Directory of Open Access Journals (Sweden)
Barbaro Michela
2013-01-01
Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Homozygous variegate porphyria presenting with developmental and language delay in childhood.
Pinder, V A E; Holden, S T; Deshpande, C; Siddiqui, A; Mellerio, J E; Wraige, E; Powell, A M
2013-10-01
Variegate porphyria is an autosomal dominant disorder that usually presents with photosensitivity and acute neurological crises in adulthood. It is caused by heterozygous mutations in the protoporphyrinogen oxidase gene (PPOX). A rarer variant, homozygous variegate porphyria (HVP), presents in childhood with recurrent skin blisters and scarring. More variable features of HVP are short stature, brachydactyly, nystagmus, epilepsy, developmental delay and mental retardation. We describe a child who presented with nystagmus, developmental delay and ataxia, combined with a photosensitive eruption. Analysis of porphyrins in plasma, urine and stool supported a clinical diagnosis of HVP. DNA from the patient showed that he is compound heterozygous for two novel missense mutations in the PPOX coding region: c.169G>C (p.Gly57Arg) and c.1259C>G (Pro420Arg). Interestingly, cranial magnetic resonance imaging showed an absence of myelin, a feature not previously reported in HVP, which expands the differential diagnosis of childhood hypomyelinating leucoencephalopathies. © 2013 British Association of Dermatologists.
Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes
International Nuclear Information System (INIS)
Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver
2005-01-01
Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin
Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans
Directory of Open Access Journals (Sweden)
Coppée Jean-Yves
2010-02-01
Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.
Molecular evolution of the polyamine oxidase gene family in Metazoa
Directory of Open Access Journals (Sweden)
Polticelli Fabio
2012-06-01
Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported
Gene cloning and characterization of NADH oxidase from ...
African Journals Online (AJOL)
The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...
Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...
African Journals Online (AJOL)
The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...
Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha
Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.
1989-01-01
We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Energy Technology Data Exchange (ETDEWEB)
Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)
1997-03-01
An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.
Directory of Open Access Journals (Sweden)
O.I. Grabelnych
2017-02-01
Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.
The terminal oxidases of Paracoccus denitrificans
de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.
Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...
Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav
International Nuclear Information System (INIS)
Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.
2017-01-01
ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis
Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.
2003-01-01
Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379
Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O
1998-01-01
In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.
2012-01-01
PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G
1999-10-01
To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.
Czech Academy of Sciences Publication Activity Database
Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef
2012-01-01
Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012
Directory of Open Access Journals (Sweden)
Jagna Chmielowska-Bąk
2017-06-01
Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung
1999-01-01
To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828
Isolated sulfite oxidase deficiency.
Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R
1996-12-01
Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Directory of Open Access Journals (Sweden)
Hamed Esmaeil Lashgarian
2016-10-01
Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.
Energy Technology Data Exchange (ETDEWEB)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.
A role for NADPH oxidase in antigen presentation
Directory of Open Access Journals (Sweden)
Gail J Gardiner
2013-09-01
Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.
Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing
2015-02-01
Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-05-01
Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo
2003-04-01
We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.
Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L
2017-03-01
It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.
Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo
2009-01-01
The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Gene cloning and characterization of NADH oxidase from ...
African Journals Online (AJOL)
use
2011-12-07
Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Genetics Home Reference: isolated sulfite oxidase deficiency
... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...
Directory of Open Access Journals (Sweden)
Yan Zhao
Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Pöggeler, Stefanie
2011-04-01
Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-01-01
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...
Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre
2000-01-01
The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359
Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O
1991-01-01
Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito
2009-01-01
Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Directory of Open Access Journals (Sweden)
Dinesh Kumar
2015-10-01
Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor
Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.
2007-01-01
A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T
2005-04-15
In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).
Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David
2015-10-01
A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun
2017-11-01
Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.
Directory of Open Access Journals (Sweden)
Xiuchun Ge
Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.
Directory of Open Access Journals (Sweden)
Efthimios A. Andronis
2014-04-01
Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.
Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis
Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie
2001-01-01
The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that
Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese
Directory of Open Access Journals (Sweden)
Li Sheng-Bin
2011-10-01
Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.
Directory of Open Access Journals (Sweden)
Yuange Wang
2014-08-01
Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.
Directory of Open Access Journals (Sweden)
Buades-Rotger M
2014-07-01
Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A
Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.
We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene
Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1
Frisse, Andrea; Pimenta, Maria João; Lange, Theo
2003-01-01
Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Effect of a heme oxygenase-1 inducer on NADPH oxidase ...
African Journals Online (AJOL)
Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...
Directory of Open Access Journals (Sweden)
Rogayah Sekeli
2014-06-01
Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*
Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun
2010-01-01
Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes
Directory of Open Access Journals (Sweden)
Deepak Verma
2017-10-01
Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.
Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.
Haruta, M; Murata, M; Kadokura, H; Homma, S
1999-03-01
An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.
DEFF Research Database (Denmark)
Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid
2009-01-01
-amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...
Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong
2016-11-05
As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.
2014-01-01
Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.
Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine
2017-08-01
Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.
Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression
Czech Academy of Sciences Publication Activity Database
Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.
2004-01-01
Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto
2015-09-01
Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with
Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila
Directory of Open Access Journals (Sweden)
Alessandro R. Ferrari
2018-01-01
Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.
Glucose oxidase variants with improved properities
Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje
2014-01-01
Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase
Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata
2017-01-01
Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...
Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi
2012-01-01
Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.
Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori
2017-11-01
Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Norrie disease gene is distinct from the monoamine oxidase genes
Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.
1989-01-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Verónica Loera-Castañeda
2014-01-01
Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.
Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai
2014-01-01
A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E
1992-01-01
Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
A broad distribution of the alternative oxidase in microsporidian parasites.
Directory of Open Access Journals (Sweden)
Bryony A P Williams
2010-02-01
Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.
Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip
2017-01-01
The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.
Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain
2009-08-01
The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.
Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J
2014-01-01
Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.
Pils, D; Schmetterer, G
2001-09-25
Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.
Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E
2016-10-01
Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo
2006-11-01
Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.
Stasia, Marie-José
2007-05-01
Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.
Norrie disease gene is distinct from the monoamine oxidase genes.
Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A
1989-09-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.
Oxidase-based biocatalytic processes
DEFF Research Database (Denmark)
Ramesh, Hemalata; Woodley, John; Krühne, Ulrich
interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...
Directory of Open Access Journals (Sweden)
Suriana
2012-08-01
Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.
Directory of Open Access Journals (Sweden)
Hoi-Sen Yong
Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.
Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.
2012-01-01
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227
Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J
2012-12-14
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.
Directory of Open Access Journals (Sweden)
Laura A Nucci
Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in
International Nuclear Information System (INIS)
Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan
2017-01-01
Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental
Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro
2012-03-01
The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Exploring flavin-containing carbohydrate oxidases
Ferrari, Alessandro Renato
2017-01-01
Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein
International Nuclear Information System (INIS)
Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong
2008-01-01
Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-03-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.
Role of pH in oxidase variability of Aeromonas hydrophila.
Hunt, L K; Overman, T L; Otero, R B
1981-01-01
Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...
Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.
2002-01-01
Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX
Directory of Open Access Journals (Sweden)
Sluse F.E.
1998-01-01
Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.
Directory of Open Access Journals (Sweden)
Veerachat Muangsombut
2017-08-01
Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Makkonen J.
2015-01-01
Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.
Energy Technology Data Exchange (ETDEWEB)
Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: shakim@lgls.com [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)
2012-08-15
Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Energy Technology Data Exchange (ETDEWEB)
Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))
1989-09-01
The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.
International Nuclear Information System (INIS)
Johnson, J.L.; Rajagopalan, K.V.; London, R.E.
1989-01-01
The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Polyphenol Oxidase Enzyme and Inactivation Methods
Directory of Open Access Journals (Sweden)
Leman Yılmaz
2018-03-01
Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.
Hinkkanen, A; Maly, F E; Decker, K
1983-04-01
The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E
2013-09-10
Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.
Cytochrome oxidase assembly does not require catalytically active cytochrome C.
Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander
2003-03-14
Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.
Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H
2008-10-05
Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.
DEFF Research Database (Denmark)
Andreou, Dimitrios; Saetre, Peter; Werge, Thomas
2012-01-01
The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...
Confirmation of a blocked amino terminus of sulfhydryl oxidase
International Nuclear Information System (INIS)
Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.
1990-01-01
The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked
Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak
Directory of Open Access Journals (Sweden)
Marić Slađana
2005-01-01
Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.
Immobilization of oxidases and their analytical applications
International Nuclear Information System (INIS)
Yasinzai, M.
2007-01-01
Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)
NADPH Oxidases: Progress and Opportunities
San Martin, Alejandra; Griendling, Kathy K.
2014-01-01
From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...
Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M
2009-01-01
Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan
2012-12-01
Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C
2007-02-01
Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-05-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.
Modulation of NADPH oxidase activity by known uraemic retention solutes
DEFF Research Database (Denmark)
Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera
2014-01-01
chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...
Gravity Responsive NADH Oxidase of the Plasma Membrane
Morre, D. James (Inventor)
2002-01-01
A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.
Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin
2017-01-01
Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407
Directory of Open Access Journals (Sweden)
Nikola Kovářová
2016-06-01
Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.
International Nuclear Information System (INIS)
Long, C.M.; Rohrmann, G.F.; Merrill, G.F.
2009-01-01
Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.
Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292
Calcium transport in vesicles energized by cytochrome oxidase
Energy Technology Data Exchange (ETDEWEB)
Rosier, Randy N. [Univ. of Rochester, NY (United States)
1979-01-01
Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K+ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K+ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.
Key role of alternative oxidase in lovastatin solid-state fermentation.
Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier
2017-10-01
Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.
Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei
2018-04-01
2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.
Modulation of NADPH oxidase activity by known uraemic retention solutes.
Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim
2014-08-01
Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.
Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E
2017-02-09
In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.
Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M
2014-07-15
Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.
Lysyl oxidase in colorectal cancer
DEFF Research Database (Denmark)
Cox, Thomas R; Erler, Janine T
2013-01-01
Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....
El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K
2012-01-01
Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.
Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.
Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof
2010-05-01
Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.
Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo
2013-01-01
Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901
Directory of Open Access Journals (Sweden)
Tao Zhan
Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.
Directory of Open Access Journals (Sweden)
Saied Reza Naddaf
2012-12-01
Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-joining method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...
Production of rabbit antibodies against purified Glucose oxidase
Directory of Open Access Journals (Sweden)
Muhammad Anjum Zia
2012-02-01
Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.
Czech Academy of Sciences Publication Activity Database
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra
2013-01-01
Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013
Chemoenzymatic combination of glucose oxidase with titanium silicalite -1
DEFF Research Database (Denmark)
Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.
2010-01-01
Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....
Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions
Directory of Open Access Journals (Sweden)
Sandip A. Ghuge
2015-07-01
Full Text Available Polyamines (PAs are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs, including copper amine oxidases (CuAOs and flavin adenine dinucleotide (FAD-dependent polyamine oxidases (PAOs. The biologically-active hydrogen peroxide (H2O2 is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H2O2 biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H2O2 derived from PA oxidation in xylem tissue maturation under stress-simulated conditions.
Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje
2014-01-01
Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369
Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na
2018-03-16
Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.
Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong
2010-08-01
To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and
Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.
Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang
2013-02-01
Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
user
2011-01-31
Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.
Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.
Gudkova, O O; Latyshko, N V; Shandrenko, S G
2016-01-01
In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.
Directory of Open Access Journals (Sweden)
Patti Hayes
2015-09-01
Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase
Laboratory-evolved vanillyl-alcohol oxidase produces natural vanillin
Heuvel, van den R.H.H.; Berg, van den W.A.M.; Rovida, S.; Berkel, van W.J.H.
2004-01-01
The flavoenzyme vanillyl-alcohol oxidase was subjected to random mutagenesis to generate mutants with enhanced reactivity to creosol (2-methoxy-4-methylphenol). The vanillyl-alcohol oxidase-mediated conversion of creosol proceeds via a two-step process in which the initially formed vanillyl alcohol
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-03-17
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.
Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo
2017-06-05
Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.
International Nuclear Information System (INIS)
Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette
2010-01-01
Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.
Directory of Open Access Journals (Sweden)
Man K. Xu
2017-10-01
Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.
Putting together a plasma membrane NADH oxidase: a tale of three laboratories.
Löw, Hans; Crane, Frederick L; Morré, D James
2012-11-01
The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.
Yang, Deng-Fu; Chen, Jia-Haur; Chiang, Chun-Pin; Huang, Zheng; Lee, Jeng-Woei; Liu, Chung-Ji; Chang, Junn-Liang; Hsu, Yih-Chih
2014-09-01
Topical 5-aminolevulinic acid-mediated photodynamic therapy (topical ALA-PDT) is effective for treating oral precancerous lesions. The aim of this in vivo and in vitro study was to examine whether the efficacy of topical ALA-PDT could be further improved by calcipotriol (CAL). Precancerous lesions in the buccal pouch of hamsters were induced by dimethylbenz(a)anthracene (DMBA). Lesions were treated with multiple topical ALA-PDT with or without CAL pretreatment. ALA-induced protoporphyrine IX (PpIX) was monitored by in situ fluorescence measurement. The effect of CAL on heme-related enzymes (CPOX, PPOX, and FECH) were examined in an in vitro model using human squamous cell carcinoma (SCC) cells (SCC4, SAS) using Western blots. Fluorescence spectroscopy revealed that PpIX reached its peak level in precancerous epithelial cells of buccal pouch at 2.5 or 3.5h without or with CAL pretreatment, respectively. Both treatment regimens showed similar response rates, but the complete response was achieved after 5 times of ALA-PDT and 3 times of CAL-ALA-PDT (plevel. Topical CAL can improve the efficacy of ALA-PDT in treating precancerous lesions, likely through the increase in CPOX level and in PpIX production. Copyright © 2014 Elsevier B.V. All rights reserved.
Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li
2016-07-09
In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.
Monoamine Oxidase Inhibitors (MAOIs)
... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...
Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du
2016-12-01
Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.
Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.
Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M
2003-12-01
Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.
Directory of Open Access Journals (Sweden)
Jingxin Li
Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.
Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R
2013-07-01
Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.
Optimization of glucose oxidase production by Aspergillus niger
African Journals Online (AJOL)
user
2011-02-28
Feb 28, 2011 ... manganese, cobalt, thioglycolic acid, and gluconic acid according to (Liu et al., .... In this experiment duplicate media of glucose 10% were adjusted at different ... Glucose oxidase as a pharmaceutical anti oxidant Drug. Devt. ... Plush KS, Hellmuth K, Rinas U (1996). kinetics of glucose oxidase excretion by ...
Isolation of a cotton NADP(H oxidase homologue induced by drought stress
Directory of Open Access Journals (Sweden)
NEPOMUCENO ALEXANDRE LIMA
2000-01-01
Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.
Cytochrome cbb3 of Thioalkalivibrio is a Na+-pumping cytochrome oxidase
Muntyan, M.S.; Cherepanov, D.A.; Malinen, A.M.; Bloch, D.A.; Sorokin, D.Y.; Severina, I.I.; Ivashina, T.V.; Lahti, R.; Muyzer, G.; Skulachev, V.P.
2015-01-01
Cytochrome c oxidases (Coxs) are the basic energy transducers in the respiratory chain of the majority of aerobic organisms. Coxs studied to date are redox-driven proton-pumping enzymes belonging to one of three subfamilies: A-, B-, and C-type oxidases. The C-type oxidases (cbb3 cytochromes), which
Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T
2013-11-01
Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.
Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P
2015-03-28
Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.
Czech Academy of Sciences Publication Activity Database
Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.
2006-01-01
Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006
Serum diamine oxidase activity in patients with histamine intolerance.
Manzotti, G; Breda, D; Di Gioacchino, M; Burastero, S E
2016-03-01
Intolerance to various foods, excluding bona fide coeliac disease and lactose intolerance, represents a growing cause of patient visits to allergy clinics.Histamine intolerance is a long-known, multifaceted clinical condition triggered by histamine-rich foods and alcohol and/or by drugs that liberate histamine or block diamine oxidase (DAO), the main enzyme involved in the metabolism of ingested histamine. Histamine limitation diets impose complex, non-standardized restrictions that may severely impact the quality of life of patients. We retrospectively evaluated 14 patients who visited allergy outpatient facilities in northern Italy with a negative diagnosis for IgE-mediated food hypersensitivity, coeliac disease, conditions related to gastric hypersecretion, and systemic nickel hypersensitivity, and who previously underwent a histamine limitation diet with benefits for their main symptoms. Serum diamine oxidase levels and the clinical response to diamine oxidase supplementation were investigated. We found that 10 out of 14 patients had serum DAO activityintolerance. Moreover, 13 out of 14 patients subjectively reported a benefit in at least one of the disturbances related to food intolerances following diamine oxidase supplementation. The mean value (±SD) of diamine oxidase activity in the cohort of patients with histamine intolerance symptoms was 7.04±6.90 U/mL compared to 39.50±18.16 U/mL in 34 healthy controls (P=0.0031). In patients with symptoms triggered by histamine-rich food, measuring the serum diamine oxidase activity can help identify subjects who can benefit from a histamine limitation diet and/or diamine oxidase supplementation.Properly designed, controlled studies investigating histamine intolerance that include histamine provocation are indispensable for providing insights into the area of food intolerances, which are currently primarily managed with non-scientific approaches in Italy. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
Young-Moo Choo
Full Text Available Antennae-specific odorant-degrading enzymes (ODEs are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes--the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs. Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW, Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13-16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13-16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons.
Structure and activity of Aspergillus nidulans copper amine oxidase
DEFF Research Database (Denmark)
McGrath, Aaron P; Mithieux, Suzanne M; Collyer, Charles A
2011-01-01
Aspergillus nidulans amine oxidase (ANAO) has the unusual ability among the family of copper and trihydroxyphenylalanine quinone-containing amine oxidases of being able to oxidize the amine side chains of lysine residues in large peptides and proteins. We show here that in common with the related...... enzyme from the yeast Pichia pastoris, ANAO can promote the cross-linking of tropoelastin and oxidize the lysine residues in α-casein proteins and tropoelastin. The crystal structure of ANAO, the first for a fungal enzyme in this family, has been determined to a resolution of 2.4 Å. The enzyme is a dimer...... with the archetypal fold of a copper-containing amine oxidase. The active site is the most open of any of those of the structurally characterized enzymes in the family and provides a ready explanation for its lysine oxidase-like activity....
Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James
2017-11-30
Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.
Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.
Legge, M; Duff, G B
1981-01-01
Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less ga...
Metavanadate causes cellular accumulation of copper and decreased lysyl oxidase activity
International Nuclear Information System (INIS)
Cui, Changtai T.; Uriu-Adams, Janet Y.; Tchaparian, Eskouhie H.; Keen, Carl L.; Rucker, Robert B.
2004-01-01
Selected indices of copper metabolism in weanling rats and fibroblast cultures were progressively altered in response to increased levels of sodium metavanadate. In diets, vanadium was added in amounts ranging from 0 to 80 μg V/g of diet, that is, 0-1.6 μmol V/g of diet. In fibroblast cultures, vanadium ranged from 0 to 400 nmol V/ml. The inhibition of P-ATPase-7A activity by metavanadate, important to copper egress from cells, was a primary focus. In skin, and tendon, the copper concentration was increased in response to increased dietary levels of metavanadate, whereas lysyl oxidase activity, a secreted cuproprotein, was reduced. The reduction in lysyl oxidase activity was also accompanied by reduced redox cycling potential of isolated fractions of lysyl oxidase, presumably due to reduced lysyltyrosyl quinone (LTQ) formation at the active site of lysyl oxidase. In contrast, liver copper concentrations and plasma ceruloplasmin activity were not affected by metavanadate exposure. However, semicarbazide-sensitive benzylamine oxidase (SCBO) activity, which was taken as an indirect measure of vascular adhesive protein-1 (VAP-1), was increased. In cultured fibroblasts, cellular copper was also increased and lysyl oxidase decreased in response to metavanadate. Moreover, the steady-state levels of atp7a and lysyl oxidase mRNAs were not affected by addition of metavanadate to culture medium up to 200 nmol/ml. Taken together, these data suggest that pathways involving copper egress and lysyl oxidase activation are particularly sensitive to metavanadate exposure through processes that are predominately posttranslational
Oxidases as Breast Cancer Oncogens
National Research Council Canada - National Science Library
Yeldandi, Anjana
2000-01-01
...) in a non-tumorigenic human mammary epithelial cell line to ascertain whether oxidase overexpressing cells undergo transformation when exposed to substrate xanthine for XOX and uric acid for UOX...
Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.
2011-01-01
The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791
Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.
Legge, M; Duff, G B
1981-02-01
Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.
Kim, Ji Min; Lee, Eun Kyeong; Kim, Dae Hyun; Yu, Byung Pal
2010-01-01
Advanced glycation endproducts (AGE) are oxidative products formed from the reaction between carbohydrates and a free amino group of proteins that are provoked by reactive species (RS). It is also known that AGE enhance the generation of RS and that the binding of AGE to a specific AGE receptor (RAGE) induces the activation of the redox-sensitive, pro-inflammatory transcription factor, nuclear factor-kappa B (NF-ĸB). In this current study, we investigated the anti-oxidative effects of short-term kaempferol supplementation on the age-related formation of AGE and the binding activity of RAGE in aged rat kidney. We further investigated the suppressive action of kaempferol against AGE's ability to stimulate activation of pro-inflammatory NF-ĸB and its molecular mechanisms. For this study, we utilized young (6 months old), old (24 months old), and kaempferol-fed (2 and 4 mg/kg/day for 10 days) old rats. In addition, for the molecular work, the rat endothelial cell line, YPEN-1 was used. The results show that AGE and RAGE were increased during aging and that these increases were blunted by kaempferol. In addition, dietary kaempferol reduced age-related increases in NF-κB activity and NF-ĸB-dependant pro-inflammatory gene activity. The most significant new finding from this study is that kaempferol supplementation prevented age-related NF-κB activation by suppressing AGE-induced nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Taken together, our results demonstrated that dietary kaempferol exerts its anti-oxidative and anti-inflammatory actions by modulating the age-related NF-κB signaling cascade and its pro-inflammatory genes by suppressing AGE-induced NADPH oxidase activation. Based on these data, dietary kaempferol is proposed as a possible anti-AGE agent that may have the potential for use in anti-inflammation therapies. PMID:20431987
Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin
2010-02-01
Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.
Guerin, Andrea; Aziz, Aly S; Mutch, Carly; Lewis, Jillian; Go, Cristina Y; Mercimek-Mahmutoglu, Saadet
2015-08-01
Pyridox(am)ine-5-phosphate oxidase deficiency is an autosomal recessive disorder of pyridoxine metabolism. Intractable neonatal epileptic encephalopathy is the classical presentation. Pyridoxal-5-phosphate or pyridoxine supplementation improves symptoms. We report a patient with myoclonic and tonic seizures at the age of 1 hour. Pyridoxal-5-phosphate was started on the first day of life and seizures stopped at the age of 3 days, but encephalopathy persisted for 4 weeks. She had normal neurodevelopmental outcome at the age of 12 months on pyridoxal-5-phosphate monotherapy. She had novel homozygous pathogenic frameshift mutation (c.448_451del;p.Pro150Argfs*27) in the PNPO gene. Long-lasting encephalopathy despite well-controlled clinical seizures does neither confirm nor exclude pyridox(am)ine-5-phosphate oxidase deficiency. Normal neurodevelopmental outcome of our patient emphasizes the importance of pyridoxal-5-phosphate treatment. Pyridox(am)ine-5-phosphate oxidase deficiency should be included in the differential diagnosis of Ohtahara syndrome and neonatal myoclonic encephalopathy as a treatable underlying cause. In addition, we reviewed the literature for pyridox(am)ine-5-phosphate oxidase deficiency and summarized herein all confirmed cases. © The Author(s) 2014.
21 CFR 866.2420 - Oxidase screening test for gonorrhea.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420... screening test for gonorrhea. (a) Identification. An oxidase screening test for gonorrhea is an in vitro... of gonorrhea. (b) Classification. Class III (premarket approval) (transitional device). (c) Date PMA...
Institute of Scientific and Technical Information of China (English)
Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou
2006-01-01
BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients
Catalytic aspects of a copper(II) complex: biological oxidase to ...
Indian Academy of Sciences (India)
BISWAJIT CHOWDHURY
2017-10-03
Oct 3, 2017 ... made with a Jasco model V-730 UV-Vis spectrophotometer. ..... Ligand-induced coordination changes ... Fet3 protein from yeast, a multinuclear copper oxidase ... of mutants of the multicopper oxidase Fet3p Biochem-.
Platelet monoamine oxidase: specific activity and turnover number in headache
International Nuclear Information System (INIS)
Summers, K.M.; Brown, G.K.; Craig, I.W.; Peatfield, R.; Rose, F.C.
1982-01-01
Monoamine oxidase turnover numbers (molecules of substrate converted to product per minute per active site) have been calculated for the human platelet enzyme using [ 3 H]pargyline. Headache patients with high and low monoamine oxidase specific activities relative to controls were found to have turnover numbers very close to those for controls. This finding suggests that their specific activities vary because of differences in the concentration of active monoamine oxidase molecules, rather than differences in the ability of those enzyme molecules to catalyse the deamination reaction. (Auth.)
Seo, M.; Peeters, A.J.M.; Koiwai, H.; Oritani, T.; Marion-Poll, A.; Zeevaart, J.A.D.; Koornneef, M.; Kamiya, Y.; Koshiba, T.
2000-01-01
Abscisic acid (ABA) is a plant hormone involved in seed development and germination and in responses to various environmental stresses. The last step of ABA biosynthesis involves oxidation of abscisic aldehyde, and aldehyde oxidase (EC 1.2.3.1) is thought to catalyze this reaction. An aldehyde
Czech Academy of Sciences Publication Activity Database
Conrad, K.; Motyka, Václav; Schlüter, T.
2007-01-01
Roč. 130, č. 4 (2007), s. 572-579 ISSN 0031-9317 R&D Projects: GA ČR GA206/03/0313 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : OXIDASE ACTIVITY * GENE-EXPRESSION * ZEA - MAYS Subject RIV: EF - Botanics Impact factor: 2.192, year: 2007
Immobilization of xanthine oxidase on a polyaniline silicone support.
Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B
1996-03-01
A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.
Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying
2017-02-01
Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Xanthine oxidase in human skeletal muscle following eccentric exercise
DEFF Research Database (Denmark)
Hellsten, Ylva; Frandsen, Ulrik; Orthenblad, N.
1997-01-01
the increase in xanthine oxidase in the muscle there were no detectable changes in the levels of muscle malondialdehyde or in plasma antioxidant capacity up to 4 days post-exercise. 5. It is concluded that eccentric exercise leads to an increased level of xanthine oxidase in human muscle and that the increase...
Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity.
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2012-11-02
Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.
Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2012-01-01
Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056
Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger
Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.
2012-01-01
BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The
Directory of Open Access Journals (Sweden)
Xiaohui eLi
2015-06-01
Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.
Cytochemical Localization of Glucose Oxidase in Peroxisomes of Aspergillus niger
Veenhuis, Marten; Dijken, Johannes Pieter van
1980-01-01
The subcellular localization of glucose oxidase (E.C. 1.1.3.4) in mycelia of Aspergillus niger has been investigated using cytochemical staining techniques. Mycelia from fermenter cultures, which produced gluconic acid from glucose, contained elevated levels of glucose oxidase and catalase. Both
Directory of Open Access Journals (Sweden)
G.H.M. eSagor
2016-02-01
Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.
International Nuclear Information System (INIS)
Gamache, D.A.; Kornberg, L.J.; Bartolf, M.; Franson, R.C.
1986-01-01
Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1- 14 C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A 2 (PLA 2 ) activity (64.3-545.6 nmols/min/mg). The PLA 2 was maximally active in the neutral-alkaline pH range, was Ca 2+ -dependent, and was unaffected by the addition of xanthine. PLA 2 activity was totally inhibited by 1mM EDTA whereas radical production by optimal concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA 2 activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca 2+ -dependent PLA 2 measured in various tissue homogenates (≤ 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA 2 may have influenced previously published reports, and such studies should be interpreted cautiously
Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan
2013-04-01
A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity
Directory of Open Access Journals (Sweden)
Koji Sode
2012-11-01
Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.
Isolation of a candidate gene for Norrie disease by positional cloning
Berger, W.; Meindl, A.; van de Pol, T. J.; Cremers, F. P.; Ropers, H. H.; Döerner, C.; Monaco, A.; Bergen, A. A.; Lebo, R.; Warburg, M.
1992-01-01
The gene for Norrie disease, an X-linked disorder characterized by progressive atrophy of the eyes, mental disturbances and deafness, has been mapped to chromosome Xp11.4 close to DXS7 and the monoamine oxidase (MAO) genes. By subcloning a YAC with a 640 kilobases (kb) insert which spans the
Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao
2018-01-01
This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.
Production of rabbit antibodies against purified Glucose oxidase
Zia,Muhammad Anjum; Ain,Qurat-ul; Iftikhar,Tehreema; Abbas,Rao Zahid; Rahman,Khalil-ur
2012-01-01
Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose) resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex ...
The use of galactose oxidase in lipid labeling
International Nuclear Information System (INIS)
Radin, N.S.; Evangelatos, G.P.
1981-01-01
Galactose oxidase can be used to oxidize the terminal carbon atom of lipids containing galactose or N-acetylgalactosamine, and the resultant aldehyde group can be reduced back to the original carbinol with radioactive borohydride. The efficiency of the first reaction has been investigated systematically by using [6- 3 H]galactosyl ceramide as substrate and measuring the amount of radioactive water formed. This enabled us to establish that the addition of catalase and peroxidase greatly speeded the oxidation, that phosphate and PIPES buffers were the best among those tested, that the reaction continued for 24 hr without a second addition of galactose oxidase, and that the optimum concentration of organic solvent (tetrahydrofuran) was 50%. The suggestion if made that a similar set of variables be studied for each lipid or nonlipid by the same basic technique: labeling by the oxidase/borohydride method and use of the resultant compound as substrate
Houde, Mario; Diallo, Amadou Oury
2008-08-27
Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.
Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini
2018-01-01
Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.
Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H
2006-06-01
The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.
Molecular Basis for Converting (2S-Methylsuccinyl-CoA Dehydrogenase into an Oxidase
Directory of Open Access Journals (Sweden)
Simon Burgener
2017-12-01
Full Text Available Although flavoenzymes have been studied in detail, the molecular basis of their dioxygen reactivity is only partially understood. The members of the flavin adenosine dinucleotide (FAD-dependent acyl-CoA dehydrogenase and acyl-CoA oxidase families catalyze similar reactions and share common structural features. However, both enzyme families feature opposing reaction specificities in respect to dioxygen. Dehydrogenases react with electron transfer flavoproteins as terminal electron acceptors and do not show a considerable reactivity with dioxygen, whereas dioxygen serves as a bona fide substrate for oxidases. We recently engineered (2S-methylsuccinyl-CoA dehydrogenase towards oxidase activity by rational mutagenesis. Here we characterized the (2S-methylsuccinyl-CoA dehydrogenase wild-type, as well as the engineered (2S-methylsuccinyl-CoA oxidase, in detail. Using stopped-flow UV-spectroscopy and liquid chromatography-mass spectrometry (LC-MS based assays, we explain the molecular base for dioxygen reactivity in the engineered oxidase and show that the increased oxidase function of the engineered enzyme comes at a decreased dehydrogenase activity. Our findings add to the common notion that an increased activity for a specific substrate is achieved at the expense of reaction promiscuity and provide guidelines for rational engineering efforts of acyl-CoA dehydrogenases and oxidases.
The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy.
Elmer, Lawrence W; Bertoni, John M
2008-11-01
The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.
Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity.
Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A
2001-07-01
Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).
Lysyl oxidase in cancer research
DEFF Research Database (Denmark)
Perryman, Lara; Erler, Janine Terra
2014-01-01
Metastasis is the main reason for cancer-associated deaths and therapies are desperately needed to target the progression of cancer. Lysyl oxidase (LOX) plays a pivotal role in cancer progression, including metastasis, and is therefore is an attractive therapeutic target. In this review we...
Angiotensin II inhibits the Na+-K+ pump via PKC-dependent activation of NADPH oxidase.
White, Caroline N; Figtree, Gemma A; Liu, Chia-Chi; Garcia, Alvaro; Hamilton, Elisha J; Chia, Karin K M; Rasmussen, Helge H
2009-04-01
The sarcolemmal Na(+)-K(+) pump, pivotal in cardiac myocyte function, is inhibited by angiotensin II (ANG II). Since ANG II activates NADPH oxidase, we tested the hypothesis that NADPH oxidase mediates the pump inhibition. Exposure to 100 nmol/l ANG II increased superoxide-sensitive fluorescence of isolated rabbit ventricular myocytes. The increase was abolished by pegylated superoxide dismutase (SOD), by the NADPH oxidase inhibitor apocynin, and by myristolated inhibitory peptide to epsilon-protein kinase C (epsilonPKC), previously implicated in ANG II-induced Na(+)-K(+) pump inhibition. A role for epsilonPKC was also supported by an ANG II-induced increase in coimmunoprecipitation of epsilonPKC with the receptor for the activated kinase and with the cytosolic p47(phox) subunit of NADPH oxidase. ANG II decreased electrogenic Na(+)-K(+) pump current in voltage-clamped myocytes. The decrease was abolished by SOD, by the gp91ds inhibitory peptide that blocks assembly and activation of NADPH oxidase, and by epsilonPKC inhibitory peptide. Since colocalization should facilitate NADPH oxidase-dependent regulation of the Na(+)-K(+) pump, we examined whether there is physical association between the pump subunits and NADPH oxidase. The alpha(1)-subunit coimmunoprecipitated with caveolin 3 and with membrane-associated p22(phox) and cytosolic p47(phox) NADPH oxidase subunits at baseline. ANG II had no effect on alpha(1)/caveolin 3 or alpha(1)/p22(phox) interaction, but it increased alpha(1)/p47(phox) coimmunoprecipitation. We conclude that ANG II inhibits the Na(+)-K(+) pump via PKC-dependent NADPH oxidase activation.
Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F
2011-02-01
Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.
Mural granulosa cell gene expression associated with oocyte developmental competence
Directory of Open Access Journals (Sweden)
Jiang Jin-Yi
2010-03-01
Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and
Jakubowska, Dagmara; Janicka, Małgorzata
2017-11-01
The present research aim was to define the role of brassinosteroids (BRs) in plant adaptation to cadmium stress. We observed a stimulating effect of exogenous BR on the activity of two plasma membrane enzymes which play a key role in plants adaptation to cadmium stress, H + -ATPase (EC 3.6.3.14) and NADPH oxidase (EC 1.6.3.1). Using anti-phosphothreonine antibody we showed that modification of PM H + -ATPase activity under BR action could result from phosphorylation of the enzyme protein. Also the relative expression of genes encoding both PM H + -ATPase and NADPH oxidase was affected by BR. To confirm the role of BR in the cadmium stimulating effect on activity of both studied plasma membrane enzymes, an assay in the presence of a BR biosynthesis inhibitor (propiconazole) was performed. Moreover, as a tool in our work we used commercially available plant mutants unable to BR biosynthesis or with dysfunctional BR signaling pathway, to further confirm participation of BR in plant adaptation to heavy metal stress. Presented results demonstrate some elements of the brassinosteroid-induced pathway activated under cadmium stress, wherein H + -ATPase and NADPH oxidase are key factors. Copyright © 2017 Elsevier B.V. All rights reserved.
Fluorescent Probes for Analysis and Imaging of Monoamine Oxidase Activity
Energy Technology Data Exchange (ETDEWEB)
Kim, Dokyoung; Jun, Yong Woong; Ahn, Kyo Han [POSTECH, Pohang (Korea, Republic of)
2014-05-15
Monoamine oxidases catalyze the oxidative deamination of dietary amines and amine neurotransmitters, and assist in maintaining the homeostasis of the amine neurotransmitters in the brain. Dysfunctions of these enzymes can cause neurological and behavioral disorders including Parkinson's and Alzheimer's diseases. To understand their physiological roles, efficient assay methods for monoamine oxidases are essential. Reviewed in this Perspective are the recent progress in the development of fluorescent probes for monoamine oxidases and their applications to enzyme assays in cells and tissues. It is evident that still there is strong need for a fluorescent probe with desirable substrate selectivity and photophysical properties to challenge the much unsolved issues associated with the enzymes and the diseases.
A new fatal case of pyridox(am)ine 5'-phosphate oxidase (PNPO) deficiency.
Ruiz, Angeles; García-Villoria, Judit; Ormazabal, Aida; Zschocke, Johannes; Fiol, Miquel; Navarro-Sastre, Aleix; Artuch, Rafael; Vilaseca, Maria Antonia; Ribes, Antonia
2008-02-01
We present a patient with severe pyridox(am)ine 5'-phosphate oxidase deficiency and homozygosity for a novel nonsense-mutation, p.A174X, in the PNPO gene who died with pyridoxal phosphate (PLP) treatment despite initial clinical recovery. He presented neonatally, with the classical clinical symptoms of the disease. Increase of urinary vanillactate was the first biochemical factor of alert. Amino acid and neurotransmitter analysis in CSF indicated reduced activity of several PLP-dependent enzymes. The diagnosis was confirmed by mutational studies. From this and the other reported patients it may be concluded that the administration of PLP should not be delayed until the complete biochemical evidence is obtained.
[Experimental rationale for the parameters of a rapid method for oxidase activity determination].
Butorina, N N
2010-01-01
Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.
Action of DCCD on the H+/O stoichiometry of mitoplast cytochrome c oxidase.
Lehninger, A L; Reynafarje, B; Costa, L
1985-01-01
The mechanistic H+/O ejection stoichiometry of the cytochrome c oxidase reaction in rat liver mitoplasts is close to 4 at level flow when the reduced oxidase is pulsed with O2. Dicyclohexylcarbodiimide (DCCD) up to 30 nmol/mg protein fails to influence the rate of electron flow through the mitoplast oxidase, but inhibits H+ ejection. The inhibition of H+ ejection appears to be biphasic; ejection of 2-3 H+ per O is completely inhibited by very low DCCD, whereas inhibition of the remaining H+ ejection requires very much higher concentrations of DCCD. This effect suggests the occurrence of two types of H+ pumps in the native cytochrome oxidase of mitoplasts.
Cox1 mutation abrogates need for Cox23 in cytochrome c oxidase biogenesis
Directory of Open Access Journals (Sweden)
Richard Dela Cruz
2016-06-01
Full Text Available Cox23 is a known conserved assembly factor for cytochrome c oxidase, although its role in cytochrome c oxidase (CcO biogenesis remains unresolved. To gain additional insights into its role, we isolated spontaneous suppressors of the respiratory growth defect in cox23∆ yeast cells. We recovered independent colonies that propagated on glycerol/lactate medium for cox23∆ cells at 37°C. We mapped these mutations to the mitochondrial genome and specifically to COX1 yielding an I101F substitution. The I101F Cox1 allele is a gain-of-function mutation enabling yeast to respire in the absence of Cox23. CcO subunit steady-state levels were restored with the I101F Cox1 suppressor mutation and oxygen consumption and CcO activity were likewise restored. Cells harboring the mitochondrial genome encoding I101F Cox1 were used to delete genes for other CcO assembly factors to test the specificity of the Cox1 mutation as a suppressor of cox23∆ cells. The Cox1 mutant allele fails to support respiratory growth in yeast lacking Cox17, Cox19, Coa1, Coa2, Cox14 or Shy1, demonstrating its specific suppressor activity for cox23∆ cells.
Vanillyl-alcohol oxidase, a tasteful biocatalyst
Heuvel, van den R.H.H.; Fraaije, M.W.; Mattevi, A.; Laane, C.; Berkel, van W.J.H.
2001-01-01
The covalent flavoenzyme vanillyl-alcohol oxidase (VAO) is a versatile biocatalyst. It converts a wide range of phenolic compounds by catalysing oxidation, deamination, demethylation, dehydrogenation and hydroxylation reactions. The production of natural vanillin, 4-hydroxybenzaldehyde, coniferyl
Directory of Open Access Journals (Sweden)
Diallo Amadou
2008-08-01
Full Text Available Abstract Background Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive that differ in their response to Al were performed. Results Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. Conclusion In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.
Unique role of NADPH oxidase 5 in oxidative stress in human renal proximal tubule cells
Directory of Open Access Journals (Sweden)
Peiying Yu
2014-01-01
Full Text Available NADPH oxidases are the major sources of reactive oxygen species in cardiovascular, neural, and kidney cells. The NADPH oxidase 5 (NOX5 gene is present in humans but not rodents. Because Nox isoforms in renal proximal tubules (RPTs are involved in the pathogenesis of hypertension, we tested the hypothesis that NOX5 is differentially expressed in RPT cells from normotensive (NT and hypertensive subjects (HT. We found that NOX5 mRNA, total NOX5 protein, and apical membrane NOX5 protein were 4.2±0.7-fold, 5.2±0.7-fold, and 2.8±0.5-fold greater in HT than NT. Basal total NADPH oxidase activity was 4.5±0.2-fold and basal NOX5 activity in NOX5 immunoprecipitates was 6.2±0.2-fold greater in HT than NT (P=<0.001, n=6–14/group. Ionomycin increased total NOX and NOX5 activities in RPT cells from HT (P<0.01, n=4, ANOVA, effects that were abrogated by pre-treatment of the RPT cells with diphenylene-iodonium or superoxide dismutase. Silencing NOX5 using NOX5-siRNA decreased NADPH oxidase activity (−45.1±3.2% vs. mock-siRNA, n=6–8 in HT. D1-like receptor stimulation decreased NADPH oxidase activity to a greater extent in NT (−32.5±1.8% than HT (−14.8±1.8. In contrast to the marked increase in expression and activity of NOX5 in HT, NOX1 mRNA and protein were minimally increased in HT, relative to NT; total NOX2 and NOX4 proteins were not different between HT and NT, while the increase in apical RPT cell membrane NOX1, NOX2, and NOX4 proteins in HT, relative to NT, was much less than those observed with NOX5. Thus, we demonstrate, for the first time, that NOX5 is expressed in human RPT cells and to greater extent than the other Nox isoforms in HT than NT. We suggest that the increased expression of NOX5, which may be responsible for the increased oxidative stress in RPT cells in human essential hypertension, is caused, in part, by a defective renal dopaminergic system.
Veenhuis, M.; Wendelaar Bonga, S.E.
1979-01-01
The distribution of catalase, amino acid oxidase, α-hydroxy acid oxidase, urate oxidase and alcohol oxidase was studied cytochemically in rat hepatocytes. The presence of catalase was demonstrated with the conventional diaminobenzidine technique. Oxidase activities were visualized with methods based
Lysyl Oxidase and the Tumor Microenvironment
Directory of Open Access Journals (Sweden)
Tong-Hong Wang
2016-12-01
Full Text Available The lysyl oxidase (LOX family of oxidases contains a group of extracellular copper-dependent enzymes that catalyze the cross-linking of collagen and elastin by oxidation, thus maintaining the rigidity and structural stability of the extracellular matrix (ECM. Aberrant expression or activation of LOX alters the cellular microenvironment, leading to many diseases, including atherosclerosis, tissue fibrosis, and cancer. Recently, a number of studies have shown that LOX is overexpressed in most cancers and that it is involved in the regulation of tumor progression and metastasis. In contrast, a few reports have also indicated the tumor-suppressing role of LOX. In this short review, we discuss recent research on the correlations between LOX and cancer. Further, the role of LOX in tumor microenvironment remodeling, tumorigenesis, and metastasis and the underlying mechanisms have also been elucidated.
Directory of Open Access Journals (Sweden)
Xinchi Shi
2016-09-01
Full Text Available Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the byproduct glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37 % higher than that for CON (30.82 ± 1.54 g/L. Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved
Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.
Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J
1997-03-25
1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.
Up-Streaming Process for Glucose Oxidase by Thermophilic Penicillium sp. in Shake Flask
Muhammad Mohsin JAVED; Aroosh SHABIR; Sana ZAHOOR; Ikram UL-HAQ
2012-01-01
The present study is concerned with the production of glucose oxidase (GOD) from thermophilic Penicillium sp. in 250 mL shake flask. Fourteen different strains of thermophilic Penicillium sp. were isolated from the soil and were screened for glucose oxidase production. IIBP-13 strain gave maximum extra-cellular glucose oxidase production as compared to other isolates. Effect of submerged fermentation in shaking and static conditions, different carbon sources and incubation period on the produ...
Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I
2007-04-01
Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.
NADPH oxidases as novel pharmacologic targets against influenza A virus infection.
Vlahos, Ross; Selemidis, Stavros
2014-12-01
Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.
Two X-linked chronic granulomatous disease patients with unusual NADPH oxidase properties
Wolach, Baruch; Broides, Arnon; Zeeli, Tal; Gavrieli, Ronit; de Boer, Martin; van Leeuwen, Karin; Levy, Jacov; Roos, Dirk
2011-01-01
Chronic granulomatous disease (CGD) is an immune deficiency syndrome caused by defects in the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, the enzyme that generates reactive oxygen species (ROS) in phagocytizing leukocytes. This study evaluates the NADPH oxidase capacity in two
Jonathan M. LaMantia; Ambika Chandra; David R. Huff
2018-01-01
Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO) has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning prime...
Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.
2015-01-01
Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614
Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence
2015-03-01
Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...
Blockade of TGF-β 1 Signalling Inhibits Cardiac NADPH Oxidase Overactivity in Hypertensive Rats
Directory of Open Access Journals (Sweden)
José Luis Miguel-Carrasco
2012-01-01
Full Text Available NADPH oxidases constitute a major source of superoxide anion (⋅O2 - in hypertension. Several studies suggest an important role of NADPH oxidases in different effects mediated by TGF-β 1. In this study we show that chronic administration of P144, a peptide synthesized from type III TGF-β 1 receptor, significantly reduced the cardiac NADPH oxidase expression and activity as well as in the nitrotyrosine levels observed in control spontaneously hypertensive rats (V-SHR to levels similar to control normotensive Wistar Kyoto rats. In addition, P144 was also able to reduce the significant increases in the expression of collagen type I protein and mRNA observed in hearts from V-SHR. In addition, positive correlations between collagen expression, NADPH oxidase activity, and nitrotyrosine levels were found in all animals. Finally, TGF-β 1-stimulated Rat-2 exhibited significant increases in NADPH oxidase activity that was inhibited in the presence of P144. It could be concluded that the blockade of TGF-β 1 with P144 inhibited cardiac NADPH oxidase in SHR, thus adding new data to elucidate the involvement of this enzyme in the profibrotic actions of TGF-β 1.
Herbivore-plant interactions: mixed-function oxidases and secondary plant substances.
Brattsten, L B; Wilkinson, C F; Eisner, T
1977-06-17
The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.
Functional heterogeneity of NADPH oxidase-mediated contractions to endothelin with vascular aging.
Meyer, Matthias R; Barton, Matthias; Prossnitz, Eric R
2014-11-24
Aging, a physiological process and main risk factor for cardiovascular and renal diseases, is associated with endothelial cell dysfunction partly resulting from NADPH oxidase-dependent oxidative stress. Because increased formation of endothelium-derived endothelin-1 (ET-1) may contribute to vascular aging, we studied the role of NADPH oxidase function in age-dependent contractions to ET-1. Renal arteries and abdominal aortas from young and old C57BL6 mice (4 and 24 months of age) were prepared for isometric force measurements. Contractions to ET-1 (0.1-100 nmol/L) were determined in the presence and absence of the NADPH oxidase-selective inhibitor gp91ds-tat (3 μmol/L). To exclude age-dependent differential effects of NO bioactivity between vascular beds, all experiments were conducted in the presence of the NO synthase inhibitor L-NAME (300 μmol/L). In young animals, ET-1-induced contractions were 6-fold stronger in the renal artery than in the aorta (prenal artery and aorta, respectively (pAging had no effect on NADPH oxidase-dependent and -independent contractions to ET-1 in the renal artery. In contrast, contractions to ET-1 were markedly reduced in the aged aorta (5-fold, page-dependent heterogeneity of NADPH oxidase-mediated vascular contractions to ET-1, demonstrating an inherent resistance to functional changes in the renal artery but not in the aorta with aging. Thus, local activity of NADPH oxidase differentially modulates responses to ET-1 with aging in distinct vascular beds. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
A positive feedback-based gene circuit to increase the production of a membrane protein
Directory of Open Access Journals (Sweden)
Gennis Robert B
2010-05-01
Full Text Available Abstract Background Membrane proteins are an important class of proteins, playing a key role in many biological processes, and are a promising target in pharmaceutical development. However, membrane proteins are often difficult to produce in large quantities for the purpose of crystallographic or biochemical analyses. Results In this paper, we demonstrate that synthetic gene circuits designed specifically to overexpress certain genes can be applied to manipulate the expression kinetics of a model membrane protein, cytochrome bd quinol oxidase in E. coli, resulting in increased expression rates. The synthetic circuit involved is an engineered, autoinducer-independent variant of the lux operon activator LuxR from V. fischeri in an autoregulatory, positive feedback configuration. Conclusions Our proof-of-concept experiments indicate a statistically significant increase in the rate of production of the bd oxidase membrane protein. Synthetic gene networks provide a feasible solution for the problem of membrane protein production.
Evaluation of the Expression of Amine Oxidase Proteins in Breast Cancer
Directory of Open Access Journals (Sweden)
Woo Young Sun
2017-12-01
Full Text Available We aimed to evaluate the expression of amine oxidase proteins in breast cancer and their clinical implications. We performed immunohistochemical staining of amine oxidase proteins (LOX, lysyl oxidase, AOC3, amine oxidase, MAOA, monoamine oxidase A, MAOB, monoamine oxidase B. Based on their hormone receptors, such as estrogen receptor (ER and progesterone receptor (PR, human epidermal growth factor receptor 2 (HER-2, and Ki-67 immunohistochemical staining, breast cancer was divided into four molecular subtypes: luminal A, luminal B, HER-2 type, and triple-negative breast cancer (TNBC. Luminal A was observed in 380 cases (49.4%, luminal B in 224 (29.1%, HER-2 type in 68 (8.8%, and TNBC in 98 (12.7%. Stromal AOC3, MAO-A, and MAO-B expression varied according to molecular subtypes. Stromal AOC3 expression was high in luminal B and HER-2 type and MAO-A expression was high in luminal A and luminal B (p < 0.001. MAO-B expression was higher in TNBC than in other subtypes (p = 0.020. LOX positivity was associated with high histological grade (p < 0.001 and high Ki-67 labeling index (LI (p = 0.009, and stromal AOC3 positivity was associated with high histological grade (p = 0.001, high Ki-67 LI (p < 0.001, and HER-2 positivity (p = 0.002. MAO-A positivity was related to low histological grade (p < 0.001, ER positivity, PR positivity (p < 0.001, and low Ki-67 LI (p < 0.001. In univariate analysis, MAO-A positivity was related to short disease-free survival in HER-2 type (p = 0.013, AOC3 negativity was related to short disease-free survival and overall survival in ER-positive breast cancer, PR-positive breast cancer, HER-2-negative breast cancer, and lymph node metastasis. In conclusion, the expression of amine oxidase proteins varies depending on the molecular subtype of breast cancer. Stromal AOC3 expression was high in luminal B and HER-2 type, and MAO-A expression was high in luminal A and luminal B.
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom
2013-01-01
A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom
2013-01-01
A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets.
Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.
Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L
2012-08-01
Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (Ppenis. Apocynin treatment of sickle mice reversed (P0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in the SCD mouse penis. © 2012 International Society for Sexual Medicine.
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Monoamine oxidase and agitation in psychiatric patients.
Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela
2016-08-01
Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. Copyright © 2016 Elsevier Inc. All rights reserved.
Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris
International Nuclear Information System (INIS)
Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W.
2007-01-01
High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an α-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10 4 U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions
Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum
2018-03-01
Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.
Multi-Copper Oxidases and Human Iron Metabolism
Vashchenko, Ganna; MacGillivray, Ross T. A.
2013-01-01
Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651
Cataplexy and monoamine oxidase deficiency in Norrie disease.
Vossler, D G; Wyler, A R; Wilkus, R J; Gardner-Walker, G; Vlcek, B W
1996-05-01
Norrie disease (ND) is an X-linked recessive disorder causing ocular atrophy, mental retardation, deafness, and dysmorphic features. Virtually absent monoamine oxidase (MAO) type-A and -B activity has been found in some boys with chromosome deletions. We report the coexistence of cataplexy and abnormal REM sleep organization with ND. Three related boys, referred for treatment of medically refractory atonic spells and apneas, underwent extended EEG-video-polysomnographic monitoring. They demonstrated attacks of cataplexy and inappropriate periods of REM sleep during which they were unarousable. One boy also had generalized tonic-clonic seizures. Previous testing revealed that all three have complete ND gene deletions. In all subjects, platelet MAO-B activity was absent, serum serotonin levels were markedly increased, and plasma catecholamine levels were normal. Data from the canine narcolepsy syndrome model implicate abnormal catecholaminergic and cholinergic activities in the pathogenesis of cataplexy. Our findings suggest that abnormal MAO activity or an imbalance between serotonin and other neurotransmitter levels may be involved in the pathogenesis of human cataplexy.
Engineering glucose oxidase to minimize the influence of oxygen on sensor response
International Nuclear Information System (INIS)
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2014-01-01
Glucose oxidase (GOx) is an important industrial enzyme and is recognized as the gold standard for monitoring blood glucose. However, due to its inherent oxidase property, the presence of oxygen affects electrochemical measurements of venous blood glucose employing artificial electron mediators. We therefore attempted to engineer Penicillium amagasakiense-derived GOx into a dehydrogenase by focusing on the amino acid residues predicted to interact with oxygen. Our rational amino acid substitution approach resulted in the construction of the Ser114Ala/Phe355Leu mutant, which has an 11-fold decrease in oxidase activity and 2.8-fold increase in dehydrogenase activity compared with wild-type GOx. As a result, the dehydrogenase/oxidase activity ratio of the engineered enzyme was 32-fold greater than that of the wild-type enzyme. The enzyme sensor constructed with Ser114Ala/Phe355Leu was considerably less affected by oxygen than the wild-type GOx-based sensor at lower glucose concentrations
International Nuclear Information System (INIS)
Dubey, G.P.; Srivastava, V.K.; Agrawal, A.; Udupa, K.N.
1988-01-01
Platelet monoamine oxidase is a mitochondrial enzyme taking part in the deamination reaction of total catecholamine. Recent studies of monoamine oxidase inhibitors have gained its importance in the control of variety of psychosomatic disorders like mental depression, arterial hypertension and anxiety neurosis. 30 apparently normal individuals and 42 diagnosed cases of essential hypertension were selected for the present study. The platelet monoamine oxidase activity was measured by using 14 C-tryptamine bisuccinate. Comparatively low activity of platelet monoamine oxidase was noticed in hypertension cases than in the normal. After oral administration of an indigenous drug 'Geriforte' for three months, a significant rise in platelet monoamine oxidase activity was noticed in hypertension cases. It can be concluded that this indigenous formulation has the capacity to regulate the monoamine oxidase activity, as such, it may provide an alternative remedy in the management of psychosomatic disorders. (author). 11 refs
Wongnate, Thanyaporn; Chaiyen, Pimchai
2013-07-01
Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.
Vuong, Thu V; Foumani, Maryam; MacCormick, Benjamin; Kwan, Rachel; Master, Emma R
2016-11-21
Glucose oxidase (GO) activity is generally restricted to glucose and is susceptible to inactivation by H 2 O 2 . By comparison, the Y300A variant of gluco-oligosaccharide oxidase (GOOX) from Sarocladium strictum showed broader substrate range and higher H 2 O 2 stability. Specifically, Y300A exhibited up to 40 times higher activity on all tested sugars except glucose, compared to GO. Moreover, fusion of the Y300A variant to a family 22 carbohydrate binding module from Clostridium thermocellum (CtCBM22A) nearly doubled its catalytic efficiency on glucose, while retaining significant activity on oligosaccharides. In the presence of 200 mM of H 2 O 2 , the recombinant CtCBM22A_Y300A retained 80% of activity on glucose and 100% of activity on cellobiose, the preferred substrate for this enzyme. By contrast, a commercial glucose oxidase reported to contain ≤0.1 units catalase/ mg protein, retained 60% activity on glucose under the same conditions. GOOX variants appear to undergo a different mechanism of inactivation, as a loss of histidine instead of methionine was observed after H 2 O 2 incubation. The addition of CtCBM22A also promoted functional binding of the fusion enzyme to xylan, facilitating its simultaneous purification and immobilization using edible oat spelt xylan, which might benefit the usage of this enzyme preparation in food and baking applications.
Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan
2017-01-15
In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright © 2016 Elsevier B.V. All rights reserved.
The antioxidant properties, cytotoxicity and monoamine oxidase ...
African Journals Online (AJOL)
ajl yemi
2011-11-28
Nov 28, 2011 ... Department of Pharmaceutical Chemistry, North-West University, Private Bag X6001, Potchefstroom 2520, ..... on the inhibition of the catabolism of serotonin, .... Structure of human monoamine oxidase B, a drug target for.
Investigation of antihemolytic, xanthine oxidase inhibition ...
African Journals Online (AJOL)
Abbreviations: SVEs: Salvia Verbenaca L. aerial part Extracts; CrE: Crud Extract; ChE: Chloroform Extract ; EAE: Ethyl Acetate Extract; AqE : Aqueous Extract ; ROS: Reactive Oxygen Spices; AAPH : 2,2, -Azobis (2-AmidinoPropane) Dihydrochloride ; DPPH: DiPhenyl- Picryl-Hydrazyl; XO: Xanthine Oxidase; Gen: Gentamicin ...
Directory of Open Access Journals (Sweden)
Federica Sandri
2017-06-01
Full Text Available Pseudomonas pseudoalcaligenes KF707 is a soil bacterium which is known for its capacity to aerobically degrade harmful organic compounds such as polychlorinated biphenyls (PCBs using biphenyl as co-metabolite. Here we provide the first genetic and functional analysis of the KF707 respiratory terminal oxidases in cells grown with two different carbon sources: glucose and biphenyl. We identified five terminal oxidases in KF707: two c(caa3 type oxidases (Caa3 and Ccaa3, two cbb3 type oxidases (Cbb31 and Cbb32, and one bd type cyanide-insensitive quinol oxidase (CIO. While the activity and expression of both Cbb31 and Cbb32 oxidases was prevalent in glucose grown cells as compared to the other oxidases, the activity and expression of the Caa3 oxidase increased considerably only when biphenyl was used as carbon source in contrast to the Cbb32 oxidase which was repressed. Further, the respiratory activity and expression of CIO was up-regulated in a Cbb31 deletion strain as compared to W.T. whereas the CIO up-regulation was not present in Cbb32 and C(caa3 deletion mutants. These results, together, reveal that both function and expression of cbb3 and caa3 type oxidases in KF707 are modulated by biphenyl which is the co-metabolite needed for the activation of the PCBs-degradation pathway.
Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase.
Thrower, J S; Blalock, R; Klinman, J P
2001-08-14
1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.
Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor
2011-01-01
Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.
Intracellular lysyl oxidase: Effect of a specific inhibitor on nuclear mass in proliferating cells
Energy Technology Data Exchange (ETDEWEB)
Saad, Fawzy A. [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Torres, Marie [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Wang, Hao [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Graham, Lila, E-mail: lilagraham@cs.com [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States)
2010-06-11
LOX, the principal enzyme involved in crosslinking of collagen, was the first of several lysyl oxidase isotypes to be characterized. Its active form was believed to be exclusively extracellular. Active LOX was later reported to be present in cell nuclei; its function there is unknown. LOX expression opposes the effect of mutationally activated Ras, which is present in about 30% of human cancers. The mechanism of LOX in countering the action of Ras is also unknown. In the present work, assessment of nuclear protein for possible effects of lysyl oxidase activity led to the discovery that proliferating cells dramatically increase their nuclear protein content when exposed to BAPN ({beta}-aminopropionitrile), a highly specific lysyl oxidase inhibitor that reportedly blocks LOX inhibition of Ras-induced oocyte maturation. In three cell types (PC12 cells, A7r5 smooth muscle cells, and NIH 3T3 fibroblasts), BAPN caused a 1.8-, 1.7-, and 2.1-fold increase in total nuclear protein per cell, respectively, affecting all major components in both nuclear matrix and chromatin fractions. Since nuclear size is correlated with proliferative status, enzyme activity restricting nuclear growth may be involved in the lysyl oxidase tumor suppressive effect. Evidence is also presented for the presence of apparent lysyl oxidase isotype(s) containing a highly conserved LOX active site sequence in the nuclei of PC12 cells, which do not manufacture extracellular lysyl oxidase substrates. Results reported here support the hypothesis that nuclear lysyl oxidase regulates nuclear growth, and thereby modulates cell proliferation.
Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.
2004-01-01
We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42
Increased xanthine oxidase during labour--implications for oxidative stress.
Many, A; Roberts, J M
1997-11-01
Xanthine dehydrogenase/oxidase (XDH/XO) produces uric acid. When in the oxidase form, this production is coupled with the generation of free radicals. Hypoxia-reperfusion enhances conversion of XDH to XO. Since the placenta is exposed to short periods of hypoxia reperfusion during labour, 17 placentae of pregnancy terminated by elective caesarean section and five placentae of pregnancies terminated by caesarean section during labour were examined for XDH/XO activity. It was found that XO activity was higher in the placentae of labouring women (P = 0.003), which suggests that labour enhances conversion of XDH to XO, facilitating free radical production.
Production of a new D-amino acid oxidase from the fungus Fusarium oxysporum.
Gabler, M; Fischer, L
1999-08-01
The fungus Fusarium oxysporum produced a D-amino acid oxidase (EC 1. 4.3.3) in a medium containing glucose as the carbon and energy source and ammonium sulfate as the nitrogen source. The specific D-amino acid oxidase activity was increased up to 12.5-fold with various D-amino acids or their corresponding derivatives as inducers. The best inducers were D-alanine (2.7 microkat/g of dry biomass) and D-3-aminobutyric acid (2.6 microkat/g of dry biomass). The addition of zinc ions was necessary to permit the induction of peroxisomal D-amino acid oxidase. Bioreactor cultivations were performed on a 50-liter scale, yielding a volumetric D-amino acid oxidase activity of 17 microkat liter(-1) with D-alanine as an inducer. Under oxygen limitation, the volumetric activity was increased threefold to 54 microkat liter(-1) (3,240 U liter(-1)).
Fraser, D M; Zakeeruddin, S M; Grätzel, M
1992-01-30
A ferrocene-derivatised detergent, (11-ferrocenylundecyl) trimethylammonium bromide (FTMAB), when oxidised to the corresponding ferricinium ion, was found by electrochemical studies to be an effective electron acceptor for reduced glucose oxidase of Aspergillus niger (EC 1.13.4) and thus acts as a electron-transfer mediator between glucose oxidase and a working electrode held at a potential sufficiently positive to reoxidise reduced FTMAB. An increase in mediating activity was produced when FTMAB was present in concentrations above its critical micelle concentration. An 'enzyme electrode' was formed by adsorption of glucose oxidase and FTMAB surfactant on a graphite rod. The electrode functioned as an amperometric biosensor for glucose in phosphate-buffered saline solution. A mixed micelle of glucose oxidase and FTMAB, probably adsorbed on the electrode surface, appears to be advantageous for the amperometric determination of glucose. Additionally, glucose oxidase was treated with alpha-mannosidase. When this partially-deglycosylated glucose oxidase was incorporated in an enzyme electrode, a 100-fold increase in the second-order rate constant (k) for electron transfer between the enzyme and FTMAB was observed, together with increased current densities, with respect to the equivalent values for FTMAB and commercial glucose oxidase. The use of deglycosylated enzymes in biosensors is suggested.
Institute of Scientific and Technical Information of China (English)
LI; Chijun; (
2001-01-01
[1]Liang, Z., Liang, H. G., The respiratory metabolism of plants, in Plant Physiology and Molecular Biology (eds. Yu, S. W., Tang, Z. C.) (in Chinese), 2nd ed., Beijing: Science Press, 1998, 344-365.[2]Lü, C. S., Liang, H. G., Induced respiration in melon fruits, Scientia Sinica, 1963, 12(4): 616.[3]Liang, H. G., Lü, C. S., A comparative study of CN-resistant respiration in different cultures of tobacco callus, Plant Physiol., 1984, 75: 876.[4]Elthon, T. E., McIntosh, L., Identification of the alternative terminal oxidase of higher plant mitochondria, Proc. Natl. Acad. Sci. USA, 1987, 84: 8399.[5]Elthon, T. E., Nickels, R. L., McIntosh, L., Monoclonal antibodies to the alternative oxidase of higher plant mitochondria, Plant Physiol., 1989, 89: 1311.[6]Liang, W. S., Liang, H. G., Progress of the alternative oxidase, Chinese Bulletin of Botany (in Chinese), 1997, 14(2): 9.[7]Liang, W. S., Liang, H. G., Induction of alternative oxidase expression by endogenous ethylene in aging potato slices, Acta Phytophysiol. Sin. (in Chinese), 1999, 25(2): 205.[8]He, J. X., Wei, Z. Q., Liang, H. G., Effects of water stress on development, and operation and gene expression of cyanide-resistant respiratory pathway in wheat, Science in China, Ser. C, 1999, 42(3): 300.[9]McIntosh, L., Molecular biology of the alternative oxidase, Plant Physiol., 1994, 105: 781.[10] Wang, J., Zhang, L. X., Liu, Z. L. et al., A possible calcium binding site in D1 protein: A fluorescence and FTIR study of the interaction between lanthanides and a synthetic peptide, Photosynthesis Research, 1995, 44: 297.[11] Li, X. P., Du, L. F., Liang, H. G. et al., Preparation and identification of antidodecapeptide of polypeptide D1 or photosys-tem II reaction center, Prog. Biochem. Biophys. (in Chinese), 1997, 24(3): 283.[12] Wen, J. Q., Liang, H. G., Studies on energy status and mitochondria respiration during growth and senescence of mung bean cotyledons, Physiol
Intramolecular electron transfer in ascorbate oxidase is enhanced in the presence of oxygen
DEFF Research Database (Denmark)
Farver, O; Wherland, S; Pecht, I
1994-01-01
Intramolecular electron transfer from the type 1 copper center to the type 3 copper(II) pair is induced in the multi-copper enzyme, ascorbate oxidase, following pulse radiolytic reduction of the type 1 Cu(II) ion. In the presence of a slight excess of dioxygen over ascorbate oxidase, interaction...... between the trinuclear copper center and O2 is observed even with singly reduced ascorbate oxidase molecules. Under these conditions, the rate constant for intramolecular electron transfer from type 1 Cu(I) to type 3 Cu(II) increases 5-fold to 1100 +/- 300 s-1 (20 degrees C, pH 5.8) as compared...
Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Herbert, Eric; Ferrari, Roselyne; Chapeland-Leclerc, Florence
2018-07-01
The Podospora anserina genome contains a large family of 15 multicopper oxidases (MCOs), including three genes encoding a FET3-like protein, an ABR1-like protein and an ascorbate oxidase (AO)-like protein. FET3, ABR1 and AO1 are involved in global laccase-like activity since deletion of the relevant genes led to a decrease of activity when laccase substrate (ABTS) was used as substrate. However, contrary to the P. anserina MCO proteins previously characterized, none of these three MCOs seemed to be involved in lignocellulose degradation and in resistance to phenolic compounds and oxidative stress. We showed that the bulk of ferroxidase activity was clearly due to ABR1, and only in minor part to FET3, although ABR1 does not contain all the residues typical of FET3 proteins. Moreover, we showed that ABR1, related to the Aspergillus fumigatus ABR1 protein, was clearly and specifically involved in pigmentation of ascospores. Surprisingly, phenotypes were more severe in mutants lacking both abr1 and ao1. Deletion of the ao1 gene led to an almost total loss of AO activity. No direct involvement of AO1 in fungal developmental process in P. anserina was evidenced, except in a abr1 Δ background. Overall, unlike other previously characterized MCOs, we thus evidence a clear involvement of ABR1 protein in fungal development. Copyright © 2018 Elsevier Inc. All rights reserved.
Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence
Energy Technology Data Exchange (ETDEWEB)
Ruvolo, M.; Disotell, T.R.; Allard, M.W. (Harvard Univ., Cambridge, MA (United States)); Brown, W.M. (Univ. of Michigan, Ann Arbor (United States)); Honeycutt, R.L. (Texas A and M Univ., College Station (United States))
1991-02-15
Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.
Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence
International Nuclear Information System (INIS)
Ruvolo, M.; Disotell, T.R.; Allard, M.W.; Brown, W.M.; Honeycutt, R.L.
1991-01-01
Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time
Rational redesign of glucose oxidase for improved catalytic function and stability.
Directory of Open Access Journals (Sweden)
J Todd Holland
Full Text Available Glucose oxidase (GOx is an enzymatic workhorse used in the food and wine industries to combat microbial contamination, to produce wines with lowered alcohol content, as the recognition element in amperometric glucose sensors, and as an anodic catalyst in biofuel cells. It is naturally produced by several species of fungi, and genetic variants are known to differ considerably in both stability and activity. Two of the more widely studied glucose oxidases come from the species Aspergillus niger (A. niger and Penicillium amagasakiense (P. amag., which have both had their respective genes isolated and sequenced. GOx from A. niger is known to be more stable than GOx from P. amag., while GOx from P. amag. has a six-fold superior substrate affinity (K(M and nearly four-fold greater catalytic rate (k(cat. Here we sought to combine genetic elements from these two varieties to produce an enzyme displaying both superior catalytic capacity and stability. A comparison of the genes from the two organisms revealed 17 residues that differ between their active sites and cofactor binding regions. Fifteen of these residues in a parental A. niger GOx were altered to either mirror the corresponding residues in P. amag. GOx, or mutated into all possible amino acids via saturation mutagenesis. Ultimately, four mutants were identified with significantly improved catalytic activity. A single point mutation from threonine to serine at amino acid 132 (mutant T132S, numbering includes leader peptide led to a three-fold improvement in k(cat at the expense of a 3% loss of substrate affinity (increase in apparent K(M for glucose resulting in a specify constant (k(cat/K(M of 23.8 (mM(-1 · s(-1 compared to 8.39 for the parental (A. niger GOx and 170 for the P. amag. GOx. Three other mutant enzymes were also identified that had improvements in overall catalysis: V42Y, and the double mutants T132S/T56V and T132S/V42Y, with specificity constants of 31.5, 32.2, and 31.8 mM(-1 · s
Ratiometric glucose sensing based on fluorescent oxygen films and glucose oxidase
Directory of Open Access Journals (Sweden)
Fengyu Su
2017-06-01
Full Text Available A new two-layer sensor film was constructed for sensing glucose based on glucose oxidase and oxygen sensing material. The first layer of film containing the oxygen sensor and intra-reference material was polymerized, then the second layer of glucose oxidase and glutaraldehyde was formed on the oxygen sensor layer. The two-layer sensor film has a resolution up to 0.05 mM and a detection range from 0 to 5 mM to glucose. The effects of pH and temperature on the sensing performance were systematically investigated. The selective detection of glucose among other monosaccharides, such as fructose, mannose and galactose indicated that the sensing film has excellent selectivity. The prepared sensor was successfully applied for glucose sample detection of glucose concentration in artificial tears. Keywords: Glucose sensor, Glucose oxidase, Fluorescence, Oxygen film, Diabetes
Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger
Directory of Open Access Journals (Sweden)
Tamayo-Ramos Juan Antonio
2012-12-01
Full Text Available Abstract Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA and 2,2-azino-di(3-ethylbenzthiazoline sulfonic acid (ABTS, and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst.
Glucose oxidase-functionalized fluorescent gold nanoclusters as probes for glucose
International Nuclear Information System (INIS)
Xia, Xiaodong; Long, Yunfei; Wang, Jianxiu
2013-01-01
Highlights: ► A glucose oxidase/gold nanocluster conjugates formed by etching chemistry. ► Integration of the bioactivities and fluorescence properties within a single unit. ► These conjugates serve as novel fluorescent probe for glucose. -- Abstract: Creation and application of noble metal nanoclusters have received continuous attention. By integrating enzyme activity and fluorescence for potential applications, enzyme-capped metal clusters are more desirable. This work demonstrated a glucose oxidase (an enzyme for glucose)-functionalized gold cluster as probe for glucose. Under physiological conditions, such bioconjugate was successfully prepared by an etching reaction, where tetrakis (hydroxylmethyl) phosphonium-protected gold nanoparticle and thioctic acid-modified glucose oxidase were used as precursor and etchant, respectively. These bioconjugates showed unique fluorescence spectra (λ em max = 650 nm, λ ex max = 507 nm) with an acceptable quantum yield (ca. 7%). Moreover, the conjugated glucose oxidase remained active and catalyzed reaction of glucose and dissolved O 2 to produce H 2 O 2 , which quenched quantitatively the fluorescence of gold clusters and laid a foundation of glucose detection. A linear range of 2.0 × 10 −6 –140 × 10 −6 M and a detection limit of 0.7 × 10 −6 M (S/N = 3) were obtained. Also, another horseradish peroxidase/gold cluster bioconjugate was produced by such general synthesis method. Such enzyme/metal cluster bioconjugates represented a promising class of biosensors for biologically important targets in organelles or cells
Energy Technology Data Exchange (ETDEWEB)
Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China); Wei, Ling [Beijing Center for Physical & Chemical Analysis, Beijing 100089 (China); Liu, Yutong [School of Life Science, Beijing Normal University, Beijing 100875 (China); Liao, Jieying [Department of Translational Medicine, Xiamen Institute of Rare Earth Materials, Chinese Academy of Sciences, Xiamen 361024 (China); Gao, Hui-Ming [Model Animal Research Center of Nanjing University, Nanjing 211800 (China); Zhou, Hui, E-mail: hardhui@gmail.com [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China)
2017-05-01
Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm{sup 2} induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm{sup 2}) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91{sup phox}, p47{sup phox} and p40{sup phox}); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47{sup phox} and p67{sup phox} translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to
International Nuclear Information System (INIS)
Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin; Wei, Ling; Liu, Yutong; Liao, Jieying; Gao, Hui-Ming; Zhou, Hui
2017-01-01
Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm 2 induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm 2 ) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91 phox , p47 phox and p40 phox ); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47 phox and p67 phox translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to oxidative damage to DA neurons. Our
Analysis of cellulase and polyphenol oxidase production by southern pine beetle associated fungi
Abduvali Valiev; Zumrut B. Ogel; Dier D. Klepzig
2009-01-01
In this study, the production of extracellular enzymes by fungi associated with southern pine beetle was investigated for the first time. Cellulase and polyphenol oxidase production were analyzed for three beetle associated fungi. Only the mutualistic symbiont Entomocorticium sp. A was found to produce cellulases and polyphenol oxidase....
Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen
International Nuclear Information System (INIS)
Pasqualini, Stefania; Tedeschini, Emma; Frenguelli, Giuseppe; Wopfner, Nicole; Ferreira, Fatima; D'Amato, Gennaro; Ederli, Luisa
2011-01-01
Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O 3 ) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O 3 fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O 3 fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O 3 , determined from the mRNA levels of the major allergens. We conclude that O 3 can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: → O 3 reduces the viability of ragweed pollen. → ROS and allergens of ragweed pollen were not affected by O 3 exposure. → O 3 enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. → O 3 increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.
Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen
Energy Technology Data Exchange (ETDEWEB)
Pasqualini, Stefania, E-mail: spas@unipg.it [Department of Applied Biology, University of Perugia, Perugia (Italy); Tedeschini, Emma; Frenguelli, Giuseppe [Department of Applied Biology, University of Perugia, Perugia (Italy); Wopfner, Nicole; Ferreira, Fatima [Department of Molecular Biology, CD Laboratory for Allergy Diagnosis and Therapy, University of Salzburg, Salzburg (Austria); D' Amato, Gennaro [Division of Respiratory and Allergic Diseases, ' A. Cardarelli' High Speciality Hospital, Naples (Italy); Ederli, Luisa [Department of Applied Biology, University of Perugia, Perugia (Italy)
2011-10-15
Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O{sub 3}) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O{sub 3} fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O{sub 3} fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O{sub 3}, determined from the mRNA levels of the major allergens. We conclude that O{sub 3} can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: > O{sub 3} reduces the viability of ragweed pollen. > ROS and allergens of ragweed pollen were not affected by O{sub 3} exposure. > O{sub 3} enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. > O{sub 3} increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.
Functional Assembly of Soluble and Membrane Recombinant Proteins of Mammalian NADPH Oxidase Complex.
Souabni, Hajer; Ezzine, Aymen; Bizouarn, Tania; Baciou, Laura
2017-01-01
Activation of phagocyte cells from an innate immune system is associated with a massive consumption of molecular oxygen to generate highly reactive oxygen species (ROS) as microbial weapons. This is achieved by a multiprotein complex, the so-called NADPH oxidase. The activity of phagocyte NADPH oxidase relies on an assembly of more than five proteins, among them the membrane heterodimer named flavocytochrome b 558 (Cytb 558 ), constituted by the tight association of the gp91 phox (also named Nox2) and p22 phox proteins. The Cytb 558 is the membrane catalytic core of the NADPH oxidase complex, through which the reducing equivalent provided by NADPH is transferred via the associated prosthetic groups (one flavin and two hemes) to reduce dioxygen into superoxide anion. The other major proteins (p47 phox , p67 phox , p40 phox , Rac) requisite for the complex activity are cytosolic proteins. Thus, the NADPH oxidase functioning relies on a synergic multi-partner assembly that in vivo can be hardly studied at the molecular level due to the cell complexity. Thus, a cell-free assay method has been developed to study the NADPH oxidase activity that allows measuring and eventually quantifying the ROS generation based on optical techniques following reduction of cytochrome c. This setup is a valuable tool for the identification of protein interactions, of crucial components and additives for a functional enzyme. Recently, this method was improved by the engineering and the production of a complete recombinant NADPH oxidase complex using the combination of purified proteins expressed in bacterial and yeast host cells. The reconstitution into artificial membrane leads to a fully controllable system that permits fine functional studies.
Xanthine oxidase activity and free radical generation in patients with sepsis syndrome
DEFF Research Database (Denmark)
Galley, H F; Davies, Michael Jonathan; Webster, N R
1996-01-01
OBJECTIVE: To determine xanthine oxidase activity, free radical concentrations, and lipid peroxidation in patients with sepsis syndrome compared with noninfected critically ill patients. DESIGN: A prospective observational study. SETTING: A nine-bed intensive care unit in a university teaching......). CONCLUSIONS: Patients with sepsis have xanthine oxidase activation, high free-radical concentrations, and evidence of free radical damage. The finding that xanthine oxidase activity was lower in those patients who died, coupled with increased lactate concentrations implies more severe ischemia with incomplete...... to the Acute Physiology and Chronic Health Evaluation (APACHE) II score or to the presence of organ dysfunction. The mean ascorbyl radical concentration (arbitrary units) determined by electron paramagnetic resonance following spin trapping was increased in patients compared with healthy subjects (p
Characterisation of genes induced during memory formation in the chick
International Nuclear Information System (INIS)
Bailey, K.A.; Luermans, J.; Gibbs, M.
2002-01-01
Full text: Memory formation can be divided into short-term and long-term. Short-term memory involves electro-chemical activity in the neurons whereas long-term memory requires a permanent change that includes protein synthesis. One of the problems involved with identifying late memory related genes is determining an optimal system in which to study gene expression. We have used a discriminated passive avoidance task in chicks to identify genes that are differentially regulated during memory formation. A mRNA subtraction method was previously used to specifically identify several genes that are expressed in the chick intermediate medial hyperstriatum ventrale (IMHV) within two hours of training. Eight bands ranging in size from 400bp to 1100bp were obtained in the initially screen. We are currently cloning these PCR products into suitable vectors for further analysis. Two of these clones have been sequenced and analysed using both the blastn and blastx programs in ANGIS. The first clone was found to correspond to cytochrome c oxidase subunit 2. Cytochrome C oxidase (COX) is a transmembrane protein localized in the inner mitochondrial membrane and forms part of the mitochondrial respiratory chain complex. The second clone codes for the ferritin heavy chain. Ferritin is a ubiquitous protein that is involved in iron homeostasis. At present it is unclear what role these two proteins play in memory formation but further studies are being undertaken to determine the expression profiles of these genes following memory induction. Copyright (2002) Australian Neuroscience Society
Ehsan, Muhammad; Akhter, Nasreen; Bhutto, Bachal; Arijo, Abdullah; Ali Gadahi, Javaid
2017-05-30
Cystic echinococcosis is an important zoonotic disease; it has serious impacts on animals as well as human health throughout the world. Genotypic characterization of Echinocossus granulosus (E. granulosus) in buffaloes has not been addressed in Pakistan. Therefore, the present study was conducted to evaluate the incidence and genotypic characterization of bovine E. granulosus. Out of 832 buffaloes examined, 112 (13.46%) were found infected. The favorable site for hydatid cyst development was liver (8.65%) followed by lungs (4.80%). The rate of cystic echinococcosis was found higher in females 14.43% than males 9.77%. The females above seven years aged were more infected as compared to the young ones. The partial sequence of mitochondrial cytochrome oxidase 1 (CO1) gene was used for identification and molecular analysis of buffalo's E. granulosus isolates. The alignment of redundant sequences were compared with already identified 10 genotypes available at National Centre for Biotechnology Information (NCBI) GenBank. The sequencing and phylogenetic analysis of all randomly selected buffalo isolates were belong to the G1- G3 complex (E. granulosus sensu stricto). All sequences were diverse from the reference sequence. No one showed complete identity to the buffalo strain (G3), representing substantial microsequence variability in G1, G2 and G3 genotypes. We evaluated the echinococcal infectivity and first time identification of genotypes in buffaloes in Sindh, Pakistan. This study will lead to determine accurate source of this zoonotic disease to humans in Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Marta Berrocal-Lobo
2010-12-01
Full Text Available Pathogen associated molecular patterns (PAMPs are signals detected by plants that activate basal defenses. One of these PAMPs is chitin, a carbohydrate present in the cell walls of fungi and in insect exoskeletons. Previous work has shown that chitin treatment of Arabidopsis thaliana induced defense-related genes in the absence of a pathogen and that the response was independent of the salicylic acid (SA, jasmonic acid (JA and ethylene (ET signaling pathways. One of these genes is ATL9 ( = ATL2G, which encodes a RING zinc-finger like protein. In the current work we demonstrate that ATL9 has E3 ubiquitin ligase activity and is localized to the endoplasmic reticulum. The expression pattern of ATL9 is positively correlated with basal defense responses against Golovinomyces cichoracearum, a biotrophic fungal pathogen. The basal levels of expression and the induction of ATL9 by chitin, in wild type plants, depends on the activity of NADPH oxidases suggesting that chitin-mediated defense response is NADPH oxidase dependent. Although ATL9 expression is not induced by treatment with known defense hormones (SA, JA or ET, full expression in response to chitin is compromised slightly in mutants where ET- or SA-dependent signaling is suppressed. Microarray analysis of the atl9 mutant revealed candidate genes that appear to act downstream of ATL9 in chitin-mediated defenses. These results hint at the complexity of chitin-mediated signaling and the potential interplay between elicitor-mediated signaling, signaling via known defense pathways and the oxidative burst.
Monoamine Oxidase A in Antisocial Personality Disorder and Borderline Personality Disorder.
Kolla, Nathan J; Vinette, Sarah A
2017-01-01
Variation in the monoamine oxidase A (MAO-A) gene and MAO-A enzyme levels have been linked to antisocial behavior and aggression in clinical and non-clinical populations. Here, we provide an overview of the genetic, epigenetic, and neuroimaging research that has examined MAO-A structure and function in antisocial personality disorder (ASPD) and borderline personality disorder (BPD). The low-activity MAO-A variable nucleotide tandem repeat genetic polymorphism has shown a robust association with large samples of violent and seriously violent offenders, many of whom had ASPD. A recent positron emission tomography (PET) study of ASPD similarly revealed low MAO-A density in brain regions thought to contribute to the psychopathology of the condition. By contrast, PET has also demonstrated that brain MAO-A levels are increased in BPD and that they relate to symptoms of low mood and suicidality. Candidate gene studies have produced the most compelling evidence connecting MAO-A genetic variants to both ASPD and BPD. Still, conflicting results abound in the literature, making it highly unlikely that ASPD or BPD is related to a specific MAO-A genetic variant. Future research should strive to examine how MAO-A genotypes interact with broad-spectrum environmental influences to produce brain endophenotypes that may ultimately become tractable targets for novel treatment strategies.
Buschmann, Sabine; Richers, Sebastian; Ermler, Ulrich; Michel, Hartmut
2014-04-01
The cbb3 cytochrome c oxidases are distant members of the superfamily of heme copper oxidases. These terminal oxidases couple O2 reduction with proton transport across the plasma membrane and, as a part of the respiratory chain, contribute to the generation of an electrochemical proton gradient. Compared with other structurally characterized members of the heme copper oxidases, the recently determined cbb3 oxidase structure at 3.2 Å resolution revealed significant differences in the electron supply system, the proton conducting pathways and the coupling of O2 reduction to proton translocation. In this paper, we present a detailed report on the key steps for structure determination. Improvement of the protein quality was achieved by optimization of the number of lipids attached to the protein as well as the separation of two cbb3 oxidase isoenzymes. The exchange of n-dodecyl-β-D-maltoside for a precisely defined mixture of two α-maltosides and decanoylsucrose as well as the choice of the crystallization method had a most profound impact on crystal quality. This report highlights problems frequently encountered in membrane protein crystallization and offers meaningful approaches to improve crystal quality. © 2014 The Protein Society.
Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia
2018-02-17
Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.
Age-related ultrastructural and monoamine oxidase changes in the rat optic nerve.
Taurone, S; Ripandelli, G; Minni, A; Lattanzi, R; Miglietta, S; Pepe, N; Fumagalli, L; Micera, A; Pastore, F S; Artico, M
2016-01-01
The aim of this paper is to study the morphology and the distribution of the monoamine oxidase enzymatic system in the optic nerve of 4 month-old Wistar (young) and 28 month-old Wistar (old) rats. The optic nerve was harvested from 20 young and old rats. The segment of optic nerve was divided longitudinally into two pieces, each 0.1 mm in length. The first piece was used for transmission electron microscopy. The second piece was stained with histochemical reaction for monoamine oxidase. The agerelated changes in the optic nerve of rats include micro-anatomical details, ultrastructure and monoamine oxidase histochemical staining. A strong decrease of the thin nerve fibers and a swelling of the thick ones can be observed in optic nerve fibers of old rats. Increased monoamine oxidase histochemical staining of the optic nerve of aged rats is well demonstrated. The increase of meningeal shealth and the decrease of thin nerve fibers of the optic nerve in old rats are well documented. Morphological, ultrastructural and histochemical changes observed in optic nerve fibers of the old rats show a close relation with aging.
The antioxidant properties, cytotoxicity and monoamine oxidase ...
African Journals Online (AJOL)
Tarchonanthus camphoratus (camphor bush) has been widely used for numerous medicinal purposes. The aim of the present study was to evaluate the antioxidant properties, cytotoxicity and monoamine oxidase inhibition activities of the crude dichloromethane leaf extract of T. camphoratus. The antioxidant activities were ...
The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism
Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong
2011-01-01
Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…
Son, Yu-Lim; Kim, Hyoun-Young; Thiyagarajan, Saravanakumar; Xu, Jing Jing
2012-01-01
cDNA of the glx1 gene encoding glyoxal oxidase (GLX) from Phanerochaete chrysosporium was isolated and expressed in Pichia pastoris. The recombinant GLX (rGLX) produces H2O2 over 7.0 nmol/min/mL using methyl glyoxal as a substrate. Use of rGLX as a generator of H2O2 improved the coupled reaction with recombinant manganese peroxidase resulting in decolorization of malachite green up to 150 µM within 90 min. PMID:23323052
Glycosylation site-targeted PEGylation of glucose oxidase retains native enzymatic activity.
Ritter, Dustin W; Roberts, Jason R; McShane, Michael J
2013-04-10
Targeted PEGylation of glucose oxidase at its glycosylation sites was investigated to determine the effect on enzymatic activity, as well as the bioconjugate's potential in an optical biosensing assay. Methoxy-poly(ethylene glycol)-hydrazide (4.5kDa) was covalently coupled to periodate-oxidized glycosylation sites of glucose oxidase from Aspergillus niger. The bioconjugate was characterized using gel electrophoresis, liquid chromatography, mass spectrometry, and dynamic light scattering. Gel electrophoresis data showed that the PEGylation protocol resulted in a drastic increase (ca. 100kDa) in the apparent molecular mass of the protein subunit, with complete conversion to the bioconjugate; liquid chromatography data corroborated this large increase in molecular size. Mass spectrometry data proved that the extent of PEGylation was six poly(ethylene glycol) chains per glucose oxidase dimer. Dynamic light scattering data indicated the absence of higher-order oligomers in the PEGylated GOx sample. To assess stability, enzymatic activity assays were performed in triplicate at multiple time points over the course of 29 days in the absence of glucose, as well as before and after exposure to 5% w/v glucose for 24h. At a confidence level of 95%, the bioconjugate's performance was statistically equivalent to native glucose oxidase in terms of activity retention over the 29 day time period, as well as following the 24h glucose exposure. Finally, the bioconjugate was entrapped within a poly(2-hydroxyethyl methacrylate) hydrogel containing an oxygen-sensitive phosphor, and the construct was shown to respond approximately linearly with a 220±73% signal change (n=4, 95% confidence interval) over the physiologically-relevant glucose range (i.e., 0-400mg/dL); to our knowledge, this represents the first demonstration of PEGylated glucose oxidase incorporated into an optical biosensing assay. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jonathan M. LaMantia
2018-04-01
Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.
Hackenberg, C.; Kern, R.; Hüge, J; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to
Hackenberg, C.; Kern, R.; Hüge, J.; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to
Chen, Feng; Qian, Li-Hua; Deng, Bo; Liu, Zhi-Min; Zhao, Ying; Le, Ying-Ying
2013-09-01
Hyperglycemia-induced oxidative stress has been implicated in diabetic vascular complications in which NADPH oxidase is a major source of reactive oxygen species (ROS) generation. Resveratrol is a naturally occurring polyphenol, which has vasoprotective effects in diabetic animal models and inhibits high glucose (HG)-induced oxidative stress in endothelial cells. We aimed to examine whether HG-induced NADPH oxidase activation and ROS production contribute to glucotoxicity to endothelial cells and the effect of resveratrol on glucotoxicity. Using a murine brain microvascular endothelial cell line bEnd3, we found that NADPH oxidase inhibitor (apocynin) and resveratrol both inhibited HG-induced endothelial cell apoptosis. HG-induced elevation of NADPH oxidase activity and production of ROS were inhibited by apocynin, suggesting that HG induces endothelial cell apoptosis through NADPH oxidase-mediated ROS production. Mechanistic studies revealed that HG upregulated NADPH oxidase subunit Nox1 but not Nox2, Nox4, and p22(phox) expression through NF-κB activation, which resulted in elevation of NADPH oxidase activity and consequent ROS production. Resveratrol prevented HG-induced endothelial cell apoptosis through inhibiting HG-induced NF-κB activation, NADPH oxidase activity elevation, and ROS production. HG induces endothelial cell apoptosis through NF-κB/NADPH oxidase/ROS pathway, which was inhibited by resveratrol. Our findings provide new potential therapeutic targets against brain vascular complications of diabetes. © 2013 John Wiley & Sons Ltd.
Paulus, Angela; Rossius, Sebastiaan Gijsbertus Hendrik; Dijk, Madelon; de Vries, Simon
2012-01-01
The quinol-linked cytochrome bd oxidases are terminal oxidases in respiration. These oxidases harbor a low spin heme b558 that donates electrons to a binuclear heme b595/heme d center. The reaction with O2 and subsequent catalytic steps of the Escherichia coli cytochrome bd-I oxidase were investigated by means of ultra-fast freeze-quench trapping followed by EPR and UV-visible spectroscopy. After the initial binding of O2, the O–O bond is heterolytically cleaved to yield a kinetically competent heme d oxoferryl porphyrin π-cation radical intermediate (compound I) magnetically interacting with heme b595. Compound I accumulates to 0.75–0.85 per enzyme in agreement with its much higher rate of formation (∼20,000 s−1) compared with its rate of decay (∼1,900 s−1). Compound I is next converted to a short lived heme d oxoferryl intermediate (compound II) in a phase kinetically matched to the oxidation of heme b558 before completion of the reaction. The results indicate that cytochrome bd oxidases like the heme-copper oxidases break the O–O bond in a single four-electron transfer without a peroxide intermediate. However, in cytochrome bd oxidases, the fourth electron is donated by the porphyrin moiety rather than by a nearby amino acid. The production of reactive oxygen species by the cytochrome bd oxidase was below the detection level of 1 per 1000 turnovers. We propose that the two classes of terminal oxidases have mechanistically converged to enzymes in which the O–O bond is broken in a single four-electron transfer reaction to safeguard the cell from the formation of reactive oxygen species. PMID:22287551
Peroxidasin-mediated crosslinking of collagen IV is independent of NADPH oxidases
Directory of Open Access Journals (Sweden)
Gábor Sirokmány
2018-06-01
Full Text Available Collagen IV is a major component of the basement membrane in epithelial tissues. The NC1 domains of collagen IV protomers are covalently linked together through sulfilimine bonds, the formation of which is catalyzed by peroxidasin. Although hydrogen peroxide is essential for this reaction, the exact source of the oxidant remains elusive. Members of the NOX/DUOX NADPH oxidase family are specifically devoted to the production of superoxide and hydrogen peroxide. Our aim in this study was to find out if NADPH oxidases contribute in vivo to the formation of collagen IV sulfilimine crosslinks. We used multiple genetically modified in vivo model systems to provide a detailed assessment of this question. Our data indicate that in various peroxidasin-expressing tissues sulfilimine crosslinks between the NC1 domains of collagen IV can be readily detected in the absence of functioning NADPH oxidases. We also analyzed how subatmospheric oxygen levels influence the collagen IV network in collagen-producing cultured cells with rapid matrix turnover. We showed that collagen IV crosslinks remain intact even under strongly hypoxic conditions. Our hypothesis is that during collagen IV network formation PXDN cooperates with a NOX/DUOX-independent H2O2 source that is functional also at very low ambient oxygen levels. Keywords: Peroxidasin, NADPH oxidase, Hydrogen peroxide, Collagen IV, Sulfilimine
Directory of Open Access Journals (Sweden)
Jamsari Amirul Firdaus Jamaluddin
2011-01-01
Full Text Available Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F ST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.
Habib, Mohamed H. M.; Deuss, Peter J.; Loncar, Nikola; Trajkovic, Milos; Fraaije, Marco W.
2017-01-01
Synthetic lignin was prepared biocatalytically in a one-pot, two-step reaction using an oxidase/peroxidase cascade enzyme system. Using eugenol in combination with eugenol oxidase and a peroxidase, lignin-like material was produced. The cascade reaction takes advantage of the ability of the oxidase
Plasma diamine oxidase activity in asthmatic children
Directory of Open Access Journals (Sweden)
Kyoichiro Toyoshima
1996-01-01
Full Text Available Histamine plays an important role in the development of asthmatic symptoms. Diamine oxidase (DAO histaminase, which inactivates histamine, is located in the intestine and kidney and is released into plasma. Plasma DAO activity in asthmatic children was measured by a recently developed high performance liquid chromatographic method using histamine as the DAO substrate. Diamine oxidase activity was higher in severely asthmatic children than in those with mild asthma. A time course study during the acute exacerbation phase revealed that DAO activity rose during acute asthmatic attacks and then decreased gradually over several days. Although the mechanisms of plasma DAO activity increase during acute asthmatic attacks could not be explained, data showed that plasma DAO activity is an important index of histamine metabolism in asthmatics and may relate to some mechanisms of acute exacerbation of airway inflammation. Consequently, fluctuations in plasma DAO can be used as one of various indices of instability in management of asthma.
Glucose oxidase-functionalized fluorescent gold nanoclusters as probes for glucose
Energy Technology Data Exchange (ETDEWEB)
Xia, Xiaodong [College of Chemistry and Chemical Engineering, Central South University, Changsha 410083 (China); School of Chemistry and Chemical Engineering, Hunan University of Science and Technology, Xiangtan 411201 (China); Long, Yunfei, E-mail: l_yunfei927@163.com [School of Chemistry and Chemical Engineering, Hunan University of Science and Technology, Xiangtan 411201 (China); Wang, Jianxiu, E-mail: jxiuwang@csu.edu.cn [College of Chemistry and Chemical Engineering, Central South University, Changsha 410083 (China)
2013-04-15
Highlights: ► A glucose oxidase/gold nanocluster conjugates formed by etching chemistry. ► Integration of the bioactivities and fluorescence properties within a single unit. ► These conjugates serve as novel fluorescent probe for glucose. -- Abstract: Creation and application of noble metal nanoclusters have received continuous attention. By integrating enzyme activity and fluorescence for potential applications, enzyme-capped metal clusters are more desirable. This work demonstrated a glucose oxidase (an enzyme for glucose)-functionalized gold cluster as probe for glucose. Under physiological conditions, such bioconjugate was successfully prepared by an etching reaction, where tetrakis (hydroxylmethyl) phosphonium-protected gold nanoparticle and thioctic acid-modified glucose oxidase were used as precursor and etchant, respectively. These bioconjugates showed unique fluorescence spectra (λ{sub em} {sub max} = 650 nm, λ{sub ex} {sub max} = 507 nm) with an acceptable quantum yield (ca. 7%). Moreover, the conjugated glucose oxidase remained active and catalyzed reaction of glucose and dissolved O{sub 2} to produce H{sub 2}O{sub 2}, which quenched quantitatively the fluorescence of gold clusters and laid a foundation of glucose detection. A linear range of 2.0 × 10{sup −6}–140 × 10{sup −6} M and a detection limit of 0.7 × 10{sup −6} M (S/N = 3) were obtained. Also, another horseradish peroxidase/gold cluster bioconjugate was produced by such general synthesis method. Such enzyme/metal cluster bioconjugates represented a promising class of biosensors for biologically important targets in organelles or cells.
DEFF Research Database (Denmark)
Morthensen, Sofie Thage; Meyer, Anne S.; Jørgensen, Henning
2017-01-01
Membrane separation of xylose and glucose can be accomplished via oxidation of glucose to gluconic acid by enzymatic glucose oxidase catalysis. Oxygen for this reaction can be supplied via decomposition of hydrogen peroxide by enzymatic catalase catalysis. In order to maximize the biocatalytic...... productivity of glucose oxidase and catalase (gluconic acid yield per total amount of enzyme) the following system set-ups were compared: immobilization of glucose oxidase alone; co-immobilization of glucose oxidase and catalase; glucose oxidase and catalase free in the membrane bioreactor. Fouling......-induced enzyme immobilization in the porous support of an ultrafiltration membrane was used as strategy for entrapment of glucose oxidase and catalase. The biocatalytic productivity of the membrane reactor was found to be highly related to the oxygen availability, which in turn depended on the reactor...
Conformational lock and dissociative thermal inactivation of lentil seedling amine oxidase.
Moosavi-Nejad, S Zahra; Moosavi-Movahedi, Ali-Akbar; Rezaei-Tavirani, Mostafa; Floris, Giovanni; Medda, Rosaria
2003-03-31
The kinetics of thermal inactivation of copper-containing amine oxidase from lentil seedlings were studied in a 100 mM potassium phosphate buffer, pH 7, using putrescine as the substrate. The temperature range was between 47-60 degrees C. The thermal inactivation curves were not linear at 52 and 57 degrees C; three linear phases were shown. The first phase gave some information about the number of dimeric forms of the enzyme that were induced by the higher temperatures using the "conformational lock" pertaining theory to oligomeric enzyme. The "conformational lock" caused two additional dimeric forms of the enzyme when the temperature increased to 57 degrees C. The second and third phases were interpreted according to a dissociative thermal inactivation model. These phases showed that lentil amine oxidase was reversibly-dissociated before the irreversible thermal inactivation. Although lentil amine oxidase is not a thermostable enzyme, its dimeric structure can form "conformational lock," conferring a structural tolerance to the enzyme against heat stress.
The glucose oxidase-peroxidase assay for glucose
The glucose oxidase-peroxidase assay for glucose has served as a very specific, sensitive, and repeatable assay for detection of glucose in biological samples. It has been used successfully for analysis of glucose in samples from blood and urine, to analysis of glucose released from starch or glycog...
Kim, Tae Hwan; Kim, Ju Sung; Kim, Zoo Haye; Huang, Ren Bin; Chae, Young Lye; Wang, Ren Sheng
2014-07-10
Khz-cp is a crude polysaccharide extract that is obtained after nuclear fusion in Ganoderma lucidum and Polyporus umbellatus mycelia (Khz). It inhibits the growth of cancer cells. Khz-cp was extracted by solvent extraction. The anti-proliferative activity of Khz-cp was confirmed by using Annexin-V/PI-flow cytometry analysis. Intracellular calcium increase and measurement of intracellular reactive oxygen species (ROS) were performed by using flow cytometry and inverted microscope. SNU-1 cells were treated with p38, Bcl-2 and Nox family siRNA. siRNA transfected cells was employed to investigate the expression of apoptotic, growth and survival genes in SNU-1 cells. Western blot analysis was performed to confirm the expression of the genes. In the present study, Khz-cp induced apoptosis preferentially in transformed cells and had only minimal effects on non-transformed cells. Furthermore, Khz-cp was found to induce apoptosis by increasing the intracellular Ca2+ concentration ([Ca2+]i) and activating P38 to generate reactive oxygen species (ROS) via NADPH oxidase and the mitochondria. Khz-cp-induced apoptosis was caspase dependent and occurred via a mitochondrial pathway. ROS generation by NADPH oxidase was critical for Khz-cp-induced apoptosis, and although mitochondrial ROS production was also required, it appeared to occur secondary to ROS generation by NADPH oxidase. Activation of NADPH oxidase was shown by the translocation of the regulatory subunits p47phox and p67phox to the cell membrane and was necessary for ROS generation by Khz-cp. Khz-cp triggered a rapid and sustained increase in [Ca2+]i that activated P38. P38 was considered to play a key role in the activation of NADPH oxidase because inhibition of its expression or activity abrogated membrane translocation of the p47phox and p67phox subunits and ROS generation. In summary, these data indicate that Khz-cp preferentially induces apoptosis in cancer cells and that the signaling mechanisms involve an
Interrupted reperfusion reduces the activation of NADPH oxidase after cerebral I/R injury.
Shen, Jia; Bai, Xiao-Yin; Qin, Yuan; Jin, Wei-Wei; Zhou, Jing-Yin; Zhou, Ji-Ping; Yan, Ying-Gang; Wang, Qiong; Bruce, Iain C; Chen, Jiang-Hua; Xia, Qiang
2011-06-15
Interrupted reperfusion reduces ischemia/reperfusion (I/R) injury. This study was designed to determine whether NADPH oxidase participates in the neural protection against global I/R injury after interrupted reperfusion. Mice were randomly divided into five groups: sham (sham-operated), I/R (20-min global I/R), RR (I/R+interrupted reperfusion), Apo (I/R+apocynin administration), and RR+Apo. Behavioral tests (pole test, beam walking, and Morris water maze) and Nissl staining were undertaken in all five groups; superoxide levels, expression of gp91(phox) and p47(phox), p47(phox) translocation, and Rac1 activation were measured in the sham, I/R, and RR groups. The motor coordination, bradykinesia, and spatial learning and memory, as well as the neuron survival rates, were better in the RR, Apo, and RR+Apo groups than in the I/R group. The NADPH oxidase-dependent superoxide levels, p47(phox) and gp91(phox) expression, p47(phox) translocation, and Rac1 activation were lower in the RR group than in the I/R group. In conclusion, the neural protective effect of interrupted reperfusion is at least partly mediated by decreasing the expression and assembly of NADPH oxidase and the levels of NADPH oxidase-derived superoxide. The most striking reduction Rac1-GTP in the RR group suggests that interrupted reperfusion also acts on the activation of assembled NADPH oxidase by reducing the availability of Rac1-GTP. Copyright © 2011 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Pospíšilová, H.; Jiskrová, E.; Vojta, P.; Mrízová, K.; Kokáš, F.; Majeská Čudějková, M.; Bergougnoux, V.; Plíhal, O.; Klimešová, J.; Novák, Ondřej; Dzurová, L.; Frébort, I.; Galuszka, P.
2016-01-01
Roč. 33, č. 5 (2016), s. 692-705 ISSN 1871-6784 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : ROOT-GROWTH * OXIDASE/DEHYDROGENASE GENES * BETA-GLUCOSIDASE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.813, year: 2016
Production of recombinant cholesterol oxidase containing covalently bound FAD in Escherichia coli
Directory of Open Access Journals (Sweden)
Molla Gianluca
2010-04-01
Full Text Available Abstract Background Cholesterol oxidase is an alcohol dehydrogenase/oxidase flavoprotein that catalyzes the dehydrogenation of C(3-OH of cholesterol. It has two major biotechnological applications, i.e. in the determination of serum (and food cholesterol levels and as biocatalyst providing valuable intermediates for industrial steroid drug production. Cholesterol oxidases of type I are those containing the FAD cofactor tightly but not covalently bound to the protein moiety, whereas type II members contain covalently bound FAD. This is the first report on the over-expression in Escherichia coli of type II cholesterol oxidase from Brevibacterium sterolicum (BCO. Results Design of the plasmid construct encoding the mature BCO, optimization of medium composition and identification of the best cultivation/induction conditions for growing and expressing the active protein in recombinant E. coli cells, concurred to achieve a valuable improvement: BCO volumetric productivity was increased from ~500 up to ~25000 U/L and its crude extract specific activity from 0.5 up to 7.0 U/mg protein. Interestingly, under optimal expression conditions, nearly 55% of the soluble recombinant BCO is produced as covalently FAD bound form, whereas the protein containing non-covalently bound FAD is preferentially accumulated in insoluble inclusion bodies. Conclusions Comparison of our results with those published on non-covalent (type I COs expressed in recombinant form (either in E. coli or Streptomyces spp., shows that the fully active type II BCO can be produced in E. coli at valuable expression levels. The improved over-production of the FAD-bound cholesterol oxidase will support its development as a novel biotool to be exploited in biotechnological applications.
Tian, Rong; Ding, Yun; Peng, Yi-Yuan; Lu, Naihao
2017-03-11
Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-derived reactive oxygen species (ROS) such as superoxide and hydrogen peroxide (H 2 O 2 ), have emerged as important molecules in the pathogenesis of diabetic endothelial dysfunction. Additionally, neutrophils-derived myeloperoxidase (MPO) and MPO-catalyzed hypochlorous acid (HOCl) play important roles in the vascular injury. However, it is unknown whether MPO can use vascular-derived ROS to induce diabetic endothelial dysfunction. In the present study, we demonstrated that NADPH oxidase was the main source of ROS formation in high glucose-cultured human umbilical vein endothelial cells (HUVECs), and played a critical role in high glucose-induced endothelial dysfunction such as cell apoptosis, loss of cell viability and reduction of nitric oxide (NO). However, the addition of MPO could amplify the high glucose-induced endothelial dysfunction which was inhibited by the presence of apocynin (NADPH oxidase inhibitor), catalase (H 2 O 2 scavenger), or methionine (HOCl scavenger), demonstrating the contribution of NADPH oxidase-H 2 O 2 -MPO-HOCl pathway in the MPO/high glucose-induced vascular injury. In high glucose-incubated rat aortas, MPO also exacerbated the NADPH oxidase-induced impairment of endothelium-dependent relaxation. Consistent with these in vitro data, in diabetic rat aortas, both MPO expresion and NADPH oxidase activity were increased while the endothelial function was simultaneously impaired. The results suggested that vascular-bound MPO could amplify high glucose-induced vascular injury in diabetes. MPO-NADPH oxidase-HOCl may represent an important pathogenic pathway in diabetic vascular diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit
2018-01-01
Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998
Surface reconstitution of glucose oxidase onto a norbornylogous bridge self-assembled monolayer
International Nuclear Information System (INIS)
Liu Jingquan; Paddon-Row, Michael N.; Gooding, J. Justin
2006-01-01
An electrode construct was fabricated in which a self-assembled monolayer containing a novel norbornylogous bridge was covalently attached to flavin adenine dinucleotide (FAD), the redox active centre of several oxidase enzymes. The electrochemistry of the construct was investigated before and after the reconstitution of glucose oxidase around the surface bound FAD. Rapid rates of electron transfer were observed both before and after the reconstitution of biocatalytically active enzyme. However, no biocatalytic activity was observed under anaerobic conditions suggesting the a lack of enzyme turnover through direct electron transfer. It is proposed that a decrease in the electronic coupling between the redox active FAD and the electrode following reconstitution of the glucose oxidase - a probable consequence of the FAD being immersed in a protein environment - was responsible for the inability of the enzyme to be turned over under anaerobic conditions
Genetic defects of cytochrome c oxidase assembly
Czech Academy of Sciences Publication Activity Database
Pecina, Petr; Houšťková, H.; Hansíková, H.; Zeman, J.; Houštěk, Josef
2004-01-01
Roč. 53, Suppl. 1 (2004), s. S213-S223 ISSN 0862-8408 R&D Projects: GA ČR GA303/03/0749 Institutional research plan: CEZ:AV0Z5011922 Keywords : cytochrome c oxidase * mitochondrial disorders Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 1.140, year: 2004
Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase.
Gandara, Ana Caroline Paiva; Torres, André; Bahia, Ana Cristina; Oliveira, Pedro L; Schama, Renata
2017-03-29
NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not been examined. In this study, we analyzed the evolution of this gene family in arthropods. A thorough search of genomes and transcriptomes was performed enabling us to browse most branches of arthropod phylogeny. We have found that the subfamilies NOX5 and DUOX are present in all arthropod groups. We also show that a NOX gene, closely related to NOX4 and previously found only in mosquitoes (NOXm), can also be found in other taxonomic groups, leading us to rename it as NOX4-art. Although the accessory protein p22-phox, essential for NOX1-4 activation, was not found in any of the arthropods studied, NOX4-art of Aedes aegypti encodes an active protein that produces H 2 O 2 . Although NOX4-art has been lost in a number of arthropod lineages, it has all the domains and many signature residues and motifs necessary for ROS production and, when silenced, H 2 O 2 production is considerably diminished in A. aegypti cells. Combining all bioinformatic analyses and laboratory work we have reached interesting conclusions regarding arthropod NOX gene family evolution. NOX5 and DUOX are present in all arthropod lineages but it seems that a NOX2-like gene was lost in the ancestral lineage leading to Ecdysozoa. The NOX4-art gene originated from a NOX4-like ancestor and is functional. Although no p22-phox was observed in arthropods, there was no evidence of neo-functionalization and this gene probably produces H 2 O 2 as in other metazoan NOX4 genes. Although functional and present in the genomes of many
Sridhar, J; Chinna Babu Naik, V; Ghodke, A; Kranthi, S; Kranthi, K R; Singh, B P; Choudhary, J S; Krishna, M S R
2017-11-01
Pink bollworm (PBW), Pectinophora gossypiella is one of the most destructive pest's globally inflicting huge economic losses in cotton even during later stages of crop growth. In the present investigation, the population genetic structure, distribution, and genetic diversity of P. gossypiella in cotton growing zones of India using partial mitochondrial DNA cytochrome oxidase-I (COI) gene was addressed. The overall haplotype (Hd), number of nucleotide differences (K), and nucleotide diversity (π) were 0.3028, 0.327, and 0.00047, respectively which suggest that entire population exhibited low level of genetic diversity. Zone-wise clustering of population revealed that central zone recorded low level of Hd (0.2730) as compared to north (0.3619) and south (0.3028) zones. The most common haplotype (H1) reported in all 19 locations could be proposed as ancestral/original haplotype. This haplotype with one mutational step formed star-like phylogeny connected with 11 other haplotypes. The phylogenetic relationship studies revealed that most haplotypes of populations are closely related to each other. Haplotype 5 was exclusively present in Dharwad (South zone) shared with populations of Hanumangarh and Bathinda (North zone). The result indicated that there is no isolation by distance effect among the Indian populations of PBW. The present study reports a low genetic diversity among PBW populations of India and H1, as ancestral haplotype from which other haplotypes have evolved suggests that the migration and dispersal over long distance and invasiveness are major factors.
Salicylic Acid Regulation of Respiration in Higher Plants: Alternative Oxidase Expression.
Rhoads, DM; McIntosh, L
1992-01-01
Alternative respiratory pathway capacity increases during the development of the thermogenic appendix of a voodoo lily inflorescence. The levels of the alternative oxidase proteins increased dramatically between D-4 (4 days prior to the day of anthesis) and D-3 and continued to increase until the day of anthesis (D-day). The level of salicylic acid (SA) in the appendix is very low early on D-1, but increases to a high level in the evening of D-1. Thermogenesis occurs after a few hours of light on D-day. Therefore, the initial accumulation of the alternative oxidase proteins precedes the increase in SA by 3 days, indicating that other regulators may be involved. A 1.6-kb transcript encoding the alternative oxidase precursor protein accumulated to a high level in the appendix tissue by D-1. Application of SA to immature appendix tissue caused an increase in alternative pathway capacity and a dramatic accumulation of the alternative oxidase proteins and the 1.6-kb transcript. Time course experiments showed that the increase in capacity, protein levels, and transcript level corresponded precisely. The response to SA was blocked by cycloheximide or actinomycin D, indicating that de novo transcription and translation are required. However, nuclear, in vitro transcription assays indicated that the accumulation of the 1.6-kb transcript did not result from a simple increase in the rate of transcription of aox1. PMID:12297672
Zhou, Guangqi; Yin, Jianhua; Chen, Haijiang; Hua, Yijie; Sun, Linlin; Gao, Haichun
2013-09-01
Shewanella species are a group of facultative Gram-negative microorganisms with remarkable respiration abilities that allow the use of a diverse array of terminal electron acceptors (EA). Like most bacteria, S. oneidensis possesses multiple terminal oxidases, including two heme-copper oxidases (caa3- and cbb3-type) and a bd-type quinol oxidase. As aerobic respiration is energetically favored, mechanisms underlying the fact that these microorganisms thrive in redox-stratified environments remain vastly unexplored. In this work, we discovered that the cbb3-type oxidase is the predominant system for respiration of oxygen (O2), especially when O2 is abundant. Under microaerobic conditions, the bd-type quinol oxidase has a significant role in addition to the cbb3-type oxidase. In contrast, multiple lines of evidence suggest that under test conditions the caa3-type oxidase, an analog to the mitochondrial enzyme, has no physiological significance, likely because of its extremely low expression. In addition, expression of both cbb3- and bd-type oxidases is under direct control of Crp (cAMP receptor protein) but not the well-established redox regulator Fnr (fumarate nitrate regulator) of canonical systems typified in Escherichia coli. These data, collectively, suggest that adaptation of S. oneidensis to redox-stratified environments is likely due to functional loss of the caa3-type oxidase and switch of the regulatory system for respiration.
NADPH oxidase 4 attenuates cerebral artery changes during the progression of Marfan syndrome.
Onetti, Yara; Meirelles, Thayna; Dantas, Ana P; Schröder, Katrin; Vila, Elisabet; Egea, Gustavo; Jiménez-Altayó, Francesc
2016-05-01
Marfan syndrome (MFS) is a connective tissue disorder that is often associated with the fibrillin-1 (Fbn1) gene mutation and characterized by cardiovascular alterations, predominantly ascending aortic aneurysms. Although neurovascular complications are uncommon in MFS, the improvement in Marfan patients' life expectancy is revealing other secondary alterations, potentially including neurovascular disorders. However, little is known about small-vessel pathophysiology in MFS. MFS is associated with hyperactivated transforming growth factor (TGF)-β signaling, which among numerous other downstream effectors, induces the NADPH oxidase 4 (Nox4) isoform of NADPH oxidase, a strong enzymatic source of H2O2 We hypothesized that MFS induces middle cerebral artery (MCA) alterations and that Nox4 contributes to them. MCA properties from 3-, 6-, or 9-mo-old Marfan (Fbn1(C1039G/+)) mice were compared with those from age/sex-matched wild-type littermates. At 6 mo, Marfan compared with wild-type mice developed higher MCA wall/lumen (wild-type: 0.081 ± 0.004; Marfan: 0.093 ± 0.002; 60 mmHg; P Marfan mice with Nox4 deficiency (Nox4(-/-)). Strikingly, Nox4 deletion in Marfan mice aggravated MCA wall thickening (cross-sectional area; Marfan: 6,660 ± 363 μm(2); Marfan Nox4(-/-): 8,795 ± 824 μm(2); 60 mmHg; P < 0.05), accompanied by decreased TGF-β expression and increased collagen deposition and Nox1 expression. These findings provide the first evidence that Nox4 mitigates cerebral artery structural changes in a murine model of MFS. Copyright © 2016 the American Physiological Society.
El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M.; El-Ewasy, Sara M.
2016-01-01
Background Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. Results One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis...
Crystallization of carbohydrate oxidase from Microdochium nivale
Czech Academy of Sciences Publication Activity Database
Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Ostergaard, L. H.; Fuglsang, C. C.; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich
2009-01-01
Roč. 65, č. 6 (2009), s. 638-640 ISSN 1744-3091 R&D Projects: GA AV ČR IAA500500701; GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : carbohydrate oxidase * crystallization * data processing Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.551, year: 2009
Ratiometric glucose sensing based on fluorescent oxygen films and glucose oxidase
Fengyu Su; Liqiang Zhang; Xiangxing Kong; Fred Lee; Yanqing Tian; Deirdre R. Meldrum
2017-01-01
A new two-layer sensor film was constructed for sensing glucose based on glucose oxidase and oxygen sensing material. The first layer of film containing the oxygen sensor and intra-reference material was polymerized, then the second layer of glucose oxidase and glutaraldehyde was formed on the oxygen sensor layer. The two-layer sensor film has a resolution up to 0.05 mM and a detection range from 0 to 5 mM to glucose. The effects of pH and temperature on the sensing performance were systemati...
International Nuclear Information System (INIS)
Woods, Courtney G.; Kosyk, Oksana; Bradford, Blair U.; Ross, Pamela K.; Burns, Amanda M.; Cunningham, Michael L.; Qu Pingping; Ibrahim, Joseph G.; Rusyn, Ivan
2007-01-01
Administration of peroxisome proliferators to rodents causes proliferation of peroxisomes, induction of β-oxidation enzymes, hepatocellular hypertrophy and hyperplasia, with chronic exposure ultimately leading to hepatocellular carcinomas. Many responses associated with peroxisome proliferators are nuclear receptor-mediated events involving peroxisome proliferators-activated receptor alpha (PPARα). A role for nuclear receptor-independent events has also been shown, with evidence of Kupffer cell-mediated free radical production, presumably through NAPDH oxidase, induction of redox-sensitive transcription factors involved in cytokine production and cytokine-mediated cell replication following acute treatment with peroxisome proliferators in rodents. Recent studies have demonstrated, by using p47 phox -null mice which are deficient in NADPH oxidase, that this enzyme is not related to the phenotypic events caused by prolonged administration of peroxisome proliferators. In an effort to determine the timing of the transition from Kupffer cell-to PPARα-dependent modulation of peroxisome proliferator effects, gene expression was assessed in liver from Pparα-null, p47 phox -null and corresponding wild-type mice following treatment with 4-chloro-6-(2,3-xylidino)-pyrimidynylthioacetic acid (WY-14,643) for 8 h, 24 h, 72 h, 1 week or 4 weeks. WY-14,643-induced gene expression in p47 phox -null mouse liver differed substantially from wild-type mice at acute doses and striking differences in baseline expression of immune related genes were evident. Pathway mapping of genes that respond to WY-14,643 in a time- and dose-dependent manner demonstrates suppression of immune response, cell death and signal transduction and promotion of lipid metabolism, cell cycle and DNA repair. Furthermore, these pathways were largely dependent on PPARα, not NADPH oxidase demonstrating a temporal shift in response to peroxisome proliferators. Overall, this study shows that NADPH oxidase
Pickl, Mathias; Swoboda, Alexander; Romero, Elvira; Winkler, Christoph; Binda, Claudia; Mattevi, Andrea; Faber, Kurt; Fraaije, Marco
2018-01-01
Various flavoprotein oxidases were recently shown to oxidize prim-thiols. Here we extend this reactivity towards sec-thiols via structure-guided engineering of 5-(hydroxymethyl)furfural oxidase (HMFO). The variants obtained were employed for the oxidative kinetic resolution of rac-sec-thiols
Baker, J L; Derr, A M; Karuppaiah, K; MacGilvray, M E; Kajfasz, J K; Faustoferri, R C; Rivera-Ramos, I; Bitoun, J P; Lemos, J A; Wen, Z T; Quivey, R G
2014-06-01
NADH oxidase (Nox, encoded by nox) is a flavin-containing enzyme used by the oral pathogen Streptococcus mutans to reduce diatomic oxygen to water while oxidizing NADH to NAD(+). The critical nature of Nox is 2-fold: it serves to regenerate NAD(+), a carbon cycle metabolite, and to reduce intracellular oxygen, preventing formation of destructive reactive oxygen species (ROS). As oxygen and NAD(+) have been shown to modulate the activity of the global transcription factors Spx and Rex, respectively, Nox is potentially poised at a critical junction of two stress regulons. In this study, microarray data showed that either addition of oxygen or loss of nox resulted in altered expression of genes involved in energy metabolism and transport and the upregulation of genes encoding ROS-metabolizing enzymes. Loss of nox also resulted in upregulation of several genes encoding transcription factors and signaling molecules, including the redox-sensing regulator gene rex. Characterization of the nox promoter revealed that nox was regulated by oxygen, through SpxA, and by Rex. These data suggest a regulatory loop in which the roles of nox in reduction of oxygen and regeneration of NAD(+) affect the activity levels of Spx and Rex, respectively, and their regulons, which control several genes, including nox, crucial to growth of S. mutans under conditions of oxidative stress. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Vanlerberghe, G C; McIntosh, L
1992-09-01
Suspension cells of NT1 tobacco (Nicotiana tabacum L. cv bright yellow) have been used to study the effect of growth temperature on the CN-resistant, salicylhydroxamic acid-sensitive alternative pathway of respiration. Mitochondria isolated from cells maintained at 30 degrees C had a low capacity to oxidize succinate via the alternative pathway, whereas mitochondria isolated from cells 24 h after transfer to 18 degrees C displayed, on average, a 5-fold increase in this capacity (from 7 to 32 nanoatoms oxygen per milligram protein per minute). This represented an increase in alternative pathway capacity from 18 to 45% of the total capacity of electron transport. This increased capacity was lost upon transfer of cells back to 30 degrees C. A monoclonal antibody to the terminal oxidase of the alternative pathway (the alternative oxidase) from Sauromatum guttatum (T.E. Elthon, R.L. Nickels, L. McIntosh [1989] Plant Physiology 89: 1311-1317) recognized a 35-kilodalton mitochondrial protein in tobacco. There was an excellent correlation between the capacity of the alternative path in isolated tobacco mitochondria and the levels of this 35-kilodalton alternative oxidase protein. Cycloheximide could inhibit both the increased level of the 35-kilodalton alternative oxidase protein and the increased alternative pathway capacity normally seen upon transfer to 18 degrees C. We conclude that transfer of tobacco cells to the lower temperature increases the capacity of the alternative pathway due, at least in part, to de novo synthesis of the 35-kilodalton alternative oxidase protein.
Layer-by-Layer Assembly of Glucose Oxidase on Carbon Nanotube Modified Electrodes.
Suroviec, Alice H
2017-01-01
The use of enzymatically modified electrodes for the detection of glucose or other non-electrochemically active analytes is becoming increasingly common. Direct heterogeneous electron transfer to glucose oxidase has been shown to be kinetically difficult, which is why electron transfer mediators or indirect detection is usually used for monitoring glucose with electrochemical sensors. It has been found, however, that electrodes modified with single or multi-walled carbon nanotubes (CNTs) demonstrate fast heterogeneous electron transfer kinetics as compared to that found for traditional electrodes. Incorporating CNTs into the assembly of electrochemical glucose sensors, therefore, affords the possibility of facile electron transfer to glucose oxidase, and a more direct determination of glucose. This chapter describes the methods used to use CNTs in a layer-by-layer structure along with glucose oxidase to produce an enzymatically modified electrode with high turnover rates, increased stability and shelf-life.
Optimization of cholesterol oxidase production by Brevibacterium sp ...
African Journals Online (AJOL)
An ultrasound-assisted emulsification as a pretreatment for cholesterol oxidase production by submerge fermentation using Brevibacterium sp. in a batch system was studied. Medium improvement for the production employing response surface methodology (RSM) was optimized in this paper. The concentration of ...
Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity
International Nuclear Information System (INIS)
Guo, Leilei; Huang, Kaixun; Liu, Hongmei
2016-01-01
Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na 2 SeO 3 as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3′,5,5′-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant (K m ) values and maximal reaction velocity (V max ) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.
Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity
Guo, Leilei; Huang, Kaixun; Liu, Hongmei
2016-03-01
Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na2SeO3 as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant ( K m) values and maximal reaction velocity ( V max) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.
Hydroxychavicol: a potent xanthine oxidase inhibitor obtained from the leaves of betel, Piper betle.
Murata, Kazuya; Nakao, Kikuyo; Hirata, Noriko; Namba, Kensuke; Nomi, Takao; Kitamura, Yoshihisa; Moriyama, Kenzo; Shintani, Takahiro; Iinuma, Munekazu; Matsuda, Hideaki
2009-07-01
The screening of Piperaceous plants for xanthine oxidase inhibitory activity revealed that the extract of the leaves of Piper betle possesses potent activity. Activity-guided purification led us to obtain hydroxychavicol as an active principle. Hydroxychavicol is a more potent xanthine oxidase inhibitor than allopurinol, which is clinically used for the treatment of hyperuricemia.
Directory of Open Access Journals (Sweden)
Julia Leclerc
Full Text Available Porphyromonas gingivalis is an etiologic agent of periodontal disease in humans. The disease is associated with the formation of a mixed oral biofilm which is exposed to oxygen and environmental stress, such as oxidative stress. To investigate possible roles for cytochrome bd oxidase in the growth and persistence of this anaerobic bacterium inside the oral biofilm, mutant strains deficient in cytochrome bd oxidase activity were characterized. This study demonstrated that the cytochrome bd oxidase of Porphyromonas gingivalis, encoded by cydAB, was able to catalyse O2 consumption and was involved in peroxide and superoxide resistance, and dioxygen tolerance.
Antioxidant Activity of Some Plant Extracts Towards Xanthine Oxidase, Lipoxygenase and Tyrosinase
Directory of Open Access Journals (Sweden)
Pi-Yu Chen
2009-08-01
Full Text Available Natural products have the potential to be developed into new drugs for the treatment of various diseases. The aim of the present study was to screen the antioxidant activities of some common edible fruits, garden plants and medicinal plants indigenous to Taiwan. This was performed by assessing the activities of lipoxygenase, xanthine oxidase and tyrosinase following incubation with extracts from these plants. A further aim was to use HPLC-DAD and tyrosinase to chromatographically identify the antioxidative constituents obtained from an extract exhibiting strong antioxidative properties. The acetone extracts of 27 cultivated plant species from Taiwan were tested for antioxidant activities towards xanthine oxidase, tyrosinase and lipoxygenase using spectrophotometric assays. Koelreuteria henryi, Prunus campanulata, and Rhodiola rosea showed the highest xanthine oxidase inhibitory activities. Camellia sinensis, Rhodiola rosea, and Koelreuteria henryi exhibited good tyrosinase inhibitory activities and potent anti-lipoxygenase activities. As Koelreuteria henryi had notable significant inhibitory activities towards xanthine oxidase, tyrosinase, and lipoxygenase, it was further tested with tyrosinase and HPLC-DAD. The results from this part of the study revealed that the more powerful the antioxidant capability of the extracted component, the greater the decrease in peak height obtained after reacting with tyrosinase. Additional studies are warranted to further characterize the compounds responsible for the antioxidant properties of the examined extracts.
Crystallization and preliminary X-ray analysis of Aspergillus oryzae catechol oxidase
International Nuclear Information System (INIS)
Kaljunen, Heidi; Gasparetti, Chiara; Kruus, Kristiina; Rouvinen, Juha; Hakulinen, Nina
2011-01-01
Catechol oxidase from A. oryzae was crystallized by the hanging-drop vapour-diffusion method. Catechol oxidase is an enzyme that catalyzes the oxidation of o-diphenols to the corresponding o-quinones. It is a copper-containing enzyme with a binuclear copper active site. Here, the crystallization and multiple-wavelength anomalous dispersion data collection of catechol oxidase from the mould fungus Aspergillus oryzae are described. During the purification, three forms of the enzyme (39.3, 40.5 and 44.3 kDa) were obtained. A mixture of these three forms was initially crystallized and gave crystals that diffracted to 2.5 Å resolution and belonged to space group P3 2 21, with unit-cell parameters a = b = 118.9, c = 84.5 Å, α = β = 90, γ = 120°. A preparation containing only the shorter form (39.3 kDa) produced crystals that diffracted to 2.9 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 51.8, b = 95.3, c = 139.5 Å, α = β = γ = 90°
Directory of Open Access Journals (Sweden)
Simon Auer
2017-05-01
Full Text Available NADPH oxidases of human cells are not only functional in defense against invading microorganisms and for oxidative reactions needed for specialized biosynthetic pathways but also during the past few years have been established as signaling modules. It has been shown that human Nox4 is expressed in most somatic cell types and produces hydrogen peroxide, which signals to remodel the actin cytoskeleton. This correlates well with the function of Yno1, the only NADPH oxidase of yeast cells. Using two established tumor cell lines, which are derived from hepatic and neuroblastoma tumors, respectively, we are showing here that in both tumor models Nox4 is expressed in the ER (like the yeast NADPH oxidase, where according to published literature, it produces hydrogen peroxide. Reducing this biochemical activity by downregulating Nox4 transcription leads to loss of F-actin stress fibers. This phenotype is reversible by adding hydrogen peroxide to the cells. The effect of the Nox4 silencer RNA is specific for this gene as it does not influence the expression of Nox2. In the case of the SH-SY5Y neuronal cell line, Nox4 inhibition leads to loss of cell mobility as measured in scratch assays. We propose that inhibition of Nox4 (which is known to be strongly expressed in many tumors could be studied as a new target for cancer treatment, in particular for inhibition of metastasis.
Functional analysis of fructosyl-amino acid oxidases of Aspergillus oryzae.
Akazawa, Shin-Ichi; Karino, Tetsuya; Yoshida, Nobuyuki; Katsuragi, Tohoru; Tani, Yoshiki
2004-10-01
Three active fractions of fructosyl-amino acid oxidase (FAOD-Ao1, -Ao2a, and -Ao2b) were isolated from Aspergillus oryzae strain RIB40. N-terminal and internal amino acid sequences of FAOD-Ao2a corresponded to those of FAOD-Ao2b, suggesting that these two isozymes were derived from the same protein. FAOD-Ao1 and -Ao2 were different in substrate specificity and subunit assembly; FAOD-Ao2 was active toward N(epsilon)-fructosyl N(alpha)-Z-lysine and fructosyl valine (Fru-Val), whereas FAOD-Ao1 was not active toward Fru-Val. The genes encoding the FAOD isozymes (i.e., FAOAo1 and FAOAo2) were cloned by PCR with an FAOD-specific primer set. The deduced amino acid sequences revealed that FAOD-Ao1 was 50% identical to FAOD-Ao2, and each isozyme had a peroxisome-targeting signal-1, indicating their localization in peroxisomes. The genes was expressed in Escherichia coli and rFaoAo2 showed the same characteristics as FAOD-Ao2, whereas rFaoAo1 was not active. FAOAo2 disruptant was obtained by using ptrA as a selective marker. Wild-type strain grew on the medium containing Fru-Val as the sole carbon and nitrogen sources, but strain Delta faoAo2 did not grow. Addition of glucose or (NH(4))(2)SO(4) to the Fru-Val medium did not affect the assimilation of Fru-Val by wild-type, indicating glucose and ammonium repressions did not occur in the expression of the FAOAo2 gene. Furthermore, conidia of the wild-type strain did not germinate on the medium containing Fru-Val and NaNO(2) as the sole carbon and nitrogen sources, respectively, suggesting that Fru-Val may also repress gene expression of nitrite reductase. These results indicated that FAOD is needed for utilization of fructosyl-amino acids as nitrogen sources in A. oryzae.
Effects of glucose oxidase on the growth performance, serum ...
African Journals Online (AJOL)
Martina
2016-02-06
Feb 6, 2016 ... The experiment was conducted to investigate the effects of diets supplemented with ... Keywords: Glucose oxidase, intestinal health, performance, swine ..... This work was supported by the National High-Tech Research and ...
In vitro oxidation of indoleacetic acid by soluble auxin-oxidases and peroxidases from maize roots
International Nuclear Information System (INIS)
Beffa, R.; Martin, H.V.; Pilet, P.E.
1990-01-01
Soluble auxin-oxidases were extracted from Zea mays L. cv LG11 apical root segments and partially separated from peroxidases (EC 1.11.1.7) by size-exclusion chromatography. Auxin-oxidases were resolved into one main peak corresponding to a molecular mass of 32.5 kilodaltons and a minor peak at 54.5 kilodaltons. Peroxidases were separated into at least four peaks, with molecular masses from 32.5 to 78 kilodaltons. In vitro activity of indoleacetic acid-oxidases was dependent on the presence of MnCl 2 and p-coumaric acid. Compound(s) present in the crude extract and several synthetic auxin transport inhibitors (including 2,3,5-triiodobenzoic acid and N-1-naphthylphthalamic acid) inhibited auxin-oxidase activity, but had no effect on peroxidases. The products resulting from the in vitro enzymatic oxidation of [ 3 H]indoleacetic acid were separated by HPLC and the major metabolite was found to cochromatograph with indol-3yl-methanol
International Nuclear Information System (INIS)
Heibashy, M.I.A.; El-Nahla, A.M.; Ibrahim, A.I.; Saleh, Sh.Y.A.
2010-01-01
This study was conducted to show whether DMSO, allopurinol and urate oxidase could offer ameliorating effects against abnormal alterations in kidney function tests in gentamicin (GM) induced nephrotoxic rats . Two experiments were carried out, the first one showed that daily injection of 80 mg GM/kg b. wt interapertonealy (I.P) for two weeks induced acute renal failure indicated by significant elevation in serum urea, creatinine, uric acid, potassium, inorganic phosphorus, TBARS and PTH and a significant decline in serum sodium, total and ionized calcium when compared with their corresponding values in saline injected rats. In the second experiment, comparisons were made between GM induced nephrotoxic rats and other nephrotoxic groups received daily pf I.P injection of DMSO (4 ml/kg b.wt), allopurinol (1.5 mg/100 g b.wt) and urate oxidase (10 mg/100 g b.wt) for 30 days after the incidence of nephrotoxicity. At all intervals, 10,20 and 30 days; serum urea, creatinine, uric acid, potassium, inorganic phosphorus, TBARS and PTH in DMSO, allopurinol and urate oxidase treated groups exhibited significant reduction than nephrotoxic untreated rats. During the same intervals, the levels of serum total and ionized calcium showed an opposite trend. serum sodium level did not show any significant difference between all treated groups except after 20 days , it was increased significantly in urate oxidase treated group and after 30 days in both allopurinol and urate oxidase treated groups. in term time intervals, a significant correction was recorded on the level of most measured parameters. in nephritic rats, the administration of DMSO, allopurinol or urate oxidase led to a significant amelioration effects in the kidney function tests and urate oxidase was the best protective.
Borsa, Philippe; Durand, Jean-Dominique; Shen, Kang-Ning; Arlyza, Irma S; Solihin, Dedy D; Berrebi, Patrick
2013-02-01
It has been previously established that the Leopard Whipray, Himantura leoparda, consists of two genetically isolated, cryptic species, provisionally designated as 'Cluster 1' and 'Cluster 4' (Arlyza et al., Mol. Phylogenet. Evol. 65 (2013) [1]). Here, we show that the two cryptic species differ by the spotting patterns on the dorsal surface of adults: Cluster-4 individuals tend to have larger-ocellated spots, which also more often have a continuous contour than Cluster-1 individuals. We show that H. leoparda's holotype has the typical larger-ocellated spot pattern, designating Cluster 4 as the actual H. leoparda. The other species (Cluster 1) is described as Himantura tutul sp. nov. on the basis of the nucleotide sequence of a 655-base pair fragment of its cytochrome-oxidase I gene (GenBank accession No. JX263335). Nucleotide synapomorphies at this locus clearly distinguish H. tutul sp. nov. from all three other valid species in the H. uarnak species complex, namely H. leoparda, H. uarnak, and H. undulata. H. tutul sp. nov. has a wide distribution in the Indo-West Pacific, from the shores of eastern Africa to the Indo-Malay archipelago. H. leoparda under its new definition has a similarly wide Indo-West Pacific distribution. Copyright © 2013 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Tom A. Ewing
2018-01-01
Full Text Available Vanillyl alcohol oxidase (VAO and eugenol oxidase (EUGO are flavin-dependent enzymes that catalyse the oxidation of para-substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para-phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol and a EUGO variant (V436I with increased activity towards chavicol (4-allylphenol and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para-phenol oxidases, facilitating the enzyme engineering of known para-phenol oxidases and the evaluation of the substrate specificity of novel para-phenol oxidases.
Ewing, Tom A; van Noord, Aster; Paul, Caroline E; van Berkel, Willem J H
2018-01-14
Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes that catalyse the oxidation of para -substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para -phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para -phenol oxidases, facilitating the enzyme engineering of known para- phenol oxidases and the evaluation of the substrate specificity of novel para -phenol oxidases.
Cytochrome oxidase as an indicator of ice storage and frozen storage
DEFF Research Database (Denmark)
Godiksen, Helene; Jessen, Flemming
2001-01-01
in different cods was 21%, and the coefficient of variation of different analyses on the same homogenate was 5%. It was shown that ice storage of muscle samples before they were frozen and thawed resulted in a major freezing-induced activation of cytochrome oxidase activity. The enzyme may therefore be used...... as an indicator of frozen fish to determine if the fish has been stored on ice before freezing. Cytochrome oxidase activity showed also potential as an indicator of frozen storage, as it was possible to distinguish between the frozen storage temperatures -9, -20, and -40 degreesC....
Dual inhibitors of cholinesterases and monoamine oxidases for Alzheimer's disease.
Knez, Damijan; Sova, Matej; Košak, Urban; Gobec, Stanislav
2017-05-01
Accumulating evidence indicates a solid relationship between several enzymes and Alzheimer's disease. Cholinesterases and monoamine oxidases are closely associated with the disease symptomatology and progression and have been tackled simultaneously using several multifunctional ligands. This design strategy offers great chances to alter the course of Alzheimer's disease, in addition to alleviation of the symptoms. More than 15 years of research has led to the identification of various dual cholinesterase/monoamine oxidase inhibitors, while some showing positive outcomes in clinical trials, thus giving rise to additional research efforts in the field. The aim of this review is to provide an update on the novel dual inhibitors identified recently and to shed light on their therapeutic potential.
Czech Academy of Sciences Publication Activity Database
Shleev, S.; Andoralov, V.; Falk, M.; Reimann, C. T.; Ruzgas, T.; Srnec, Martin; Ryde, U.; Rulíšek, Lubomír
2012-01-01
Roč. 24, č. 7 (2012), s. 1524-1540 ISSN 1040-0397 Grant - others:7th Framework Program(XE) NMP4-SL-2009-229255 Institutional research plan: CEZ:AV0Z40550506 Keywords : bilirubin oxidase * intramolecular electron transfer * rate-limiting catalytic step * reorganization energy * QM/MM calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.817, year: 2012
Lenobel, R; Sebela, M; Frébort, I
2005-01-01
The amino acid sequence of methylamine oxidase (MeAO) from the fungus Aspergillus niger was analyzed using mass spectrometry (MS). First, MeAO was characterized by an accurate molar mass of 72.4 kDa of the monomer measured using MALDI-TOF-MS and by a pI value of 5.8 determined by isoelectric focusing. MALDI-TOF-MS revealed a clear peptide mass fingerprint after tryptic digestion, which did not provide any relevant hit when searched against a nonredundant protein database and was different from that of A. niger amine oxidase AO-I. Tandem mass spectrometry with electrospray ionization coupled to liquid chromatography allowed unambiguous reading of six peptide sequences (11-19 amino acids) and seven sequence tags (4-15 amino acids), which were used for MS BLAST homology searching. MeAO was found to be largely homologous to a hypothetical protein AN7641.2 (EMBL/GenBank protein-accession code EAA61827) from Aspergillus nidulans FGSC A4 with a theoretical molar mass of 76.46 kDa and pI 6.14, which belongs to the superfamily of copper amine oxidases. The protein AN7641.2 is only little homologous to the amine oxidase AO-I (32% identity, 49 % similarity).
Monoamine oxidase inhibitors from Gentiana lutea.
Haraguchi, Hiroyuki; Tanaka, Yasumasa; Kabbash, Amal; Fujioka, Toshihiro; Ishizu, Takashi; Yagi, Akira
2004-08-01
Three monoamine oxidase (MAO) inhibitors were isolated from Gentiana lutea. Their structures were elucidated to be 3-3''linked-(2'-hydroxy-4-O-isoprenylchalcone)-(2'''-hydroxy-4''-O-isoprenyldihydrochalcone) (1), 2-methoxy-3-(1,1'-dimethylallyl)-6a,10a-dihydrobenzo(1,2-c)chroman-6-one and 5-hydroxyflavanone. These compounds, and the hydrolysis product of 1, displayed competitive inhibitory properties against MAO-B which was more effective than MAO-A.
Oxidase catalysis via aerobically generated hypervalent iodine intermediates
Maity, Asim; Hyun, Sung-Min; Powers, David C.
2018-02-01
The development of sustainable oxidation chemistry demands strategies to harness O2 as a terminal oxidant. Oxidase catalysis, in which O2 serves as a chemical oxidant without necessitating incorporation of oxygen into reaction products, would allow diverse substrate functionalization chemistry to be coupled to O2 reduction. Direct O2 utilization suffers from intrinsic challenges imposed by the triplet ground state of O2 and the disparate electron inventories of four-electron O2 reduction and two-electron substrate oxidation. Here, we generate hypervalent iodine reagents—a broadly useful class of selective two-electron oxidants—from O2. This is achieved by intercepting reactive intermediates of aldehyde autoxidation to aerobically generate hypervalent iodine reagents for a broad array of substrate oxidation reactions. The use of aryl iodides as mediators of aerobic oxidation underpins an oxidase catalysis platform that couples substrate oxidation directly to O2 reduction. We anticipate that aerobically generated hypervalent iodine reagents will expand the scope of aerobic oxidation chemistry in chemical synthesis.
Ultra-high-throughput screening method for the directed evolution of glucose oxidase.
Ostafe, Raluca; Prodanovic, Radivoje; Nazor, Jovana; Fischer, Rainer
2014-03-20
Glucose oxidase (GOx) is used in many industrial processes that could benefit from improved versions of the enzyme. Some improvements like higher activity under physiological conditions and thermal stability could be useful for GOx applications in biosensors and biofuel cells. Directed evolution is one of the currently available methods to engineer improved GOx variants. Here, we describe an ultra-high-throughput screening system for sorting the best enzyme variants generated by directed evolution that incorporates several methodological refinements: flow cytometry, in vitro compartmentalization, yeast surface display, fluorescent labeling of the expressed enzyme, delivery of glucose substrate to the reaction mixture through the oil phase, and covalent labeling of the cells with fluorescein-tyramide. The method enables quantitative screening of gene libraries to identify clones with improved activity and it also allows cells to be selected based not only on the overall activity but also on the specific activity of the enzyme. Copyright © 2014 Elsevier Ltd. All rights reserved.
Jeong, Eunjoo; Houn, Thavrak; Kuk, Yongin; Kim, Eun-Seon; Chandru, Hema Kumar; Baik, Myunggi; Back, Kyoungwhan; Guh, Ja-Ock; Han, Oksoo
2003-10-01
In an effort to asses the effect of Val311Met point mutation of Bacillus subtilis protoporphyrinogen oxidase on the resistance to diphenyl ether herbicides, a Val311Met point mutant of B. subtilis protoporphyrinogen oxidase was prepared, heterologously expressed in Escherichia coli, and the purified recombinant Val311Met mutant protoporphyrinogen oxidase was kinetically characterized. The mutant protoporphyrinogen oxidase showed very similar kinetic patterns to wild type protoporphyrinogen oxidase, with slightly decreased activity dependent on pH and the concentrations of NaCl, Tween 20, and imidazole. When oxyfluorfen was used as a competitive inhibitor, the Val311Met mutant protoporphyrinogen oxidase showed an increased inhibition constant about 1.5 times that of wild type protoporphyrinogen oxidase. The marginal increase of the inhibition constant indicates that the Val311Met point mutation in B. subtilis protoporphyrinogen oxidase may not be an important determinant in the mechanism that protects protoporphyrinogen oxidase against diphenyl ether herbicides.
International Nuclear Information System (INIS)
Obame, C. E. L.; Savadogo, P. W.; Mamoudou, D. H.; Dembele, R. H.; Traore, A. S.
2009-01-01
The biodegradation of the phenolic compounds is performed using oxidative enzymes, e. g. polyphenol oxidases (PPOs) and peroxidases (POXs). These oxidases displaying a wide spectrum for the oxidation of phenolic compounds were isolated either from sorghum or mixed bacteria. Spectrophotometric methods were used to assess the monophenolase and diphenolase activities of PPOs as well as the hydrogen-dependant oxidation of POXs. (Author)
Energy Technology Data Exchange (ETDEWEB)
Obame, C. E. L.; Savadogo, P. W.; Mamoudou, D. H.; Dembele, R. H.; Traore, A. S.
2009-07-01
The biodegradation of the phenolic compounds is performed using oxidative enzymes, e. g. polyphenol oxidases (PPOs) and peroxidases (POXs). These oxidases displaying a wide spectrum for the oxidation of phenolic compounds were isolated either from sorghum or mixed bacteria. Spectrophotometric methods were used to assess the monophenolase and diphenolase activities of PPOs as well as the hydrogen-dependant oxidation of POXs. (Author)
Directory of Open Access Journals (Sweden)
Sabina Nasti
2006-01-01
Full Text Available Background: specific polymorphisms of genes regulating intracellular redox balance and oxidative stress are related to atherogenesis. Some studies have identified a relationship between progression of atherosclerosis and C242T mutation in CYBA gene coding for p22phox, a subunit of the NADH/NADPH oxidase system.
International Nuclear Information System (INIS)
Yu Ye; Cao Jin; Su Zongxian; Chen Zixiong
1990-01-01
The paper deals with the preparation of immobilized glucose oxidase membrane by using two steps irradiation (irradiation gratfting, irradiation entrapping). Some properties of membrane were discussed. The immobilized glucose oxidase membrane with oxygen electrode and oxygen analyser can be satisfied with the clinic analysis for the determination of serum glucose
Li, Bao; Tian, Jing; Sun, Yi; Xu, Tao-Rui; Chi, Rui-Fang; Zhang, Xiao-Li; Hu, Xin-Ling; Zhang, Yue-An; Qin, Fu-Zhong; Zhang, Wei-Fang
2015-05-01
Nicotinamide adenine dinucleotide 3-phosphate (NADPH) oxidase activity and endoplasmic reticulum (ER) stress are increased after myocardial infarction (MI). In this study, we proposed to test whether activation of the NADPH oxidase in the remote non-infarcted myocardium mediates ER stress and left ventricular (LV) remodeling after MI. Rabbits with MI or sham operation were randomly assigned to orally receive an NADPH oxidase inhibitor apocynin or placebo for 30 days. The agents were administered beginning at 1 week after surgery. MI rabbits exhibited decreases in LV fractional shortening, LV ejection fraction and the first derivative of the LV pressure rise, which were abolished by apocynin treatment. NADPH oxidase Nox2 protein and mRNA expressions were increased in the remote non-infarcted myocardium after MI. Immunolabeling further revealed that Nox2 was increased in cardiac myocytes in the remote myocardium. The apocynin treatment prevented increases in the Nox2 expression, NADPH oxidase activity, oxidative stress, myocyte apoptosis and GRP78, CHOP and cleaved caspase 12 protein expression in the remote myocardium. The apocynin treatment also attenuated increases in myocyte diameter and cardiac fibrosis. In cultured H9C2 cardiomyocytes exposed to angiotensin II, an important stimulus for post-MI remodeling, Nox2 knockdown with siRNA significantly inhibited angiotensin II-induced NADPH oxidase activation, reactive oxygen species and GRP78 and CHOP protein expression. We conclude that NADPH oxidase inhibition attenuates increased ER stress in the remote non-infarcted myocardium and LV remodeling late after MI in rabbits. These findings suggest that the activation of NADPH oxidase in the remote non-infarcted myocardium mediates increased ER stress, contributing to myocyte apoptosis and LV remodeling after MI. Copyright © 2015 Elsevier B.V. All rights reserved.
Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity
Energy Technology Data Exchange (ETDEWEB)
Guo, Leilei; Huang, Kaixun; Liu, Hongmei, E-mail: hmliu2004@126.com [Huazhong University of Science and Technology, School of Chemistry and Chemical Engineering (China)
2016-03-15
Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na{sub 2}SeO{sub 3} as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3′,5,5′-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant (K{sub m}) values and maximal reaction velocity (V{sub max}) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.
International Nuclear Information System (INIS)
Haq, I.; Nawaz, A.; Mukhtar, A.N.H.; Mansoor, H.M.Z.; Ameer, S.M.
2014-01-01
The study deals with the improvement of wild strain Aspergillus niger IIB-31 through random mutagenesis using chemical mutagens. The main aim of the work was to enhance the glucose oxidase (GOX) yield of wild strain (24.57+-0.01 U/g of cell mass) through random mutagenesis and process optimization. The wild strain of Aspergillus niger IIB-31 was treated with chemical mutagens such as Ethyl methane sulphonate (EMS) and nitrous acid for this purpose. Mutagen treated 98 variants indicating the positive results were picked and screened for the glucose oxidase production using submerged fermentation. EMS treated E45 mutant strain gave the highest glucose oxidase production (69.47 + 0.01 U/g of cell mass), which was approximately 3-folds greater than the wild strain IIB-31. The preliminary cultural conditions for the production of glucose oxidase using submerged fermentation from strain E45 were also optimized. The highest yield of GOD was obtained using 8% glucose as carbon and 0.3% peptone as nitrogen source at a medium pH of 7.0 after an incubation period of 72 hrs at 30 degree. (author)
Mori, Masayuki; Li, Guixin; Hashimoto, Maiko; Nishio, Ayako; Tomozawa, Hiroshi; Suzuki, Nobuyoshi; Usami, Shin-ichi; Higuchi, Keiichi; Matsumoto, Kiyoshi
2009-09-01
MES is a rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. Herein, we report that eosinophilia in MES rats is caused by a loss-of-function mutation in the gene for cytochrome b(-245), alpha polypeptide (Cyba; also known as p22(phox)), which is an essential component of the superoxide-generating NADPH oxidase complex. The MES rat has a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene. As a consequence of the deletion, a 51-nucleotide sequence of intron 4 is incorporated into the Cyba transcripts. Leukocytes from the MES strain lack both CYBA protein and NADPH oxidase activity. Nevertheless, unlike patients with chronic granulomatous disease, who suffer from infections with pathogens due to similar genetic defects in NADPH oxidase, MES rats retain normal innate immune defense against Staphylococcus aureus infection. This is due to large quantities of peritoneal eosinophils in MES rats, which phagocytose and kill the bacteria. MES rat has a balance defect due to impaired formation of otoconia in the utricles and saccules. Eosinophilia of the MES rat was normalized by introduction of a normal Cyba transgene. The mechanisms by which impairment of NADPH oxidase leads to eosinophilia in the MES rat are elusive. However, our study highlights the essential role of NADPH oxidase in homeostatic regulation of innate immunity beyond conventional microbicidial functions.
van Kuilenburg, A. B.; Gorren, A. C.; Dekker, H. L.; Nieboer, P.; van Gelder, B. F.; Muijsers, A. O.
1992-01-01
Human cytochrome c oxidase was purified in a fully active form from heart and skeletal muscle. The enzyme was selectively solubilised with octylglucoside and KCl from submitochondrial particles followed by ammonium sulphate fractionation. The presteady-state and steady-state kinetic properties of
Vanlerberghe, Greg C.; McIntosh, Lee
1992-01-01
Suspension cells of NT1 tobacco (Nicotiana tabacum L. cv bright yellow) have been used to study the effect of growth temperature on the CN-resistant, salicylhydroxamic acid-sensitive alternative pathway of respiration. Mitochondria isolated from cells maintained at 30°C had a low capacity to oxidize succinate via the alternative pathway, whereas mitochondria isolated from cells 24 h after transfer to 18°C displayed, on average, a 5-fold increase in this capacity (from 7 to 32 nanoatoms oxygen per milligram protein per minute). This represented an increase in alternative pathway capacity from 18 to 45% of the total capacity of electron transport. This increased capacity was lost upon transfer of cells back to 30°C. A monoclonal antibody to the terminal oxidase of the alternative pathway (the alternative oxidase) from Sauromatum guttatum (T.E. Elthon, R.L. Nickels, L. McIntosh [1989] Plant Physiology 89: 1311-1317) recognized a 35-kilodalton mitochondrial protein in tobacco. There was an excellent correlation between the capacity of the alternative path in isolated tobacco mitochondria and the levels of this 35-kilodalton alternative oxidase protein. Cycloheximide could inhibit both the increased level of the 35-kilodalton alternative oxidase protein and the increased alternative pathway capacity normally seen upon transfer to 18°C. We conclude that transfer of tobacco cells to the lower temperature increases the capacity of the alternative pathway due, at least in part, to de novo synthesis of the 35-kilodalton alternative oxidase protein. Images Figure 3 Figure 4 PMID:16652932
Sedbrook, John C.; Carroll, Kathleen L.; Hung, Kai F.; Masson, Patrick H.; Somerville, Chris R.
2002-01-01
To investigate how roots respond to directional cues, we characterized a T-DNA-tagged Arabidopsis mutant named sku5 in which the roots skewed and looped away from the normal downward direction of growth on inclined agar surfaces. sku5 roots and etiolated hypocotyls were slightly shorter than normal and exhibited a counterclockwise (left-handed) axial rotation bias. The surface-dependent skewing phenotype disappeared when the roots penetrated the agar surface, but the axial rotation defect persisted, revealing that these two directional growth processes are separable. The SKU5 gene belongs to a 19-member gene family designated SKS (SKU5 Similar) that is related structurally to the multiple-copper oxidases ascorbate oxidase and laccase. However, the SKS proteins lack several of the conserved copper binding motifs characteristic of copper oxidases, and no enzymatic function could be assigned to the SKU5 protein. Analysis of plants expressing SKU5 reporter constructs and protein gel blot analysis showed that SKU5 was expressed most strongly in expanding tissues. SKU5 was glycosylated and modified by glycosyl phosphatidylinositol and localized to both the plasma membrane and the cell wall. Our observations suggest that SKU5 affects two directional growth processes, possibly by participating in cell wall expansion.
Have, ten A.; Woltering, E.J.
1997-01-01
Ethylene production and expression patterns of an 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase (CARAO1) and of two ACC synthase (EC 4.4.1.14) genes (CARACC3 and CARAS1) were studied in floral organs of cut carnation flowers (Dianthus caryophyllus L.) cv. White Sim. During the vase life and
Interferon gamma/NADPH oxidase defence system in immunity and cancer
Czech Academy of Sciences Publication Activity Database
Hodný, Zdeněk; Reiniš, Milan; Hubáčková, Soňa; Vašicová, Pavla; Bartek, Jiří
-, 01 Sep (2015) ISSN 2162-4011 Institutional support: RVO:68378050 ; RVO:61388971 Keywords : IFNγ * NADPH oxidase * immunity * cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.266, year: 2014
Erv2p: characterization of the redox behavior of a yeast sulfhydryl oxidase
DEFF Research Database (Denmark)
Wang, Wenzhong; Winther, Jakob R; Thorpe, Colin
2007-01-01
centers that facilitate the transfer of reducing equivalents from the dithiol substrates of these oxidases to the isoalloxazine ring where the reaction with molecular oxygen occurs. The present study examines yeast Erv2p and compares the redox behavior of this ER luminal protein with the augmenter...... and with unfolded proteins. Rapid reaction studies confirm that reduction of the flavin center of Erv2p is rate-limiting during turnover with molecular oxygen. This comparison of the redox properties between members of the ERV/ALR family of sulfhydryl oxidases provides insights into their likely roles in oxidative......The FAD prosthetic group of the ERV/ALR family of sulfhydryl oxidases is housed at the mouth of a 4-helix bundle and communicates with a pair of juxtaposed cysteine residues that form the proximal redox active disulfide. Most of these enzymes have one or more additional distal disulfide redox...
Crystallization of carbohydrate oxidase from Microdochium nivale
International Nuclear Information System (INIS)
Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich
2009-01-01
Industrially used carbohydrate oxidase was successfully crystallized in several forms, diffraction data suitable for structural analysis were collected. Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 Å resolution, with unit-cell parameters a = b = 55.7, c = 610.4 Å and apparent space group P6 2 22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 Å, β = 95.7°. Data sets were collected to a resolution of 2.4 Å. The structure was solved by the molecular-replacement method. Model refinement is currently in progress
Directory of Open Access Journals (Sweden)
Dilek ODACI DEMIRKOL
2017-03-01
Full Text Available Here, a novel enzymatic biosensor was developed using multiwalled carbon nanotube including screen printed electrodes (MWCNT-SPE. Pyranose oxidase (PyOx was immobilized on the electrode surface by way of gelatin membrane and then cross-linked using glutaraldehyde. Glucose was detected at -0.7 V (vs. Ag/AgCl by watching consumed oxygen in enzymatic reaction after addition substrate. After optimization of pH and enzyme loading, the linearity was found in the range of 0.1–1.0 mM of glucose. After that, the effect of MCNT on the current was tested. Also the enzymatic biosensor including glucose oxidase instead of pyranose oxidase was prepared and the biosensor response followed for glucose. Furthermore, this system was tested for glucose analysis in soft drinks.
Directory of Open Access Journals (Sweden)
Gi Soo Youn
2017-08-01
Full Text Available Histone deacetylase 6 (HDAC6 likely is important in inflammatory diseases. However, how HDAC6 exerts its effect on inflammatory processes remains unclear. HIV-1 transactivator of transcription (Tat activates NADPH oxidase resulting in generation of reactive oxygen species (ROS, leading to extensive neuro-inflammation in the central nervous system. We investigated the correlation of HDAC6 and NADPH oxidase in HIV-1 Tat-stimulated astrocytes. HDAC6 knockdown attenuated HIV-1 Tat-induced ROS generation and NADPH oxidase activation. HDAC6 knockdown suppressed HIV-1 Tat-induced expression of NADPH oxidase subunits, such as Nox2, p47phox, and p22phox. Specific inhibition of HDAC6 using tubastatin A suppressed HIV-1 Tat-induced ROS generation and activation of NADPH oxidase. N-acetyl cysteine, diphenyl iodonium, and apocynin suppressed HIV-1 Tat-induced expression of HDAC6 and the pro-inflammatory chemokines CCL2, CXCL8, and CXCL10. Nox2 knockdown attenuated HIV-1 Tat-induced HDAC6 expression and subsequent expression of chemokines. The collective results point to the potential crosstalk between HDAC6 and NADPH oxidase, which could be a combined therapeutic target for relief of HIV-1 Tat-mediated neuro-inflammation. Keywords: HIV-1 Tat, HDAC6, NADPH oxidase, ROS, Inflammation, Astrocytes
Directory of Open Access Journals (Sweden)
Greg C. Vanlerberghe
2013-03-01
Full Text Available Alternative oxidase (AOX is a non-energy conserving terminal oxidase in the plant mitochondrial electron transport chain. While respiratory carbon oxidation pathways, electron transport, and ATP turnover are tightly coupled processes, AOX provides a means to relax this coupling, thus providing a degree of metabolic homeostasis to carbon and energy metabolism. Beside their role in primary metabolism, plant mitochondria also act as “signaling organelles”, able to influence processes such as nuclear gene expression. AOX activity can control the level of potential mitochondrial signaling molecules such as superoxide, nitric oxide and important redox couples. In this way, AOX also provides a degree of signaling homeostasis to the organelle. Evidence suggests that AOX function in metabolic and signaling homeostasis is particularly important during stress. These include abiotic stresses such as low temperature, drought, and nutrient deficiency, as well as biotic stresses such as bacterial infection. This review provides an introduction to the genetic and biochemical control of AOX respiration, as well as providing generalized examples of how AOX activity can provide metabolic and signaling homeostasis. This review also examines abiotic and biotic stresses in which AOX respiration has been critically evaluated, and considers the overall role of AOX in growth and stress tolerance.
International Nuclear Information System (INIS)
Fogel, W.A.; Bieganski, T.; Wozniak, J.; Maslinski, C.
1978-01-01
The Δ 1 pyrroline formation, as an indicator of diamine oxidase activity according to Okuyama and Kobayashi 14 C putrescine test (1961, Archs Biochem. Biophys., vol.95, 242), has been investigated in several tissue homogenates. When guinea pig liver homogenate was used as a source of enzyme in the presence of aldehyde dehydrogenase inhibitors chlorate hydrate and acetaldehyde the level of formation Δ 1 pyrroline was strongly increased in a dose-dependent manner. Also inhibition of aldehyde reductase by phenobarbital enhanced Δ 1 pyrroline formation, but to a lesser degree. In other tissues, with very high initial diamine oxidase activity (rat intestine, dog kidney) or with very low diamine oxidase activity (guinea pig skin, dog liver) the influence of these inhibitors was only slight. Pyrazole, an inhibitor of alcohol dehydrogenase exerted only a small effect on Δ 1 pyrroline formation. All aldehyde-metabolizing enzymes inhibitors, except pyrazole, were without effect on purified pea seddling and hog kidney diamine oxidases. The use of aldehyde-metabolizing enzymes inhibitors may help to reveal the real values of diamine oxidase activity, when tissues homogenates are used as a source of enzyme. (author)
Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V
2002-08-06
The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.
Song, Xiu-Shi; Xing, Shu; Li, He-Ping; Zhang, Jing-Bo; Qu, Bo; Jiang, Jin-He; Fan, Chao; Yang, Peng; Liu, Jin-Long; Hu, Zu-Quan; Xue, Sheng; Liao, Yu-Cai
2016-05-01
Plant germplasm resources with natural resistance against globally important toxigenic Fusarium are inadequate. CWP2, a Fusarium genus-specific antibody, confers durable resistance to different Fusarium pathogens that infect cereals and other crops, producing mycotoxins. However, the nature of the CWP2 target is not known. Thus, investigation of the gene coding for the CWP2 antibody target will likely provide critical insights into the mechanism underlying the resistance mediated by this disease-resistance antibody. Immunoblots and mass spectrometry analysis of two-dimensional electrophoresis gels containing cell wall proteins from Fusarium graminearum (Fg) revealed that a glyoxal oxidase (GLX) is the CWP2 antigen. Cellular localization studies showed that GLX is localized to the plasma membrane. This GLX efficiently catalyzes hydrogen peroxide production; this enzymatic activity was specifically inhibited by the CWP2 antibody. GLX-deletion strains of Fg, F. verticillioides (Fv) and F. oxysporum had significantly reduced virulence on plants. The GLX-deletion Fg and Fv strains had markedly reduced mycotoxin accumulation, and the expression of key genes in mycotoxin metabolism was downregulated. This study reveals a single gene-encoded and highly conserved cellular surface antigen that is specifically recognized by the disease-resistance antibody CWP2 and regulates both virulence and mycotoxin biosynthesis in Fusarium species. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Enhanced production of glucose oxidase from UVmutant of ...
African Journals Online (AJOL)
UV rays were used as mutagen in wild type strain of Aspergillus niger for enhanced production of glucose oxidase. After mutangenization and selection, mutant A. niger strains, resistant to 2-deoxy-Dglucose were obtained. The mutants showed 1.57 and 1.98 fold increase in activities of extra and intra cellular glucose ...
in Escherichia coli with native cholesterol oxidase expressed
African Journals Online (AJOL)
The structure and bio-activity of an endogenous cholesterol oxidase from Brevibacterium sp. was compared to the same enzyme exogenously expressed in Escherichia coli BL21 (DE3) with and without N- or C-terminal his-tags. The different proteins were purified with affinity and subtractive protocols. The specific activity of ...
Novel thidiazuron-derived inhibitors of cytokinin oxidase/dehydrogenase
Czech Academy of Sciences Publication Activity Database
Nisler, Jaroslav; Kopečný, D.; Končitíková, R.; Zatloukal, Marek; Bazgier, Václav; Berka, K.; Zalabák, D.; Briozzo, P.; Strnad, Miroslav; Spíchal, Lukáš
2016-01-01
Roč. 92, 1-2 (2016), s. 235-248 ISSN 0167-4412 R&D Projects: GA MŠk(CZ) LO1204; GA ČR GA15-22322S Institutional support: RVO:61389030 Keywords : Cytokinin oxidase/dehydrogenase * Crystal structure * Molecular docking Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.356, year: 2016
Tremey, Emilie; Suraniti, Emmanuel; Courjean, Olivier; Gounel, Sébastien; Stines-Chaumeil, Claire; Louerat, Frédéric; Mano, Nicolas
2014-06-04
In the 5-8 mM glucose concentration range, of particular interest for diabetes management, glucose oxidase bioelectrodes are O2 dependent, which decrease their efficiencies. By replacing the natural cofactor of glucose oxidase, we succeeded in turning an O2 sensitive bioelectrode into an almost insensitive one.
Nanoporous gold assembly of glucose oxidase for electrochemical biosensing
DEFF Research Database (Denmark)
Xiao, Xinxin; Ulstrup, Jens; Li, Hui
2014-01-01
Nanoporous gold (NPG) is composed of three-dimensional (3D) bicontinuous nanostructures with large surface area. Nano-channels inside NPG provide an ideal local environment for immobilization of enzyme molecules with expected stabilization of the protein molecules. In this work, glucose oxidase (...
Variations in epidermal cytochrome oxidase activity after local irradiation
International Nuclear Information System (INIS)
Itoiz, M.E.; Rey, B.M. de; Cabrini, R.L.
1982-01-01
Cytochrome oxidase activity was evaluated histochemically as an index of mitochondrial damage after local irradiation with X-rays. It was determined by microphotometry on the tail skin of newly born Wistar rats four days after irradiation with doses ranging from 2 to 16krad. The enzyme activity of the whole epidermis increased after irradiation, the increases being related to the increase in thickness of the epithelium which was observed as a response to irradiation injury. Within the dose range tested, the enzyme concentration (expressed per unit volume of tissue) decreased in relation to the dose applied. At the electron microscopy level, the cytochemical demonstration of cytochrome oxidase revealed an irregular reaction over the cristae, intramitochondrial vacuolization and partial homogenization of the matrix. Positive membrane fragments were seen around lipid droplets. This reaction confirms the mitochondrial origin of these previously observed radiation-induced vacuoles. (author)
Development of Galactose Biosensor Based on Functionalized ZnO Nanorods with Galactose Oxidase
Directory of Open Access Journals (Sweden)
K. Khun
2012-01-01
Full Text Available The fabrication of galactose biosensor based on functionalised ZnO nanorods is described. The galactose biosensor was developed by immobilizing galactose oxidase on ZnO nanorods in conjunction with glutaraldehyde as a cross-linker molecule. The IRAS study provided evidence for the interaction of galactose oxidase with the surface of ZnO nanorods. The electromotive force (EMF response of the galactose biosensor was measured by potentiometric method. We observed that the proposed biosensor has a linear detection range over a concentration range from 10 mM to 200 mM with good sensitivity of 89.10±1.23 mV/decade. In addition, the proposed biosensor has shown fast time response of less than 10 s and a good selectivity towards galactose in the presence of common interferents such as ascorbic acid, uric acid, glucose, and magnesium ions. The galactose biosensor based on galactose oxidase immobilized ZnO nanorods has a shelf life more than four weeks.
Regulation of the NADPH Oxidase RBOHD During Plant Immunity.
Kadota, Yasuhiro; Shirasu, Ken; Zipfel, Cyril
2015-08-01
Pathogen recognition induces the production of reactive oxygen species (ROS) by NADPH oxidases in both plants and animals. ROS have direct antimicrobial properties, but also serve as signaling molecules to activate further immune outputs. However, ROS production has to be tightly controlled to avoid detrimental effects on host cells, but yet must be produced in the right amount, at the right place and at the right time upon pathogen perception. Plant NADPH oxidases belong to the respiratory burst oxidase homolog (RBOH) family, which contains 10 members in the model plant Arabidopsis thaliana. The perception of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs) leads to a rapid, specific and strong production of ROS, which is dependent on RBOHD. RBOHD is mainly controlled by Ca(2+) via direct binding to EF-hand motifs and phosphorylation by Ca(2+)-dependent protein kinases. Recent studies have, however, revealed a critical role for a Ca(2+)-independent regulation of RBOHD. The plasma membrane-associated cytoplasmic kinase BIK1 (BOTRYTIS-INDUCED KINASE1), which is a direct substrate of the PRR complex, directly interacts with and phosphorylates RBOHD upon PAMP perception. Impairment of these phosphorylation events completely abolishes the function of RBOHD in immunity. These results suggest that RBOHD activity is tightly controlled by multilayered regulations. In this review, we summarize recent advances in our understanding of the regulatory mechanisms controlling RBOHD activation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Simona-Adriana Manea
2018-06-01
Full Text Available Reactive oxygen species (ROS generated by up-regulated NADPH oxidase (Nox contribute to structural-functional alterations of the vascular wall in diabetes. Epigenetic mechanisms, such as histone acetylation, emerged as important regulators of gene expression in cardiovascular disorders. Since their role in diabetes is still elusive we hypothesized that histone deacetylase (HDAC-dependent mechanisms could mediate vascular Nox overexpression in diabetic conditions. Non-diabetic and streptozotocin-induced diabetic C57BL/6J mice were randomized to receive vehicle or suberoylanilide hydroxamic acid (SAHA, a pan-HDAC inhibitor. In vitro studies were performed on a human aortic smooth muscle cell (SMC line. Aortic SMCs typically express Nox1, Nox4, and Nox5 subtypes. HDAC1 and HDAC2 proteins along with Nox1, Nox2, and Nox4 levels were found significantly elevated in the aortas of diabetic mice compared to non-diabetic animals. Treatment of diabetic mice with SAHA mitigated the aortic expression of Nox1, Nox2, and Nox4 subtypes and NADPH-stimulated ROS production. High concentrations of glucose increased HDAC1 and HDAC2 protein levels in cultured SMCs. SAHA significantly reduced the high glucose-induced Nox1/4/5 expression, ROS production, and the formation malondialdehyde-protein adducts in SMCs. Overexpression of HDAC2 up-regulated the Nox1/4/5 gene promoter activities in SMCs. Physical interactions of HDAC1/2 and p300 proteins with Nox1/4/5 promoters were detected at the sites of active transcription. High glucose induced histone H3K27 acetylation enrichment at the promoters of Nox1/4/5 genes in SMCs. The novel data of this study indicate that HDACs mediate vascular Nox up-regulation in diabetes. HDAC inhibition reduces vascular ROS production in experimental diabetes, possibly by a mechanism involving negative regulation of Nox expression. Keywords: NADPH oxidase, Epigenetics, HDAC, Histone acetylation, Diabetes
International Nuclear Information System (INIS)
Mizutani, Kimihiko; Toyoda, Mayuko; Sagara, Kenta; Takahashi, Nobuyuki; Sato, Atsuko; Kamitaka, Yuji; Tsujimura, Seiya; Nakanishi, Yuji; Sugiura, Toshiyuki; Yamaguchi, Shotaro; Kano, Kenji; Mikami, Bunzo
2010-01-01
The crystal structure of bilirubin oxidase (BOD) from M. verrucaria has been determined at 2.3 Å resolution using a merohedrally twinned crystal. BOD has four copper-coordination sites that are almost identical to those of other multicopper oxidases and is also very similar to them in overall structure. Bilirubin oxidase (BOD), a multicopper oxidase found in Myrothecium verrucaria, catalyzes the oxidation of bilirubin to biliverdin. Oxygen is the electron acceptor and is reduced to water. BOD is used for diagnostic analysis of bilirubin in serum and has attracted considerable attention as an enzymatic catalyst for the cathode of biofuel cells that work under neutral conditions. Here, the crystal structure of BOD is reported for the first time. Blue bipyramid-shaped crystals of BOD obtained in 2-methyl-2,4-pentanediol (MPD) and ammonium sulfate solution were merohedrally twinned in space group P6 3 . Structure determination was achieved by the single anomalous diffraction (SAD) method using the anomalous diffraction of Cu atoms and synchrotron radiation and twin refinement was performed in the resolution range 33–2.3 Å. The overall organization of BOD is almost the same as that of other multicopper oxidases: the protein is folded into three domains and a total of four copper-binding sites are found in domains 1 and 3. Although the four copper-binding sites were almost identical to those of other multicopper oxidases, the hydrophilic Asn residue (at the same position as a hydrophobic residue such as Leu in other multicopper oxidases) very close to the type I copper might contribute to the characteristically high redox potential of BOD
Shi, Guang-Xia; Wang, Xue-Rui; Yan, Chao-Qun; He, Tian; Yang, Jing-Wen; Zeng, Xiang-Hong; Xu, Qian; Zhu, Wen; Du, Si-Qi; Liu, Cun-Zhi
2015-12-10
In the current study, we aimed to investigate whether NADPH oxidase, a major ROS-producing enzyme, was involved in the antioxidant effect of acupuncture on cognitive impairment after cerebral ischaemia. The cognitive function, infract size, neuron cell loss, level of superoxide anion and expression of NADPH oxidase subunit in hippocampus of two-vessel occlusion (2VO) rats were determined after 2-week acupuncture. Furthermore, the cognitive function and production of O2(-) were determined in the presence and absence of NADPH oxidase agonist (TBCA) and antagonist (Apocynin). The effect of acupuncture on cognitive function after cerebral ischaemia in gp91phox-KO mice was evaluated by Morris water maze. Acupuncture reduced infarct size, attenuated overproduction of O2(-), and reversed consequential cognitive impairment and neuron cell loss in 2VO rats. The elevations of gp91phox and p47phox after 2VO were significantly decreased after acupuncture treatment. However, no differences of gp91phox mRNA were found among any experimental groups. Furthermore, these beneficial effects were reversed by TBCA, whereas apocynin mimicked the effect of acupuncture by improving cognitive function and decreasing O2(-) generation. Acupuncture failed to improve the memory impairment in gp91phox KO mice. Full function of the NADPH oxidase enzyme plays an important role in neuroprotective effects against cognitive impairment via inhibition of NAPDH oxidase-mediated oxidative stress.
Veenhuis, M.; Wendelaar Bonga, S.D.
1977-01-01
The distribution of catalase and D-amino acid oxidase, marker enzymes for peroxisomes, was determined cytochemically in the kidney tubules of an euryhaline teleost, the three-spined stickleback. Catalase activity was localized with the diaminobenzidine technique. The presence of D-amino acid oxidase
Antibacterial properties of the mammalian L-amino acid oxidase IL4I1.
Directory of Open Access Journals (Sweden)
Marie-Line Puiffe
Full Text Available L-amino acid oxidases (LAAO are flavoproteins that catalyze the oxidative deamination of L-amino acids to a keto-acid along with the production of H₂O₂ and ammonia. Interleukin 4 induced gene 1 (IL4I1 is a secreted LAAO expressed by macrophages and dendritic cells stimulated by microbial derived products or interferons, which is endowed with immunoregulatory properties. It is the first LAAO described in mammalian innate immune cells. In this work, we show that this enzyme blocks the in vitro and in vivo growth of Gram negative and Gram positive bacteria. This antibiotic effect is primarily mediated by H₂O₂ production but is amplified by basification of the medium due to the accumulation of ammonia. The depletion of phenylalanine (the primary amino acid catabolized by IL4I1 may also participate in the in vivo inhibition of staphylococci growth. Thus, IL4I1 plays a distinct role compared to other antibacterial enzymes produced by mononuclear phagocytes.
DEFF Research Database (Denmark)
Vinther-Jensen, T; Nielsen, Troels Tolstrup; Budtz-Jørgensen, E
2016-01-01
Huntington's disease (HD) is an autosomal dominantly inherited neurodegenerative disorder characterized by motor, psychiatric, and cognitive manifestations. HD is caused by a CAG repeat expansion in the Huntingtin (HTT) gene but the exact pathogenesis remains unknown. Dopamine imbalance has......-described cohort of Danish HD gene-expansion carriers. We show that cognitive impairment and psychiatric symptoms in HD are modified by polymorphisms in the monoamine oxidase A (MAOA) and catechol-O-methyltransferase (COMT) genes and by the 4p16.3 B haplotype. These results support the theory of dopamine imbalance...
Valencene oxidase CYP706M1 from Alaska cedar (Callitropsis nootkatensis).
Cankar, Katarina; van Houwelingen, Adèle; Goedbloed, Miriam; Renirie, Rokus; de Jong, René M; Bouwmeester, Harro; Bosch, Dirk; Sonke, Theo; Beekwilder, Jules
2014-03-18
(+)-Nootkatone is a natural sesquiterpene ketone used in grapefruit and citrus flavour compositions. It occurs in small amounts in grapefruit and is a major component of Alaska cedar (Callitropsis nootkatensis) heartwood essential oil. Upon co-expression of candidate cytochrome P450 enzymes from Alaska cedar in yeast with a valencene synthase, a C. nootkatensis valencene oxidase (CnVO) was identified to produce trans-nootkatol and (+)-nootkatone. Formation of (+)-nootkatone was detected at 144±10μg/L yeast culture. CnVO belongs to a new subfamily of the CYP706 family of cytochrome P450 oxidases. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Marziaz, Mandy L; Frazier, Kathryn; Guidry, Paul B; Ruiz, Robyn A; Petrikovics, Ilona; Haines, Donovan C
2013-01-01
Cyanide inhibits cytochrome c oxidase, the terminal oxidase of the mitochondrial respiratory pathway, therefore inhibiting the cell oxygen utilization and resulting in the condition of histotoxic anoxia. The enzyme rhodanese detoxifies cyanide by utilizing sulfur donors to convert cyanide to thiocyanate, and new and improved sulfur donors are actively sought as researchers seek to improve cyanide prophylactics. We have determined brain cytochrome c oxidase activity as a marker for cyanide exposure for mice pre-treated with various cyanide poisoning prophylactics, including sulfur donors thiosulfate (TS) and thiotaurine (TT3). Brain mitochondria were isolated by differential centrifugation, the outer mitochondrial membrane was disrupted by a maltoside detergent, and the decrease in absorbance at 550 nm as horse heart ferrocytochrome c (generated by the dithiothreitol reduction of ferricytochrome c) was oxidized was monitored. Overall, the TS control prophylactic treatment provided significant protection of the cytochrome c oxidase activity. The TT3-treated mice showed reduced cytochrome c oxidase activity even in the absence of cyanide. In both treatment series, addition of exogenous Rh did not significantly enhance the prevention of cytochrome c oxidase inhibition, but the addition of sodium nitrite did. These findings can lead to a better understanding of the protection mechanism by various cyanide antidotal systems. Copyright © 2011 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Ping-Ho Chen
2014-01-01
Full Text Available Betel quid (BQ and areca nut (AN (major BQ ingredient are group I human carcinogens illustrated by International Agency for Research on Cancer and are closely associated with an elevated risk of oral potentially malignant disorders (OPMDs and cancers of the oral cavity and pharynx. The primary alkaloid of AN, arecoline, can be metabolized via the monoamine oxidase (MAO gene by inducing reactive oxygen species (ROS. The aim of this study was to investigate whether the variants of the susceptible candidate MAO genes are associated with OPMDs and oral and pharyngeal cancer. A significant trend of MAO-A mRNA expression was found in in vitro studies. Using paired human tissues, we confirmed the significantly decreased expression of MAO-A and MAO-B in cancerous tissues when compared with adjacent noncancerous tissues. Moreover, we determined that MAO-A single nucleotide polymorphism variants are significantly linked with oral and pharyngeal cancer patients in comparison to OPMDs patients [rs5953210 risk G-allele, odds ratio = 1.76; 95% confidence interval = 1.02-3.01]. In conclusion, we suggested that susceptible MAO family variants associated with oral and pharyngeal cancer may be implicated in the modulation of MAO gene activity associated with ROS.
Chen, Ping-Ho; Huang, Bin; Shieh, Tien-Yu; Wang, Yan-Hsiung; Chen, Yuk-Kwan; Wu, Ju-Hui; Huang, Jhen-Hao; Chen, Chun-Chia; Lee, Ka-Wo
2014-01-01
Betel quid (BQ) and areca nut (AN) (major BQ ingredient) are group I human carcinogens illustrated by International Agency for Research on Cancer and are closely associated with an elevated risk of oral potentially malignant disorders (OPMDs) and cancers of the oral cavity and pharynx. The primary alkaloid of AN, arecoline, can be metabolized via the monoamine oxidase (MAO) gene by inducing reactive oxygen species (ROS). The aim of this study was to investigate whether the variants of the susceptible candidate MAO genes are associated with OPMDs and oral and pharyngeal cancer. A significant trend of MAO-A mRNA expression was found in in vitro studies. Using paired human tissues, we confirmed the significantly decreased expression of MAO-A and MAO-B in cancerous tissues when compared with adjacent noncancerous tissues. Moreover, we determined that MAO-A single nucleotide polymorphism variants are significantly linked with oral and pharyngeal cancer patients in comparison to OPMDs patients [rs5953210 risk G-allele, odds ratio = 1.76; 95% confidence interval = 1.02-3.01]. In conclusion, we suggested that susceptible MAO family variants associated with oral and pharyngeal cancer may be implicated in the modulation of MAO gene activity associated with ROS.
Directory of Open Access Journals (Sweden)
Faccio Greta
2010-08-01
Full Text Available Abstract Background Sulfhydryl oxidases are flavin-dependent enzymes that catalyse the formation of de novo disulfide bonds from free thiol groups, with the reduction of molecular oxygen to hydrogen peroxide. Sulfhydryl oxidases have been investigated in the food industry to remove the burnt flavour of ultraheat-treated milk and are currently studied as potential crosslinking enzymes, aiming at strengthening wheat dough and improving the overall bread quality. Results In the present study, potential sulfhydryl oxidases were identified in the publicly available fungal genome sequences and their sequence characteristics were studied. A representative sulfhydryl oxidase from Aspergillus oryzae, AoSOX1, was expressed in the fungus Trichoderma reesei. AoSOX1 was produced in relatively good yields and was purified and biochemically characterised. The enzyme catalysed the oxidation of thiol-containing compounds like glutathione, D/L-cysteine, beta-mercaptoethanol and DTT. The enzyme had a melting temperature of 57°C, a pH optimum of 7.5 and its enzymatic activity was completely inhibited in the presence of 1 mM ZnSO4. Conclusions Eighteen potentially secreted sulfhydryl oxidases were detected in the publicly available fungal genomes analysed and a novel proline-tryptophan dipeptide in the characteristic motif CXXC, where X is any amino acid, was found. A representative protein, AoSOX1 from A. oryzae, was produced in T. reesei in an active form and had the characteristics of sulfhydryl oxidases. Further testing of the activity on thiol groups within larger peptides and on protein level will be needed to assess the application potential of this enzyme.
Faccio, Greta; Kruus, Kristiina; Buchert, Johanna; Saloheimo, Markku
2010-08-20
Sulfhydryl oxidases are flavin-dependent enzymes that catalyse the formation of de novo disulfide bonds from free thiol groups, with the reduction of molecular oxygen to hydrogen peroxide. Sulfhydryl oxidases have been investigated in the food industry to remove the burnt flavour of ultraheat-treated milk and are currently studied as potential crosslinking enzymes, aiming at strengthening wheat dough and improving the overall bread quality. In the present study, potential sulfhydryl oxidases were identified in the publicly available fungal genome sequences and their sequence characteristics were studied. A representative sulfhydryl oxidase from Aspergillus oryzae, AoSOX1, was expressed in the fungus Trichoderma reesei. AoSOX1 was produced in relatively good yields and was purified and biochemically characterised. The enzyme catalysed the oxidation of thiol-containing compounds like glutathione, D/L-cysteine, beta-mercaptoethanol and DTT. The enzyme had a melting temperature of 57°C, a pH optimum of 7.5 and its enzymatic activity was completely inhibited in the presence of 1 mM ZnSO4. Eighteen potentially secreted sulfhydryl oxidases were detected in the publicly available fungal genomes analysed and a novel proline-tryptophan dipeptide in the characteristic motif CXXC, where X is any amino acid, was found. A representative protein, AoSOX1 from A. oryzae, was produced in T. reesei in an active form and had the characteristics of sulfhydryl oxidases. Further testing of the activity on thiol groups within larger peptides and on protein level will be needed to assess the application potential of this enzyme.
International Nuclear Information System (INIS)
Mishra, Nawneet; Timilsina, Uddhav; Ghimire, Dibya; Dubey, Ravi C.; Gaur, Ritu
2017-01-01
Mitochondrial Dysfunction has been implicated in multiple human diseases, including cancer. Among all cancer, lung cancer is the most common type of cancer worldwide with low survival rates. Mammals possess multiple subunits of the mitochondrial enzyme Cytochrome C oxidase (COX). The COX subunits are expressed in a tissue specific manner and have been implicated in cancer cell metabolism although their molecular and regulatory mechanisms are not clearly understood. In this study, we aimed at identifying novel gene signatures in lung cancer. We performed extensive analysis of seven different Gene Expression Omnibus (GEO) datasets pertaining to different stages of lung adenocarcinoma and identified that multiple subunits of COX genes are differentially expressed in these patients. Amongst all COX genes, the expression of COX7A1 gene was observed to be highly down regulated in these patients. In order to validate the GEO datasets, we looked at the expression of multiple COX genes using quantitative real time PCR (qPCR) using human lung adenocarcinoma cell line A549. Our results confirmed that COX 7A1 gene expression was indeed highly reduced in these cells. Overexpression of COX7A1 in human lung cancer cells led to inhibition of cell proliferation and increase in cell death via apoptosis. These results indicated that low level of COX7A1 gene expression is essential to regulate cell viability and inhibit cell death in lung adenocarcinoma. Our study has identified COX7A1 as a novel gene that might play a crucial role in the etiology of lung adenocarcinoma and can serve as a biomarker for lung cancer disease progression.
Immobilization of glucose oxidase on sepharose by UV-initiated graft copolymerization
International Nuclear Information System (INIS)
D'Angiuro, L.; Cremonesi, P.
1982-01-01
The performance of a new method of enzyme immobilization based on photochemically initiated direct graft copolymerization was recently investigated. The immobilization reaction can be carried out in a simple way and by carefully selecting the reaction conditions, the enzyme-graft copolymer can be obtained as the main reaction product. Coupling efficiency of glucose oxidase has been found to depend only on the amount of photocatalyst (FeCl 3 ) fixed on Sepharose used as polysaccharide support. Small quantities of glycidylmethacrylate (GMA) (0.25 g/g dry Sepharose) are sufficient but necessary to achieve the best enzyme coupling efficiency (20-40%). Enzyme immobilization occurs very rapidly and the entire reaction occurs within 60 min. Reaction patterns and physicochemical characteristics of the obtained enzyme-graft copolymers exclude the glucose oxidase entrapment: therefore a covalent attachment mechanism may be proposed. The kinetic parameters of immobilized glucose oxidase (K/sub m/' = 2.0 x 10 -2 M) are quite similar to those of free enzyme (K/sub m/ = 1.93 x 10 -2 M), and no diffusion limitation phenomena are evidenced in samples having different enzyme or polymer content. Lyophilization, thermostability, and long-term continuous operation also have been investigated. The advantages of this method over that using vinylenzyme copolymerization are discussed
Wu, Yun H; Wu, Tsung M; Hong, Chwan Y; Wang, Yei S; Yen, Jui H
2014-01-01
Vinclozolin, a dicarboximide fungicide, is an endocrine disrupting chemical that competes with an androgenic endocrine disruptor compound. Most research has focused on the epigenetic effect of vinclozolin in humans. In terms of ecotoxicology, understanding the effect of vinclozolin on non-target organisms is important. The expression profile of a comprehensive set of genes in the amphipod Hyalella azteca exposed to vinclozolin was examined. The expressed sequence tags in low-dose vinclozolin-treated and -untreated amphipods were isolated and identified by suppression subtractive hybridization. DNA dot blotting was used to confirm the results and establish a subtracted cDNA library for comparing all differentially expressed sequences with and without vinclozolin treatment. In total, 494 differentially expressed genes, including hemocyanin, heatshock protein, cytochrome, cytochrome oxidase and NADH dehydrogenase were detected. Hemocyanin was the most abundant gene. DNA dot blotting revealed 55 genes with significant differential expression. These genes included larval serum protein 1 alpha, E3 ubiquitin-protein ligase, mitochondrial cytochrome c oxidase, mitochondrial protein, proteasome inhibitor, hemocyanin, zinc-finger-containing protein, mitochondrial NADH-ubiquinone oxidoreductase and epididymal sperm-binding protein. Vinclozolin appears to upregulate stress-related genes and hemocyanin, related to immunity. Moreover, vinclozolin downregulated NADH dehydrogenase, related to respiration. Thus, even a non-lethal concentration of vinclozolin still has an effect at the genetic level in H. azteca and presents a potential risk, especially as it would affect non-target organism hormone metabolism.
Energy Technology Data Exchange (ETDEWEB)
Ren, Jian-Ching; Rebrin, Igor [Department of Pharmacology and Pharmaceutical Sciences, University of Southern California, Los Angeles, CA 90033 (United States); Klichko, Vladimir; Orr, William C. [Department of Biological Sciences, Southern Methodist University, Dallas, TX 75275 (United States); Sohal, Rajindar S., E-mail: sohal@usc.edu [Department of Pharmacology and Pharmaceutical Sciences, University of Southern California, Los Angeles, CA 90033 (United States)
2010-10-08
Research highlights: {yields} Cytochrome c oxidase loses catalytic activity during the aging process. {yields} Abundance of seven nuclear-encoded subunits of cytochrome c oxidase decreased with age in Drosophila. {yields} Cytochrome c oxidase is specific intra-mitochondrial site of age-related deterioration. -- Abstract: The hypothesis, that structural deterioration of cytochrome c oxidase (CcO) is a causal factor in the age-related decline in mitochondrial respiratory activity and an increase in H{sub 2}O{sub 2} generation, was tested in Drosophila melanogaster. CcO activity and the levels of seven different nuclear DNA-encoded CcO subunits were determined at three different stages of adult life, namely, young-, middle-, and old-age. CcO activity declined progressively with age by 33%. Western blot analysis, using antibodies specific to Drosophila CcO subunits IV, Va, Vb, VIb, VIc, VIIc, and VIII, indicated that the abundance these polypeptides decreased, ranging from 11% to 40%, during aging. These and previous results suggest that CcO is a specific intra-mitochondrial site of age-related deterioration, which may have a broad impact on mitochondrial physiology.
International Nuclear Information System (INIS)
Ren, Jian-Ching; Rebrin, Igor; Klichko, Vladimir; Orr, William C.; Sohal, Rajindar S.
2010-01-01
Research highlights: → Cytochrome c oxidase loses catalytic activity during the aging process. → Abundance of seven nuclear-encoded subunits of cytochrome c oxidase decreased with age in Drosophila. → Cytochrome c oxidase is specific intra-mitochondrial site of age-related deterioration. -- Abstract: The hypothesis, that structural deterioration of cytochrome c oxidase (CcO) is a causal factor in the age-related decline in mitochondrial respiratory activity and an increase in H 2 O 2 generation, was tested in Drosophila melanogaster. CcO activity and the levels of seven different nuclear DNA-encoded CcO subunits were determined at three different stages of adult life, namely, young-, middle-, and old-age. CcO activity declined progressively with age by 33%. Western blot analysis, using antibodies specific to Drosophila CcO subunits IV, Va, Vb, VIb, VIc, VIIc, and VIII, indicated that the abundance these polypeptides decreased, ranging from 11% to 40%, during aging. These and previous results suggest that CcO is a specific intra-mitochondrial site of age-related deterioration, which may have a broad impact on mitochondrial physiology.
Nguyen, Quoc-Thai; De Gonzalo, Gonzalo; Binda, Claudia; Rioz, Ana; Mattevi, Andrea; Fraaije, Marco
2016-01-01
Eugenol oxidase (EUGO) from Rhodococcus jostii RHA1 was previously shown to convert only a limited set of phenolic compounds. In this study, we have explored the biocatalytic potential of this flavoprotein oxidase resulting in a broadened substrate scope and a deeper insight into its structural
DEFF Research Database (Denmark)
Tindal, Stuart; Carr, Reuben; Archer, Ian V. J.
2011-01-01
Recent advances in biocatalysis have seen increased interest in the use of D-amino acid oxidase to synthesize optically pure amino acids. However, the creation of a genuine oxidase based platform technology will require suitable process technology as well as an understanding of the challenges...... and opportunities of a wider portfolio of synthetic targets. In this article we address some of the recent progress in process technology to enable the future development of a generic platform technology....
Energy Technology Data Exchange (ETDEWEB)
Fogel, W A [Polish Academy of Sciences, Cracow (Poland). Inst. of Pharmacology; Bieganski, T; Wozniak, J; Maslinski, C
1978-01-01
The ..delta../sup 1/ pyrroline formation, as an indicator of diamine oxidase activity according to Okuyama and Kobayashi /sup 14/C putrescine test (1961, Archs Biochem. Biophys., vol.95, 242), has been investigated in several tissue homogenates. When guinea pig liver homogenate was used as a source of enzyme in the presence of aldehyde dehydrogenase inhibitors chlorate hydrate and acetaldehyde the level of formation ..delta../sup 1/ pyrroline was strongly increased in a dose-dependent manner. Also inhibition of aldehyde reductase by phenobarbital enhanced ..delta../sup 1/ pyrroline formation, but to a lesser degree. In other tissues, with very high initial diamine oxidase activity (rat intestine, dog kidney) or with very low diamine oxidase activity (guinea pig skin, dog liver) the influence of these inhibitors was only slight. Pyrazole, an inhibitor of alcohol dehydrogenase exerted only a small effect on ..delta../sup 1/ pyrroline formation. All aldehyde-metabolizing enzymes inhibitors, except pyrazole, were without effect on purified pea seddling and hog kidney diamine oxidases. The use of aldehyde-metabolizing enzymes inhibitors may help to reveal the real values of diamine oxidase activity, when tissues homogenates are used as a source of enzyme.
Extracellular oxidases and the transformation of solubilised low-rank coal by wood-rot fungi
Energy Technology Data Exchange (ETDEWEB)
Ralph, J.P. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Graham, L.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Catcheside, D.E.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences
1996-12-31
The involvement of extracellular oxidases in biotransformation of low-rank coal was assessed by correlating the ability of nine white-rot and brown-rot fungi to alter macromolecular material in alkali-solubilised brown coal with the spectrum of oxidases they produce when grown on low-nitrogen medium. The coal fraction used was that soluble at 3.0{<=}pH{<=}6.0 (SWC6 coal). In 15-ml cultures, Gloeophyllum trabeum, Lentinus lepideus and Trametes versicolor produced little or no lignin peroxidase, manganese (Mn) peroxidase or laccase activity and caused no change to SWC6 coal. Ganoderma applanatum and Pycnoporus cinnabarinus also produced no detectable lignin or Mn peroxidases or laccase yet increased the absorbance at 400 nm of SWC6 coal. G. applanatum, which produced veratryl alcohol oxidase, also increased the modal apparent molecular mass. SWC6 coal exposed to Merulius tremellosus and Perenniporia tephropora, which secreted Mn peroxidases and laccase and Phanerochaete chrysosporium, which produced Mn and lignin peroxidases was polymerised but had unchanged or decreased absorbance. In the case of both P. chrysosporium and M. tremellosus, polymerisation of SWC6 coal was most extensive, leading to the formation of a complex insoluble in 100 mM NaOH. Rigidoporus ulmarius, which produced only laccase, both polymerised and reduced the A{sub 400} of SWC6 coal. P. chrysosporium, M. tremellosus and P. tephropora grown in 10-ml cultures produced a spectrum of oxidases similar to that in 15-ml cultures but, in each case, caused more extensive loss of A{sub 400}, and P. chrysosporium depolymerised SWC6 coal. It is concluded that the extracellular oxidases of white-rot fungi can transform low-rank coal macromolecules and that increased oxygen availability in the shallower 10-ml cultures favours catabolism over polymerisation. (orig.)
Pseudo-bi-enzyme glucose sensor: ZnS hollow spheres and glucose oxidase concerted catalysis glucose.
Shuai, Ying; Liu, Changhua; Wang, Jia; Cui, Xiaoyan; Nie, Ling
2013-06-07
This work creatively uses peroxidase-like ZnS hollow spheres (ZnS HSs) to cooperate with glucose oxidase (GOx) for glucose determinations. This approach is that the ZnS HSs electrocatalytically oxidate the enzymatically generated H2O2 to O2, and then the O2 circularly participates in the previous glucose oxidation by glucose oxidase. Au nanoparticles (AuNPs) and carbon nanotubes (CNTs) are used as electron transfer and enzyme immobilization matrices, respectively. The biosensor of glucose oxidase-carbon nanotubes-Au nanoparticles-ZnS hollow spheres-gold electrode (GOx-CNT-AuNPs-ZnS HSs-GE) exhibits a rapid response, a low detection limit (10 μM), a wide linear range (20 μM to 7 mM) as well as good anti-interference, long-term longevity and reproducibility.
Lu, Chia-Yang; Yang, Ya-Chen; Li, Chien-Chun; Liu, Kai-Li; Lii, Chong-Kuei; Chen, Haw-Wen
2014-09-01
Andrographolide, the major bioactive component of Andrographis paniculata, has been demonstrated to have various biological properties including anti-inflammation, antioxidation, and anti-hepatotoxicity. Oxidative stress is considered a major risk factor in aging, inflammation, cancer, atherosclerosis, and diabetes mellitus. NADPH oxidase is a major source of endogenous reactive oxygen species (ROS). In this study, we used EA.hy926 endothelial-like cells to explore the anti-inflammatory activity of andrographolide. Andrographolide attenuated TNFα-induced ROS generation, Src phosphorylation, membrane translocation of the NADPH oxidase subunits p47(phox) and p67(phox), and ICAM-1 gene expression. In the small hairpin RNA interference assay, shp47(phox) abolished TNFα-induced p65 nuclear translocation, ICAM-1 gene expression, and adhesion of HL-60 cells. Andrographolide induced the gene expression of heme oxygenase 1 (HO-1) and glutamate cysteine ligase modifier subunit (GCLM) in a time-dependent manner. Cellular glutathione (GSH) content was increased by andrographolide. shGCLM attenuated the andrographolide-induced increase in GSH content and reversed the andrographolide inhibition of HL-60 adhesion. shHO-1 showed a similar effect on andrographolide inhibition of HL-60 adhesion to shGCLM. The mechanism underlying the up-regulation of HO-1 and GCLM by andrographolide was dependent on the PI3K/Akt pathway, and both the Nrf2 and AP-1 transcriptional factors were involved. Our results suggest that andrographolide attenuates TNFα-induced ICAM-1 expression at least partially through suppression of NADPH oxidase activation and induction of HO-1 and GCLM expression, which is PI3K/Akt pathway-dependent. Copyright © 2014. Published by Elsevier Inc.
Imaging Monoamine Oxidase in the Human Brain
Energy Technology Data Exchange (ETDEWEB)
Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean
1999-11-10
Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.
Imaging Monoamine Oxidase in the Human Brain
International Nuclear Information System (INIS)
Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean
1999-01-01
Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets
Yeşiller, Gülden; Sezgintürk, Mustafa Kemal
2015-11-10
In this research, a novel enzyme activity analysis methodology is introduced as a new perspective for this area. The activity of elastase enzyme, which is a digestive enzyme mostly of found in the digestive system of vertebrates, was determined by an electrochemical device composed of carbon nanotubes and a second enzyme, glucose oxidase, which was used as a signal generator enzyme. In this novel methodology, a complex bioactive layer was constructed by using carbon nanotubes, glucose oxidase and a supporting protein, gelatin on a solid, conductive substrate. The activity of elastase was determined by monitoring the hydrolysis rate of elastase enzyme in the bioactive layer. As a result of this hydrolysis of elastase, glucose oxidase was dissociated from the bioactive layer, and following this the electrochemical signal due to glucose oxidase was decreased. The progressive elastase-catalyzed digestion of the bioactive layer containing glucose oxidase decreased the layer's enzymatic efficiency, resulting in a decrease of the glucose oxidation current as a function of the enzyme activity. The ratio of the decrease was correlated to elastase activity level. In this study, optimization experiments of bioactive components and characterization of the resulting new electrochemical device were carried out. A linear calibration range from 0.0303U/mL to 0.0729U/mL of elastase was reported. Real sample analyses were also carried out by the new electrochemical device. Copyright © 2015 Elsevier B.V. All rights reserved.
NADPH oxidase: an enzyme for multicellularity?
Lalucque, Hervé; Silar, Philippe
2003-01-01
Multicellularity has evolved several times during the evolution of eukaryotes. One evolutionary pressure that permits multicellularity relates to the division of work, where one group of cells functions as nutrient providers and the other in specialized roles such as defence or reproduction. This requires signalling systems to ensure harmonious development of multicellular structures. Here, we show that NADPH oxidases are specifically present in organisms that differentiate multicellular structures during their life cycle and are absent from unicellular life forms. The biochemical properties of these enzymes make them ideal candidates for a role in intercellular signalling.
Ag-doped CdO nanocatalysts: Preparation, characterization and catechol oxidase activity
El-Kemary, Maged; El-Mehasseb, Ibrahim; El-Shamy, Hany
2018-06-01
Silver doped cadmium oxide (Ag/CdO) nanoparticles with an average size of 41 nm have been successfully synthesized via thermal decomposition and liquid impregnation technique. The structural characterization has been performed by using several spectroscopic techniques, e.g., X-ray diffraction (XRD), scanning electron microscopy (SEM) and fourier-transform infrared (FT-IR). The catechol oxidase has been studied by UV-visible absorption spectroscopy and fourier-transform infrared as well as the mechanism has been assured by cyclic voltammetry and fluorescence spectroscopy. The results indicate that the oxidation does not occur in the presence of unsupported cadmium oxide particles by silver and in the same time, the catechol oxidase activity of silver doped CdO nanoparticles were improved by about three orders of magnitude than silver ions.
Directory of Open Access Journals (Sweden)
Yamabhai Montarop
2010-07-01
Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2
Morrison, Ryan D.; Blobaum, Anna L.; Byers, Frank W.; Santomango, Tammy S.; Bridges, Thomas M.; Stec, Donald; Brewer, Katrina A.; Sanchez-Ponce, Raymundo; Corlew, Melany M.; Rush, Roger; Felts, Andrew S.; Manka, Jason; Bates, Brittney S.; Venable, Daryl F.; Rodriguez, Alice L.; Jones, Carrie K.; Niswender, Colleen M.; Conn, P. Jeffrey; Lindsley, Craig W.; Emmitte, Kyle A.
2012-01-01
Negative allosteric modulation (NAM) of metabotropic glutamate receptor subtype 5 (mGlu5) represents a therapeutic strategy for the treatment of childhood developmental disorders, such as fragile X syndrome and autism. VU0409106 emerged as a lead compound within a biaryl ether series, displaying potent and selective inhibition of mGlu5. Despite its high clearance and short half-life, VU0409106 demonstrated efficacy in rodent models of anxiety after extravascular administration. However, lack of a consistent correlation in rat between in vitro hepatic clearance and in vivo plasma clearance for the biaryl ether series prompted an investigation into the biotransformation of VU0409106 using hepatic subcellular fractions. An in vitro appraisal in rat, monkey, and human liver S9 fractions indicated that the principal pathway was NADPH-independent oxidation to metabolite M1 (+16 Da). Both raloxifene (aldehyde oxidase inhibitor) and allopurinol (xanthine oxidase inhibitor) attenuated the formation of M1, thus implicating the contribution of both molybdenum hydroxylases in the biotransformation of VU0409106. The use of 18O-labeled water in the S9 experiments confirmed the hydroxylase mechanism proposed, because 18O was incorporated into M1 (+18 Da) as well as in a secondary metabolite (M2; +36 Da), the formation of which was exclusively xanthine oxidase-mediated. This unusual dual and sequential hydroxylase metabolism was confirmed in liver S9 and hepatocytes of multiple species and correlated with in vivo data because M1 and M2 were the principal metabolites detected in rats administered VU0409106. An in vitro-in vivo correlation of predicted hepatic and plasma clearance was subsequently established for VU0409106 in rats and nonhuman primates. PMID:22711749
Chung, Wen-Shuo; Farley, Jerry M; Drummond, Heather A
2011-01-01
The aim of this study was to determine if VSMC ASIC-like currents are regulated by oxidative state. We used whole-cell patch clamp of isolated mouse cerebral VSMCs to determine if 1) reducing agents, such as DTT and GSH, and 2) inhibition of endogenous oxidase activity from NADPH and Xanthine oxidases potentiate active currents and activate electrically silent currents. Pretreatment with 2 mM DTT or GSH, increased the mean peak amplitude of ASIC-like currents evoked by pH 6.0 from 0.4 ± 0.1 to 14.9 ± 3.6 pA/pF, and from 0.9 ± 0.3 to 11.3 ± 2.4 pA/pF, respectively. Pretreatment with apocynin, a NADPH oxidase inhibitor, mimics the effect of the reducing agents, with the mean peak current amplitude increased from 0.9 ± 0.5 to 7.0 ± 2.6 pA/pF and from 0.5 ± 0.2 to 26.4 ± 6.8 pA/pF by 50 and 200 μM apocynin, respectively. Pretreatment with allopurinol, a xanthine oxidase inhibitor, also potentiates the VSMC ASIC-like activity. These findings suggest that VSMC ASIC-like channels are regulated by oxidative state and may be inhibited by basal endogenous oxidative sources such as NADPH and xanthine oxidase. Copyright © 2011 S. Karger AG, Basel.
Sen, Supatra; Mukherji, S
2009-07-01
Season-controlled changes in biochemical constituents viz. carotenoids (carotene and xanthophyll) and pectic substances along with IAA-oxidase and polyphenol oxidase (PPO) enzyme activities were estimated/assayed in leaves of Lycopersicon esculentum Mill. (tomato) in two developmental stages--pre-flowering (35 days after sowing) and post-flowering (75 days after sowing) in three different seasons--summer rainy and winter Carotenoid content along with pectic substances were highest in winter and declined significantly in summer followed by rainy i.e. winter > summer > rainy. Carotenoid content was significantly higher in the pre-flowering as compared to post-flowering in all three seasons while pectic substances increased in the post-flowering as compared to pre-flowering throughout the annual cycle. IAA oxidase and PPO enzyme activities were enhanced in rainy and decreased sharply in summer and winter i.e. rainy > summer > winter. Both the enzymes exhibited higher activity in the post-flowering stage as compared to pre-flowering in all three seasons. These results indicate winter to be the most favourable season for tomato plants while rainy season environmental conditions prove to be unfavourable (stressful) with diminished content of carotenoid and pectic substances and low activities of IAA oxidase and PPO, ultimately leading to poor growth and productivity.
Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T
2009-10-01
Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.
Electrochemical L-Lactic Acid Sensor Based on Immobilized ZnO Nanorods with Lactate Oxidase
Directory of Open Access Journals (Sweden)
Kimleang Khun
2012-02-01
Full Text Available In this work, fabrication of gold coated glass substrate, growth of ZnO nanorods and potentiometric response of lactic acid are explained. The biosensor was developed by immobilizing the lactate oxidase on the ZnO nanorods in combination with glutaraldehyde as a cross linker for lactate oxidase enzyme. The potentiometric technique was applied for the measuring the output (EMF response of L-lactic acid biosensor. We noticed that the present biosensor has wide linear detection range of concentration from 1 × 10−4–1 × 100 mM with acceptable sensitivity about 41.33 ± 1.58 mV/decade. In addition, the proposed biosensor showed fast response time less than 10 s, a good selectivity towards L-lactic acid in presence of common interfering substances such as ascorbic acid, urea, glucose, galactose, magnesium ions and calcium ions. The present biosensor based on immobilized ZnO nanorods with lactate oxidase sustained its stability for more than three weeks.
Electrochemical L-lactic acid sensor based on immobilized ZnO nanorods with lactate oxidase.
Ibupoto, Zafar Hussain; Shah, Syed Muhammad Usman Ali; Khun, Kimleang; Willander, Magnus
2012-01-01
In this work, fabrication of gold coated glass substrate, growth of ZnO nanorods and potentiometric response of lactic acid are explained. The biosensor was developed by immobilizing the lactate oxidase on the ZnO nanorods in combination with glutaraldehyde as a cross linker for lactate oxidase enzyme. The potentiometric technique was applied for the measuring the output (EMF) response of l-lactic acid biosensor. We noticed that the present biosensor has wide linear detection range of concentration from 1 × 10(-4)-1 × 10(0) mM with acceptable sensitivity about 41.33 ± 1.58 mV/decade. In addition, the proposed biosensor showed fast response time less than 10 s, a good selectivity towards l-lactic acid in presence of common interfering substances such as ascorbic acid, urea, glucose, galactose, magnesium ions and calcium ions. The present biosensor based on immobilized ZnO nanorods with lactate oxidase sustained its stability for more than three weeks.
Thermal Characterization of Purified Glucose Oxidase from A Newly Isolated Aspergillus Niger UAF-1
Anjum Zia, Muhammad; Khalil-ur-Rahman; K. Saeed, Muhammad; Andaleeb, Fozia; I. Rajoka, Muhammad; A. Sheikh, Munir; A. Khan, Iftikhar; I. Khan, Azeem
2007-01-01
An intracellular glucose oxidase was isolated from the mycelium extract of a locally isolated strain of Aspergillus niger UAF-1. The enzyme was purified to a yield of 28.43% and specific activity of 135 U mg−1 through ammonium sulfate precipitation, anion exchange and gel filtration chromatography. The enzyme showed high affinity for D-glucose with a Km value of 2.56 mM. The enzyme exhibited optimum catalytic activity at pH 5.5. Temperature optimum for glucose oxidase, catalyzed D-glucose oxidation was 40°C. The enzyme showed a high thermostability having a half-life 30 min, enthalpy of denaturation 99.66 kJ mol−1 and free energy of denaturation 103.63 kJ mol−1. These characteristics suggest the use of glucose oxidase from Aspergillus niger UAF-1 as an analytical reagent and in the design of biosensors for clinical, biochemical and diagnostic assays. PMID:18193107
Serum xanthine oxidase profile in stressed Marwari sheep from arid tracts in India
Directory of Open Access Journals (Sweden)
Maan R.
2012-08-01
Full Text Available The present investigation was aimed to determine serum xanthine oxidase profile in stressed Marwari breed of sheep belonging to arid tracts in Rajasthan, India. Extreme hot and cold ambiences were considered as stress conditions to the animals. Blood samples were collected to obtain sera during moderate, extreme hot and cold ambiences. The mean value of serum xanthine oxidase during moderate ambience was 93.33±1.11 mU L-1.The mean value of serum xanthine oxidase was significantly (p≤0.05higher during hot and significantly (p≤0.05 lower during cold ambiences as compared to moderate mean value serving as control. The sex and age effects were significant (p≤0.05 in all ambiences. The mean values were significantly (p≤0.05 higher in males than females. In each ambience the age effect showed a significant (p≤0.05 increase in the mean values being highest in the animals of 2.5-4.5 years of age. The effects of extreme ambiences were observed on the male and female animals of all age groups as revealed by various interactions studied viz. ambience X age; ambience X sex and age X sex (p≤0.01. Further sex effect was present in the animals of each age group. It can be concluded that serum xanthine oxidase can be used as an effective marker to assess oxidative stress in these animals. Mean values obtained from large number of animals during moderate ambience will help in providing physiological reference values for future research and clinical interpretations.
Directory of Open Access Journals (Sweden)
Lishan Zhou
2013-01-01
Full Text Available Hu-Lu-Ba-Wan (HLBW is a Chinese herbal prescription used to treat kidney deficiency. The aim of this study was to explore the effect and mechanism of HLBW on diabetic nephropathy (DN in type 2 diabetic rats. The rat model of DN was established by being fed a high-fat diet and intravenous injection of streptozotocin. Then, HLBW decoction was administered for 16 weeks. Blood glucose level, lipid profile, renal function, 24-hour total urinary protein, and albumin content were examined. Renal morphology and superoxide anion levels were evaluated. The activity of nicotinamide-adenine dinucleotide phosphate (NADPH and protein kinase C-alpha (PKC-α related genes expression in renal tissue were also determined. Our data demonstrated that HLBW significantly improved hyperglycemia, hyperlipidemia, and proteinuria in diabetic rats compared with those of control group. HLBW also alleviated glomerular expansion and fibrosis, extracellular matrix accumulation and effacement of the foot processes. Additionally, HLBW reduced superoxide anion level, NADPH oxidase activity, the protein and mRNA expressions of p47phox, and the protein expression of phosphorylated PKC-α in renal tissue. These results suggest that HLBW is effective in the treatment of DN in rats. The underlying mechanism may be related to the attenuation of renal oxidative stress via PKC-α/NADPH oxidase signaling pathway.
Yuan, Haibo; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Shi, Zhongping; Liu, Long
2018-01-01
2,5-Furandicarboxylic acid (FDCA) is a promising bio-based building block and can be produced by biotransformation of 5-hydroxymethylfurfural (HMF). To improve the FDCA production, two genes-one encoding HMF oxidase (HMFO; from Methylovorus sp. strain MP688) and another encoding for HMF/Furfural oxidoreductase (HmfH; from Cupriavidus basilensis HMF14)-were introduced into Raoultella ornithinolytica BF60. The FDCA production in the engineered whole-cell biocatalyst increased from 51.0 to 93.6mM, and the molar conversion ratio of HMF to FDCA increased from 51.0 to 93.6%. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gene Expression Patterns during Light and Dark Infection of Prochlorococcus by Cyanophage.
Directory of Open Access Journals (Sweden)
Luke R Thompson
Full Text Available Cyanophage infecting the marine cyanobacteria Prochlorococcus and Synechococcus require light and host photosystem activity for optimal reproduction. Many cyanophages encode multiple photosynthetic electron transport (PET proteins, which are presumed to maintain electron flow and produce ATP and NADPH for nucleotide biosynthesis and phage genome replication. However, evidence suggests phage augment NADPH production via the pentose phosphate pathway (PPP, thus calling into question the need for NADPH production by PET. Genes implicated in cyclic PET have since been identified in cyanophage genomes. It remains an open question which mode of PET, cyclic or linear, predominates in infected cyanobacteria, and thus whether the balance is towards producing ATP or NADPH. We sequenced transcriptomes of a cyanophage (P-HM2 and its host (Prochlorococcus MED4 throughout infection in the light or in the dark, and analyzed these data in the context of phage replication and metabolite measurements. Infection was robust in the light, but phage were not produced in the dark. Host gene transcripts encoding high-light inducible proteins and two terminal oxidases (plastoquinol terminal oxidase and cytochrome c oxidase-implicated in protecting the photosynthetic membrane from light stress-were the most enriched in light but not dark infection. Among the most diminished transcripts in both light and dark infection was ferredoxin-NADP+ reductase (FNR, which uses the electron acceptor NADP+ to generate NADPH in linear photosynthesis. The phage gene for CP12, which putatively inhibits the Calvin cycle enzyme that receives NADPH from FNR, was highly expressed in light infection. Therefore, both PET production of NADPH and its consumption by carbon fixation are putatively repressed during phage infection in light. Transcriptomic evidence is thus consistent with cyclic photophosphorylation using oxygen as the terminal electron acceptor as the dominant mode of PET under
Genes, Parenting, Self-Control, and Criminal Behavior.
Watts, Stephen J; McNulty, Thomas L
2016-03-01
Self-control has been found to predict a wide variety of criminal behaviors. In addition, studies have consistently shown that parenting is an important influence on both self-control and offending. However, few studies have examined the role that biological factors may play in moderating the relationship between parenting, self-control, and offending. Using a sample of adolescent males drawn from the National Longitudinal Study of Adolescent Health (N = 3,610), we explore whether variants of the monoamine oxidase A gene (MAOA) and the dopamine transporter (DAT1) gene interact with parenting to affect self-control and offending. Results reveal that parenting interacts with these genes to influence self-control and offending, and that the parenting-by-gene interaction effect on offending is mediated by self-control. The effects of parenting on self-control and offending are most pronounced for those who carry plasticity alleles for both MAOA and DAT1. Thus, MAOA and DAT1 may be implicated in offending because they increase the negative effects of parenting on self-control. Implications for theory are discussed. © The Author(s) 2014.
Purushothaman, K-Raman; Purushothaman, Meerarani; Turnbull, Irene C; Adams, David H; Anyanwu, Anelechi; Krishnan, Prakash; Kini, Annapoorna; Sharma, Samin K; O'Connor, William N; Moreno, Pedro R
Collagen cross-linking is mediated by lysyl oxidase (LOX) enzyme in the extracellular matrix (ECM) of mitral valve leaflets. Alterations in collagen content and LOX protein expression in the ECM of degenerative mitral valve may enhance leaflet expansion and disease severity. Twenty posterior degenerative mitral valve leaflets from patients with severe mitral regurgitation were obtained at surgery. Five normal posterior mitral valve leaflets procured during autopsy served as controls. Valvular interstitial cells (VICs) density was quantified by immunohistochemistry, collagen Types I and III by picro-sirius red staining and immunohistochemistry, and proteoglycans by alcian blue staining. Protein expression of LOX and its mediator TGFβ1 were quantified by immunofluorescence and gene expression by PCR. VIC density was increased, structural Type I collagen density was reduced, while reparative Type III collagen and proteoglycan densities were increased (PDegenerative Mitral Valve Disease may be secondary to alterations in LOX protein expression, contributing to disorganization of ECM and disease severity. Copyright © 2017 Elsevier Inc. All rights reserved.
Cytokinin oxidase or dehydrogenase? Mechanism of cytokinin degradation in cereals
DEFF Research Database (Denmark)
Galuszka, P.; Frebort, I.; Sebela, M.
2001-01-01
An enzyme degrading cytokinins with isoprenoid side chain, previously named cytokinin oxidase, was purified to near homogeneity from wheat and barley grains. New techniques were developed for the enzyme activity assay and staining on native electrophoretic gels to identify the protein. The purifi...
Lysyl oxidases regulate fibrillar collagen remodelling in idiopathic pulmonary fibrosis
Tjin, Gavin; White, Eric S; Faiz, Alen; Sicard, Delphine; Tschumperlin, Daniel J; Mahar, Annabelle; Kable, Eleanor P W; Burgess, Janette K
2017-01-01
Idiopathic pulmonary fibrosis (IPF) is a progressive scarring disease of the lung with feweffective therapeutic options. Structural remodelling of the extracellular matrix [i.e. collagen cross-linkingmediated by the lysyl oxidase (LO) family of enzymes (LOX, LOXL1-4)] might contribute to disease
DNA damage and decrease of cellular oxidase activity in piglet ...
African Journals Online (AJOL)
DNA damage and decrease of cellular oxidase activity in piglet sertoli cells exposed to gossypol. Ming Zhang, Hui Yuan, Zuping He, Liyun Yuan, Jine Yi, Sijun Deng, Li Zhu, Chengzhi Guo, Yin Lu, Jing Wu, Lixin Wen, Qiang Wei, Liqun Xue ...
Lactate Biosensor Based on Cellulose Acetate Membrane Bound Lactate Oxidase
Directory of Open Access Journals (Sweden)
Suman
2007-05-01
Full Text Available Lactate biosensor was fabricated by immobilizing lactate oxidase in cellulose acetate membrane and by mounting over the sensing part of Pt electrode (working and connected to Ag/AgCl electrode (reference along with auxillary electrode through potentiostat. The enzyme electrode was anodically polarized at +400 mV to generate electrons from H2O2, which was formed from oxidation of serum lactate by immobilized lactate oxidase. The minimum detection limit of the electrode was 0.1mmoles/L and sensitivity of the sensor was 0.008 mA/mM/L lactate. Assay coefficients of variation were < 2% .A good correlation (r=0.99 was found between lactate values obtained by colorimetric method and lactate biosensor. The self-life of the biosensor was 18 days at 4ºC and enzyme electrode can be re-used 150 times without any significant loss in enzyme activity.
Liu, Biwu; Huang, Zhicheng; Liu, Juewen
2016-07-01
Nanomaterial-based enzyme mimics (nanozymes) are currently a new forefront of chemical research. However, the application of nanozymes is limited by their low catalytic activity and low turnover numbers. Cerium dioxide nanoparticles (nanoceria) are among the few with oxidase activity. Herein, we report an interesting finding addressing their limitations. The oxidase activity of nanoceria is improved by over 100-fold by fluoride capping, making it more close to real oxidases. The turnover number reached 700 in 15 min, drastically improved from ~15 turnovers for the naked particles. The mechanism is attributed to surface charge modulation and facilitated electron transfer by F- capping based on ζ-potential and free radical measurements. Ultrasensitive sensing of fluoride was achieved with a detection limit of 0.64 μM F- in water and in toothpastes, while no other tested anions can achieve the activity enhancement.Nanomaterial-based enzyme mimics (nanozymes) are currently a new forefront of chemical research. However, the application of nanozymes is limited by their low catalytic activity and low turnover numbers. Cerium dioxide nanoparticles (nanoceria) are among the few with oxidase activity. Herein, we report an interesting finding addressing their limitations. The oxidase activity of nanoceria is improved by over 100-fold by fluoride capping, making it more close to real oxidases. The turnover number reached 700 in 15 min, drastically improved from ~15 turnovers for the naked particles. The mechanism is attributed to surface charge modulation and facilitated electron transfer by F- capping based on ζ-potential and free radical measurements. Ultrasensitive sensing of fluoride was achieved with a detection limit of 0.64 μM F- in water and in toothpastes, while no other tested anions can achieve the activity enhancement. Electronic supplementary information (ESI) available: Methods, TMB oxidation kinetics and control experiments. See DOI: 10.1039/c6nr02730j
Directory of Open Access Journals (Sweden)
Agnès eHovasse
2016-02-01
Full Text Available The acid mine drainage (AMD impacted creek of the Carnoulès mine (Southern France is characterized by acid waters with a high heavy metal content. The microbial community inhabiting this AMD was extensively studied using isolation, metagenomic and metaproteomic methods, and the results showed that a natural arsenic (and iron attenuation process involving the arsenite oxidase activity of several Thiomonas strains occurs at this site. A sensitive quantitative Selected Reaction Monitoring (SRM-based proteomic approach was developed for detecting and quantifying the two subunits of the arsenite oxidase and RpoA of two different Thiomonas groups. Using this approach combined with 16S rRNA gene sequence analysis based on pyrosequencing and FISH, it was established here for the first time that these Thiomonas strains are ubiquitously present in minor proportions in this AMD and that they express the key enzymes involved in natural remediation processes at various locations and time points. In addition to these findings, this study also confirms that targeted proteomics applied at the community level can be used to detect weakly abundant proteins in situ.
Directory of Open Access Journals (Sweden)
Ji Hye Park
2018-01-01
Full Text Available Estimation of postmortem interval (PMI is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin. The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI nucleotide sequences. The molecular identification method commonly uses Sanger’s nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger’s nucleotide sequencing, single-nucleotide polymorphisms (SNPs in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger’s nucleotide sequencing.
International Nuclear Information System (INIS)
Williamson, P.R.; Kagan, H.M.
1987-01-01
Benzylamine derivatives containing para substituents of differing electronegativity as well as isomers of aminomethylpyridine have been assessed for their substrate and inhibitor potentials toward lysyl oxidase. Substituted benzylamines with increasingly electronegative para substituents had the lowest KI values and thus were the most effective inhibitors of the oxidation of elastin by lysyl oxidase. The kcat values for these compounds as substrates of lysyl oxidase were also reduced with increasingly electronegative para substituents. Both the Dkcat and D(kcat/Km) kinetic isotope effects decreased with increasingly electronegative p-substituents in [alpha, alpha'- 2 H]benzylamines. In contrast, there was no Dkcat solvent isotope effect with [ 2 H] H 2 O while the D(kcat/Km) solvent isotope effect tended to increase with increasingly electronegative p-substituents. These results are consistent with the stabilization of an enzyme-generated substrate carbanion and the retardation of substrate oxidation by electronegative substituents. Such ground state stabilization can result in compounds with increased potential for the inhibition of the oxidation of protein substrates of lysyl oxidase
Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase
Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.
2013-01-01
Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588
The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer's disease
Directory of Open Access Journals (Sweden)
Landreth Gary E
2006-11-01
Full Text Available Abstract Alzheimer's disease is the most common cause of dementia in the elderly, and manifests as progressive cognitive decline and profound neuronal loss. The principal neuropathological hallmarks of Alzheimer's disease are the senile plaques and the neurofibrillary tangles. The senile plaques are surrounded by activated microglia, which are largely responsible for the proinflammatory environment within the diseased brain. Microglia are the resident innate immune cells in the brain. In response to contact with fibrillar beta-amyloid, microglia secrete a diverse array of proinflammatory molecules. Evidence suggests that oxidative stress emanating from activated microglia contribute to the neuronal loss characteristic of this disease. The source of fibrillar beta-amyloid induced reactive oxygen species is primarily the microglial nicotinamide adenine dinucleotide phosphate (NADPH oxidase. The NADPH oxidase is a multicomponent enzyme complex that, upon activation, produces the highly reactive free radical superoxide. The cascade of intracellular signaling events leading to NADPH oxidase assembly and the subsequent release of superoxide in fibrillar beta-amyloid stimulated microglia has recently been elucidated. The induction of reactive oxygen species, as well as nitric oxide, from activated microglia can enhance the production of more potent free radicals such as peroxynitrite. The formation of peroxynitrite causes protein oxidation, lipid peroxidation and DNA damage, which ultimately lead to neuronal cell death. The elimination of beta-amyloid-induced oxidative damage through the inhibition of the NADPH oxidase represents an attractive therapeutic target for the treatment of Alzheimer's disease.
Effect of heat treatment on polyphenol oxidase and peroxidase ...
African Journals Online (AJOL)
Effect of heat treatment (55°C/20 min) on polyphenol oxidase (PPO) and peroxidase (POD) activities and total phenolic compounds was investigated in Algerian dates (Deglet Nour variety) at Tamar (fully ripe) stage and in dates stored for 5 months at ambient temperature and in cold storage (10°C). Results obtained ...
Structure of choline oxidase in complex with the reaction product glycine betaine.
Salvi, Francesca; Wang, Yuan-Fang; Weber, Irene T; Gadda, Giovanni
2014-02-01
Choline oxidase from Arthrobacter globiformis, which is involved in the biosynthesis of glycine betaine from choline, has been extensively characterized in its mechanistic and structural properties. Despite the knowledge gained on the enzyme, the details of substrate access to the active site are not fully understood. The `loop-and-lid' mechanism described for the glucose-methanol-choline enzyme superfamily has not been confirmed for choline oxidase. Instead, a hydrophobic cluster on the solvent-accessible surface of the enzyme has been proposed by molecular dynamics to control substrate access to the active site. Here, the crystal structure of the enzyme was solved in complex with glycine betaine at pH 6.0 at 1.95 Å resolution, allowing a structural description of the ligand-enzyme interactions in the active site. This structure is the first of choline oxidase in complex with a physiologically relevant ligand. The protein structures with and without ligand are virtually identical, with the exception of a loop at the dimer interface, which assumes two distinct conformations. The different conformations of loop 250-255 define different accessibilities of the proposed active-site entrance delimited by the hydrophobic cluster on the other subunit of the dimer, suggesting a role in regulating substrate access to the active site.
Directory of Open Access Journals (Sweden)
Seiichi Takamatsu
2010-06-01
Full Text Available We have developed a package for disposable glucose sensor chips using Parylene encapsulation of a glucose oxidase solution in the liquid phase and a cover structure made of an ultraviolet (UV curable adhesive. Parylene was directly deposited onto a small volume (1 μL of glucose oxidase solution through chemical vapor deposition. The cover and reaction chamber were constructed on Parylene film using a UV-curable adhesive and photolithography. The package was processed at room temperature to avoid denaturation of the glucose oxidase. The glucose oxidase solution was encapsulated and unsealed. Glucose sensing was demonstrated using standard amperometric detection at glucose concentrations between 0.1 and 100 mM, which covers the glucose concentration range of diabetic patients. Our proposed Parylene encapsulation and UV-adhesive cover form a liquid phase glucose-oxidase package that has the advantages of room temperature processing and direct liquid encapsulation of a small volume solution without use of conventional solidifying chemicals.
Hofmeister effects on the glucose oxidase hydrogel-modified electrode
International Nuclear Information System (INIS)
Suzuki, Aimi; Tsujimura, Seiya
2016-01-01
We describe the consistent effect of salts in the electrolyte solution on glucose oxidation current production in the redox hydrogel-modified electrode containing glucose oxidase as an electrocatalyst and Os complex mediator. The ions affect not only on the electron transfer between the enzyme and the Os complex, but also on the hydrogel structure. This study found that the degree of the effect can be characterized by Hofmeister series. The relative decrease in oxidization current is the lowest in the middle of the Hofmeister series, and increases monotonically on either side. An increase of ionic strength inhibits the electron transfer from the active site of glucose oxidase to Os complex. In addition to this, the kosmotropic anions, which are strongly hydrated, caused hydrogel deswelling (shrinking). The more chaotropic an ion is, the more it adsorbs to uncharged parts of polymer/enzyme with dispersion force, and the swelling of the hydrogel decreases the catalytic current. This study impacts the design of hydrogel electrode and selection of electrolyte ions for bioelectronic applications.
Hahm, J E; Kim, C W; Kim, S S
2018-04-06
A widespread scabies infestation, associated to long-term residence in nursing homes, is becoming a serious issue in developed countries. Mineral oil examination is regarded as the gold standard in diagnosing scabies, but the sensitivity of this method is generally low-approximately 50%. Molecular tests may contribute to enhance the sensitivity of current tests for laboratory diagnosis of human scabies. In this study, we developed new primers for a nested PCR for the cytochrome c oxidase subunit 1 (cox1) gene of Sarcoptes scabiei var. hominis to increase the sensitivity of a previously developed conventional PCR. Clinically suspected scabies patients underwent dermoscopy-guided skin scraping with microscopic examination. The diagnosis was positive for scabies when mites or eggs were found under the microscope, and patients were then designated as 'microscopy-positive'. Patients in the 'microscopy-negative' group presented with negative microscopic results. Skin scrapings were collected from both groups for PCR. Of the total 63 samples, 28 were microscopy-positive and 35 were negative with no differences in sex and age between the two groups. All microscopically proven scabies cases were positive with the cox1 nested PCR. Among microscopy-negative ones, S. scabiei DNA was detected in 9 samples. If sensitivity of the cox1 nested PCR is considered 100% (95% CI, 90.51-100), then sensitivity of microscopy is 75.68% (95% CI, 58.80-88.23; P = 0.004). Nested PCR can be successfully used as an alternative method for diagnosing suspected scabies patient. Therefore, infection control measures and treatments can be initiated before significant transmission occurs, minimizing the risk of outbreaks. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Fraaije, M W; Veeger, C; van Berkel, W J
1995-11-15
The substrate specificity of the flavoprotein vanillyl-alcohol oxidase from Penicillium simplicissimum was investigated. Vanillyl-alcohol oxidase catalyzes besides the oxidation of 4-hydroxybenzyl alcohols, the oxidative deamination of 4-hydroxybenzylamines and the oxidative demethylation of 4-(methoxymethyl)phenols. During the conversion of vanillylamine to vanillin, a transient intermediate, most probably vanillylimine, is observed. Vanillyl-alcohol oxidase weakly interacts with 4-hydroxyphenylglycols and a series of catecholamines. These compounds are converted to the corresponding ketones. Both enantiomers of (nor)epinephrine are substrates for vanillyl-alcohol oxidase, but the R isomer is preferred. Vanillyl-alcohol oxidase is most active with chavicol and eugenol. These 4-allylphenols are converted to coumaryl alcohol and coniferyl alcohol, respectively. Isotopic labeling experiments show that the oxygen atom inserted at the C gamma atom of the side chain is derived from water. The 4-hydroxycinnamyl alcohol products and the substrate analog isoeugenol are competitive inhibitors of vanillyl alcohol oxidation. The binding of isoeugenol to the oxidized enzyme perturbs the optical spectrum of protein-bound FAD. pH-dependent binding studies suggest that vanillyl-alcohol oxidase preferentially binds the phenolate form of isoeugenol (pKa < 6, 25 degrees C). From this and the high pH optimum for turnover, a hydride transfer mechanism involving a p-quinone methide intermediate is proposed for the vanillyl-alcohol-oxidase-catalyzed conversion of 4-allylphenols.
Hallmann, Kerstin; Kudin, Alexei P; Zsurka, Gábor; Kornblum, Cornelia; Reimann, Jens; Stüve, Burkhard; Waltz, Stephan; Hattingen, Elke; Thiele, Holger; Nürnberg, Peter; Rüb, Cornelia; Voos, Wolfgang; Kopatz, Jens; Neumann, Harald; Kunz, Wolfram S
2016-02-01
Isolated cytochrome c oxidase (complex IV) deficiency is one of the most frequent respiratory chain defects in humans and is usually caused by mutations in proteins required for assembly of the complex. Mutations in nuclear-encoded structural subunits are very rare. In a patient with Leigh-like syndrome presenting with leukodystrophy and severe epilepsy, we identified a homozygous splice site mutation in COX8A, which codes for the ubiquitously expressed isoform of subunit VIII, the smallest nuclear-encoded subunit of complex IV. The mutation, affecting the last nucleotide of intron 1, leads to aberrant splicing, a frame-shift in the highly conserved exon 2, and decreased amount of the COX8A transcript. The loss of the wild-type COX8A protein severely impairs the stability of the entire cytochrome c oxidase enzyme complex and manifests in isolated complex IV deficiency in skeletal muscle and fibroblasts, similar to the frequent c.845_846delCT mutation in the assembly factor SURF1 gene. Stability and activity of complex IV could be rescued in the patient's fibroblasts by lentiviral expression of wild-type COX8A. Our findings demonstrate that COX8A is indispensable for function of human complex IV and its mutation causes human disease. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Fraaije, Marco W.; Veeger, Cees; Berkel, Willem J.H. van
1995-01-01
The substrate specificity of the flavoprotein vanillyl-alcohol oxidase from Penicillium simplicissimum was investigated. Vanillyl-alcohol oxidase catalyzes besides the oxidation of 4-hydroxybenzyl alcohols, the oxidative deamination of 4-hydroxybenzylamines and the oxidative demethylation of 4-(methoxymethyl)phenols. During the conversion of vanillylamine to vanillin, a transient intermediate, most probably vanillylimine, is observed. Vanillyl-alcohol oxidase weakly interacts with 4-hydroxyph...
Wong-Riley, M T; Trusk, T C; Kaboord, W; Huang, Z
1994-09-01
One of the hallmarks of the primate striate cortex is the presence of cytochrome oxidase-rich puffs in its supragranular layers. Neurons in puffs have been classified as type A, B, and C in ascending order of cytochrome oxidase content, with type C cells being the most vulnerable to retinal impulse blockade. The present study aimed at analysing cytochrome oxidase-poor interpuffs with reference to their metabolic cell types and the effect of intraretinal tetrodotoxin treatment. The same three metabolic types were found in interpuffs, except that type B and C neurons were smaller and less cytochrome oxidase-reactive in interpuffs than in puffs. Type A neurons had small perikarya, low levels of cytochrome oxidase, and received exclusively symmetric axosomatic synapses. The largest neurons were pyramidal, type B cells with moderate cytochrome oxidase activity and were also contacted exclusively by symmetric axosomatic synapses. Type C cells medium-sized with a rich supply of large, darkly reactive mitochondria and possessed all the characteristics of GABAergic neurons. They were the only cell type that received both symmetric and asymmetric axosomatic synapses. Two weeks of monocular tetrodotoxin blockade in adult monkeys caused all three major cell types in deprived interpuffs to suffer a significant downward shift in the size and cytochrome oxidase reactivity of their mitochondria, but the effects were more severe in type B and C neurons. In nondeprived interpuffs, all three cell types gained both in size and absolute number of mitochondria, and type A cells also had an elevated level of cytochrome oxidase, indicating that they might be functioning at a competitive advantage over cells in deprived columns. However, type B and C neurons showed a net loss of darkly reactive mitochondria, indicating that these cells became less active. Thus, mature interpuff neurons remained vulnerable to retinal impulse blockade and the metabolic capacity of these cells remains tightly
Nox1 oxidase suppresses influenza a virus-induced lung inflammation and oxidative stress.
Directory of Open Access Journals (Sweden)
Stavros Selemidis
Full Text Available Influenza A virus infection is an ongoing clinical problem and thus, there is an urgent need to understand the mechanisms that regulate the lung inflammation in order to unravel novel generic pharmacological strategies. Evidence indicates that the Nox2-containing NADPH oxidase enzyme promotes influenza A virus-induced lung oxidative stress, inflammation and dysfunction via ROS generation. In addition, lung epithelial and endothelial cells express the Nox1 isoform of NADPH oxidase, placing this enzyme at key sites to regulate influenza A virus-induced lung inflammation. The aim of this study was to investigate whether Nox1 oxidase regulates the inflammatory response and the oxidative stress to influenza infection in vivo in mice. Male WT and Nox1-deficient (Nox1(-/y mice were infected with the moderately pathogenic HkX-31 (H3N2, 1×10(4 PFU influenza A virus for analysis of bodyweight, airways inflammation, oxidative stress, viral titre, lung histopathology, and cytokine/chemokine expression at 3 and 7 days post infection. HkX-31 virus infection of Nox1(-/y mice resulted in significantly greater: loss of bodyweight (Day 3; BALF neutrophilia, peri-bronchial, peri-vascular and alveolar inflammation; Nox2-dependent inflammatory cell ROS production and peri-bronchial, epithelial and endothelial oxidative stress. The expression of pro-inflammatory cytokines including CCL2, CCL3, CXCL2, IL-1β, IL-6, GM-CSF and TNF-α was higher in Nox1(-/y lungs compared to WT mice at Day 3, however, the expression of CCL2, CCL3, CXCL2, IFN-γ and the anti-inflammatory cytokine IL-10 were lower in lungs of Nox1(-/y mice vs. WT mice at Day 7. Lung viral titre, and airways infiltration of active CD8(+ and CD4(+ T lymphocytes, and of Tregs were similar between WT and Nox1(-/y mice. In conclusion, Nox1 oxidase suppresses influenza A virus induced lung inflammation and oxidative stress in mice particularly at the early phases of the infection. Nox1 and Nox2 oxidases appear
Directory of Open Access Journals (Sweden)
Lalida Shank
2010-09-01
Full Text Available Peroxidases (POD and polyphenol oxidase (PPO are enzymes that are well known to be involved in the enzymatic browning reaction of fruits and vegetables with different catalytic mechanisms. Both enzymes have some common substrates, but each also has its specific substrates. In our computational study, the amino acid sequence of grape peroxidase (ABX was used for the construction of models employing homology modeling method based on the X-ray structure of cytosolic ascorbate peroxidase from pea (PDB ID:1APX, whereas the model of grape polyphenol oxidase was obtained directly from the available X-ray structure (PDB ID:2P3X. Molecular docking of common substrates of these two enzymes was subsequently studied. It was found that epicatechin and catechin exhibited high affinity with both enzymes, even though POD and PPO have different binding pockets regarding the size and the key amino acids involved in binding. Predicted binding modes of substrates with both enzymes were also compared. The calculated docking interaction energy of trihydroxybenzoic acid related compounds shows high affinity, suggesting specificity and potential use as common inhibitor to grape ascorbate peroxidase and polyphenol oxidase.
Thermal and pH stabilities of partially purified polyphenol oxidase ...
African Journals Online (AJOL)
Dr. Paul Chidoka Chikezie
2012-07-30
Jul 30, 2012 ... indices of the two PPO extracts is summarized in Table. 1. At the end of the .... activity near neutral pH values (Jime´nez-Atie´nzar et al.,. 2004; Dogan and Dogan, 2004). ..... oxidase from white cherry fruit (Starks gold). GIDA.
Addiction, adolescence, and innate immune gene induction
Directory of Open Access Journals (Sweden)
Fulton T Crews
2011-04-01
Full Text Available Repeated drug use/abuse amplifies psychopathology, progressively reducing frontal lobe behavioral control and cognitive flexibility while simultaneously increasing limbic temporal lobe negative emotionality. The period of adolescence is a neurodevelopmental stage characterized by poor behavioral control as well as strong limbic reward and thrill seeking. Repeated drug abuse and/or stress during this stage increase the risk of addiction and elevate activator innate immune signaling in the brain. Nuclear factor-kappa-light-chain-enhancer of activated B cells (NF-κB is a key glial transcription factor that regulates proinflammatory chemokines, cytokines, oxidases, proteases, and other innate immune genes. Induction of innate brain immune gene expression (e.g., NF-κB facilitates negative affect, depression-like behaviors, and inhibits hippocampal neurogenesis. In addition, innate immune gene induction alters cortical neurotransmission consistent with loss of behavioral control. Studies with anti-oxidant, anti-inflammatory, and anti-depressant drugs as well as opiate antagonists link persistent innate immune gene expression to key behavioral components of addiction, e.g. negative affect-anxiety and loss of frontal cortical behavioral control. This review suggests that persistent and progressive changes in innate immune gene expression contribute to the development of addiction. Innate immune genes may represent a novel new target for addiction therapy.
Fung, Shin Yee; Lee, Mui Li; Tan, Nget Hong
2015-03-01
Snake venom LAAOs have been reported to exhibit a wide range of pharmacological activities, including cytotoxic, edema-inducing, platelet aggregation-inducing/platelet aggregation-inhibiting, bactericidal and antiviral activities. A heat-stable form of l-amino acid oxidase isolated from king cobra (Ophiophagus hannah) venom (OH-LAAO) has been shown to exhibit very potent cytotoxicity against human tumorigenic cells but not in their non-tumorigenic counterparts, and the cytotoxicity was due to the apoptosis-inducing effect of the enzyme. In this work, the molecular mechanism of cell death induced by OH-LAAO was investigated. The enzyme exerts its apoptosis-inducing effect presumably via both intrinsic and extrinsic pathways as suggested by the increase in caspase-8 and -9 activities. Oligonucleotide microarray analysis showed that the expression of a total of 178 genes was significantly altered as a result of oxidative stress induced by the hydrogen peroxide generated by the enzyme. Of the 178 genes, at least 27 genes are involved in apoptosis and cell death. These alterations of gene expression was presumably caused by the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidative modifications of signaling molecules that eventually lead to apoptosis and cell death. The very substantial up-regulation of cytochrome P450 genes may also contribute to the potent cytotoxic action of OH-LAAO by producing excessive reactive oxygen species (ROS). In conclusion, the potent apoptosis inducing activity of OH-LAAO was likely due to the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidation of signalling molecules. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Chatfield, J.M.; Armstrong, D.J.
1987-01-01
The effects of metal ions on cytokinin oxidase activity extracted from callus tissues of Phaseolus vulgaris L. cv Great Northern have been examined using an assay based on the oxidation of N 6 -(Δ 2 -isopentenyl)-adenine-2,8- 3 H (i 6 Ade) to adenine (Ade). The addition of cupric ions to reaction mixtures containing imidazole buffer markedly enhanced cytokinin oxidase activity. In the presence of optimal concentrations of copper and imidazole, cytokinin oxidase activity was stimulated more than 20-fold. The effect was enzyme dependent, specific for copper, and observed only in the presence of imidazole. The substrate specificity of the copper-imidazole enhanced reaction, as judged by substrate competition tests, was the same as that observed in the absence of copper and imidazole. Similarly, in tests involving DEAE-cellulose chromatography, elution profiles of cytokinin oxidase activity determined using a copper-imidazole enhanced assay were identical to those obtained using an assay without copper and imidazole. On the basis of these results, the addition of copper and imidazole to reaction mixtures used to assay for cytokinin oxidase activity is judged to provide a reliable and specific assay of greatly enhanced sensitivity for the enzyme. The mechanism by which copper and imidazole enhance cytokinin oxidase activity is not certain, but the reaction catalyzed by the enzyme was not inhibited by anaerobic conditions when these reagents were present. This observation suggests that copper-imidazole complexes are substituting for oxygen in the reaction mechanism by which cytokinin oxidase effects cleavage of the N 6 -side chain of i 6 Ade
Sarmaga, Don; Dubois, Jeffrey A; Lyon, Martha E
2011-11-01
Off-meter dosed photometric glucose-oxidase-based glucose meters have been reported to be susceptible to interference by hydrogen-peroxide-based disinfecting agents. The objective of this study was to determine if a single application of hydrogen-peroxide-containing Accel® wipe to disinfect an on-meter dosed amperometric glucose-oxidase-based glucose meter will influence its performance. The performance of five on-meter dosed amperometric glucose-oxidase-based glucose meters was determined before and after disinfecting the devices with a single application of either CaviWipes® (14.3% isopropanol and 0.23% diisobutyl-phenoxy-ethoxyethyl dimethyl benzyl ammonium chloride) or Accel (0.5% hydrogen peroxide) wipes. Replicate glucose measurements were conducted before disinfecting the devices, immediately after disinfecting, and then 1 and 2 min postdisinfecting, with measurements in triplicate. Analysis was sequentially completed for five different meters. Results were analyzed by a two-way analysis of variance (Analyze-it software). No clinical ( .05) in glucose concentration were detected when the on-meter dosed amperometric glucose-oxidase-based glucose meters were disinfected with either CaviWipes or Accel wipes and measured immediately or 1 or 2 min postdisinfecting. No clinically significant difference in glucose concentration was detected between meters (glucose oxidase amperometric-based glucose meters are not analytically susceptible to interference by a single application of hydrogen-peroxide-containing Accel disinfectant wipes. © 2011 Diabetes Technology Society.
Directory of Open Access Journals (Sweden)
Deepti Nair
Full Text Available In rodents, exposure to intermittent hypoxia (IH, a hallmark of obstructive sleep apnea (OSA, is associated with neurobehavioral impairments, increased apoptosis in the hippocampus and cortex, as well as increased oxidant stress and inflammation. Excessive NADPH oxidase activity may play a role in IH-induced CNS dysfunction.The effect of IH during light period on two forms of spatial learning in the water maze and well as markers of oxidative stress was assessed in mice lacking NADPH oxidase activity (gp91phox(_/Y and wild-type littermates. On a standard place training task, gp91phox(_/Y displayed normal learning, and were protected from the spatial learning deficits observed in wild-type littermates exposed to IH. Moreover, anxiety levels were increased in wild-type mice exposed to IH as compared to room air (RA controls, while no changes emerged in gp91phox(_/Y mice. Additionally, wild-type mice, but not gp91phox(_/Y mice had significantly elevated levels of NADPH oxidase expression and activity, as well as MDA and 8-OHDG in cortical and hippocampal lysates following IH exposures.The oxidative stress responses and neurobehavioral impairments induced by IH during sleep are mediated, at least in part, by excessive NADPH oxidase activity, and thus pharmacological agents targeting NADPH oxidase may provide a therapeutic strategy in sleep-disordered breathing.
Directory of Open Access Journals (Sweden)
Quan-Guang Zhang
Full Text Available BACKGROUND: Oxidative stress is known to play an important role in the pathology of traumatic brain injury. Mitochondria are thought to be the major source of the damaging reactive oxygen species (ROS following TBI. However, recent work has revealed that the membrane, via the enzyme NADPH oxidase can also generate the superoxide radical (O(2(-, and thereby potentially contribute to the oxidative stress following TBI. The current study thus addressed the potential role of NADPH oxidase in TBI. METHODOLOGY/PRINCIPAL FINDINGS: The results revealed that NADPH oxidase activity in the cerebral cortex and hippocampal CA1 region increases rapidly following controlled cortical impact in male mice, with an early peak at 1 h, followed by a secondary peak from 24-96 h after TBI. In situ localization using oxidized hydroethidine and the neuronal marker, NeuN, revealed that the O(2(- induction occurred in neurons at 1 h after TBI. Pre- or post-treatment with the NADPH oxidase inhibitor, apocynin markedly inhibited microglial activation and oxidative stress damage. Apocynin also attenuated TBI-induction of the Alzheimer's disease proteins β-amyloid and amyloid precursor protein. Finally, both pre- and post-treatment of apocynin was also shown to induce significant neuroprotection against TBI. In addition, a NOX2-specific inhibitor, gp91ds-tat was also shown to exert neuroprotection against TBI. CONCLUSIONS/SIGNIFICANCE: As a whole, the study demonstrates that NADPH oxidase activity and superoxide production exhibit a biphasic elevation in the hippocampus and cortex following TBI, which contributes significantly to the pathology of TBI via mediation of oxidative stress damage, microglial activation, and AD protein induction in the brain following TBI.
Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen.
Pasqualini, Stefania; Tedeschini, Emma; Frenguelli, Giuseppe; Wopfner, Nicole; Ferreira, Fatima; D'Amato, Gennaro; Ederli, Luisa
2011-10-01
Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O(3)) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O(3) fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O(3) fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O(3), determined from the mRNA levels of the major allergens. We conclude that O(3) can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. Copyright © 2011 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Bokoch, Michael P.; Devadoss, Anando; Palencsar, Mariela S.; Burgess, James D.
2004-01-01
Cholesterol oxidase is immobilized in electrode-supported lipid bilayer membranes. Platinum electrodes are initially modified with a self-assembled monolayer of thiolipid. A vesicle fusion method is used to deposit an outer leaflet of phospholipids onto the thiolipid monolayer forming a thiolipid/lipid bilayer membrane on the electrode surface. Cholesterol oxidase spontaneously inserts into the electrode-supported lipid bilayer membrane from solution and is consequently immobilized to the electrode surface. Cholesterol partitions into the membrane from buffer solutions containing cyclodextrin. Cholesterol oxidase catalyzes the oxidation of cholesterol by molecular oxygen, forming hydrogen peroxide as a product. Amperometric detection of hydrogen peroxide for continuous solution flow experiments are presented, where flow was alternated between cholesterol solution and buffer containing no cholesterol. Steady-state anodic currents were observed during exposures of cholesterol solutions ranging in concentration from 10 to 1000 μM. These data are consistent with the Michaelis-Menten kinetic model for oxidation of cholesterol as catalyzed by cholesterol oxidase immobilized in the lipid bilayer membrane. The cholesterol detection limit is below 1 μM for cholesterol solution prepared in buffered cyclodextrin. The response of the electrodes to low density lipoprotein solutions is increased upon addition of cyclodextrin. Evidence for adsorption of low density lipoprotein to the electrode surface is presented
Wang, Yimin; Luo, Xiao; Pan, Hao; Huang, Wei; Wang, Xueping; Wen, Huali; Shen, Kezhen; Jin, Baiye
2015-09-01
Cisplatin induced nephrotoxicity is primarily caused by ROS (Reactive Oxygen Species) induced proximal tubular cell death. NADPH oxidase is major source of ROS production by cisplatin. Here, we reported that pharmacological inhibition of NADPH oxidase by acetovanillone (obtained from medicinal herb Picrorhiza kurroa) led to reduced cisplatin nephrotoxicity in mice. In this study we used various molecular biology and biochemistry methods a clinically relevant model of nephropathy, induced by an important chemotherapeutic drug cisplatin. Cisplatin-induced nephrotoxicity was evident by histological damage from loss of the tubular structure. The damage was also marked by the increase in blood urea nitrogen, creatinine, protein nitration as well as cell death markers such as caspase 3/7 activity and DNA fragmentation. Tubular cell death by cisplatin led to pro-inflammatory response by production of TNFα and IL1β followed by leukocyte/neutrophil infiltration which resulted in new wave of ROS involving more NADPH oxidases. Cisplatin-induced markers of kidney damage such as oxidative stress, cell death, inflammatory cytokine production and nephrotoxicity were attenuated by acetovanillone. In addition to that, acetovanillone enhanced cancer cell killing efficacy of cisplatin. Thus, pharmacological inhibition of NADPH oxidase can be protective for cisplatin-induced nephrotoxicity in mice. Copyright © 2015. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Gutierrez R, Ingrid Marcela; Fagua, Giovanny
2012-01-01
Parides hubner is a terminal taxon of troidini, an aposematic butterfly group that is diverse in the tropics and subtropics, and a model of Mullerian and Batesian mimetic complexes. Several American species of parides are sympatric and include populations with intraspecific variation in color pattern, thus creating confusion on their taxonomic status, mainly in Colombia where the biota of North and South America converge. This work presents a phylogenetic hypothesis of these butterflies and proposes a more robust definition of some taxa. For this, 15 taxa of the subgenus parides were analyzed as ingroup; species of other two genera of troidini, closer to parides, were used as out-group. DNA was extracted using the pascual et al. (1997) protocol and quiagen dnaeasy kit. A terminal fragment of cytochrome oxidase I gen (476 bp) were amplified. We obtained a phylogenetic approximation using maximum parsimony and evaluated the branch support with jackknife and absolute bremer support. We also conducted a bayesian analysis. The resulting phylogenetic hypothesis suggested that parides is a paraphyletic group; the molecular evidence support one species and five subspecies. The analyzed taxa were divided in three principal groups coincident with the lysander (group 1) and aeneas (groups 1 and 2) groups proposed by rothschild and jordan (1906).
Directory of Open Access Journals (Sweden)
Muhammad Anjum Zia
2013-12-01
Full Text Available This work aimed to study the production and purification of glucose oxidase by Aspergillus niger and Penicillium notatum using corn steep liquor as the substrate and evaluate its antimicrobial activity for use in pharmaceutical and food industries. The enzyme was purified by ammonium sulfate precipitation (60-85%, DEAE-cellulose ion exchange and Sephadex G-200 size exclusion chromatography. The crude enzyme extracts of A. niger and P. notatum showed 2.32 and 5.53 U mg-1 specific activities, respectively, which after desalting was 15.52 and 12.05 U mg-1, and after ion exchange and gel filtration chromatography was 29.09 - 62 and 25.72 - 59.37 U mg-1 for A. niger and P. notatum, respectively. The antimicrobial activity was determined by disc diffusion method against selected microbial strains where glucose oxidase from A. niger showed anti-bacterial activity, while no fungicidal effects were shown by both A. niger and P. notatum glucose oxidases.
El-Benna, Jamel; Dang, Pham My-Chan; Gougerot-Pocidalo, Marie-Anne
2008-07-01
Neutrophils play an essential role in host defense against microbial pathogens and in the inflammatory reaction. Upon activation, neutrophils produce superoxide anion (O*2), which generates other reactive oxygen species (ROS) such as hydrogen peroxide (H2O2), hydroxyl radical (OH*) and hypochlorous acid (HOCl), together with microbicidal peptides and proteases. The enzyme responsible for O2* production is called the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase or respiratory burst oxidase. This multicomponent enzyme system is composed of two trans-membrane proteins (p22phox and gp91phox/NOX2, which form the cytochrome b558), three cytosolic proteins (p47phox, p67phox, p40phox) and a GTPase (Rac1 or Rac2), which assemble at membrane sites upon cell activation. NADPH oxidase activation in phagocytes can be induced by a large number of soluble and particulate factors. Three major events accompany NAPDH oxidase activation: (1) protein phosphorylation, (2) GTPase activation, and (3) translocation of cytosolic components to the plasma membrane to form the active enzyme. Actually, the neutrophil NADPH oxidase exists in different states: resting, primed, activated, or inactivated. The resting state is found in circulating blood neutrophils. The primed state can be induced by neutrophil adhesion, pro-inflammatory cytokines, lipopolysaccharide, and other agents and has been characterized as a "ready to go" state, which results in a faster and higher response upon exposure to a second stimulus. The active state is found at the inflammatory or infection site. Activation is induced by the pathogen itself or by pathogen-derived formylated peptides and other agents. Finally, inactivation of NADPH oxidase is induced by anti-inflammatory agents to limit inflammation. Priming is a "double-edged sword" process as it contributes to a rapid and efficient elimination of the pathogens but can also induce the generation of large quantities of toxic ROS by hyperactivation of
Zhang, Xinxing; Li, Kunhua; Jones, Rachel A; Bruner, Steven D; Butcher, Rebecca A
2016-09-06
Caenorhabditis elegans secretes ascarosides as pheromones to communicate with other worms and to coordinate the development and behavior of the population. Peroxisomal β-oxidation cycles shorten the side chains of ascaroside precursors to produce the short-chain ascaroside pheromones. Acyl-CoA oxidases, which catalyze the first step in these β-oxidation cycles, have different side chain-length specificities and enable C. elegans to regulate the production of specific ascaroside pheromones. Here, we determine the crystal structure of the acyl-CoA oxidase 1 (ACOX-1) homodimer and the ACOX-2 homodimer bound to its substrate. Our results provide a molecular basis for the substrate specificities of the acyl-CoA oxidases and reveal why some of these enzymes have a very broad substrate range, whereas others are quite specific. Our results also enable predictions to be made for the roles of uncharacterized acyl-CoA oxidases in C. elegans and in other nematode species. Remarkably, we show that most of the C. elegans acyl-CoA oxidases that participate in ascaroside biosynthesis contain a conserved ATP-binding pocket that lies at the dimer interface, and we identify key residues in this binding pocket. ATP binding induces a structural change that is associated with tighter binding of the FAD cofactor. Mutations that disrupt ATP binding reduce FAD binding and reduce enzyme activity. Thus, ATP may serve as a regulator of acyl-CoA oxidase activity, thereby directly linking ascaroside biosynthesis to ATP concentration and metabolic state.
Kinetic isotope effect studies on milk xanthine oxidase and on chicken liver xanthine dehydrogenase
International Nuclear Information System (INIS)
D'Ardenne, S.C.; Edmondson, D.E.
1990-01-01
The effect of isotopic substitution of the 8-H of xanthine (with 2 H and 3 H) on the rate of oxidation by bovine xanthine oxidase and by chicken xanthine dehydrogenase has been measured. V/K isotope effects were determined from competition experiments. No difference in H/T (V/K) values was observed between xanthine oxidase and xanthine dehydrogenase. Xanthine dehydrogenase exhibited a larger T/D (V/K) value than that observed for xanthine oxidase. Observed H/T (V/K) values for either enzyme are less than those H/T (V/K) values calculated with D/T (V/K) data. These discrepancies are suggested to arise from the presence of a rate-limiting step(s) prior to the irreversible C-H bond cleavage step in the mechanistic pathways of both enzymes. These kinetic complexities preclude examination of whether tunneling contributes to the reaction coordinate for the H-transfer step in each enzyme. No observable exchange of tritium with solvent is observed during the anaerobic incubation of [8- 3 H]xanthine with either enzyme, which suggests the reverse commitment to catalysis (C r ) is essentially zero. With the assumption of adherence to reduced mass relationships, the intrinsic deuterium isotope effect ( D k) for xanthine oxidation is calculated. By the use of these values and steady-state kinetic data, the minimal rate for the hydrogen-transfer step is calculated to be ∼75-fold faster than k cat for xanthine oxidase and ∼10-fold faster than k cat for xanthine dehydrogenase. Values calculated for each enzyme were found to be identical within experimental uncertainty
Slesak, Günther; Douangdala, Phouvieng; Inthalad, Saythong; Silisouk, Joy; Vongsouvath, Manivanh; Sengduangphachanh, Amphonesavanh; Moore, Catrin E; Mayxay, Mayfong; Matsuoka, Hiroyuki; Newton, Paul N
2009-07-29
Chromobacterium violaceum is a Gram negative facultative anaerobic bacillus, found in soil and stagnant water, that usually has a violet pigmented appearance on agar culture. It is rarely described as a human pathogen, mostly from tropical and subtropical areas. A 53 year-old farmer died with Chromobacterium violaceum septicemia in Laos. A modified oxidase method was used to demonstrate that this violacious organism was oxidase positive. Forensic analysis of the glucose-6-phosphate dehydrogenase genotypes of his family suggest that the deceased patient did not have this possible predisposing condition. C. violaceum infection should be included in the differential diagnosis in patients presenting with community-acquired septicaemia in tropical and subtropical areas. The apparently neglected but simple modified oxidase test may be useful in the oxidase assessment of other violet-pigmented organisms or of those growing on violet coloured agar.
Papagianni, Maria; Avramidis, Nicholaos
2012-08-10
The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. Copyright © 2012 Elsevier Inc. All rights reserved.
Direction of the reactivity of vanillyl-alcohol oxidase with 4-alkylphenols
van den Heuvel, RHH; Fraaije, MW; van Berkel, WJH; Heuvel, Robert H.H. van den; Berkel, Willem J.H. van
2000-01-01
The covalent flavoprotein vanillyl-alcohol oxidase (VAO) predominantly converts short-chain 4-alkylphenols, like 4-ethylphenol, to (R)-1-(4'-hydroxyphenyl)alcohols and medium-chain 4-alkylphenols, like 4-butylphenol, to 1-(4'-hydroxyphenyl)alkenes. Crystallographic studies have indicated that the
Effect of gamma irradiation on aspergillus niger for enhanced production of glucose oxidase
International Nuclear Information System (INIS)
Zia, M.A.; Rasul, S.
2012-01-01
Developing countries have a high prevalence of diabetes and their populations are suffering from associated adverse factors. Such a frequency requires more effective diagnosis, mostly achieved by glucose diagnostic kits. Although high priced kits are available in market but local production of such kits can be highly cost effective and may confer the decline in incidence of the disease. Glucose oxidase is the key enzyme for the determination of glucose in such analytical tools. Enhanced production of glucose oxidase was performed by mutagenesis of Aspergillus niger by gamma irradiation. A dose of 80 krad was found as optimum for derivation of positive mutant strains. Following the screening by triton X-100 and 2-deoxy-D-glucose, the selected strains A. niger G-80-A, A. niger G-80-B and A. niger G-80-C showed 27.5, 23.20 and 20.55 UmL/sub -1/ glucose oxidase activity in enzyme diffusion zone test; which is much higher to parental strain (7.5 UmL/sup -1/). A. niger G-80-A was subjected to submerged fermentation and obtained highest yields after 36 h, at CSL 2%, pH 6.5, 30 degree C, KH/sub 2/PO/sub 4/ 0.8% and urea 0.3%. Partial purification by ammonium sulfate resulted in 175 UmL/sup -1/ of glucose oxidase activity after dialysis. Kinetic parameters like optimum pH, temperature, K/sub m/ and V/sub max/ were found to be 6.0 (180 +- 2 UmL/sup -1/), 30 degree C (185 +- 0.5 UmL/sup -1/), 5.26 mM and 400 U mL/sup -1/, respectively. Active inhibition of the enzyme by increasing concentration of PLP in reaction mixture confirmed the presence of functional lysyl residue on the active site of enzyme. (author)
Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers
Directory of Open Access Journals (Sweden)
Pattana Srifah Huehne
2013-08-01
Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.
Reconstitution of apoglucose oxidase with FAD conjugates for biosensoring of progesterone
Posthuma-Trumpie, G.A.; Berg, van den W.A.M.; Wiel, van de D.F.M.; Schaaper, W.M.M.; Korf, J.; Berkel, van W.J.H.
2007-01-01
The reconstitution of Aspergillus niger apoglucose oxidase (apoGOx) with FAD conjugates for biosensoring of progesterone was investigated. ApoGOx prepared by partial unfolding of the protein under acidic conditions consisted of reconstitutable monomers (50 ± 10%), reconstitutable dimers (20 ± 10%)
Localization of Glucose Oxidase and Catalase Activities in Aspergillus niger
Witteveen, Cor F.B.; Veenhuis, Marten; Visser, Jaap
The subcellular localization of glucose oxidase (EC 1.1.3.4) in Aspergillus niger N400 (CBS 120.49) was investigated by (immuno)cytochemical methods. By these methods, the bulk of the enzyme was found to be localized in the cell wall. In addition, four different catalases (EC 1.11.1.6) were
Mechanism-Based Inhibitors of Cytokinin Oxidase/Dehydrogenase Attack FAD Cofactor
Czech Academy of Sciences Publication Activity Database
Kopečný, D.; Šebela, M.; Briozzo, P.; Spíchal, Lukáš; Houba-Hérin, N.; Mašek, V.; Joly, N.; Madzak, C.; Anzenbacher, P.; Laloue, M.
2008-01-01
Roč. 380, č. 5 (2008), s. 886-899 ISSN 0022-2836 R&D Projects: GA ČR(CZ) GP522/08/P113 Institutional research plan: CEZ:AV0Z50380511 Keywords : cytokinin oxidase/dehydrogenase * cytokinin signaling * protein structure Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.146, year: 2008
Araújo Castro, Jacqueline; Gomes Ferreira, Monique Drielle; Santana Silva, Raner José; Andrade, Bruno Silva; Micheli, Fabienne
2017-01-01
The alternative oxidase (AOX) protein is present in plants, fungi, protozoa and some invertebrates. It is involved in the mitochondrial respiratory chain, providing an alternative route for the transport of electrons, leading to the reduction of oxygen to form water. The present study aimed to characterize the family of AOX genes in mandarin (Citrus clementina) and sweet orange (Citrus sinensis) at nucleotide and protein levels, including promoter analysis, phylogenetic analysis and C. sinensis gene expression. This study also aimed to do the homology modeling of one AOX isoform (CcAOXd). Moreover, the molecular docking of the CcAOXd protein with the ubiquinone (UQ) was performed. Four AOX genes were identified in each citrus species. These genes have an open reading frame (ORF) ranging from 852 bp to 1150 bp and a number of exons ranging from 4 to 9. The 1500 bp-upstream region of each AOX gene contained regulatory cis-elements related to internal and external response factors. CsAOX genes showed a differential expression in citrus tissues. All AOX proteins were predicted to be located in mitochondria. They contained the conserved motifs LET, NERMHL, LEEEA and RADE-H as well as several putative post-translational modification sites. The CcAOXd protein was modeled by homology to the AOX of Trypanosona brucei (45% of identity). The 3-D structure of CcAOXd showed the presence of two hydrophobic helices that could be involved in the anchoring of the protein in the inner mitochondrial membrane. The active site of the protein is located in a hydrophobic environment deep inside the AOX structure and contains a diiron center. The molecular docking of CcAOXd with UQ showed that the binding site is a recessed pocket formed by the helices and submerged in the membrane. These data are important for future functional studies of citrus AOX genes and/or proteins, as well as for biotechnological approaches leading to AOX inhibition using UQ homologs.
Directory of Open Access Journals (Sweden)
Mayxay Mayfong
2009-07-01
Full Text Available Abstract Background Chromobacterium violaceum is a Gram negative facultative anaerobic bacillus, found in soil and stagnant water, that usually has a violet pigmented appearance on agar culture. It is rarely described as a human pathogen, mostly from tropical and subtropical areas. Case presentation A 53 year-old farmer died with Chromobacterium violaceum septicemia in Laos. A modified oxidase method was used to demonstrate that this violacious organism was oxidase positive. Forensic analysis of the glucose-6-phosphate dehydrogenase genotypes of his family suggest that the deceased patient did not have this possible predisposing condition. Conclusion C. violaceum infection should be included in the differential diagnosis in patients presenting with community-acquired septicaemia in tropical and subtropical areas. The apparently neglected but simple modified oxidase test may be useful in the oxidase assessment of other violet-pigmented organisms or of those growing on violet coloured agar.
Zhang, Xinxing; Jones, Rachel A.; Bruner, Steven D.; Butcher, Rebecca A.
2016-01-01
Caenorhabditis elegans secretes ascarosides as pheromones to communicate with other worms and to coordinate the development and behavior of the population. Peroxisomal β-oxidation cycles shorten the side chains of ascaroside precursors to produce the short-chain ascaroside pheromones. Acyl-CoA oxidases, which catalyze the first step in these β-oxidation cycles, have different side chain-length specificities and enable C. elegans to regulate the production of specific ascaroside pheromones. Here, we determine the crystal structure of the acyl-CoA oxidase 1 (ACOX-1) homodimer and the ACOX-2 homodimer bound to its substrate. Our results provide a molecular basis for the substrate specificities of the acyl-CoA oxidases and reveal why some of these enzymes have a very broad substrate range, whereas others are quite specific. Our results also enable predictions to be made for the roles of uncharacterized acyl-CoA oxidases in C. elegans and in other nematode species. Remarkably, we show that most of the C. elegans acyl-CoA oxidases that participate in ascaroside biosynthesis contain a conserved ATP-binding pocket that lies at the dimer interface, and we identify key residues in this binding pocket. ATP binding induces a structural change that is associated with tighter binding of the FAD cofactor. Mutations that disrupt ATP binding reduce FAD binding and reduce enzyme activity. Thus, ATP may serve as a regulator of acyl-CoA oxidase activity, thereby directly linking ascaroside biosynthesis to ATP concentration and metabolic state. PMID:27551084
Graphene-glucose oxidase bioanodes for enzymatic biofuel cells
DEFF Research Database (Denmark)
Tang, Jing; Werchmeister, Rebecka Maria Larsen; Engelbrekt, Christian
2017-01-01
as supporting material, polyethyleneimine (PEI) as linker and glucose oxidase (GOD) as the chosen enzyme. GOD can catalyze oxidation of glucose to gluconolactone, but needs a mediator to assist electron transfer between the enzyme and electrodes. The redox molecule ferrocene carboxylic acid (Fc...... and systematically investigated. The assembled EBFCs show good reproducibility. EBFCs provide maximum output power density 2.47 μW cm-2 at 35 ℃, indicating the optimized activity of EBFCs fed with glucose....