycopene inhibits NF-κB activation and adhesion molecule expression through Nrf2-mediated heme oxygenase-1 in endothelial cells.

    Science.gov (United States)

    Yang, Po-Min; Chen, Huang-Zhi; Huang, Yu-Ting; Hsieh, Chia-Wen; Wung, Being-Sun

    2017-06-01

    The endothelial expression of cell adhesion molecules plays a leading role in atherosclerosis. Lycopene, a carotenoid with 11 conjugated double bonds, has been shown to have anti-inflammatory properties. In the present study, we demonstrate a putative mechanism for the anti-inflammatory effects of lycopene. We demonstrate that lycopene inhibits the adhesion of tumor necrosis factor α (TNFα)-stimulated monocytes to endothelial cells and suppresses the expression of intercellular cell adhesion molecule-1 (ICAM-1) at the transcriptional level. Moreover, lycopene was found to exert its inhibitory effects by blocking the degradation of the inhibitory protein, IκBα, following 6 h of pre-treatment. In TNFα-stimulated endothelial cells, nuclear factor-κB (NF-κB) nuclear translocation and transcriptional activity were abolished by up to 12 h of lycopene pre-treatment. We also found that lycopene increased the intracellular glutathione (GSH) level and glutamate-cysteine ligase expression. Subsequently, lycopene induced nuclear factor-erythroid 2 related factor 2 (Nrf2) activation, leading to the increased expression of downstream of heme oxygenase-1 (HO-1). The use of siRNA targeting HO-1 blocked the inhibitory effects of lycopene on IκB degradation and ICAM-1 expression. The inhibitory effects of lycopene thus appear to be mediated through its induction of Nrf2-mediated HO-1 expression. Therefore, the findings of the present study indicate that lycopene suppresses the activation of TNFα-induced signaling pathways through the upregulation of Nrf2-mediated HO-1 expression.

  12. Transition between acute and chronic hepatotoxicity in mice is associated with impaired energy metabolism and induction of mitochondrial heme oxygenase-1.

    Directory of Open Access Journals (Sweden)

    Aniket Nikam

    Full Text Available The formation of protein inclusions is frequently associated with chronic metabolic diseases. In mice, short-term intoxication with 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC leads to hepatocellular damage indicated by elevated serum liver enzyme activities, whereas only minor morphological changes are observed. Conversely, chronic administration of DDC for several weeks results in severe morphological damage, characterized by hepatocellular ballooning, disruption of the intermediate filament cytoskeleton, and formation of Mallory-Denk bodies consisting predominantly of misfolded keratins, Sqstm1/p62, and heat shock proteins. To evaluate the mechanistic underpinnings for this dichotomy we dissected the time-course of DDC intoxication for up to 10 weeks. We determined body weight change, serum liver enzyme activities, morphologic alterations, induction of antioxidant response (heme oxygenase-1, HO-1, oxidative damage and ATP content in livers as well as respiration, oxidative damage and the presence and activity of HO-1 in endoplasmic reticulum and mitochondria (mtHO-1. Elevated serum liver enzyme activity and oxidative liver damage were already present at early intoxication stages without further subsequent increase. After 2 weeks of intoxication, mice had transiently lost 9% of their body weight, liver ATP-content was reduced to 58% of controls, succinate-driven respiration was uncoupled from ATP-production and antioxidant response was associated with the appearance of catalytically active mtHO-1. Oxidative damage was associated with both acute and chronic DDC toxicity whereas the onset of chronic intoxication was specifically associated with mitochondrial dysfunction which was maximal after 2 weeks of intoxication. At this transition stage, adaptive responses involving mtHO-1 were induced, indirectly leading to improved respiration and preventing further drop of ATP levels. Our observations clearly demonstrate principally different

  13. The application of powerful promoters to enhance gene expression in industrial microorganisms.

    Science.gov (United States)

    Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

    2017-02-01

    Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

  14. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    Science.gov (United States)

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  15. Isorhamnetin inhibits Prevotella intermedia lipopolysaccharide-induced production of interleukin-6 in murine macrophages via anti-inflammatory heme oxygenase-1 induction and inhibition of nuclear factor-κB and signal transducer and activator of transcription 1 activation.

    Science.gov (United States)

    Jin, J Y; Choi, E Y; Park, H R; Choi, J I; Choi, I S; Kim, S J

    2013-12-01

    Interleukin-6 (IL-6) is a key proinflammatory cytokine that has been considered to be important in the pathogenesis of periodontal disease. Therefore, host-modulatory agents directed at inhibiting IL-6 appear to be beneficial in terms of attenuating periodontal disease progression and potentially improving disease susceptibility. In the current study, we investigated the effect of the flavonoid isorhamnetin on the production of IL-6 in murine macrophages stimulated with lipopolysaccharide (LPS) from Prevotella intermedia, a pathogen implicated in inflammatory periodontal disease, and its mechanisms of action. Lipopolysaccharide from P. intermedia ATCC 25611 was isolated using the standard hot phenol-water method. Culture supernatants were collected and assayed for IL-6. We used real-time PCR to quantify IL-6 and heme oxygenase-1 (HO-1) mRNA expression. The expression of HO-1 protein and the levels of signaling proteins were monitored using immunoblot analyses. The DNA-binding activity of nuclear factor-κB (NF-κB) was analyzed using ELISA-based assay kits. Isorhamnetin significantly down-regulated P. intermedia LPS-induced production of IL-6 as well as its mRNA expression in RAW264.7 cells. Isorhamnetin up-regulated the expression of HO-1 at both gene transcription and translation levels in cells stimulated with P. intermedia LPS. In addition, inhibition of HO-1 activity by tin protoporphyrin IX blocked the inhibitory effect of isorhamnetin on IL-6 production. Isorhamnetin failed to prevent LPS from activating either c-Jun N-terminal kinase or p38 pathways. Isorhamnetin did not inhibit NF-κB transcriptional activity at the level of inhibitory κB-α degradation. Isorhamnetin suppressed NF-κB signaling through inhibition of nuclear translocation and DNA binding activity of NF-κB p50 subunit and attenuated signal transducer and activator of transcription 1 signaling. Although further research is required to clarify the detailed mechanism of action, we propose

  16. A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Li Mingji

    2012-02-01

    Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.

  17. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  18. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  19. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  20. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  1. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    OpenAIRE

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  2. Low-Dose Radiation Induces Genes Promoting Cell Survival

    International Nuclear Information System (INIS)

    Liu, Shu-Zheng; Chen, Dong; Mu, Ying

    1999-01-01

    Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes

  3. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  4. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  5. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    Science.gov (United States)

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  6. Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

    Science.gov (United States)

    Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

    2017-11-26

    Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

  7. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  8. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  9. Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

    Directory of Open Access Journals (Sweden)

    Alexander Michael Bedford Johns

    2016-10-01

    Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  10. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  11. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  12. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  13. Characterization of the distal promoter of the human pyruvate carboxylase gene in pancreatic beta cells.

    Directory of Open Access Journals (Sweden)

    Ansaya Thonpho

    Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.

  14. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

    Science.gov (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

    1996-12-01

    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  15. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  16. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong

    2010-04-01

    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  17. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    V Shilpa

    2014-01-01

    Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.

  18. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    International Nuclear Information System (INIS)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy

    2016-01-01

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H 2 O 2 ) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H 2 O 2 levels. Furthermore, H 2 O 2 independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H 2 O 2 levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H 2 O 2 -independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H 2 O 2 - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments omeprazole-mediated induction of HO-1.

  19. Transduction of PEP-1-heme oxygenase-1 into insulin-producing INS-1 cells protects them against cytokine-induced cell death

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Su Jin; Kang, Hyung Kyung [Department of Physiology, College of Medicine, Hallym University, Chunchon 200-702 (Korea, Republic of); Song, Dong Keun [Department of Pharmacology, College of Medicine, Hallym University, Chunchon 200-702 (Korea, Republic of); Eum, Won Sik; Park, Jinseu [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Choi, Soo Young, E-mail: sychoi@hallym.ac.kr [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Kwon, Hyeok Yil, E-mail: hykwon@hallym.ac.kr [Department of Physiology, College of Medicine, Hallym University, Chunchon 200-702 (Korea, Republic of)

    2015-06-05

    Pro-inflammatory cytokines play a crucial role in the destruction of pancreatic β-cells, thereby triggering the development of autoimmune diabetes mellitus. We recently developed a cell-permeable fusion protein, PEP-1-heme oxygenase-1 (PEP-1-HO-1) and investigated the anti-inflammatory effects in macrophage cells. In this study, we transduced PEP-1-HO-1 into INS-1 insulinoma cells and examined its protective effect against cytokine-induced cell death. PEP-1-HO-1 was successfully delivered into INS-1 cells in time- and dose-dependent manner and was maintained within the cells for at least 48 h. Pre-treatment with PEP-1-HO-1 increased the survival of INS-1 cells exposed to cytokine mixture (IL-1β, IFN-γ, and TNF-α) in a dose-dependent manner. PEP-1-HO-1 markedly decreased cytokine-induced production of reactive oxygen species (ROS), nitric oxide (NO), and malondialdehyde (MDA). These protective effects of PEP-1-HO-1 against cytokines were correlated with the changes in the levels of signaling mediators of inflammation (iNOS and COX-2) and cell apoptosis/survival (Bcl-2, Bax, caspase-3, PARP, JNK, and Akt). These results showed that the transduced PEP-1-HO-1 efficiently prevented cytokine-induced cell death of INS-1 cells by alleviating oxidative/nitrosative stresses and inflammation. Further, these results suggested that PEP-1-mediated HO-1 transduction may be a potential therapeutic strategy to prevent β-cell destruction in patients with autoimmune diabetes mellitus. - Highlights: • We showed that PEP-1-HO-1 was efficiently delivered into INS-1 cells. • Transduced PEP-1-HO-1 exerted a protective effect against cytokine-induced cell death. • Transduced PEP-1-HO-1 inhibited cytokine-induced ROS and NO accumulation. • PEP-1-HO-1 suppressed cytokine-induced expression of iNOS, COX-2, and Bax. • PEP-1-HO-1 transduction may be an efficient tool to prevent β-cell destruction.

  20. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu

    2016-11-15

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H{sub 2}O{sub 2}) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H{sub 2}O{sub 2} levels. Furthermore, H{sub 2}O{sub 2} independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H{sub 2}O{sub 2} levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H{sub 2}O{sub 2}-independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H{sub 2}O{sub 2} - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments

  1. Daily exercise prevents diastolic dysfunction and oxidative stress in a female mouse model of western diet induced obesity by maintaining cardiac heme oxygenase-1 levels.

    Science.gov (United States)

    Bostick, Brian; Aroor, Annayya R; Habibi, Javad; Durante, William; Ma, Lixin; DeMarco, Vincent G; Garro, Mona; Hayden, Melvin R; Booth, Frank W; Sowers, James R

    2017-01-01

    Obesity is a global epidemic with profound cardiovascular disease (CVD) complications. Obese women are particularly vulnerable to CVD, suffering higher rates of CVD compared to non-obese females. Diastolic dysfunction is the earliest manifestation of CVD in obese women but remains poorly understood with no evidence-based therapies. We have shown early diastolic dysfunction in obesity is associated with oxidative stress and myocardial fibrosis. Recent evidence suggests exercise may increase levels of the antioxidant heme oxygenase-1 (HO-1). Accordingly, we hypothesized that diastolic dysfunction in female mice consuming a western diet (WD) could be prevented by daily volitional exercise with reductions in oxidative stress, myocardial fibrosis and maintenance of myocardial HO-1 levels. Four-week-old female C57BL/6J mice were fed a high-fat/high-fructose WD for 16weeks (N=8) alongside control diet fed mice (N=8). A separate cohort of WD fed females was allowed a running wheel for the entire study (N=7). Cardiac function was assessed at 20weeks by high-resolution cardiac magnetic resonance imaging (MRI). Functional assessment was followed by immunohistochemistry, transmission electron microscopy (TEM) and Western blotting to identify pathologic mechanisms and assess HO-1 protein levels. There was no significant body weight decrease in exercising mice, normalized body weight 14.3g/mm, compared to sedentary mice, normalized body weight 13.6g/mm (p=0.38). Total body fat was also unchanged in exercising, fat mass of 6.6g, compared to sedentary mice, fat mass 7.4g (p=0.55). Exercise prevented diastolic dysfunction with a significant reduction in left ventricular relaxation time to 23.8ms for exercising group compared to 33.0ms in sedentary group (pstress and myocardial fibrosis with improved mitochondrial architecture. HO-1 protein levels were increased in the hearts of exercising mice compared to sedentary WD fed females. This study provides seminal evidence that exercise

  2. Metformin inhibits heme oxygenase-1 expression in cancer cells through inactivation of Raf-ERK-Nrf2 signaling and AMPK-independent pathways

    International Nuclear Information System (INIS)

    Do, Minh Truong; Kim, Hyung Gyun; Khanal, Tilak; Choi, Jae Ho; Kim, Dong Hee; Jeong, Tae Cheon; Jeong, Hye Gwang

    2013-01-01

    Resistance to therapy is the major obstacle to more effective cancer treatment. Heme oxygenase-1 (HO-1) is often highly up-regulated in tumor tissues, and its expression is further increased in response to therapies. It has been suggested that inhibition of HO-1 expression is a potential therapeutic approach to sensitize tumors to chemotherapy and radiotherapy. In this study, we tested the hypothesis that the anti-tumor effects of metformin are mediated by suppression of HO-1 expression in cancer cells. Our results indicate that metformin strongly suppresses HO-1 mRNA and protein expression in human hepatic carcinoma HepG2, cervical cancer HeLa, and non-small-cell lung cancer A549 cells. Metformin also markedly reduced Nrf2 mRNA and protein levels in whole cell lysates and suppressed tert-butylhydroquinone (tBHQ)-induced Nrf2 protein stability and antioxidant response element (ARE)-luciferase activity in HepG2 cells. We also found that metformin regulation of Nrf2 expression is mediated by a Keap1-independent mechanism and that metformin significantly attenuated Raf-ERK signaling to suppress Nrf2 expression in cancer cells. Inhibition of Raf-ERK signaling by PD98059 decreased Nrf2 mRNA expression in HepG2 cells, confirming that the inhibition of Nrf2 expression is mediated by an attenuation of Raf-ERK signaling in cancer cells. The inactivation of AMPK by siRNA, DN-AMPK or the pharmacological AMPK inhibitor compound C, revealed that metformin reduced HO-1 expression in an AMPK-independent manner. These results highlight the Raf-ERK-Nrf2 axis as a new molecular target in anticancer therapy in response to metformin treatment. - Highlights: • Metformin inhibits HO-1 expression in cancer cells. • Metformin attenuates Raf-ERK-Nrf2 signaling. • Suppression of HO-1 by metformin is independent of AMPK. • HO-1 inhibition contributes to anti-proliferative effects of metformin

  3. Transduction of PEP-1-heme oxygenase-1 into insulin-producing INS-1 cells protects them against cytokine-induced cell death

    International Nuclear Information System (INIS)

    Lee, Su Jin; Kang, Hyung Kyung; Song, Dong Keun; Eum, Won Sik; Park, Jinseu; Choi, Soo Young; Kwon, Hyeok Yil

    2015-01-01

    Pro-inflammatory cytokines play a crucial role in the destruction of pancreatic β-cells, thereby triggering the development of autoimmune diabetes mellitus. We recently developed a cell-permeable fusion protein, PEP-1-heme oxygenase-1 (PEP-1-HO-1) and investigated the anti-inflammatory effects in macrophage cells. In this study, we transduced PEP-1-HO-1 into INS-1 insulinoma cells and examined its protective effect against cytokine-induced cell death. PEP-1-HO-1 was successfully delivered into INS-1 cells in time- and dose-dependent manner and was maintained within the cells for at least 48 h. Pre-treatment with PEP-1-HO-1 increased the survival of INS-1 cells exposed to cytokine mixture (IL-1β, IFN-γ, and TNF-α) in a dose-dependent manner. PEP-1-HO-1 markedly decreased cytokine-induced production of reactive oxygen species (ROS), nitric oxide (NO), and malondialdehyde (MDA). These protective effects of PEP-1-HO-1 against cytokines were correlated with the changes in the levels of signaling mediators of inflammation (iNOS and COX-2) and cell apoptosis/survival (Bcl-2, Bax, caspase-3, PARP, JNK, and Akt). These results showed that the transduced PEP-1-HO-1 efficiently prevented cytokine-induced cell death of INS-1 cells by alleviating oxidative/nitrosative stresses and inflammation. Further, these results suggested that PEP-1-mediated HO-1 transduction may be a potential therapeutic strategy to prevent β-cell destruction in patients with autoimmune diabetes mellitus. - Highlights: • We showed that PEP-1-HO-1 was efficiently delivered into INS-1 cells. • Transduced PEP-1-HO-1 exerted a protective effect against cytokine-induced cell death. • Transduced PEP-1-HO-1 inhibited cytokine-induced ROS and NO accumulation. • PEP-1-HO-1 suppressed cytokine-induced expression of iNOS, COX-2, and Bax. • PEP-1-HO-1 transduction may be an efficient tool to prevent β-cell destruction

  4. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  5. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  6. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  7. Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.

    Science.gov (United States)

    Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J

    2018-05-01

    Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.

  8. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

    Science.gov (United States)

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

    2016-01-01

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  10. Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

    DEFF Research Database (Denmark)

    Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

    2009-01-01

    reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

  11. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  12. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  13. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.

    2014-01-01

    raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted

  14. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    Science.gov (United States)

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  15. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  16. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  17. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  18. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    NARCIS (Netherlands)

    Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

  19. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  20. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  1. Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering

    Directory of Open Access Journals (Sweden)

    Jared B. Fudge

    2018-04-01

    Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.

  2. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  3. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    International Nuclear Information System (INIS)

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng

    2005-01-01

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases

  4. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  5. CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.

    Science.gov (United States)

    Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan

    2017-07-05

    DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20

  6. Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.

    Science.gov (United States)

    Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk

    2009-07-01

    To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.

  7. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.

    2012-01-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  8. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh

    2012-07-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  9. Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing

    Directory of Open Access Journals (Sweden)

    Rosner William

    2009-05-01

    Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.

  10. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  11. MITEs in the promoters of effector genes allow prediction of novel virulence genes in Fusarium oxysporum

    NARCIS (Netherlands)

    Schmidt, S.M.; Houterman, P.M.; Schreiver, I.; Ma, L.; Amyotte, S.; Chellappan, B.; Boeren, S.; Takken, F.L.W.; Rep, M.

    2013-01-01

    Background The plant-pathogenic fungus Fusarium oxysporum f.sp.lycopersici (Fol) has accessory, lineage-specific (LS) chromosomes that can be transferred horizontally between strains. A single LS chromosome in the Fol4287 reference strain harbors all known Fol effector genes. Transfer of this

  12. Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor

    International Nuclear Information System (INIS)

    Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.

    2006-01-01

    The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression

  13. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  14. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  15. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  16. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  17. Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

    Science.gov (United States)

    Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

    2017-10-01

    PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  19. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    International Nuclear Information System (INIS)

    Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

    2011-01-01

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  20. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Science.gov (United States)

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  1. Inactivation of promoter 1B of APC causes partial gene silencing: evidence for a significant role of the promoter in regulation and causative of familial adenomatous polyposis

    DEFF Research Database (Denmark)

    Rohlin, A; Engwall, Y; Fritzell, K

    2011-01-01

    inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...

  2. hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro

    International Nuclear Information System (INIS)

    Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan

    2007-01-01

    Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)

  3. Methylation of class II transactivator gene promoter IV is not associated with susceptibility to Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Lincoln Matthew R

    2008-07-01

    Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.

  4. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  5. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    Directory of Open Access Journals (Sweden)

    Skiriute Daina

    2012-06-01

    Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.

  6. Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

    Science.gov (United States)

    Lee, S H; Minowa, M T; Mouradian, M M

    1996-10-11

    The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

  7. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Science.gov (United States)

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  8. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  9. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Science.gov (United States)

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  10. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  11. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  12. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  13. Correlation between the methylation of APC gene promoter and colon cancer.

    Science.gov (United States)

    Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua

    2017-08-01

    The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.

  14. Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes

    DEFF Research Database (Denmark)

    Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard

    2009-01-01

    with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....

  15. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    International Nuclear Information System (INIS)

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi

    2006-01-01

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid

  16. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    DEFF Research Database (Denmark)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal

    2013-01-01

    , isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...

  17. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    Directory of Open Access Journals (Sweden)

    Oliveira Jorge

    2007-07-01

    Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.

  18. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    International Nuclear Information System (INIS)

    Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen

    2007-01-01

    Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses

  19. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  20. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  1. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    Science.gov (United States)

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  2. Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.

    Science.gov (United States)

    Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G

    2015-01-01

    CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.

  3. Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

    Science.gov (United States)

    Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

    2016-05-01

    Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

  4. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    Science.gov (United States)

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-03

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai

    2013-01-01

    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  6. The association of the metalloproteinase-3 gene promoter polymorphisms and the middle cerebral artery stenosis.

    Science.gov (United States)

    Fu, Chunli; Xing, Yingqi; Song, Xiaonan

    2011-04-01

    To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.

  7. Quantitative Methylation Profiles for Multiple Tumor Suppressor Gene Promoters in Salivary Gland Tumors

    Science.gov (United States)

    Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.

    2010-01-01

    Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817

  8. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  9. Genomic organization and promoter cloning of the human X11α gene APBA1.

    LENUS (Irish Health Repository)

    Chai, Ka-Ho

    2012-05-01

    X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

  10. Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring

    Directory of Open Access Journals (Sweden)

    Liu Zhongjie

    2015-11-01

    Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.

  11. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  12. Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

    International Nuclear Information System (INIS)

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-01-01

    The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

  13. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  14. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  15. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  16. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  17. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  18. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    International Nuclear Information System (INIS)

    Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent

    2011-01-01

    Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue

  19. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Directory of Open Access Journals (Sweden)

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  20. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  1. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  2. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    Science.gov (United States)

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  3. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  4. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  5. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  6. Aquilegia B gene homologs promote petaloidy of the sepals and maintenance of the C domain boundary

    Directory of Open Access Journals (Sweden)

    Bharti Sharma

    2017-11-01

    Full Text Available Abstract The model Aquilegia coerulea x “Origami” possesses several interesting floral features, including petaloid sepals that are morphologically distinct from the true petals and a broad domain containing many whorls of stamens. We undertook the current study in an effort to understand the former trait, but additionally uncovered data that inform on the latter. The Aquilegia B gene homolog AqPI is shown to contribute to the production of anthocyanin in the first whorl sepals, although it has no major role in their morphology. Surprisingly, knockdown of AqPI in Aquilegia coerulea x “Origami” also reveals a role for the B class genes in maintaining the expression of the C gene homolog AqAG1 in the outer whorls of stamens. These findings suggest that the transference of pollinator function to the first whorl sepals included a non-homeotic recruitment of the B class genes to promote aspects of petaloidy. They also confirm results in several other Ranunculales that have revealed an unexpected regulatory connection between the B and C class genes.

  7. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  8. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  9. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Kuzmina, Nina S., E-mail: nin-kuzmin@youndex.ru; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-04-15

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10{sup −7}). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10{sup −5}). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10{sup −7}). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging

  10. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    International Nuclear Information System (INIS)

    Kuzmina, Nina S.; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-01-01

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10 −7 ). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10 −5 ). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10 −7 ). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging and/or with

  11. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  12. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Directory of Open Access Journals (Sweden)

    Zhichun Zhang

    Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  13. Glucose metabolism in pigs expressing human genes under an insulin promoter.

    Science.gov (United States)

    Wijkstrom, Martin; Bottino, Rita; Iwase, Hayoto; Hara, Hidetaka; Ekser, Burcin; van der Windt, Dirk; Long, Cassandra; Toledo, Frederico G S; Phelps, Carol J; Trucco, Massimo; Cooper, David K C; Ayares, David

    2015-01-01

    Xenotransplantation of porcine islets can reverse diabetes in non-human primates. The remaining hurdles for clinical application include safe and effective T-cell-directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h)CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. This preliminary study did not show definite evidence of β-cell deficiencies, even when three transgenes were expressed under the insulin promoter. Of seven animals, all were normoglycemic at fasting, and five of seven had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  15. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  16. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

    2009-01-01

    ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

  17. The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

    Science.gov (United States)

    Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

    2009-08-01

    Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

  18. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  19. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Directory of Open Access Journals (Sweden)

    Cynthia J Thomson

    Full Text Available Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4 influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599 that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing sensation seeking between groups. There were no significant associations between genotype(s and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  20. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Science.gov (United States)

    Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L

    2014-01-01

    Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  1. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

    Directory of Open Access Journals (Sweden)

    Yin Weilun

    2010-01-01

    Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

  2. Characterization and functional analyses of the human G protein-coupled receptor kinase 4 gene promoter.

    Science.gov (United States)

    Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva

    2008-10-01

    The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.

  3. CypA, a gene downstream of HIF-1α, promotes the development of PDAC.

    Directory of Open Access Journals (Sweden)

    Huan Zhang

    Full Text Available Hypoxia-inducible factor-1α (HIF-1α is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC. In response to tumor hypoxia, cyclophilin A (CypA is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC.

  4. Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma

    International Nuclear Information System (INIS)

    Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.

    2016-01-01

    Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).

  5. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    Science.gov (United States)

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  6. Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

    Science.gov (United States)

    Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

    2011-12-01

    Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

  7. Gene promoter methylation and DNA repair capacity in monozygotic twins with discordant smoking habits.

    Science.gov (United States)

    Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca

    2015-02-01

    The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Quantitative global and gene-specific promoter methylation in relation to biological properties of neuroblastomas

    Directory of Open Access Journals (Sweden)

    Kiss Nimrod B

    2012-09-01

    Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.

  9. [Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].

    Science.gov (United States)

    Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W

    2016-11-23

    Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.

  10. The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

    Science.gov (United States)

    Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

    2011-01-01

    Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

  11. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  12. Hydrogel Design for Supporting Neurite Outgrowth and Promoting Gene Delivery to Maximize Neurite Extension

    Science.gov (United States)

    Shepard, Jaclyn A.; Stevans, Alyson C.; Holland, Samantha; Wang, Christine E.; Shikanov, Ariella; Shea, Lonnie D.

    2012-01-01

    Hydrogels capable of gene delivery provide a combinatorial approach for nerve regeneration, with the hydrogel supporting neurite outgrowth and gene delivery inducing the expression of inductive factors. This report investigates the design of hydrogels that balance the requirements for supporting neurite growth with those requirements for promoting gene delivery. Enzymatically-degradable PEG hydrogels encapsulating dorsal root ganglia explants, fibroblasts, and lipoplexes encoding nerve growth factor were gelled within channels that can physically guide neurite outgrowth. Transfection of fibroblasts increased with increasing concentration of Arg-Gly-Asp (RGD) cell adhesion sites and decreasing PEG content. The neurite length increased with increasing RGD concentration within 10% PEG hydrogels, yet was maximal within 7.5% PEG hydrogels at intermediate RGD levels. Delivering lipoplexes within the gel produced longer neurites than culture in NGF-supplemented media or co-culture with cells exposed to DNA prior to encapsulation. Hydrogels designed to support neurite outgrowth and deliver gene therapy vectors locally may ultimately be employed to address multiple barriers that limit regeneration. PMID:22038654

  13. TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

    2010-01-01

    Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

  14. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

    International Nuclear Information System (INIS)

    Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

  15. Cloning and characterization of the promoter of the 9-cis-epoxycarotenoid dioxygenase gene in Arachis hypogaea L.

    Science.gov (United States)

    Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu

    2009-09-01

    We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.

  16. Development of a flexible and potent hypoxia-inducible promoter for tumor-targeted gene expression in attenuated Salmonella

    NARCIS (Netherlands)

    Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan

    To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells

  17. Transcriptional coactivator NT-PGC-1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis.

    Science.gov (United States)

    Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung

    2016-10-01

    The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  18. Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

    Science.gov (United States)

    Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

    2018-02-01

    The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

  19. In silico analysis and DHPLC screening strategy identifies novel apoptotic gene targets of aberrant promoter hypermethylation in prostate cancer.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2011-01-01

    Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).

  20. ΔNp73 enhances promoter activity of TGF-β induced genes.

    Directory of Open Access Journals (Sweden)

    Maarten Niemantsverdriet

    Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.

  1. Promotion of Metastasis-associated Gene Expression in Survived PANC-1 Cells Following Trichostatin A Treatment.

    Science.gov (United States)

    Chen, Zongjing; Yang, Yunxiu; Liu, Biao; Wang, Benquan; Sun, Meng; Zhang, Ling; Chen, Bicheng; You, Heyi; Zhou, Mengtao

    2015-01-01

    Histone deacetylase inhibitors represent a promising class of potential anticancer agents for the treatment of human malignancies. In this study, the effects of trichostatin A (TSA) on apoptosis, metastasis-associated gene expression, and activation of the Notch pathway in human pancreatic cancer cell lines were investigated. After treatment with TSA, cell viability and apoptosis were evaluated using the MTT [3-(4,5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] assay, Hoechst 33258 staining, and flow cytometry. Moreover, RT-PCR and western blot analyses were performed to measure the expression levels of apoptosis-associated genes (Bcl-2, Bax, and caspase-3), metastasis-associated genes (E-cadherin, vimentin, and matrix metalloproteinases), and Notch pathway activation (Notch intracellular domain, NICD). The levels of matrix metalloproteinase 2 and NICD were also semi-quantified by immunoassay. Following treatment with TSA for 24 h, PANC-1, SW1990, and MIATACA-2 cells exhibited cell death. The MTT assay revealed that TSA significantly decreased cell viability in a dose-dependent manner in PANC-1 cells. The Hoechst 33258 staining and flow cytometry results evidenced a significant increase in PANC-1 cell apoptosis following TSA treatment. The expression levels of Bax and caspase-3 were increased significantly, whereas Bcl-2 was down-regulated after TSA treatment. In the PANC-1 cells that survived after TSA treatment, the expression levels of vimentin, E-cadherin, and MMP genes were altered by the promotion of potential metastasis and increased expression of NICD. TSA can induce apoptosis of pancreatic cancer cells. In addition, the up-regulation of metastasis-related genes and the activation of the Notch pathway in the survived PANC-1 cells may be associated with a too-low level of TSA or resistance to TSA.

  2. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China

    Directory of Open Access Journals (Sweden)

    Liu Wenzhong

    2008-10-01

    Full Text Available Abstract Background The prevalence of H. pylori is as high as 60–70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. Methods H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU, gastric ulcer (GU, or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1β polymorphism was investigated using restriction fragment length polymorphism. Results Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360 and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058. The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1β polymorphisms. Conclusion In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  3. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.

    Science.gov (United States)

    Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong

    2008-10-25

    The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  4. Methylation state of the EDA gene promoter in Chinese X-linked hypohidrotic ectodermal dysplasia carriers.

    Directory of Open Access Journals (Sweden)

    Wei Yin

    Full Text Available Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED which is caused by genetic ectodysplasin A (EDA deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom.A large Chinese XLHED family was reported and the entire coding region and exon-intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers' tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system.A known frameshift mutation (c.573-574 insT was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI, 18 (78.26% carriers were hypermethylated at these 4 sites.Chinese XLHED carriers often have a hypermethylated EDA promoter.

  5. The Silencing of RECK Gene is Associated with Promoter Hypermethylation and Poor Survival in Hepatocellular Carcinoma

    Science.gov (United States)

    Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin

    2012-01-01

    Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890

  6. Linkage mapping of candidate genes for induce resistance and growth promotion by trichoderma koningiopsis (th003) in tomato solanum lycopersicum

    International Nuclear Information System (INIS)

    Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella

    2011-01-01

    Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.

  7. Analysis of tomato gene promoters activated in syncytia induced in tomato and potato hairy roots by Globodera rostochiensis.

    Science.gov (United States)

    Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M

    2013-06-01

    The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.

  8. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  9. Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.

    Science.gov (United States)

    Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun

    2015-12-01

    Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL Gene Family in Betula luminifera

    Directory of Open Access Journals (Sweden)

    Xiu-Yun Li

    2018-05-01

    Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.

  11. USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy

    Science.gov (United States)

    Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.

    2014-01-01

    Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308

  12. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    International Nuclear Information System (INIS)

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  13. Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

    Science.gov (United States)

    Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik

    2014-01-01

    Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

  14. Bovine glycomacropeptide promotes the growth of Bifidobacterium longum ssp. infantis and modulates its gene expression.

    Science.gov (United States)

    O'Riordan, N; O'Callaghan, J; Buttò, L F; Kilcoyne, M; Joshi, L; Hickey, R M

    2018-05-23

    Bovine milk glycomacropeptide (GMP) is derived from κ-casein, with exclusively o-linked glycosylation. Glycomacropeptide promoted the growth of Bifidobacterium longum ssp. infantis in a concentration-dependent manner, and this activity was lost following periodate treatment of the GMP (GMP-P), which disables biological recognition of the conjugated oligosaccharides. Transcriptional analysis of B. longum ssp. infantis following exposure to GMP revealed a substantial response to GMP relative to bacteria treated with GMP-P, with a greater number of differentially expressed transcripts and larger fold changes versus the control. Therefore, stimulation of B. longum ssp. infantis growth by GMP is intrinsically linked to the peptide's O-linked glycosylation. The pool of differentially expressed transcripts included 2 glycoside hydrolase (family 25) genes, which were substantially upregulated following exposure to GMP, but not GMP-P. These GH25 genes were present in duplicated genomic islands that also contained genes encoding fibronectin type III binding domain proteins and numerous phage-related proteins, all of which were also upregulated. Homologs of this genomic arrangement were present in other Bifidobacterium species, which suggest it may be a conserved domain for the utilization of glycosylated peptides. This study provides insights into the molecular basis for the prebiotic effect of bovine milk GMP on B. longum ssp. infantis. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

    Science.gov (United States)

    Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

    2016-01-01

    Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

  16. Deletion of the Imprinted Gene Grb10 Promotes Hematopoietic Stem Cell Self-Renewal and Regeneration.

    Science.gov (United States)

    Yan, Xiao; Himburg, Heather A; Pohl, Katherine; Quarmyne, Mamle; Tran, Evelyn; Zhang, Yurun; Fang, Tiancheng; Kan, Jenny; Chao, Nelson J; Zhao, Liman; Doan, Phuong L; Chute, John P

    2016-11-01

    Imprinted genes are differentially expressed by adult stem cells, but their functions in regulating adult stem cell fate are incompletely understood. Here we show that growth factor receptor-bound protein 10 (Grb10), an imprinted gene, regulates hematopoietic stem cell (HSC) self-renewal and regeneration. Deletion of the maternal allele of Grb10 in mice (Grb10 m/+ mice) substantially increased HSC long-term repopulating capacity, as compared to that of Grb10 +/+ mice. After total body irradiation (TBI), Grb10 m/+ mice demonstrated accelerated HSC regeneration and hematopoietic reconstitution, as compared to Grb10 +/+ mice. Grb10-deficient HSCs displayed increased proliferation after competitive transplantation or TBI, commensurate with upregulation of CDK4 and Cyclin E. Furthermore, the enhanced HSC regeneration observed in Grb10-deficient mice was dependent on activation of the Akt/mTORC1 pathway. This study reveals a function for the imprinted gene Grb10 in regulating HSC self-renewal and regeneration and suggests that the inhibition of Grb10 can promote hematopoietic regeneration in vivo. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir

    2014-10-02

    Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

  18. Histone Deacetylase 7 Promotes Toll-like Receptor 4-dependent Proinflammatory Gene Expression in Macrophages*

    Science.gov (United States)

    Shakespear, Melanie R.; Hohenhaus, Daniel M.; Kelly, Greg M.; Kamal, Nabilah A.; Gupta, Praveer; Labzin, Larisa I.; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A.; Reid, Robert C.; Irvine, Katharine M.; Fairlie, David P.; Sweet, Matthew J.

    2013-01-01

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target. PMID:23853092

  19. Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages.

    Science.gov (United States)

    Shakespear, Melanie R; Hohenhaus, Daniel M; Kelly, Greg M; Kamal, Nabilah A; Gupta, Praveer; Labzin, Larisa I; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A; Reid, Robert C; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J

    2013-08-30

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target.

  20. Association between promoter polymorphisms of OPN gene and cancer risk: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Liu JW

    2015-12-01

    Full Text Available Jingwei Liu,1–2 Caiyun He,1–2 Quan Yuan,1–2 Zhenning Wang,1–2 Chengzhong Xing,1–2 Yuan Yuan1–2 1Tumor Etiology and Screening Department of Cancer Institute and General Surgery, The First Affiliated Hospital of China Medical University, 2Key Laboratory of Cancer Etiology and Prevention, China Medical University, Liaoning Provincial Education Department, Shenyang, People’s Republic of China Background: Results of the association between polymorphisms of osteopontin (OPN gene promoter region and risk of cancer were inconclusive. The aim of this meta-analysis was to elucidate whether OPN promoter polymorphisms were associated with cancer risk.Methods: Electronic databases including PubMed, Web of Science, and Chinese National Knowledge Infrastructure were systematically searched. Odd ratios (ORs and their 95% confidential interval (CI were used to assess the strength of association between OPN promoter polymorphisms and cancer risks.Results: Nine studies were finally included in this meta-analysis. For OPN rs17524488 polymorphism, carriers of GG or -/G genotype were significantly associated with increased cancer risk compared with wild-type -/- carriers, respectively (GG vs -/-: OR =1.40, 95% CI =1.03–1.91, P=0.033; -/G vs -/-: OR =1.22, 95% CI =1.07–1.40, P=0.002. Additionally, G allele was significantly associated with increased cancer risk compared with (- allele (OR =1.21, 95% CI =1.04–1.40, P=0.016. However, no significant association was observed of OPN rs11730582 polymorphism and cancer risk (CC vs TT: OR =0.98, 95% CI =0.49–1.97, P=0.964; CT vs TT: OR =0.88, 95% CI =0.54–1.43, P=0.610.Conclusion: Carriers of GG or -/G genotype of OPN promoter rs17524488 (-156-/G polymorphism might be associated with increased risk of cancer compared with wild-type -/- carriers, respectively. However, no significant association was observed between OPN promoter rs11730582 (-443C/T polymorphism and risk of cancer. Keywords: OPN

  1. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    Energy Technology Data Exchange (ETDEWEB)

    Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which

  2. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    International Nuclear Information System (INIS)

    Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi

    2012-01-01

    Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the

  3. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  4. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  5. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.