
Sample records for oxidase ppox gene

  1. Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    Directory of Open Access Journals (Sweden)

    Barbaro Michela


    Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

  2. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver


    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  3. Gene cloning and characterization of NADH oxidase from ...

    African Journals Online (AJOL)

    The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

  4. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    Directory of Open Access Journals (Sweden)

    Coppée Jean-Yves


    Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.

  5. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio


    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  6. Norrie disease gene is distinct from the monoamine oxidase genes


    Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.


    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

  7. Norrie disease gene is distinct from the monoamine oxidase genes. (United States)

    Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A


    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

  8. Gene cloning and characterization of NADH oxidase from ...

    African Journals Online (AJOL)



    Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.

  9. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum (United States)

    Diane Dietrich; Casey Crooks


    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  10. Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

    NARCIS (Netherlands)

    Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.


    We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

  11. Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

    African Journals Online (AJOL)

    The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

  12. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron (United States)

    Hiesel, Rudolf; Brennicke, Axel


    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  13. Role of Lysyl oxidase-like 1 gene polymorphisms in Pakistani patients with pseudoexfoliative glaucoma

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.


    PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been

  14. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum


    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  15. Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef


    Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012

  16. Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

    Directory of Open Access Journals (Sweden)

    O.I. Grabelnych


    Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

  17. Divergence and adaptive evolution of the gibberellin oxidase genes in plants. (United States)

    Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan


    The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

  18. Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins. (United States)

    Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo


    We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

  19. Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav

    International Nuclear Information System (INIS)

    Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.


    ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)

  20. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora). (United States)

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng


    The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  1. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora.

    Directory of Open Access Journals (Sweden)

    Yan Zhao

    Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  2. Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

    Directory of Open Access Journals (Sweden)

    Hamed Esmaeil Lashgarian


    Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

  3. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene. (United States)

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing


    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

  4. Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales. (United States)

    Pöggeler, Stefanie


    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

  5. Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose. (United States)

    Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L


    It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

  6. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia. (United States)

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua


    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.


    Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A


    The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  9. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T


    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  10. Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca. (United States)

    Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D


    The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

  11. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana (United States)

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling


    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  12. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts (United States)

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna


    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  13. Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

    Directory of Open Access Journals (Sweden)

    Li Sheng-Bin


    Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

  14. NADPH oxidase is involved in regulation of gene expression and ROS overproduction in soybean (Glycine max L. seedlings exposed to cadmium

    Directory of Open Access Journals (Sweden)

    Jagna Chmielowska-Bąk


    Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.

  15. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  16. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum. (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  17. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori. (United States)

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan


    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes

    Directory of Open Access Journals (Sweden)

    Deepak Verma


    Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.

  19. Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene. (United States)

    Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H


    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

  20. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    Energy Technology Data Exchange (ETDEWEB)

    Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)


    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  1. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants. (United States)

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O


    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

  2. NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis (United States)

    Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.


    Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379

  3. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    Directory of Open Access Journals (Sweden)

    Buades-Rotger M


    Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A

  4. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    Energy Technology Data Exchange (ETDEWEB)

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)


    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  5. Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines. (United States)

    Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin


    Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

  6. Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory. (United States)

    Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David


    A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

  7. Tet1 oxidase regulates neuronal gene transcription, active DNA hydroxymethylation, object location memory, and threat recognition memory

    Directory of Open Access Journals (Sweden)

    Dinesh Kumar


    Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

  8. Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon. (United States)

    Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G


    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

  9. Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1 (United States)

    Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung


    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

  10. Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression

    Czech Academy of Sciences Publication Activity Database

    Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.


    Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004

  11. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch


    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  12. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences (United States)

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel


    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  13. Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei. (United States)

    Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun


    Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda. (United States)

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong


    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Functionally undefined gene, yggE, alleviates oxidative stress generated by monoamine oxidase in recombinant Escherichia coli. (United States)

    Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito


    Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.

  16. Neonatal epileptic encephalopathy caused by mutations in the PNPO gene encoding pyridox(am)ine 5'-phosphate oxidase. (United States)

    Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T


    In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).

  17. Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

    Directory of Open Access Journals (Sweden)

    Yuange Wang


    Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC. regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

  18. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene. (United States)

    Rathinam, T; Gadde, U; Chapman, H D


    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

  19. Dysbindin and d-amino-acid-oxidase gene polymorphisms associated with positive and negative symptoms in schizophrenia

    DEFF Research Database (Denmark)

    Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid


    -amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...

  20. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes. (United States)

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto


    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  1. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae. (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne


    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  2. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes. (United States)

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M


    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  3. Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder. (United States)

    Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G


    Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

  4. Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population. (United States)

    Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi


    Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

  5. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen. (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K


    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  6. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza


    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa


    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...

  7. Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study. (United States)

    Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina


    Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

  8. Species phylogeny of the subgenus parides (Lepidoptera: papilionidae) based in sequences of citochrome oxidase I gene

    International Nuclear Information System (INIS)

    Gutierrez R, Ingrid Marcela; Fagua, Giovanny


    Parides hubner is a terminal taxon of troidini, an aposematic butterfly group that is diverse in the tropics and subtropics, and a model of Mullerian and Batesian mimetic complexes. Several American species of parides are sympatric and include populations with intraspecific variation in color pattern, thus creating confusion on their taxonomic status, mainly in Colombia where the biota of North and South America converge. This work presents a phylogenetic hypothesis of these butterflies and proposes a more robust definition of some taxa. For this, 15 taxa of the subgenus parides were analyzed as ingroup; species of other two genera of troidini, closer to parides, were used as out-group. DNA was extracted using the pascual et al. (1997) protocol and quiagen dnaeasy kit. A terminal fragment of cytochrome oxidase I gen (476 bp) were amplified. We obtained a phylogenetic approximation using maximum parsimony and evaluated the branch support with jackknife and absolute bremer support. We also conducted a bayesian analysis. The resulting phylogenetic hypothesis suggested that parides is a paraphyletic group; the molecular evidence support one species and five subspecies. The analyzed taxa were divided in three principal groups coincident with the lysander (group 1) and aeneas (groups 1 and 2) groups proposed by rothschild and jordan (1906).

  9. [Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test]. (United States)

    Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo


    Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.

  10. Mitochondrial cytochrome oxidase I gene analysis indicates a restricted genetic background in Finnish noble crayfish (Astacus astacus stocks

    Directory of Open Access Journals (Sweden)

    Makkonen J.


    Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.

  11. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China. (United States)

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai


    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  12. Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients.

    Directory of Open Access Journals (Sweden)

    Laura A Nucci

    Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in

  13. Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation (United States)

    Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten


    Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

  14. Mutations of dual oxidase 2 (DUOX2) gene among patients with permanent and transient congenital hypothyroidism

    International Nuclear Information System (INIS)

    Rostampour, N.; Tajaddini, M.H.; Hashemipour, M


    Objective: The prevalence of congenital hypothyroidism (CH) is high in Isfahan, Iran. In addition, it has different etiologies compared with other countries. The rate of parental consanguinity is also high in the city. Moreover, DUOX2 gene is effective in transient CH and permanent CH due to dyshormonogenesis. Therefore, the aim of this research was to investigate the mutations of DUOX2 gene in patients with transient CH and permanent CH due to dyshormonogenesis. Methodology: In this descriptive, prospective study, patients diagnosed with transient and permanent CH due to dyshormonogenesis during CH screening program were selected. Venous blood samples were obtained to determine the 3 mutations (Q36H, R376W, and D506N) of DUOX2 gene using polymerase chain reaction (PCR) method by specific primers and complementary methods such as restriction fragment length polymorphism (RFLP) and single-strand conformation polymorphism (SSCP). Results: In this study, 25 patients with transient CH and 33 subjects with permanent CH due to dyshormonogenesis were studied. In addition, 30 children were studied as the control group. We did not find any mutations of the 3 mentioned mutations of DUOX2 gene. Conclusion: Considering the findings of the current study, further studies with other methods are required to evaluate other gene mutations such as pendrin, sodium-iodide symporter (NIS) and thyroglobulin. (author)

  15. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate. (United States)

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K


    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

  16. Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences. (United States)

    Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R


    Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.

  17. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Craddock, N.; Daniels, J.; Roberts, E. [Univ. of Wales, College of Medicine, Cardiff (United Kingdom)] [and others


    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  18. Utility of the cytochrome c oxidase subunit I gene for the diagnosis of toxoplasmosis using PCR. (United States)

    Feng, Xue; Norose, Kazumi; Li, Kexin; Hikosaka, Kenji


    Toxoplasmosis is caused by the protozoan parasite Toxoplasma gondii, which belongs to the phylum Apicomplexa. Since this parasite causes severe clinical symptoms in immunocompromised patients, early diagnosis of toxoplasmosis is essential. PCR is currently used for early diagnosis, but there is no consensus regarding the most effective method for amplifying Toxoplasma DNA. In this study, we considered the utility of the cytochrome c subunit I (cox1) gene, which is encoded in the mitochondrial DNA of this parasite, as a novel target of PCR for the diagnosis of toxoplasmosis. To do this, we compared its copy number per haploid nuclear genome and the detection sensitivity of cox1-PCR with the previously reported target genes B1 and 18S rRNA and the AF146527 repeat element. We found that the copy number of cox1 was high and that the PCR using cox1 primers was more efficient at amplifying Toxoplasma DNA than the other PCR targets examined. In addition, PCR using clinical samples indicated that the cox1 gene would be useful for the diagnosis of toxoplasmosis. These findings suggest that use of cox1-PCR would facilitate the diagnosis of toxoplasmosis in clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice. (United States)

    Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang


    Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

  20. [Sequencing of mitochondrial DNA cytochrome oxidase subunit I gene in sarcosaphagous flies from 14 provinces in China]. (United States)

    Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong


    To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and

  1. Monoamine Oxidase A (MAOA Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

    Directory of Open Access Journals (Sweden)

    Man K. Xu


    Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

  2. A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis. (United States)

    Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming


    A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

  3. Association between monoamine oxidase A gene promoter 30 bp repeat polymorphism and tardive dyskinesia in Chinese schizophrenics

    Institute of Scientific and Technical Information of China (English)

    Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou


    BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients

  4. Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study. (United States)

    Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng


    The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email:

  5. Prevalence and genotypic characterization of bovine Echinococcus granulosus isolates by using cytochrome oxidase 1 (Co1) gene in Hyderabad, Pakistan. (United States)

    Ehsan, Muhammad; Akhter, Nasreen; Bhutto, Bachal; Arijo, Abdullah; Ali Gadahi, Javaid


    Cystic echinococcosis is an important zoonotic disease; it has serious impacts on animals as well as human health throughout the world. Genotypic characterization of Echinocossus granulosus (E. granulosus) in buffaloes has not been addressed in Pakistan. Therefore, the present study was conducted to evaluate the incidence and genotypic characterization of bovine E. granulosus. Out of 832 buffaloes examined, 112 (13.46%) were found infected. The favorable site for hydatid cyst development was liver (8.65%) followed by lungs (4.80%). The rate of cystic echinococcosis was found higher in females 14.43% than males 9.77%. The females above seven years aged were more infected as compared to the young ones. The partial sequence of mitochondrial cytochrome oxidase 1 (CO1) gene was used for identification and molecular analysis of buffalo's E. granulosus isolates. The alignment of redundant sequences were compared with already identified 10 genotypes available at National Centre for Biotechnology Information (NCBI) GenBank. The sequencing and phylogenetic analysis of all randomly selected buffalo isolates were belong to the G1- G3 complex (E. granulosus sensu stricto). All sequences were diverse from the reference sequence. No one showed complete identity to the buffalo strain (G3), representing substantial microsequence variability in G1, G2 and G3 genotypes. We evaluated the echinococcal infectivity and first time identification of genotypes in buffaloes in Sindh, Pakistan. This study will lead to determine accurate source of this zoonotic disease to humans in Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon). (United States)

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K


    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  7. RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2 Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L. Papaya Fruit

    Directory of Open Access Journals (Sweden)

    Rogayah Sekeli


    Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  8. Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene. (United States)

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip


    The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.

  9. Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

    Directory of Open Access Journals (Sweden)

    Hoi-Sen Yong

    Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.

  10. Probing cytokinin homeostasis in Arabidopsis thaliana by constitutively overexpressing two forms of the maize cytokinin oxidase/dehydrogenase 1 gene

    Czech Academy of Sciences Publication Activity Database

    Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.


    Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006

  11. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

    Czech Academy of Sciences Publication Activity Database

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra


    Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013

  12. The Arabidopsis aldehyde oxidase 3 (AA03) gene product catalyzes the final step in abscisic acid biosynthesis in leaves

    NARCIS (Netherlands)

    Seo, M.; Peeters, A.J.M.; Koiwai, H.; Oritani, T.; Marion-Poll, A.; Zeevaart, J.A.D.; Koornneef, M.; Kamiya, Y.; Koshiba, T.


    Abscisic acid (ABA) is a plant hormone involved in seed development and germination and in responses to various environmental stresses. The last step of ABA biosynthesis involves oxidation of abscisic aldehyde, and aldehyde oxidase (EC is thought to catalyze this reaction. An aldehyde

  13. The terminal oxidases of Paracoccus denitrificans

    NARCIS (Netherlands)

    de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.

    Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to

  14. Isolated sulfite oxidase deficiency. (United States)

    Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R


    Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

  15. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste (United States)

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin


    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  16. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Verónica Loera-Castañeda


    Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  17. D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Werge, Thomas


    The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...

  18. [The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica]. (United States)

    Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M


    Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

  19. The Characteristics of Cytochrome C Oxidase Gene Subunit I in Wild Silkmoth Cricula trifenestrata Helfer and Its Evaluation for Species Marker

    Directory of Open Access Journals (Sweden)



    Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.

  20. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs. (United States)

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio


    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

  1. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria. (United States)

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M


    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

  2. Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism. (United States)

    Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E


    In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

  3. Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene. (United States)

    Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan


    Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

  4. Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿† (United States)

    Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.


    The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

  5. Burkholderia pseudomallei Evades Nramp1 (Slc11a1- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

    Directory of Open Access Journals (Sweden)

    Veerachat Muangsombut


    Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence

  6. Genetics Home Reference: isolated sulfite oxidase deficiency (United States)

    ... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...

  7. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium. (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande


    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  8. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium (United States)

    Li, Wande


    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  9. Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C. (United States)

    Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P


    Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

  10. Effects upon metabolic pathways and energy production by Sb(III and As(III/Sb(III-oxidase gene aioA in Agrobacterium tumefaciens GW4.

    Directory of Open Access Journals (Sweden)

    Jingxin Li

    Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.

  11. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons. (United States)

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T


    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

  12. [Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidasegene variations and the risk of noise-induced hearing loss]. (United States)

    Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F


    Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidasegene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidasegene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

  13. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza. (United States)

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa


    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

  14. Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026. (United States)

    Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo


    Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

  15. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants (United States)

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.


    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  16. Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco. (United States)

    Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H


    The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

  17. Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes. (United States)

    Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E


    Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

  18. Expression of the genes dual oxidase 2, lipocalin 2 and regenerating islet-derived 1 alpha in Crohn's disease

    DEFF Research Database (Denmark)

    Csillag, C.; Nielsen, O.H.; Vainer, Ben


    colonoscopically from 33 CD patients and from 17 control subjects. All controls and 10 CD patients were medication-free at the time of colonoscopy. The Human Genome U133 Plus 2.0 GeneChip Array was used for gene profiling. Hybridization data were analysed with dChip software. Results were confirmed by real......-time reverse transcriptase polymerase chain reaction (RT-PCR). Protein product expression of selected genes was assessed by immunohistochemistry using the Envision+ visualization technique. RESULTS: The expression profile was not homogeneous with the statistical cut-point settings applied. In comparison......, fold change 3.9), codes for a mitogenic protein; this could not be confirmed by RT-PCR. Medication-free patients had no differentially expressed genes as compared with controls. Immunohistochemistry indicated that these proteins were produced by epithelial cells (REG1A, LCN2) and leucocytes (DUOX2...

  19. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette


    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  20. Confirmation of Two Sibling Species among Anopheles Fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene

    Directory of Open Access Journals (Sweden)

    Saied Reza Naddaf


    Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phy­logenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-join­ing method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individ­uals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

  1. Reducing cytoplasmic polyamine oxidase activity in Arabidopsis increases salt and drought tolerance by reducing reactive oxygen species production and increasing defense gene expression

    Directory of Open Access Journals (Sweden)

    G.H.M. eSagor


    Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.

  2. Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata. (United States)

    Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du


    Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder (United States)

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.


    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  4. Population genetic structure of cotton pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae) using mitochondrial cytochrome oxidase I (COI) gene sequences from India. (United States)

    Sridhar, J; Chinna Babu Naik, V; Ghodke, A; Kranthi, S; Kranthi, K R; Singh, B P; Choudhary, J S; Krishna, M S R


    Pink bollworm (PBW), Pectinophora gossypiella is one of the most destructive pest's globally inflicting huge economic losses in cotton even during later stages of crop growth. In the present investigation, the population genetic structure, distribution, and genetic diversity of P. gossypiella in cotton growing zones of India using partial mitochondrial DNA cytochrome oxidase-I (COI) gene was addressed. The overall haplotype (Hd), number of nucleotide differences (K), and nucleotide diversity (π) were 0.3028, 0.327, and 0.00047, respectively which suggest that entire population exhibited low level of genetic diversity. Zone-wise clustering of population revealed that central zone recorded low level of Hd (0.2730) as compared to north (0.3619) and south (0.3028) zones. The most common haplotype (H1) reported in all 19 locations could be proposed as ancestral/original haplotype. This haplotype with one mutational step formed star-like phylogeny connected with 11 other haplotypes. The phylogenetic relationship studies revealed that most haplotypes of populations are closely related to each other. Haplotype 5 was exclusively present in Dharwad (South zone) shared with populations of Hanumangarh and Bathinda (North zone). The result indicated that there is no isolation by distance effect among the Indian populations of PBW. The present study reports a low genetic diversity among PBW populations of India and H1, as ancestral haplotype from which other haplotypes have evolved suggests that the migration and dispersal over long distance and invasiveness are major factors.

  5. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene (United States)

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom


    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  6. Himantura tutul sp. nov. (Myliobatoidei: Dasyatidae), a new ocellated whipray from the tropical Indo-West Pacific, described from its cytochrome-oxidase I gene sequence. (United States)

    Borsa, Philippe; Durand, Jean-Dominique; Shen, Kang-Ning; Arlyza, Irma S; Solihin, Dedy D; Berrebi, Patrick


    It has been previously established that the Leopard Whipray, Himantura leoparda, consists of two genetically isolated, cryptic species, provisionally designated as 'Cluster 1' and 'Cluster 4' (Arlyza et al., Mol. Phylogenet. Evol. 65 (2013) [1]). Here, we show that the two cryptic species differ by the spotting patterns on the dorsal surface of adults: Cluster-4 individuals tend to have larger-ocellated spots, which also more often have a continuous contour than Cluster-1 individuals. We show that H. leoparda's holotype has the typical larger-ocellated spot pattern, designating Cluster 4 as the actual H. leoparda. The other species (Cluster 1) is described as Himantura tutul sp. nov. on the basis of the nucleotide sequence of a 655-base pair fragment of its cytochrome-oxidase I gene (GenBank accession No. JX263335). Nucleotide synapomorphies at this locus clearly distinguish H. tutul sp. nov. from all three other valid species in the H. uarnak species complex, namely H. leoparda, H. uarnak, and H. undulata. H. tutul sp. nov. has a wide distribution in the Indo-West Pacific, from the shores of eastern Africa to the Indo-Malay archipelago. H. leoparda under its new definition has a similarly wide Indo-West Pacific distribution. Copyright © 2013 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  7. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors. (United States)

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

  8. Genetic structure of the snakehead murrel, Channa striata (channidae based on the cytochrome c oxidase subunit I gene: influence of historical and geomorphological factors

    Directory of Open Access Journals (Sweden)

    Jamsari Amirul Firdaus Jamaluddin


    Full Text Available Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F ST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

  9. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene. (United States)

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom


    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets.

  10. The diamine oxidase gene is associated with hypersensitivity response to non-steroidal anti-inflammatory drugs.

    Directory of Open Access Journals (Sweden)

    José A G Agúndez

    Full Text Available UNLABELLED: Non-steroidal anti-inflammatory drugs (NSAIDs are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191, which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR  = 1.7 (95% CI  = 1.3-2.1; Pc  = 0.0003 with a gene-dose effect (P = 0.0001. The association was replicated in two populations from different geographic areas (Pc  = 0.008 and Pc  = 0.004, respectively. CONCLUSIONS AND IMPLICATIONS: The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response.

  11. A role for NADPH oxidase in antigen presentation

    Directory of Open Access Journals (Sweden)

    Gail J Gardiner


    Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.

  12. Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia. (United States)

    Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain


    The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.

  13. The efficacy of a nested PCR in detecting cytochrome c oxidase subunit 1 gene of Sarcoptes scabiei var. Hominis for diagnosing scabies. (United States)

    Hahm, J E; Kim, C W; Kim, S S


    A widespread scabies infestation, associated to long-term residence in nursing homes, is becoming a serious issue in developed countries. Mineral oil examination is regarded as the gold standard in diagnosing scabies, but the sensitivity of this method is generally low-approximately 50%. Molecular tests may contribute to enhance the sensitivity of current tests for laboratory diagnosis of human scabies. In this study, we developed new primers for a nested PCR for the cytochrome c oxidase subunit 1 (cox1) gene of Sarcoptes scabiei var. hominis to increase the sensitivity of a previously developed conventional PCR. Clinically suspected scabies patients underwent dermoscopy-guided skin scraping with microscopic examination. The diagnosis was positive for scabies when mites or eggs were found under the microscope, and patients were then designated as 'microscopy-positive'. Patients in the 'microscopy-negative' group presented with negative microscopic results. Skin scrapings were collected from both groups for PCR. Of the total 63 samples, 28 were microscopy-positive and 35 were negative with no differences in sex and age between the two groups. All microscopically proven scabies cases were positive with the cox1 nested PCR. Among microscopy-negative ones, S. scabiei DNA was detected in 9 samples. If sensitivity of the cox1 nested PCR is considered 100% (95% CI, 90.51-100), then sensitivity of microscopy is 75.68% (95% CI, 58.80-88.23; P = 0.004). Nested PCR can be successfully used as an alternative method for diagnosing suspected scabies patient. Therefore, infection control measures and treatments can be initiated before significant transmission occurs, minimizing the risk of outbreaks. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  14. Identification of Forensically Important Calliphoridae and Sarcophagidae Species Collected in Korea Using SNaPshot Multiplex System Targeting the Cytochrome c Oxidase Subunit I Gene

    Directory of Open Access Journals (Sweden)

    Ji Hye Park


    Full Text Available Estimation of postmortem interval (PMI is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin. The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI nucleotide sequences. The molecular identification method commonly uses Sanger’s nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger’s nucleotide sequencing, single-nucleotide polymorphisms (SNPs in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger’s nucleotide sequencing.

  15. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis. (United States)

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth


    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

  16. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat. (United States)

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou


    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  17. Visual expression analysis of the responses of the alternative oxidase gene (aox1) to heat shock, oxidative, and osmotic stresses in conidia of citric acid-producing Aspergillus niger. (United States)

    Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro


    The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Monoamine Oxidase Inhibitors (MAOIs) (United States)

    ... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...

  19. Effect of a heme oxygenase-1 inducer on NADPH oxidase ...

    African Journals Online (AJOL)

    Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...

  20. Defects in Nicotinamide-adenine Dinucleotide Phosphate Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel DiseaseSummary

    Directory of Open Access Journals (Sweden)

    Patti Hayes


    Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase

  1. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry. (United States)

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi


    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.). (United States)

    Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na


    Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

  3. In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

    International Nuclear Information System (INIS)

    Mahmood, T.; Rehman, M.; Aziz, E.


    Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

  4. Genetic characterization of the partial mitochondrial cytochrome oxidase c subunit I (cox 1) gene of the zoonotic parasitic nematode, Ancylostoma ceylanicum from humans, dogs and cats. (United States)

    Ngui, Romano; Mahdy, Mohammed A K; Chua, Kek Heng; Traub, Rebecca; Lim, Yvonne A L


    Ancylostoma ceylanicum is the only zoonotic hookworm species that is able to produce patent infections in humans with the majority of cases reported in South East Asia. Over the past few years, there have been an increasing number of studies investigating the prevalence of this parasitic zoonosis using molecular diagnostic tools and a single genetic locus as marker for species identification. As there can be limitations in using a single genetic locus for epidemiological studies and genetic discrimination, the complementary use of a more variable locus will provide additional evidence to support the zoonotic exchange of hookworm species between humans and animals. In the present study, the cytochrome c oxidase subunit 1 (cox 1) sequence of A. ceylanicum from positive human and animal fecal samples were determined and compared with published reference sequences. Phylogenetic analysis demonstrated that isolates of A. ceylanicum were divided into two clusters, one consisting 3 human isolates and the other comprising 19 isolates of human and animal origin from different geographical locations within Malaysia. The two groups of A. ceylanicum could be distinguished from one another through five fixed nucleotide differences at locations 891, 966, 1008, 1077 and 1083. The detection of genetically distinct groups and considerable level of genetic variation within the cox 1 sequence of A. ceylanicum might suggest potential haplotype-linked differences in zoonotic, epidemiological and pathobiological characteristics, a hypothesis that still needs further investigation. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Cloning and functional expression of the mitochondrial alternative oxidase gene (aox1) of Aspergillus niger in Lactococcus lactis and its induction by oxidizing conditions. (United States)

    Papagianni, Maria; Avramidis, Nicholaos


    Lactococcus lactis is a widely used food bacterium mainly known for its fermentation metabolism. An important, and for long time overlooked, trait of this species is its ability to perform respiratory metabolism in the presence of heme and under aerobic conditions. There is no evidence however for the presence of an alternative respiration pathway and AOX activity. In this study, a cDNA fragment encoding the mitochondrial alternative oxidase, the enzyme responsible for alternative respiration, from a citric acid producing Aspergillus niger strain was cloned and expressed in L. lactis as a host strain. Expression of aox1 conferred on this organism cyanide-resistant and salicylhydroxamate-sensitive growth. Bioreactor cultures under fully aerobic conditions of the transformed L. lactis showed that the alternative respiratory pathway operates and improves significantly the microorganism's response to oxidizing stress conditions as it enhances biomass production, suppresses lactate formation, and leads to accumulation of large amounts of nisin. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Chronic ethanol increases calcium/calmodulin-dependent protein kinaseIIδ gene expression and decreases monoamine oxidase amount in rat heart muscles: Rescue effect of Zingiber officinale (ginger) extract. (United States)

    Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini


    Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.

  7. Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight. (United States)

    Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi


    Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.

  8. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions. (United States)

    Papagianni, Maria; Avramidis, Nicholaos


    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons. (United States)

    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T


    Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

  10. Oxidase-based biocatalytic processes

    DEFF Research Database (Denmark)

    Ramesh, Hemalata; Woodley, John; Krühne, Ulrich

    interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...

  11. Quinclorac resistance induced by the suppression of the expression of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase genes in Echinochloa crus-galli var. zelayensis. (United States)

    Gao, Yuan; Li, Jun; Pan, Xukun; Liu, Dingrong; Napier, Richard; Dong, Liyao


    We previously reported that the mechanism of quinclorac resistance in Echinochloa crus-galli var. zelayensis may be closely related to ethylene biosynthesis and the detoxification of cyanide. Differences in EcCAS gene sequences and expression levels may result in higher capacity to detoxify cyanide in resistant biotypes, which may avoid cyanide accumulation and avoid more ethylene and cyanide production and then avoid damage. In the present study, we focused on the mechanism of resistance related to ethylene biosynthesis in E. crus-galli var. zelayensis. The fresh weight of susceptible and moderately resistant biotypes were significantly reduced after treatment with quinclorac. However, AOA, an ethylene biosynthesis inhibitor, reduced the impact of quinclorac. On pretreatment with AOA, ethylene production was significantly reduced in the three biotypes. The highly resistant biotype produced less ethylene compared to the other two biotypes. Three ACS and seven ACO genes, which are the key genes in ethylene biosynthesis, were obtained. The expression levels of EcACS-like, EcACS7, and EcACO1 varied in the three biotypes upon treatment with quinclorac, which could be manipulated by AOA. In summary, it is inferred that the expression of EcACS-like, EcACS7, and EcACO1 can be stimulated to varying extent after quinclorac treatment in three E. crus-galli var. zelayensis biotypes, which consequently results in varying levels of ethylene production. Lower expression of these three genes results in more resistance to quinclorac, which may also be related to quinclorac resistance in E. crus-galli var. zelayensis. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Identification of Single Nucleotide Polymorphism (SNP in Mono Amine Oxidase A (MAO-A Gene as a genetic marker for aggressiveness in sheep

    Directory of Open Access Journals (Sweden)

    Eko Handiwirawan


    Full Text Available In the population, there are aggressive sheep in a small number which requires special management those specific animal house and routine management. The purpose of this study was to identify the variation of DNA marker SNP (single nucleotide polymorphism as a genetic marker for the aggressive trait in several of sheep breed. The identification of point mutations in exon 8 of MAO-A gene associated with aggressive behavior in sheep may be further useful to become of DNA markers for the aggressive trait in sheep. Five of sheep breed were used, i.e.: Barbados Black belly Cross sheep (BC, Composite Garut (KG, Local Garut (LG, Composite Sumatra (KS and St. Cross Croix (SC. Duration of ten behavior traits, blood serotonin concentrations and DNA sequence of exon 8 of MAO-A gene from the sheep aggressive and nonaggressive were observed. PROC GLM of SAS Ver. 9.0 program was used to analyze variable behavior and blood serotonin concentrations. DNA polymorphism in exon 8 of MAO-A gene was analyzed using the MEGA software Ver. 4.0. The results show that the percentage of the aggressive rams of each breed was less than 10 percent; except for the KS sheep is higher (23%. Based on the duration of behavior, aggressive sheep group was not significantly different with non aggressive sheep group, except duration of care giving and drinking behavior. It is known that concentration of blood serotonin in aggressive and non aggressive rams was not significantly different. The aggressive trait in sheep has a mechanism or a different cause like that occurs in mice and humans. In this study, aggressive behavior in sheep was not associated with a mutation in exon 8 of MAO-A gene.

  13. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes (United States)

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric


    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  14. Hot or not? Discovery and characterization of a thermostable alditol oxidase from Acidothermus cellulolyticus 11B

    NARCIS (Netherlands)

    Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.

    We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene

  15. Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor

    NARCIS (Netherlands)

    Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.


    A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each

  16. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication. (United States)

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji


    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at

  17. Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae. (United States)

    Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo


    The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

  18. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene. (United States)

    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun


    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (FstNeutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population.

  19. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.

  20. Oxidases as Breast Cancer Oncogens

    National Research Council Canada - National Science Library

    Yeldandi, Anjana


    ...) in a non-tumorigenic human mammary epithelial cell line to ascertain whether oxidase overexpressing cells undergo transformation when exposed to substrate xanthine for XOX and uric acid for UOX...

  1. Glucose oxidase variants with improved properities


    Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje


    Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...

  2. NADPH Oxidases: Progress and Opportunities


    San Martin, Alejandra; Griendling, Kathy K.


    From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...

  3. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants (United States)

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.


    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  4. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

    Directory of Open Access Journals (Sweden)

    Xiuchun Ge

    Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

  5. Lysyl oxidase in colorectal cancer

    DEFF Research Database (Denmark)

    Cox, Thomas R; Erler, Janine T


    Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....

  6. Lysyl oxidase in cancer research

    DEFF Research Database (Denmark)

    Perryman, Lara; Erler, Janine Terra


    Metastasis is the main reason for cancer-associated deaths and therapies are desperately needed to target the progression of cancer. Lysyl oxidase (LOX) plays a pivotal role in cancer progression, including metastasis, and is therefore is an attractive therapeutic target. In this review we...

  7. Peroxisomal Polyamine Oxidase and NADPH-Oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Efthimios A. Andronis


    Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.

  8. Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1 (United States)

    Frisse, Andrea; Pimenta, Maria João; Lange, Theo


    Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

  9. Galactose Oxidase from Fusarium oxysporum - Expression in E. coli and P. pastoris and Biochemical Characterization

    Czech Academy of Sciences Publication Activity Database

    Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.


    Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

  10. Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase


    Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata


    Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...

  11. Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae* (United States)

    Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun


    Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

  12. Exploring flavin-containing carbohydrate oxidases

    NARCIS (Netherlands)

    Ferrari, Alessandro Renato


    Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein

  13. A broad distribution of the alternative oxidase in microsporidian parasites.

    Directory of Open Access Journals (Sweden)

    Bryony A P Williams


    Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.

  14. Effect of different NADH oxidase levels on glucose metabolism by Lactococus lactis : kinetics of intracellular metabolite pools determined by in vivo nuclear magnetic resonance

    NARCIS (Netherlands)

    Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.


    Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX

  15. [The X+ chronic granulomatous disease as a fabulous model to study the NADPH oxidase complex activation]. (United States)

    Stasia, Marie-José


    Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.

  16. Monoamine oxidase and agitation in psychiatric patients. (United States)

    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela


    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Immobilization of oxidases and their analytical applications

    International Nuclear Information System (INIS)

    Yasinzai, M.


    Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)

  18. Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase. (United States)

    Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O


    Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

  19. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer


    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  20. Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes (United States)

    Phil Kersten; Dan Cullen


    Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

  1. The antioxidant properties, cytotoxicity and monoamine oxidase ...

    African Journals Online (AJOL)

    ajl yemi


    Nov 28, 2011 ... Department of Pharmaceutical Chemistry, North-West University, Private Bag X6001, Potchefstroom 2520, ..... on the inhibition of the catabolism of serotonin, .... Structure of human monoamine oxidase B, a drug target for.

  2. Vanillyl-alcohol oxidase, a tasteful biocatalyst

    NARCIS (Netherlands)

    Heuvel, van den R.H.H.; Fraaije, M.W.; Mattevi, A.; Laane, C.; Berkel, van W.J.H.


    The covalent flavoenzyme vanillyl-alcohol oxidase (VAO) is a versatile biocatalyst. It converts a wide range of phenolic compounds by catalysing oxidation, deamination, demethylation, dehydrogenation and hydroxylation reactions. The production of natural vanillin, 4-hydroxybenzaldehyde, coniferyl

  3. Polyphenol Oxidase Enzyme and Inactivation Methods

    Directory of Open Access Journals (Sweden)

    Leman Yılmaz


    Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.

  4. Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees. (United States)

    Haruta, M; Murata, M; Kadokura, H; Homma, S


    An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

  5. Alternative oxidase in the branched mitochondrial respiratory network: an overview on structure, function, regulation, and role

    Directory of Open Access Journals (Sweden)

    Sluse F.E.


    Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.

  6. Cytochrome oxidase assembly does not require catalytically active cytochrome C. (United States)

    Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander


    Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

  7. Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila

    Directory of Open Access Journals (Sweden)

    Alessandro R. Ferrari


    Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.

  8. Paraquat and maneb co-exposure induces noradrenergic locus coeruleus neurodegeneration through NADPH oxidase-mediated microglial activation

    International Nuclear Information System (INIS)

    Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan


    Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental

  9. COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India. (United States)

    Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K


    Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

  10. Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency. (United States)

    Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori


    Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1 (United States)

    Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre


    The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

  12. Crystallization of carbohydrate oxidase from Microdochium nivale

    Czech Academy of Sciences Publication Activity Database

    Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Ostergaard, L. H.; Fuglsang, C. C.; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich


    Roč. 65, č. 6 (2009), s. 638-640 ISSN 1744-3091 R&D Projects: GA AV ČR IAA500500701; GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : carbohydrate oxidase * crystallization * data processing Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.551, year: 2009

  13. Investigation of antihemolytic, xanthine oxidase inhibition ...

    African Journals Online (AJOL)

    Abbreviations: SVEs: Salvia Verbenaca L. aerial part Extracts; CrE: Crud Extract; ChE: Chloroform Extract ; EAE: Ethyl Acetate Extract; AqE : Aqueous Extract ; ROS: Reactive Oxygen Spices; AAPH : 2,2, -Azobis (2-AmidinoPropane) Dihydrochloride ; DPPH: DiPhenyl- Picryl-Hydrazyl; XO: Xanthine Oxidase; Gen: Gentamicin ...

  14. Genetic defects of cytochrome c oxidase assembly

    Czech Academy of Sciences Publication Activity Database

    Pecina, Petr; Houšťková, H.; Hansíková, H.; Zeman, J.; Houštěk, Josef


    Roč. 53, Suppl. 1 (2004), s. S213-S223 ISSN 0862-8408 R&D Projects: GA ČR GA303/03/0749 Institutional research plan: CEZ:AV0Z5011922 Keywords : cytochrome c oxidase * mitochondrial disorders Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 1.140, year: 2004

  15. The antioxidant properties, cytotoxicity and monoamine oxidase ...

    African Journals Online (AJOL)

    Tarchonanthus camphoratus (camphor bush) has been widely used for numerous medicinal purposes. The aim of the present study was to evaluate the antioxidant properties, cytotoxicity and monoamine oxidase inhibition activities of the crude dichloromethane leaf extract of T. camphoratus. The antioxidant activities were ...

  16. Gene (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  17. 驯鹿的皮蝇蛆线粒体CO1基因序列分析%Sequence analysis of mitochondrial cytochrome oxidase 1 (CO1) gene of warble fly larvae from reindeer

    Institute of Scientific and Technical Information of China (English)

    高慧; 杨晓野; 李云章; 莫内; 阿拉腾保力格; 赵治国; 王瑞


    The specificity of mitochondrial cytochrome oxidaae 1 ( CO1) gene sequence of warble fly larvae of unknown species from reindeer in Inner Mongolia region of China were analyzed by molecular biological techniques. The results showed that the size of CO1 gene fragment from UEA7 to UEA10 was approximately 689 bp. The analysis of phylogenic tree showed that the unknown species from the reindeer in Inner Mongolia had high homology with Hypoderma diana France isolate. The differences analysis between the different fly species showed:the sequences between Hypodermatidae and Oestridae were obviously different, ranged from 19. 3% to 25. 5% . The divergences of different fly larvae in deer ranged from 1. 9% to 25. 5% . The divergences of Hypoderma. ranged from 6. 7% to 18. 7%. The divergences of Cephenemyia. ranged from 1. 9% to 9. 6% and the variation of the different Hypoderma diana strains was 6. 0%. It suggested that the nucleotide sequences of the mitochondrial CO1 genes could indicate the phylogenetic relationships among different genera, species and strains to some extent.%利用分子生物学技术对内蒙古驯鹿未定种皮蝇蛆线粒体CO1基因种属特异性序列进行了研究.DNA核苷酸测序结果证实:该种皮蝇线粒体CO1种属特异性基因UEA7到UEA10特殊目标编码区域片段长度约为689 bp;种系发生进化树和同源性分析显示其与鹿皮蝇法国株同源性非常接近,因此确定内蒙古地区感染驯鹿的皮蝇蛆为鹿皮蝇(Hypoderma diana).不同蝇种间差异性分析显示:皮蝇科(Hypodermatidae)与狂蝇科(Oestridae)之间序列差异明显,差异性为19.3%~25.5%;寄生于鹿的不同蝇蛆种间差异性为1.9%~25.5%;皮蝇属(Hypoderma)不同种间差异性为6.7%~18.7%;鹿蝇属(Cephenemyia)不同种间差异性为1.9%~9.6%;而同种不同株的鹿皮蝇差异性为6.0%;说明生物线粒体CO1基因核苷酸序列在一定程度上可反映出种属及株间在进化上的差异性.

  18. A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development. (United States)

    Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J


    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

  19. Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles. (United States)

    Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina


    In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

  20. Role of pH in oxidase variability of Aeromonas hydrophila.


    Hunt, L K; Overman, T L; Otero, R B


    Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

  1. Plasma diamine oxidase activity in asthmatic children

    Directory of Open Access Journals (Sweden)

    Kyoichiro Toyoshima


    Full Text Available Histamine plays an important role in the development of asthmatic symptoms. Diamine oxidase (DAO histaminase, which inactivates histamine, is located in the intestine and kidney and is released into plasma. Plasma DAO activity in asthmatic children was measured by a recently developed high performance liquid chromatographic method using histamine as the DAO substrate. Diamine oxidase activity was higher in severely asthmatic children than in those with mild asthma. A time course study during the acute exacerbation phase revealed that DAO activity rose during acute asthmatic attacks and then decreased gradually over several days. Although the mechanisms of plasma DAO activity increase during acute asthmatic attacks could not be explained, data showed that plasma DAO activity is an important index of histamine metabolism in asthmatics and may relate to some mechanisms of acute exacerbation of airway inflammation. Consequently, fluctuations in plasma DAO can be used as one of various indices of instability in management of asthma.

  2. Lysyl Oxidase and the Tumor Microenvironment

    Directory of Open Access Journals (Sweden)

    Tong-Hong Wang


    Full Text Available The lysyl oxidase (LOX family of oxidases contains a group of extracellular copper-dependent enzymes that catalyze the cross-linking of collagen and elastin by oxidation, thus maintaining the rigidity and structural stability of the extracellular matrix (ECM. Aberrant expression or activation of LOX alters the cellular microenvironment, leading to many diseases, including atherosclerosis, tissue fibrosis, and cancer. Recently, a number of studies have shown that LOX is overexpressed in most cancers and that it is involved in the regulation of tumor progression and metastasis. In contrast, a few reports have also indicated the tumor-suppressing role of LOX. In this short review, we discuss recent research on the correlations between LOX and cancer. Further, the role of LOX in tumor microenvironment remodeling, tumorigenesis, and metastasis and the underlying mechanisms have also been elucidated.

  3. Monoamine oxidase inhibitors from Gentiana lutea. (United States)

    Haraguchi, Hiroyuki; Tanaka, Yasumasa; Kabbash, Amal; Fujioka, Toshihiro; Ishizu, Takashi; Yagi, Akira


    Three monoamine oxidase (MAO) inhibitors were isolated from Gentiana lutea. Their structures were elucidated to be 3-3''linked-(2'-hydroxy-4-O-isoprenylchalcone)-(2'''-hydroxy-4''-O-isoprenyldihydrochalcone) (1), 2-methoxy-3-(1,1'-dimethylallyl)-6a,10a-dihydrobenzo(1,2-c)chroman-6-one and 5-hydroxyflavanone. These compounds, and the hydrolysis product of 1, displayed competitive inhibitory properties against MAO-B which was more effective than MAO-A.

  4. Imaging Monoamine Oxidase in the Human Brain

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean


    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  5. Imaging Monoamine Oxidase in the Human Brain

    International Nuclear Information System (INIS)

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean


    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets

  6. Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis (United States)

    Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie


    The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

  7. Modulation of NADPH oxidase activity by known uraemic retention solutes

    DEFF Research Database (Denmark)

    Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera


    chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...

  8. Chemoenzymatic combination of glucose oxidase with titanium silicalite -1

    DEFF Research Database (Denmark)

    Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.


    Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....

  9. Plasma diamine oxidase levels in pregnancy complicated by threatened abortion. (United States)

    Legge, M; Duff, G B


    Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.

  10. Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.


    Legge, M; Duff, G B


    Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less ga...

  11. Gravity Responsive NADH Oxidase of the Plasma Membrane (United States)

    Morre, D. James (Inventor)


    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  12. NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

    International Nuclear Information System (INIS)

    Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong


    Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

  13. Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803. (United States)

    Pils, D; Schmetterer, G


    Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

  14. Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica. (United States)

    Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine


    Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

  15. H2O2 and NADPH oxidases involve in regulation of 2-(2-phenylethyl)chromones accumulation during salt stress in Aquilaria sinensis calli. (United States)

    Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei


    2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Homozygous variegate porphyria presenting with developmental and language delay in childhood. (United States)

    Pinder, V A E; Holden, S T; Deshpande, C; Siddiqui, A; Mellerio, J E; Wraige, E; Powell, A M


    Variegate porphyria is an autosomal dominant disorder that usually presents with photosensitivity and acute neurological crises in adulthood. It is caused by heterozygous mutations in the protoporphyrinogen oxidase gene (PPOX). A rarer variant, homozygous variegate porphyria (HVP), presents in childhood with recurrent skin blisters and scarring. More variable features of HVP are short stature, brachydactyly, nystagmus, epilepsy, developmental delay and mental retardation. We describe a child who presented with nystagmus, developmental delay and ataxia, combined with a photosensitive eruption. Analysis of porphyrins in plasma, urine and stool supported a clinical diagnosis of HVP. DNA from the patient showed that he is compound heterozygous for two novel missense mutations in the PPOX coding region: c.169G>C (p.Gly57Arg) and c.1259C>G (Pro420Arg). Interestingly, cranial magnetic resonance imaging showed an absence of myelin, a feature not previously reported in HVP, which expands the differential diagnosis of childhood hypomyelinating leucoencephalopathies. © 2013 British Association of Dermatologists.

  17. NADPH oxidase: an enzyme for multicellularity? (United States)

    Lalucque, Hervé; Silar, Philippe


    Multicellularity has evolved several times during the evolution of eukaryotes. One evolutionary pressure that permits multicellularity relates to the division of work, where one group of cells functions as nutrient providers and the other in specialized roles such as defence or reproduction. This requires signalling systems to ensure harmonious development of multicellular structures. Here, we show that NADPH oxidases are specifically present in organisms that differentiate multicellular structures during their life cycle and are absent from unicellular life forms. The biochemical properties of these enzymes make them ideal candidates for a role in intercellular signalling.

  18. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis* (United States)

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  19. Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis. (United States)

    Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.

  20. Crystallization of carbohydrate oxidase from Microdochium nivale

    International Nuclear Information System (INIS)

    Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich


    Industrially used carbohydrate oxidase was successfully crystallized in several forms, diffraction data suitable for structural analysis were collected. Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 Å resolution, with unit-cell parameters a = b = 55.7, c = 610.4 Å and apparent space group P6 2 22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 Å, β = 95.7°. Data sets were collected to a resolution of 2.4 Å. The structure was solved by the molecular-replacement method. Model refinement is currently in progress

  1. Cytochemical Localization of Glucose Oxidase in Peroxisomes of Aspergillus niger

    NARCIS (Netherlands)

    Veenhuis, Marten; Dijken, Johannes Pieter van


    The subcellular localization of glucose oxidase (E.C. in mycelia of Aspergillus niger has been investigated using cytochemical staining techniques. Mycelia from fermenter cultures, which produced gluconic acid from glucose, contained elevated levels of glucose oxidase and catalase. Both

  2. Xanthine oxidase in human skeletal muscle following eccentric exercise

    DEFF Research Database (Denmark)

    Hellsten, Ylva; Frandsen, Ulrik; Orthenblad, N.


    the increase in xanthine oxidase in the muscle there were no detectable changes in the levels of muscle malondialdehyde or in plasma antioxidant capacity up to 4 days post-exercise. 5. It is concluded that eccentric exercise leads to an increased level of xanthine oxidase in human muscle and that the increase...

  3. Laboratory-evolved vanillyl-alcohol oxidase produces natural vanillin

    NARCIS (Netherlands)

    Heuvel, van den R.H.H.; Berg, van den W.A.M.; Rovida, S.; Berkel, van W.J.H.


    The flavoenzyme vanillyl-alcohol oxidase was subjected to random mutagenesis to generate mutants with enhanced reactivity to creosol (2-methoxy-4-methylphenol). The vanillyl-alcohol oxidase-mediated conversion of creosol proceeds via a two-step process in which the initially formed vanillyl alcohol

  4. Optimization of glucose oxidase production by Aspergillus niger

    African Journals Online (AJOL)



    Feb 28, 2011 ... manganese, cobalt, thioglycolic acid, and gluconic acid according to (Liu et al., .... In this experiment duplicate media of glucose 10% were adjusted at different ... Glucose oxidase as a pharmaceutical anti oxidant Drug. Devt. ... Plush KS, Hellmuth K, Rinas U (1996). kinetics of glucose oxidase excretion by ...

  5. 21 CFR 866.2420 - Oxidase screening test for gonorrhea. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420... screening test for gonorrhea. (a) Identification. An oxidase screening test for gonorrhea is an in vitro... of gonorrhea. (b) Classification. Class III (premarket approval) (transitional device). (c) Date PMA...

  6. Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae. (United States)

    Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E


    Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

  7. Modulation of NADPH oxidase activity by known uraemic retention solutes. (United States)

    Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim


    Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.

  8. Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions

    Directory of Open Access Journals (Sweden)

    Sandip A. Ghuge


    Full Text Available Polyamines (PAs are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs, including copper amine oxidases (CuAOs and flavin adenine dinucleotide (FAD-dependent polyamine oxidases (PAOs. The biologically-active hydrogen peroxide (H2O2 is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H2O2 biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H2O2 derived from PA oxidation in xylem tissue maturation under stress-simulated conditions.

  9. Cataplexy and monoamine oxidase deficiency in Norrie disease. (United States)

    Vossler, D G; Wyler, A R; Wilkus, R J; Gardner-Walker, G; Vlcek, B W


    Norrie disease (ND) is an X-linked recessive disorder causing ocular atrophy, mental retardation, deafness, and dysmorphic features. Virtually absent monoamine oxidase (MAO) type-A and -B activity has been found in some boys with chromosome deletions. We report the coexistence of cataplexy and abnormal REM sleep organization with ND. Three related boys, referred for treatment of medically refractory atonic spells and apneas, underwent extended EEG-video-polysomnographic monitoring. They demonstrated attacks of cataplexy and inappropriate periods of REM sleep during which they were unarousable. One boy also had generalized tonic-clonic seizures. Previous testing revealed that all three have complete ND gene deletions. In all subjects, platelet MAO-B activity was absent, serum serotonin levels were markedly increased, and plasma catecholamine levels were normal. Data from the canine narcolepsy syndrome model implicate abnormal catecholaminergic and cholinergic activities in the pathogenesis of cataplexy. Our findings suggest that abnormal MAO activity or an imbalance between serotonin and other neurotransmitter levels may be involved in the pathogenesis of human cataplexy.

  10. Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution (United States)

    Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo


    Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

  11. Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

    Directory of Open Access Journals (Sweden)

    Tao Zhan

    Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

  12. In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase. (United States)

    Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li


    In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

  13. Visualization of monoamine oxidase in human brain

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.


    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  14. An ultrafiltration assay for lysyl oxidase

    International Nuclear Information System (INIS)

    Shackleton, D.R.; Hulmes, D.J.


    A modification of the original microdistillation assay for lysyl oxidase is described in which Amicon C-10 microconcentrators are used to separate, by ultrafiltration, the 3H-labeled products released from a [4,5-3H]-lysine-labeled elastin substrate. Enzyme activity is determined by scintillation counting of the ultrafiltrate, after subtraction of radioactivity released in the presence of beta-aminopropionitrile, a specific inhibitor of the enzyme. Conditions are described which optimize both the sensitivity and the efficient use of substrate. The assay shows linear inhibition of activity in up to 1 M urea; hence, as the enzyme is normally diluted in the assay, samples in 6 M urea can be assayed directly, without prior dialysis, and corrected for partial inhibition. Comparable results are obtained when enzyme activity is assayed by ultrafiltration or microdistillation. The assay is simple and convenient and, by using disposable containers throughout, it eliminates the need for time-consuming decontamination of radioactive glassware

  15. Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications. (United States)

    Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof


    Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.

  16. Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence. (United States)

    Hinkkanen, A; Maly, F E; Decker, K


    The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

  17. Platelet monoamine oxidase: specific activity and turnover number in headache

    International Nuclear Information System (INIS)

    Summers, K.M.; Brown, G.K.; Craig, I.W.; Peatfield, R.; Rose, F.C.


    Monoamine oxidase turnover numbers (molecules of substrate converted to product per minute per active site) have been calculated for the human platelet enzyme using [ 3 H]pargyline. Headache patients with high and low monoamine oxidase specific activities relative to controls were found to have turnover numbers very close to those for controls. This finding suggests that their specific activities vary because of differences in the concentration of active monoamine oxidase molecules, rather than differences in the ability of those enzyme molecules to catalyse the deamination reaction. (Auth.)

  18. Effects of glucose oxidase on the growth performance, serum ...

    African Journals Online (AJOL)



    Feb 6, 2016 ... The experiment was conducted to investigate the effects of diets supplemented with ... Keywords: Glucose oxidase, intestinal health, performance, swine ..... This work was supported by the National High-Tech Research and ...

  19. Structure and activity of Aspergillus nidulans copper amine oxidase

    DEFF Research Database (Denmark)

    McGrath, Aaron P; Mithieux, Suzanne M; Collyer, Charles A


    Aspergillus nidulans amine oxidase (ANAO) has the unusual ability among the family of copper and trihydroxyphenylalanine quinone-containing amine oxidases of being able to oxidize the amine side chains of lysine residues in large peptides and proteins. We show here that in common with the related...... enzyme from the yeast Pichia pastoris, ANAO can promote the cross-linking of tropoelastin and oxidize the lysine residues in α-casein proteins and tropoelastin. The crystal structure of ANAO, the first for a fungal enzyme in this family, has been determined to a resolution of 2.4 Å. The enzyme is a dimer...... with the archetypal fold of a copper-containing amine oxidase. The active site is the most open of any of those of the structurally characterized enzymes in the family and provides a ready explanation for its lysine oxidase-like activity....

  20. Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli. (United States)

    Blume, B; Grierson, D


    The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

  1. Production of rabbit antibodies against purified Glucose oxidase


    Zia,Muhammad Anjum; Ain,Qurat-ul; Iftikhar,Tehreema; Abbas,Rao Zahid; Rahman,Khalil-ur


    Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose) resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex ...

  2. Unique role of NADPH oxidase 5 in oxidative stress in human renal proximal tubule cells

    Directory of Open Access Journals (Sweden)

    Peiying Yu


    Full Text Available NADPH oxidases are the major sources of reactive oxygen species in cardiovascular, neural, and kidney cells. The NADPH oxidase 5 (NOX5 gene is present in humans but not rodents. Because Nox isoforms in renal proximal tubules (RPTs are involved in the pathogenesis of hypertension, we tested the hypothesis that NOX5 is differentially expressed in RPT cells from normotensive (NT and hypertensive subjects (HT. We found that NOX5 mRNA, total NOX5 protein, and apical membrane NOX5 protein were 4.2±0.7-fold, 5.2±0.7-fold, and 2.8±0.5-fold greater in HT than NT. Basal total NADPH oxidase activity was 4.5±0.2-fold and basal NOX5 activity in NOX5 immunoprecipitates was 6.2±0.2-fold greater in HT than NT (P=<0.001, n=6–14/group. Ionomycin increased total NOX and NOX5 activities in RPT cells from HT (P<0.01, n=4, ANOVA, effects that were abrogated by pre-treatment of the RPT cells with diphenylene-iodonium or superoxide dismutase. Silencing NOX5 using NOX5-siRNA decreased NADPH oxidase activity (−45.1±3.2% vs. mock-siRNA, n=6–8 in HT. D1-like receptor stimulation decreased NADPH oxidase activity to a greater extent in NT (−32.5±1.8% than HT (−14.8±1.8. In contrast to the marked increase in expression and activity of NOX5 in HT, NOX1 mRNA and protein were minimally increased in HT, relative to NT; total NOX2 and NOX4 proteins were not different between HT and NT, while the increase in apical RPT cell membrane NOX1, NOX2, and NOX4 proteins in HT, relative to NT, was much less than those observed with NOX5. Thus, we demonstrate, for the first time, that NOX5 is expressed in human RPT cells and to greater extent than the other Nox isoforms in HT than NT. We suggest that the increased expression of NOX5, which may be responsible for the increased oxidative stress in RPT cells in human essential hypertension, is caused, in part, by a defective renal dopaminergic system.

  3. Confirmation of a blocked amino terminus of sulfhydryl oxidase

    International Nuclear Information System (INIS)

    Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.


    The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked

  4. Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w (United States)

    Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin


    Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292


    Energy Technology Data Exchange (ETDEWEB)



    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  6. Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids. (United States)

    Sytykiewicz, Hubert


    Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency. (United States)

    Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M


    Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.

  8. Improve efficacy of topical ALA-PDT by calcipotriol through up-regulation of coproporphyrinogen oxidase. (United States)

    Yang, Deng-Fu; Chen, Jia-Haur; Chiang, Chun-Pin; Huang, Zheng; Lee, Jeng-Woei; Liu, Chung-Ji; Chang, Junn-Liang; Hsu, Yih-Chih


    Topical 5-aminolevulinic acid-mediated photodynamic therapy (topical ALA-PDT) is effective for treating oral precancerous lesions. The aim of this in vivo and in vitro study was to examine whether the efficacy of topical ALA-PDT could be further improved by calcipotriol (CAL). Precancerous lesions in the buccal pouch of hamsters were induced by dimethylbenz(a)anthracene (DMBA). Lesions were treated with multiple topical ALA-PDT with or without CAL pretreatment. ALA-induced protoporphyrine IX (PpIX) was monitored by in situ fluorescence measurement. The effect of CAL on heme-related enzymes (CPOX, PPOX, and FECH) were examined in an in vitro model using human squamous cell carcinoma (SCC) cells (SCC4, SAS) using Western blots. Fluorescence spectroscopy revealed that PpIX reached its peak level in precancerous epithelial cells of buccal pouch at 2.5 or 3.5h without or with CAL pretreatment, respectively. Both treatment regimens showed similar response rates, but the complete response was achieved after 5 times of ALA-PDT and 3 times of CAL-ALA-PDT (plevel. Topical CAL can improve the efficacy of ALA-PDT in treating precancerous lesions, likely through the increase in CPOX level and in PpIX production. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants. (United States)

    Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E


    Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder. (United States)

    Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James


    Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

  11. Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))


    The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.

  12. Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

    International Nuclear Information System (INIS)

    Johnson, J.L.; Rajagopalan, K.V.; London, R.E.


    The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well

  13. Decoding NADPH oxidase 4 expression in human tumors

    Directory of Open Access Journals (Sweden)

    Jennifer L. Meitzler


    Full Text Available NADPH oxidase 4 (NOX4 is a redox active, membrane-associated protein that contributes to genomic instability, redox signaling, and radiation sensitivity in human cancers based on its capacity to generate H2O2 constitutively. Most studies of NOX4 in malignancy have focused on the evaluation of a small number of tumor cell lines and not on human tumor specimens themselves; furthermore, these studies have often employed immunological tools that have not been well characterized. To determine the prevalence of NOX4 expression across a broad range of solid tumors, we developed a novel monoclonal antibody that recognizes a specific extracellular region of the human NOX4 protein, and that does not cross-react with any of the other six members of the NOX gene family. Evaluation of 20 sets of epithelial tumors revealed, for the first time, high levels of NOX4 expression in carcinomas of the head and neck (15/19 patients, esophagus (12/18 patients, bladder (10/19 patients, ovary (6/17 patients, and prostate (7/19 patients, as well as malignant melanoma (7/15 patients when these tumors were compared to histologically-uninvolved specimens from the same organs. Detection of NOX4 protein upregulation by low levels of TGF-β1 demonstrated the sensitivity of this new probe; and immunofluorescence experiments found that high levels of endogenous NOX4 expression in ovarian cancer cells were only demonstrable associated with perinuclear membranes. These studies suggest that NOX4 expression is upregulated, compared to normal tissues, in a well-defined, and specific group of human carcinomas, and that its expression is localized on intracellular membranes in a fashion that could modulate oxidative DNA damage.

  14. Cytochemical localization of catalase and several hydrogen peroxide-producing oxidases in the nucleoids and matrix of rat liver peroxisomes

    NARCIS (Netherlands)

    Veenhuis, M.; Wendelaar Bonga, S.E.


    The distribution of catalase, amino acid oxidase, α-hydroxy acid oxidase, urate oxidase and alcohol oxidase was studied cytochemically in rat hepatocytes. The presence of catalase was demonstrated with the conventional diaminobenzidine technique. Oxidase activities were visualized with methods based

  15. Serum diamine oxidase activity in patients with histamine intolerance. (United States)

    Manzotti, G; Breda, D; Di Gioacchino, M; Burastero, S E


    Intolerance to various foods, excluding bona fide coeliac disease and lactose intolerance, represents a growing cause of patient visits to allergy clinics.Histamine intolerance is a long-known, multifaceted clinical condition triggered by histamine-rich foods and alcohol and/or by drugs that liberate histamine or block diamine oxidase (DAO), the main enzyme involved in the metabolism of ingested histamine. Histamine limitation diets impose complex, non-standardized restrictions that may severely impact the quality of life of patients. We retrospectively evaluated 14 patients who visited allergy outpatient facilities in northern Italy with a negative diagnosis for IgE-mediated food hypersensitivity, coeliac disease, conditions related to gastric hypersecretion, and systemic nickel hypersensitivity, and who previously underwent a histamine limitation diet with benefits for their main symptoms. Serum diamine oxidase levels and the clinical response to diamine oxidase supplementation were investigated. We found that 10 out of 14 patients had serum DAO activityintolerance. Moreover, 13 out of 14 patients subjectively reported a benefit in at least one of the disturbances related to food intolerances following diamine oxidase supplementation. The mean value (±SD) of diamine oxidase activity in the cohort of patients with histamine intolerance symptoms was 7.04±6.90 U/mL compared to 39.50±18.16 U/mL in 34 healthy controls (P=0.0031). In patients with symptoms triggered by histamine-rich food, measuring the serum diamine oxidase activity can help identify subjects who can benefit from a histamine limitation diet and/or diamine oxidase supplementation.Properly designed, controlled studies investigating histamine intolerance that include histamine provocation are indispensable for providing insights into the area of food intolerances, which are currently primarily managed with non-scientific approaches in Italy. © The Author(s) 2015.

  16. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads. (United States)

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo


    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  17. NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis. (United States)

    dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C


    Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

  18. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)



    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  19. Monoamine Oxidase B Inhibitors in Parkinson's Disease. (United States)

    Dezsi, Livia; Vecsei, Laszlo


    Parkinson's disease (PD) is a neurodegenerative disorder with a prevalence increasing with age. Oxidative stress and glutamate toxicity are involved in its pathomechanism. There are still many unmet needs of PD patients, including the alleviation of motor fluctuations and dyskinesias, and the development of therapies with neuroprotective potential. To give an overview of the pharmacological properties, the efficacy and safety of the monoamine oxidase B (MAO-B) inhibitors in the treatment of PD, with special focus on the results of randomized clinical trials. A literature search was conducted in PubMed for 'PD treatment', 'MAO-B inhibitors', 'selegiline', 'rasagiline', 'safinamide' and 'clinical trials' with 'MAO-B inhibitors' in 'Parkinson' disease'. MAO-B inhibitors have a favorable pharmacokinetic profile, improve the dopamine deficient state and may have neuroprotective properties. Safinamide exhibits an anti-glutamatergic effect as well. When applied as monotherapy, MAO-B inhibitors provide a modest, but significant improvement of motor function and delay the need for levodopa. Rasagiline and safinamide were proven safe and effective when added to a dopamine agonist in early PD. As add-on to levodopa, MAO-B inhibitors significantly reduced off-time and were comparable in efficacy to COMT inhibitors. Improvements were achieved as regards certain non-motor symptoms as well. Due to the efficacy shown in clinical trials and their favorable side-effect profile, MAO-B inhibitors are valuable drugs in the treatment of PD. They are recommended as monotherapy in the early stages of the disease and as add-on therapy to levodopa in advanced PD. Copyright© Bentham Science Publishers; For any queries, please email at

  20. Forage Polyphenol Oxidase and Ruminant Livestock Nutrition

    Directory of Open Access Journals (Sweden)

    Michael Richard F. Lee


    Full Text Available Polyphenol oxidase (PPO is associated with the detrimental effect of browning fruit and vegetables, however interest within PPO containing forage crops has grown since the brownng reaction was associated with reduced nitrogen (N losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage increased the quality of protein, improving N-use efficiency (NUE when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalysing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP. If the protein is an enzyme the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase un-degraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of red clover.

  1. [Effect of Kaixinsan on monoamine oxidase activity]. (United States)

    Wang, Shi; Dong, Xian-Zhe; Tan, Xiao; Wang, Yu-Ning; Liu, Ping


    To observe the effect of antidepressant medicine prescription, Kaixinsan (KXS) on monoamine oxidase (MAO) activity, and explore the mechanism of KXS in elevating the levels of monoamine neurotransmitter from the perspective of metabolism, in vitro enzyme reaction system and C6 neuroglial cells, the effect of KXS at different concentrations on MAO-A and MAO-B activity was observed. In animal studies, the effect of KXS at different concentrations on MAO-A and MAO-B activities of brain mitochondrialin normal rats and solitary chronic unpredictable moderate stress (CMS) model rats after intragastric administration for 1, 2, 3 weeks. Results showed that 10 g•L⁻¹ KXS could significantly reduce the activity of MAO-A and MAO-B in enzyme reaction system; and in C6 cells, KXS within 0.625-10 g•L⁻¹ concentration range had no significant effect on the activity of MAO-A, but had obvious inhibitory effect on the activity of MAO-B in a dose dependent manner. KXS had no significant effect on the activity of MAO-A and MAO-B in brains of normal rats after action for 1, 2, 3 weeks. After 2 and 3 weeks treatment with 338 mg•kg⁻¹ dose KXS, MAO-A activity in the brain of CMS rats was decreased as compared with the model group (PMAO-B activity after 1, 2, 3 weeks of treatment. The results indicated that KXS had certain effect on in vitro MAO-A and MAO-B activity, had no effect on brain MAO-A and MAO-B activity in vivo in normal rats, and had certain inhibitory effect on MAO-A activity in brains of CMS rats. Copyright© by the Chinese Pharmaceutical Association.

  2. Lysyl oxidase and adipose tissue dysfunction. (United States)

    Pastel, Emilie; Price, Emily; Sjöholm, Kajsa; McCulloch, Laura J; Rittig, Nikolaj; Liversedge, Neil; Knight, Bridget; Møller, Niels; Svensson, Per-Arne; Kos, Katarina


    Lysyl oxidase (LOX) is an enzyme crucial for collagen fibre crosslinking and thus for fibrosis development. Fibrosis is characterised by a surplus of collagen fibre accumulation and is amongst others also a feature of obesity-associated dysfunctional adipose tissue (AT) which has been linked with type 2 diabetes. We hypothesised that in type 2 diabetes and obesity LOX expression and activity will be increased as a consequence of worsening AT dysfunction. This study aimed to provide a comprehensive characterisation of LOX in human AT. LOX mRNA expression was analysed in omental and abdominal subcutaneous AT obtained during elective surgery from subjects with a wide range of BMI, with and without diabetes. In addition, LOX expression was studied in subcutaneous AT before and 9.5months after bariatric surgery. To study the mechanism of LOX changes, its expression and activity were assessed after either hypoxia, recombinant human leptin or glucose treatment of AT explants. In addition, LOX response to acute inflammation was tested after stimulation by a single injection of lipopolysaccharide versus saline solution (control) in healthy men, in vivo. Quantity of mRNA was measured by RT-qPCR. LOX expression was higher in obesity and correlated with BMI whilst, in vitro, leptin at high concentrations, as a potential feedback mechanism, suppressed its expression. Neither diabetes status, nor hyperglycaemia affected LOX. Hypoxia and lipopolysaccharide-induced acute inflammation increased LOX AT expression, latter was independent of macrophage infiltration. Whilst LOX may not be affected by obesity-associated complications such as diabetes, our results confirm that LOX is increased by hypoxia and inflammation as underlying mechanism for its upregulation in adipose tissue with obesity. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1. (United States)

    Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan


    A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

  4. Data on cytochrome c oxidase assembly in mice and human fibroblasts or tissues induced by SURF1 defect

    Directory of Open Access Journals (Sweden)

    Nikola Kovářová


    Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.

  5. Production of rabbit antibodies against purified Glucose oxidase

    Directory of Open Access Journals (Sweden)

    Muhammad Anjum Zia


    Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.

  6. Calcium transport in vesicles energized by cytochrome oxidase

    Energy Technology Data Exchange (ETDEWEB)

    Rosier, Randy N. [Univ. of Rochester, NY (United States)


    Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K+ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K+ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.

  7. Immobilization of xanthine oxidase on a polyaniline silicone support. (United States)

    Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B


    A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.

  8. Identification and characterization of an antennae-specific aldehyde oxidase from the navel orangeworm.

    Directory of Open Access Journals (Sweden)

    Young-Moo Choo

    Full Text Available Antennae-specific odorant-degrading enzymes (ODEs are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes--the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs. Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW, Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13-16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13-16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons.

  9. Fluorescent Probes for Analysis and Imaging of Monoamine Oxidase Activity

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dokyoung; Jun, Yong Woong; Ahn, Kyo Han [POSTECH, Pohang (Korea, Republic of)


    Monoamine oxidases catalyze the oxidative deamination of dietary amines and amine neurotransmitters, and assist in maintaining the homeostasis of the amine neurotransmitters in the brain. Dysfunctions of these enzymes can cause neurological and behavioral disorders including Parkinson's and Alzheimer's diseases. To understand their physiological roles, efficient assay methods for monoamine oxidases are essential. Reviewed in this Perspective are the recent progress in the development of fluorescent probes for monoamine oxidases and their applications to enzyme assays in cells and tissues. It is evident that still there is strong need for a fluorescent probe with desirable substrate selectivity and photophysical properties to challenge the much unsolved issues associated with the enzymes and the diseases.

  10. Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris

    International Nuclear Information System (INIS)

    Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W.


    High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an α-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10 4 U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions

  11. The use of galactose oxidase in lipid labeling

    International Nuclear Information System (INIS)

    Radin, N.S.; Evangelatos, G.P.


    Galactose oxidase can be used to oxidize the terminal carbon atom of lipids containing galactose or N-acetylgalactosamine, and the resultant aldehyde group can be reduced back to the original carbinol with radioactive borohydride. The efficiency of the first reaction has been investigated systematically by using [6- 3 H]galactosyl ceramide as substrate and measuring the amount of radioactive water formed. This enabled us to establish that the addition of catalase and peroxidase greatly speeded the oxidation, that phosphate and PIPES buffers were the best among those tested, that the reaction continued for 24 hr without a second addition of galactose oxidase, and that the optimum concentration of organic solvent (tetrahydrofuran) was 50%. The suggestion if made that a similar set of variables be studied for each lipid or nonlipid by the same basic technique: labeling by the oxidase/borohydride method and use of the resultant compound as substrate

  12. Increased xanthine oxidase during labour--implications for oxidative stress. (United States)

    Many, A; Roberts, J M


    Xanthine dehydrogenase/oxidase (XDH/XO) produces uric acid. When in the oxidase form, this production is coupled with the generation of free radicals. Hypoxia-reperfusion enhances conversion of XDH to XO. Since the placenta is exposed to short periods of hypoxia reperfusion during labour, 17 placentae of pregnancy terminated by elective caesarean section and five placentae of pregnancies terminated by caesarean section during labour were examined for XDH/XO activity. It was found that XO activity was higher in the placentae of labouring women (P = 0.003), which suggests that labour enhances conversion of XDH to XO, facilitating free radical production.

  13. Two X-linked chronic granulomatous disease patients with unusual NADPH oxidase properties

    NARCIS (Netherlands)

    Wolach, Baruch; Broides, Arnon; Zeeli, Tal; Gavrieli, Ronit; de Boer, Martin; van Leeuwen, Karin; Levy, Jacov; Roos, Dirk


    Chronic granulomatous disease (CGD) is an immune deficiency syndrome caused by defects in the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, the enzyme that generates reactive oxygen species (ROS) in phagocytizing leukocytes. This study evaluates the NADPH oxidase capacity in two

  14. Catalytic aspects of a copper(II) complex: biological oxidase to ...

    Indian Academy of Sciences (India)



    Oct 3, 2017 ... made with a Jasco model V-730 UV-Vis spectrophotometer. ..... Ligand-induced coordination changes ... Fet3 protein from yeast, a multinuclear copper oxidase ... of mutants of the multicopper oxidase Fet3p Biochem-.

  15. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)



    Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

  16. New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora. (United States)

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich


    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

  17. NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

    Energy Technology Data Exchange (ETDEWEB)

    Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)


    Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

  18. Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm (United States)

    Xu, Wei; Liao, Yalin


    Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

  19. Cox1 mutation abrogates need for Cox23 in cytochrome c oxidase biogenesis

    Directory of Open Access Journals (Sweden)

    Richard Dela Cruz


    Full Text Available Cox23 is a known conserved assembly factor for cytochrome c oxidase, although its role in cytochrome c oxidase (CcO biogenesis remains unresolved. To gain additional insights into its role, we isolated spontaneous suppressors of the respiratory growth defect in cox23∆ yeast cells. We recovered independent colonies that propagated on glycerol/lactate medium for cox23∆ cells at 37°C. We mapped these mutations to the mitochondrial genome and specifically to COX1 yielding an I101F substitution. The I101F Cox1 allele is a gain-of-function mutation enabling yeast to respire in the absence of Cox23. CcO subunit steady-state levels were restored with the I101F Cox1 suppressor mutation and oxygen consumption and CcO activity were likewise restored. Cells harboring the mitochondrial genome encoding I101F Cox1 were used to delete genes for other CcO assembly factors to test the specificity of the Cox1 mutation as a suppressor of cox23∆ cells. The Cox1 mutant allele fails to support respiratory growth in yeast lacking Cox17, Cox19, Coa1, Coa2, Cox14 or Shy1, demonstrating its specific suppressor activity for cox23∆ cells.

  20. Dithiocarbamates are teratogenic to developing zebrafish through inhibition of lysyl oxidase activity

    International Nuclear Information System (INIS)

    Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette


    Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.

  1. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis. (United States)

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping


    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

  2. Cytochrome cbb3 of Thioalkalivibrio is a Na+-pumping cytochrome oxidase

    NARCIS (Netherlands)

    Muntyan, M.S.; Cherepanov, D.A.; Malinen, A.M.; Bloch, D.A.; Sorokin, D.Y.; Severina, I.I.; Ivashina, T.V.; Lahti, R.; Muyzer, G.; Skulachev, V.P.


    Cytochrome c oxidases (Coxs) are the basic energy transducers in the respiratory chain of the majority of aerobic organisms. Coxs studied to date are redox-driven proton-pumping enzymes belonging to one of three subfamilies: A-, B-, and C-type oxidases. The C-type oxidases (cbb3 cytochromes), which

  3. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

    International Nuclear Information System (INIS)

    Long, C.M.; Rohrmann, G.F.; Merrill, G.F.


    Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

  4. The role of brassinosteroids in the regulation of the plasma membrane H+-ATPase and NADPH oxidase under cadmium stress. (United States)

    Jakubowska, Dagmara; Janicka, Małgorzata


    The present research aim was to define the role of brassinosteroids (BRs) in plant adaptation to cadmium stress. We observed a stimulating effect of exogenous BR on the activity of two plasma membrane enzymes which play a key role in plants adaptation to cadmium stress, H + -ATPase (EC and NADPH oxidase (EC Using anti-phosphothreonine antibody we showed that modification of PM H + -ATPase activity under BR action could result from phosphorylation of the enzyme protein. Also the relative expression of genes encoding both PM H + -ATPase and NADPH oxidase was affected by BR. To confirm the role of BR in the cadmium stimulating effect on activity of both studied plasma membrane enzymes, an assay in the presence of a BR biosynthesis inhibitor (propiconazole) was performed. Moreover, as a tool in our work we used commercially available plant mutants unable to BR biosynthesis or with dysfunctional BR signaling pathway, to further confirm participation of BR in plant adaptation to heavy metal stress. Presented results demonstrate some elements of the brassinosteroid-induced pathway activated under cadmium stress, wherein H + -ATPase and NADPH oxidase are key factors. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Enhanced production of glucose oxidase from UVmutant of ...

    African Journals Online (AJOL)

    UV rays were used as mutagen in wild type strain of Aspergillus niger for enhanced production of glucose oxidase. After mutangenization and selection, mutant A. niger strains, resistant to 2-deoxy-Dglucose were obtained. The mutants showed 1.57 and 1.98 fold increase in activities of extra and intra cellular glucose ...

  6. Localization of Glucose Oxidase and Catalase Activities in Aspergillus niger

    NARCIS (Netherlands)

    Witteveen, Cor F.B.; Veenhuis, Marten; Visser, Jaap

    The subcellular localization of glucose oxidase (EC in Aspergillus niger N400 (CBS 120.49) was investigated by (immuno)cytochemical methods. By these methods, the bulk of the enzyme was found to be localized in the cell wall. In addition, four different catalases (EC were

  7. The glucose oxidase-peroxidase assay for glucose (United States)

    The glucose oxidase-peroxidase assay for glucose has served as a very specific, sensitive, and repeatable assay for detection of glucose in biological samples. It has been used successfully for analysis of glucose in samples from blood and urine, to analysis of glucose released from starch or glycog...

  8. Nanoporous gold assembly of glucose oxidase for electrochemical biosensing

    DEFF Research Database (Denmark)

    Xiao, Xinxin; Ulstrup, Jens; Li, Hui


    Nanoporous gold (NPG) is composed of three-dimensional (3D) bicontinuous nanostructures with large surface area. Nano-channels inside NPG provide an ideal local environment for immobilization of enzyme molecules with expected stabilization of the protein molecules. In this work, glucose oxidase (...

  9. Optimization of cholesterol oxidase production by Brevibacterium sp ...

    African Journals Online (AJOL)

    An ultrasound-assisted emulsification as a pretreatment for cholesterol oxidase production by submerge fermentation using Brevibacterium sp. in a batch system was studied. Medium improvement for the production employing response surface methodology (RSM) was optimized in this paper. The concentration of ...

  10. in Escherichia coli with native cholesterol oxidase expressed

    African Journals Online (AJOL)

    The structure and bio-activity of an endogenous cholesterol oxidase from Brevibacterium sp. was compared to the same enzyme exogenously expressed in Escherichia coli BL21 (DE3) with and without N- or C-terminal his-tags. The different proteins were purified with affinity and subtractive protocols. The specific activity of ...

  11. Cytokinin oxidase or dehydrogenase? Mechanism of cytokinin degradation in cereals

    DEFF Research Database (Denmark)

    Galuszka, P.; Frebort, I.; Sebela, M.


    An enzyme degrading cytokinins with isoprenoid side chain, previously named cytokinin oxidase, was purified to near homogeneity from wheat and barley grains. New techniques were developed for the enzyme activity assay and staining on native electrophoretic gels to identify the protein. The purifi...

  12. Effect of heat treatment on polyphenol oxidase and peroxidase ...

    African Journals Online (AJOL)

    Effect of heat treatment (55°C/20 min) on polyphenol oxidase (PPO) and peroxidase (POD) activities and total phenolic compounds was investigated in Algerian dates (Deglet Nour variety) at Tamar (fully ripe) stage and in dates stored for 5 months at ambient temperature and in cold storage (10°C). Results obtained ...

  13. Lysyl oxidases regulate fibrillar collagen remodelling in idiopathic pulmonary fibrosis

    NARCIS (Netherlands)

    Tjin, Gavin; White, Eric S; Faiz, Alen; Sicard, Delphine; Tschumperlin, Daniel J; Mahar, Annabelle; Kable, Eleanor P W; Burgess, Janette K


    Idiopathic pulmonary fibrosis (IPF) is a progressive scarring disease of the lung with feweffective therapeutic options. Structural remodelling of the extracellular matrix [i.e. collagen cross-linkingmediated by the lysyl oxidase (LO) family of enzymes (LOX, LOXL1-4)] might contribute to disease

  14. Novel thidiazuron-derived inhibitors of cytokinin oxidase/dehydrogenase

    Czech Academy of Sciences Publication Activity Database

    Nisler, Jaroslav; Kopečný, D.; Končitíková, R.; Zatloukal, Marek; Bazgier, Václav; Berka, K.; Zalabák, D.; Briozzo, P.; Strnad, Miroslav; Spíchal, Lukáš


    Roč. 92, 1-2 (2016), s. 235-248 ISSN 0167-4412 R&D Projects: GA MŠk(CZ) LO1204; GA ČR GA15-22322S Institutional support: RVO:61389030 Keywords : Cytokinin oxidase/dehydrogenase * Crystal structure * Molecular docking Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.356, year: 2016

  15. DNA damage and decrease of cellular oxidase activity in piglet ...

    African Journals Online (AJOL)

    DNA damage and decrease of cellular oxidase activity in piglet sertoli cells exposed to gossypol. Ming Zhang, Hui Yuan, Zuping He, Liyun Yuan, Jine Yi, Sijun Deng, Li Zhu, Chengzhi Guo, Yin Lu, Jing Wu, Lixin Wen, Qiang Wei, Liqun Xue ...

  16. Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications. (United States)

    Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J


    1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.

  17. Ultra-high-throughput screening method for the directed evolution of glucose oxidase. (United States)

    Ostafe, Raluca; Prodanovic, Radivoje; Nazor, Jovana; Fischer, Rainer


    Glucose oxidase (GOx) is used in many industrial processes that could benefit from improved versions of the enzyme. Some improvements like higher activity under physiological conditions and thermal stability could be useful for GOx applications in biosensors and biofuel cells. Directed evolution is one of the currently available methods to engineer improved GOx variants. Here, we describe an ultra-high-throughput screening system for sorting the best enzyme variants generated by directed evolution that incorporates several methodological refinements: flow cytometry, in vitro compartmentalization, yeast surface display, fluorescent labeling of the expressed enzyme, delivery of glucose substrate to the reaction mixture through the oil phase, and covalent labeling of the cells with fluorescein-tyramide. The method enables quantitative screening of gene libraries to identify clones with improved activity and it also allows cells to be selected based not only on the overall activity but also on the specific activity of the enzyme. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. A new fatal case of pyridox(am)ine 5'-phosphate oxidase (PNPO) deficiency. (United States)

    Ruiz, Angeles; García-Villoria, Judit; Ormazabal, Aida; Zschocke, Johannes; Fiol, Miquel; Navarro-Sastre, Aleix; Artuch, Rafael; Vilaseca, Maria Antonia; Ribes, Antonia


    We present a patient with severe pyridox(am)ine 5'-phosphate oxidase deficiency and homozygosity for a novel nonsense-mutation, p.A174X, in the PNPO gene who died with pyridoxal phosphate (PLP) treatment despite initial clinical recovery. He presented neonatally, with the classical clinical symptoms of the disease. Increase of urinary vanillactate was the first biochemical factor of alert. Amino acid and neurotransmitter analysis in CSF indicated reduced activity of several PLP-dependent enzymes. The diagnosis was confirmed by mutational studies. From this and the other reported patients it may be concluded that the administration of PLP should not be delayed until the complete biochemical evidence is obtained.

  19. Cyanobacterial lactate oxidases serve as essential partners in N2-fixation and evolved into photorespiratory glycolate oxidases in plants.

    NARCIS (Netherlands)

    Hackenberg, C.; Kern, R.; Hüge, J; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.


    Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to

  20. Cyanobacterial lactate oxidases serve as essential partners of N2-fixation and evolved to photorespiratory glycolate oxidases in plants

    NARCIS (Netherlands)

    Hackenberg, C.; Kern, R.; Hüge, J.; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.


    Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to

  1. Key role of alternative oxidase in lovastatin solid-state fermentation. (United States)

    Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier


    Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.

  2. Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak

    Directory of Open Access Journals (Sweden)

    Marić Slađana


    Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.

  3. Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass)


    Jonathan M. LaMantia; Ambika Chandra; David R. Huff


    Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO) has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning prime...

  4. Increase in activity, glycosylation and expression of cytokinin oxidase/dehydrogenase during the senescence of barley leaf segments in the dark

    Czech Academy of Sciences Publication Activity Database

    Conrad, K.; Motyka, Václav; Schlüter, T.


    Roč. 130, č. 4 (2007), s. 572-579 ISSN 0031-9317 R&D Projects: GA ČR GA206/03/0313 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : OXIDASE ACTIVITY * GENE-EXPRESSION * ZEA - MAYS Subject RIV: EF - Botanics Impact factor: 2.192, year: 2007

  5. The gene expressions of DNA methylation/demethylation enzymes ...

    African Journals Online (AJOL)



    Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.

  6. The gene expressions of DNA methylation/demethylation enzymes ...

    African Journals Online (AJOL)

    A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...

  7. Pyridox(am)ine-5-Phosphate Oxidase Deficiency Treatable Cause of Neonatal Epileptic Encephalopathy With Burst Suppression: Case Report and Review of the Literature. (United States)

    Guerin, Andrea; Aziz, Aly S; Mutch, Carly; Lewis, Jillian; Go, Cristina Y; Mercimek-Mahmutoglu, Saadet


    Pyridox(am)ine-5-phosphate oxidase deficiency is an autosomal recessive disorder of pyridoxine metabolism. Intractable neonatal epileptic encephalopathy is the classical presentation. Pyridoxal-5-phosphate or pyridoxine supplementation improves symptoms. We report a patient with myoclonic and tonic seizures at the age of 1 hour. Pyridoxal-5-phosphate was started on the first day of life and seizures stopped at the age of 3 days, but encephalopathy persisted for 4 weeks. She had normal neurodevelopmental outcome at the age of 12 months on pyridoxal-5-phosphate monotherapy. She had novel homozygous pathogenic frameshift mutation (c.448_451del;p.Pro150Argfs*27) in the PNPO gene. Long-lasting encephalopathy despite well-controlled clinical seizures does neither confirm nor exclude pyridox(am)ine-5-phosphate oxidase deficiency. Normal neurodevelopmental outcome of our patient emphasizes the importance of pyridoxal-5-phosphate treatment. Pyridox(am)ine-5-phosphate oxidase deficiency should be included in the differential diagnosis of Ohtahara syndrome and neonatal myoclonic encephalopathy as a treatable underlying cause. In addition, we reviewed the literature for pyridox(am)ine-5-phosphate oxidase deficiency and summarized herein all confirmed cases. © The Author(s) 2014.

  8. Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase. (United States)

    Gandara, Ana Caroline Paiva; Torres, André; Bahia, Ana Cristina; Oliveira, Pedro L; Schama, Renata


    NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not been examined. In this study, we analyzed the evolution of this gene family in arthropods. A thorough search of genomes and transcriptomes was performed enabling us to browse most branches of arthropod phylogeny. We have found that the subfamilies NOX5 and DUOX are present in all arthropod groups. We also show that a NOX gene, closely related to NOX4 and previously found only in mosquitoes (NOXm), can also be found in other taxonomic groups, leading us to rename it as NOX4-art. Although the accessory protein p22-phox, essential for NOX1-4 activation, was not found in any of the arthropods studied, NOX4-art of Aedes aegypti encodes an active protein that produces H 2 O 2 . Although NOX4-art has been lost in a number of arthropod lineages, it has all the domains and many signature residues and motifs necessary for ROS production and, when silenced, H 2 O 2 production is considerably diminished in A. aegypti cells. Combining all bioinformatic analyses and laboratory work we have reached interesting conclusions regarding arthropod NOX gene family evolution. NOX5 and DUOX are present in all arthropod lineages but it seems that a NOX2-like gene was lost in the ancestral lineage leading to Ecdysozoa. The NOX4-art gene originated from a NOX4-like ancestor and is functional. Although no p22-phox was observed in arthropods, there was no evidence of neo-functionalization and this gene probably produces H 2 O 2 as in other metazoan NOX4 genes. Although functional and present in the genomes of many

  9. An antibody that confers plant disease resistance targets a membrane-bound glyoxal oxidase in Fusarium. (United States)

    Song, Xiu-Shi; Xing, Shu; Li, He-Ping; Zhang, Jing-Bo; Qu, Bo; Jiang, Jin-He; Fan, Chao; Yang, Peng; Liu, Jin-Long; Hu, Zu-Quan; Xue, Sheng; Liao, Yu-Cai


    Plant germplasm resources with natural resistance against globally important toxigenic Fusarium are inadequate. CWP2, a Fusarium genus-specific antibody, confers durable resistance to different Fusarium pathogens that infect cereals and other crops, producing mycotoxins. However, the nature of the CWP2 target is not known. Thus, investigation of the gene coding for the CWP2 antibody target will likely provide critical insights into the mechanism underlying the resistance mediated by this disease-resistance antibody. Immunoblots and mass spectrometry analysis of two-dimensional electrophoresis gels containing cell wall proteins from Fusarium graminearum (Fg) revealed that a glyoxal oxidase (GLX) is the CWP2 antigen. Cellular localization studies showed that GLX is localized to the plasma membrane. This GLX efficiently catalyzes hydrogen peroxide production; this enzymatic activity was specifically inhibited by the CWP2 antibody. GLX-deletion strains of Fg, F. verticillioides (Fv) and F. oxysporum had significantly reduced virulence on plants. The GLX-deletion Fg and Fv strains had markedly reduced mycotoxin accumulation, and the expression of key genes in mycotoxin metabolism was downregulated. This study reveals a single gene-encoded and highly conserved cellular surface antigen that is specifically recognized by the disease-resistance antibody CWP2 and regulates both virulence and mycotoxin biosynthesis in Fusarium species. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  10. Characterization of ent-kaurene synthase and kaurene oxidase involved in gibberellin biosynthesis from Scoparia dulcis. (United States)

    Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum


    Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.

  11. Lactate Biosensor Based on Cellulose Acetate Membrane Bound Lactate Oxidase

    Directory of Open Access Journals (Sweden)



    Full Text Available Lactate biosensor was fabricated by immobilizing lactate oxidase in cellulose acetate membrane and by mounting over the sensing part of Pt electrode (working and connected to Ag/AgCl electrode (reference along with auxillary electrode through potentiostat. The enzyme electrode was anodically polarized at +400 mV to generate electrons from H2O2, which was formed from oxidation of serum lactate by immobilized lactate oxidase. The minimum detection limit of the electrode was 0.1mmoles/L and sensitivity of the sensor was 0.008 mA/mM/L lactate. Assay coefficients of variation were < 2% .A good correlation (r=0.99 was found between lactate values obtained by colorimetric method and lactate biosensor. The self-life of the biosensor was 18 days at 4ºC and enzyme electrode can be re-used 150 times without any significant loss in enzyme activity.

  12. Dual inhibitors of cholinesterases and monoamine oxidases for Alzheimer's disease. (United States)

    Knez, Damijan; Sova, Matej; Košak, Urban; Gobec, Stanislav


    Accumulating evidence indicates a solid relationship between several enzymes and Alzheimer's disease. Cholinesterases and monoamine oxidases are closely associated with the disease symptomatology and progression and have been tackled simultaneously using several multifunctional ligands. This design strategy offers great chances to alter the course of Alzheimer's disease, in addition to alleviation of the symptoms. More than 15 years of research has led to the identification of various dual cholinesterase/monoamine oxidase inhibitors, while some showing positive outcomes in clinical trials, thus giving rise to additional research efforts in the field. The aim of this review is to provide an update on the novel dual inhibitors identified recently and to shed light on their therapeutic potential.

  13. Variations in epidermal cytochrome oxidase activity after local irradiation

    International Nuclear Information System (INIS)

    Itoiz, M.E.; Rey, B.M. de; Cabrini, R.L.


    Cytochrome oxidase activity was evaluated histochemically as an index of mitochondrial damage after local irradiation with X-rays. It was determined by microphotometry on the tail skin of newly born Wistar rats four days after irradiation with doses ranging from 2 to 16krad. The enzyme activity of the whole epidermis increased after irradiation, the increases being related to the increase in thickness of the epithelium which was observed as a response to irradiation injury. Within the dose range tested, the enzyme concentration (expressed per unit volume of tissue) decreased in relation to the dose applied. At the electron microscopy level, the cytochemical demonstration of cytochrome oxidase revealed an irregular reaction over the cristae, intramitochondrial vacuolization and partial homogenization of the matrix. Positive membrane fragments were seen around lipid droplets. This reaction confirms the mitochondrial origin of these previously observed radiation-induced vacuoles. (author)

  14. Contribution of the NADH-oxidase (Nox) to the aerobic life of Lactobacillus sanfranciscensis DSM20451T. (United States)

    Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F


    Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Glucose Oxidase Catalyzed Self-Assembly of Bioelectroactive Gold Nanostructures (United States)


    polymer matrix), however, electrons generated at the FAD/FADH2 active site of glucose oxidase (GOx) must tunnel ca. 15 through the protein shell...described as a surface bound thiolate [33]. Recently, the presence of free thiol groups has been proposed as a mechanism for gold reduction in pure enzymes...simultaneously [38]. The oxidative polymerization of the amines proceeds simulta- neously with the formation of gold nanoparticles such that the polymerized amine

  16. Graphene-glucose oxidase bioanodes for enzymatic biofuel cells

    DEFF Research Database (Denmark)

    Tang, Jing; Werchmeister, Rebecka Maria Larsen; Engelbrekt, Christian


    as supporting material, polyethyleneimine (PEI) as linker and glucose oxidase (GOD) as the chosen enzyme. GOD can catalyze oxidation of glucose to gluconolactone, but needs a mediator to assist electron transfer between the enzyme and electrodes. The redox molecule ferrocene carboxylic acid (Fc...... and systematically investigated. The assembled EBFCs show good reproducibility. EBFCs provide maximum output power density 2.47 μW cm-2 at 35 ℃, indicating the optimized activity of EBFCs fed with glucose....

  17. Overexpression of a water-forming NADH oxidase improves the metabolism and stress tolerance of Saccharmyces cerevisiae in aerobic fermenation

    Directory of Open Access Journals (Sweden)

    Xinchi Shi


    Full Text Available Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the byproduct glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37 % higher than that for CON (30.82 ± 1.54 g/L. Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved

  18. Multi-Copper Oxidases and Human Iron Metabolism (United States)

    Vashchenko, Ganna; MacGillivray, Ross T. A.


    Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

  19. Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity (United States)

    Guo, Leilei; Huang, Kaixun; Liu, Hongmei


    Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na2SeO3 as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant ( K m) values and maximal reaction velocity ( V max) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.

  20. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop


    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2

  1. On the Possibility of Uphill Intramolecular Electron Transfer in Multicopper Oxidases: Electrochemical and Quantum Chemical Study of Bilirubin Oxidase

    Czech Academy of Sciences Publication Activity Database

    Shleev, S.; Andoralov, V.; Falk, M.; Reimann, C. T.; Ruzgas, T.; Srnec, Martin; Ryde, U.; Rulíšek, Lubomír


    Roč. 24, č. 7 (2012), s. 1524-1540 ISSN 1040-0397 Grant - others:7th Framework Program(XE) NMP4-SL-2009-229255 Institutional research plan: CEZ:AV0Z40550506 Keywords : bilirubin oxidase * intramolecular electron transfer * rate-limiting catalytic step * reorganization energy * QM/MM calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.817, year: 2012

  2. Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass. (United States)

    Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence


    Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Direct comparison of gluco-oligosaccharide oxidase variants and glucose oxidase: substrate range and H2O2 stability. (United States)

    Vuong, Thu V; Foumani, Maryam; MacCormick, Benjamin; Kwan, Rachel; Master, Emma R


    Glucose oxidase (GO) activity is generally restricted to glucose and is susceptible to inactivation by H 2 O 2 . By comparison, the Y300A variant of gluco-oligosaccharide oxidase (GOOX) from Sarocladium strictum showed broader substrate range and higher H 2 O 2 stability. Specifically, Y300A exhibited up to 40 times higher activity on all tested sugars except glucose, compared to GO. Moreover, fusion of the Y300A variant to a family 22 carbohydrate binding module from Clostridium thermocellum (CtCBM22A) nearly doubled its catalytic efficiency on glucose, while retaining significant activity on oligosaccharides. In the presence of 200 mM of H 2 O 2 , the recombinant CtCBM22A_Y300A retained 80% of activity on glucose and 100% of activity on cellobiose, the preferred substrate for this enzyme. By contrast, a commercial glucose oxidase reported to contain ≤0.1 units catalase/ mg protein, retained 60% activity on glucose under the same conditions. GOOX variants appear to undergo a different mechanism of inactivation, as a loss of histidine instead of methionine was observed after H 2 O 2 incubation. The addition of CtCBM22A also promoted functional binding of the fusion enzyme to xylan, facilitating its simultaneous purification and immobilization using edible oat spelt xylan, which might benefit the usage of this enzyme preparation in food and baking applications.

  4. NADPH oxidase 4 attenuates cerebral artery changes during the progression of Marfan syndrome. (United States)

    Onetti, Yara; Meirelles, Thayna; Dantas, Ana P; Schröder, Katrin; Vila, Elisabet; Egea, Gustavo; Jiménez-Altayó, Francesc


    Marfan syndrome (MFS) is a connective tissue disorder that is often associated with the fibrillin-1 (Fbn1) gene mutation and characterized by cardiovascular alterations, predominantly ascending aortic aneurysms. Although neurovascular complications are uncommon in MFS, the improvement in Marfan patients' life expectancy is revealing other secondary alterations, potentially including neurovascular disorders. However, little is known about small-vessel pathophysiology in MFS. MFS is associated with hyperactivated transforming growth factor (TGF)-β signaling, which among numerous other downstream effectors, induces the NADPH oxidase 4 (Nox4) isoform of NADPH oxidase, a strong enzymatic source of H2O2 We hypothesized that MFS induces middle cerebral artery (MCA) alterations and that Nox4 contributes to them. MCA properties from 3-, 6-, or 9-mo-old Marfan (Fbn1(C1039G/+)) mice were compared with those from age/sex-matched wild-type littermates. At 6 mo, Marfan compared with wild-type mice developed higher MCA wall/lumen (wild-type: 0.081 ± 0.004; Marfan: 0.093 ± 0.002; 60 mmHg; P Marfan mice with Nox4 deficiency (Nox4(-/-)). Strikingly, Nox4 deletion in Marfan mice aggravated MCA wall thickening (cross-sectional area; Marfan: 6,660 ± 363 μm(2); Marfan Nox4(-/-): 8,795 ± 824 μm(2); 60 mmHg; P < 0.05), accompanied by decreased TGF-β expression and increased collagen deposition and Nox1 expression. These findings provide the first evidence that Nox4 mitigates cerebral artery structural changes in a murine model of MFS. Copyright © 2016 the American Physiological Society.

  5. Protein structural development of threadfin bream ( Nemipterus spp.) surimi gels induced by glucose oxidase. (United States)

    Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao


    This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.

  6. Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation (United States)

    Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin


    Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

  7. Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats. (United States)

    Gudkova, O O; Latyshko, N V; Shandrenko, S G


    In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.

  8. Up-Streaming Process for Glucose Oxidase by Thermophilic Penicillium sp. in Shake Flask


    Muhammad Mohsin JAVED; Aroosh SHABIR; Sana ZAHOOR; Ikram UL-HAQ


    The present study is concerned with the production of glucose oxidase (GOD) from thermophilic Penicillium sp. in 250 mL shake flask. Fourteen different strains of thermophilic Penicillium sp. were isolated from the soil and were screened for glucose oxidase production. IIBP-13 strain gave maximum extra-cellular glucose oxidase production as compared to other isolates. Effect of submerged fermentation in shaking and static conditions, different carbon sources and incubation period on the produ...

  9. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve (United States)

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje


    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  10. A multicopper oxidase is essential for manganese oxidation and laccase-like activity in Pedomicrobium sp. ACM 3067. (United States)

    Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I


    Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.

  11. Exploring the Utility of Partial Cytochrome c Oxidase Subunit 1 for DNA Barcoding of Gobies

    Directory of Open Access Journals (Sweden)

    Hyung-Bae Jeon


    Full Text Available Gobiids are hyperdiverse compared with other teleost groups, with about 2,000 species occurring in marine, freshwater, and blackish habitats, and they show a remarkable variety of morphologies and ecology. Testing the effectiveness of DNA barcodes on species that have emerged as a result of radiation remains a major challenge in evolutionary biology. Here, we used the cytochrome c oxidase subunit 1 (COI sequences from 144 species of gobies and related species to evaluate the performance of distance-based DNA barcoding and to conduct a phylogenetic analysis. The average intra-genus genetic distance was considerably higher than that obtained in previous studies. Additionally, the interspecific divergence at higher taxonomic levels was not significantly different from that at the intragenus level, suggesting that congeneric gobies possess substantial interspecific sequence divergence in their COI gene. However, levels of intragenus divergence varied greatly among genera, and we do not provide sufficient evidence for using COI for cryptic species delimitation. Significantly more nucleotide changes were observed at the third codon position than that at the first and the second codons, revealing that extensive variation in COI reflects synonymous changes and little protein level variation. Despite clear signatures in several genera, the COI sequences did resolve genealogical relationships in the phylogenetic analysis well. Our results support the validity of COI barcoding for gobiid species identification, but the utilization of more gene regions will assist to offer a more robust gobiid species phylogeny.

  12. Monoamine Oxidase A in Antisocial Personality Disorder and Borderline Personality Disorder. (United States)

    Kolla, Nathan J; Vinette, Sarah A


    Variation in the monoamine oxidase A (MAO-A) gene and MAO-A enzyme levels have been linked to antisocial behavior and aggression in clinical and non-clinical populations. Here, we provide an overview of the genetic, epigenetic, and neuroimaging research that has examined MAO-A structure and function in antisocial personality disorder (ASPD) and borderline personality disorder (BPD). The low-activity MAO-A variable nucleotide tandem repeat genetic polymorphism has shown a robust association with large samples of violent and seriously violent offenders, many of whom had ASPD. A recent positron emission tomography (PET) study of ASPD similarly revealed low MAO-A density in brain regions thought to contribute to the psychopathology of the condition. By contrast, PET has also demonstrated that brain MAO-A levels are increased in BPD and that they relate to symptoms of low mood and suicidality. Candidate gene studies have produced the most compelling evidence connecting MAO-A genetic variants to both ASPD and BPD. Still, conflicting results abound in the literature, making it highly unlikely that ASPD or BPD is related to a specific MAO-A genetic variant. Future research should strive to examine how MAO-A genotypes interact with broad-spectrum environmental influences to produce brain endophenotypes that may ultimately become tractable targets for novel treatment strategies.

  13. Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Xiaohui eLi


    Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.

  14. Regulation of the NADPH Oxidase RBOHD During Plant Immunity. (United States)

    Kadota, Yasuhiro; Shirasu, Ken; Zipfel, Cyril


    Pathogen recognition induces the production of reactive oxygen species (ROS) by NADPH oxidases in both plants and animals. ROS have direct antimicrobial properties, but also serve as signaling molecules to activate further immune outputs. However, ROS production has to be tightly controlled to avoid detrimental effects on host cells, but yet must be produced in the right amount, at the right place and at the right time upon pathogen perception. Plant NADPH oxidases belong to the respiratory burst oxidase homolog (RBOH) family, which contains 10 members in the model plant Arabidopsis thaliana. The perception of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs) leads to a rapid, specific and strong production of ROS, which is dependent on RBOHD. RBOHD is mainly controlled by Ca(2+) via direct binding to EF-hand motifs and phosphorylation by Ca(2+)-dependent protein kinases. Recent studies have, however, revealed a critical role for a Ca(2+)-independent regulation of RBOHD. The plasma membrane-associated cytoplasmic kinase BIK1 (BOTRYTIS-INDUCED KINASE1), which is a direct substrate of the PRR complex, directly interacts with and phosphorylates RBOHD upon PAMP perception. Impairment of these phosphorylation events completely abolishes the function of RBOHD in immunity. These results suggest that RBOHD activity is tightly controlled by multilayered regulations. In this review, we summarize recent advances in our understanding of the regulatory mechanisms controlling RBOHD activation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email:

  15. Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Leilei; Huang, Kaixun; Liu, Hongmei, E-mail: [Huazhong University of Science and Technology, School of Chemistry and Chemical Engineering (China)


    Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na{sub 2}SeO{sub 3} as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3′,5,5′-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant (K{sub m}) values and maximal reaction velocity (V{sub max}) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.

  16. Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity

    International Nuclear Information System (INIS)

    Guo, Leilei; Huang, Kaixun; Liu, Hongmei


    Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na 2 SeO 3 as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3′,5,5′-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant (K m ) values and maximal reaction velocity (V max ) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.

  17. Electroconvulsive therapy in patients taking monoamine oxidase inhibitors. (United States)

    Dolenc, Tamara J; Habl, Samar S; Barnes, Roxann D; Rasmussen, Keith G


    Concerns have been expressed regarding the use of general anesthesia for electroconvulsive therapy (ECT) in patients taking monoamine oxidase inhibitors (MAOIs). We review the published literature and present 4 new cases and conclude that there is no evidence of a dangerous interaction between ECT and MAOI use. In general, a cautious approach would be to discontinue MAOIs before ECT if the medication has not been helpful; however, there is no need for a washout interval before starting ECT. Furthermore, if there is otherwise a reason for continuing the MAOI, it can be continued during index ECT or initiated during maintenance ECT.

  18. Lysyl Oxidase, a Targetable Secreted Molecule Involved in Cancer Metastasis

    DEFF Research Database (Denmark)

    Cox, Thomas Robert; Gartland, Alison; Erler, Janine T


    to improve the tools available in our arsenal against this disease, both in terms of treatment, but also prevention. Recently, we showed that hypoxic induction of the extracellular matrix modifying enzyme lysyl oxidase (LOX) correlates with metastatic dissemination to the bone in estrogen receptor negative...... of this enzyme as a therapeutic target for metastatic breast cancer. Our work is the latest in an emerging body of work supporting the targeting of LOX and calls for greater efforts in developing therapeutics against this extracellular secreted factor in the prevention of cancer progression across multiple solid...

  19. Putting together a plasma membrane NADH oxidase: a tale of three laboratories. (United States)

    Löw, Hans; Crane, Frederick L; Morré, D James


    The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Genes and Gene Therapy (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  1. Rational redesign of glucose oxidase for improved catalytic function and stability.

    Directory of Open Access Journals (Sweden)

    J Todd Holland

    Full Text Available Glucose oxidase (GOx is an enzymatic workhorse used in the food and wine industries to combat microbial contamination, to produce wines with lowered alcohol content, as the recognition element in amperometric glucose sensors, and as an anodic catalyst in biofuel cells. It is naturally produced by several species of fungi, and genetic variants are known to differ considerably in both stability and activity. Two of the more widely studied glucose oxidases come from the species Aspergillus niger (A. niger and Penicillium amagasakiense (P. amag., which have both had their respective genes isolated and sequenced. GOx from A. niger is known to be more stable than GOx from P. amag., while GOx from P. amag. has a six-fold superior substrate affinity (K(M and nearly four-fold greater catalytic rate (k(cat. Here we sought to combine genetic elements from these two varieties to produce an enzyme displaying both superior catalytic capacity and stability. A comparison of the genes from the two organisms revealed 17 residues that differ between their active sites and cofactor binding regions. Fifteen of these residues in a parental A. niger GOx were altered to either mirror the corresponding residues in P. amag. GOx, or mutated into all possible amino acids via saturation mutagenesis. Ultimately, four mutants were identified with significantly improved catalytic activity. A single point mutation from threonine to serine at amino acid 132 (mutant T132S, numbering includes leader peptide led to a three-fold improvement in k(cat at the expense of a 3% loss of substrate affinity (increase in apparent K(M for glucose resulting in a specify constant (k(cat/K(M of 23.8 (mM(-1 · s(-1 compared to 8.39 for the parental (A. niger GOx and 170 for the P. amag. GOx. Three other mutant enzymes were also identified that had improvements in overall catalysis: V42Y, and the double mutants T132S/T56V and T132S/V42Y, with specificity constants of 31.5, 32.2, and 31.8 mM(-1 · s

  2. Downregulation of cytochrome c oxidase subunit 7A1 expression is important in enhancing cell proliferation in adenocarcinoma cells

    International Nuclear Information System (INIS)

    Mishra, Nawneet; Timilsina, Uddhav; Ghimire, Dibya; Dubey, Ravi C.; Gaur, Ritu


    Mitochondrial Dysfunction has been implicated in multiple human diseases, including cancer. Among all cancer, lung cancer is the most common type of cancer worldwide with low survival rates. Mammals possess multiple subunits of the mitochondrial enzyme Cytochrome C oxidase (COX). The COX subunits are expressed in a tissue specific manner and have been implicated in cancer cell metabolism although their molecular and regulatory mechanisms are not clearly understood. In this study, we aimed at identifying novel gene signatures in lung cancer. We performed extensive analysis of seven different Gene Expression Omnibus (GEO) datasets pertaining to different stages of lung adenocarcinoma and identified that multiple subunits of COX genes are differentially expressed in these patients. Amongst all COX genes, the expression of COX7A1 gene was observed to be highly down regulated in these patients. In order to validate the GEO datasets, we looked at the expression of multiple COX genes using quantitative real time PCR (qPCR) using human lung adenocarcinoma cell line A549. Our results confirmed that COX 7A1 gene expression was indeed highly reduced in these cells. Overexpression of COX7A1 in human lung cancer cells led to inhibition of cell proliferation and increase in cell death via apoptosis. These results indicated that low level of COX7A1 gene expression is essential to regulate cell viability and inhibit cell death in lung adenocarcinoma. Our study has identified COX7A1 as a novel gene that might play a crucial role in the etiology of lung adenocarcinoma and can serve as a biomarker for lung cancer disease progression.

  3. Hofmeister effects on the glucose oxidase hydrogel-modified electrode

    International Nuclear Information System (INIS)

    Suzuki, Aimi; Tsujimura, Seiya


    We describe the consistent effect of salts in the electrolyte solution on glucose oxidation current production in the redox hydrogel-modified electrode containing glucose oxidase as an electrocatalyst and Os complex mediator. The ions affect not only on the electron transfer between the enzyme and the Os complex, but also on the hydrogel structure. This study found that the degree of the effect can be characterized by Hofmeister series. The relative decrease in oxidization current is the lowest in the middle of the Hofmeister series, and increases monotonically on either side. An increase of ionic strength inhibits the electron transfer from the active site of glucose oxidase to Os complex. In addition to this, the kosmotropic anions, which are strongly hydrated, caused hydrogel deswelling (shrinking). The more chaotropic an ion is, the more it adsorbs to uncharged parts of polymer/enzyme with dispersion force, and the swelling of the hydrogel decreases the catalytic current. This study impacts the design of hydrogel electrode and selection of electrolyte ions for bioelectronic applications.

  4. Oxidase catalysis via aerobically generated hypervalent iodine intermediates (United States)

    Maity, Asim; Hyun, Sung-Min; Powers, David C.


    The development of sustainable oxidation chemistry demands strategies to harness O2 as a terminal oxidant. Oxidase catalysis, in which O2 serves as a chemical oxidant without necessitating incorporation of oxygen into reaction products, would allow diverse substrate functionalization chemistry to be coupled to O2 reduction. Direct O2 utilization suffers from intrinsic challenges imposed by the triplet ground state of O2 and the disparate electron inventories of four-electron O2 reduction and two-electron substrate oxidation. Here, we generate hypervalent iodine reagents—a broadly useful class of selective two-electron oxidants—from O2. This is achieved by intercepting reactive intermediates of aldehyde autoxidation to aerobically generate hypervalent iodine reagents for a broad array of substrate oxidation reactions. The use of aryl iodides as mediators of aerobic oxidation underpins an oxidase catalysis platform that couples substrate oxidation directly to O2 reduction. We anticipate that aerobically generated hypervalent iodine reagents will expand the scope of aerobic oxidation chemistry in chemical synthesis.

  5. 2-acetylphenol analogs as potent reversible monoamine oxidase inhibitors

    Directory of Open Access Journals (Sweden)

    Legoabe LJ


    Full Text Available Lesetja J Legoabe,1 Anél Petzer,1 Jacobus P Petzer1,21Centre of Excellence for Pharmaceutical Sciences, 2Department of Pharmaceutical Chemistry, School of Pharmacy, North-West University, Potchefstroom, South AfricaAbstract: Based on a previous report that substituted 2-acetylphenols may be promising leads for the design of novel monoamine oxidase (MAO inhibitors, a series of C5-substituted 2-acetylphenol analogs (15 and related compounds (two were synthesized and evaluated as inhibitors of human MAO-A and MAO-B. Generally, the study compounds exhibited inhibitory activities against both MAO-A and MAO-B, with selectivity for the B isoform. Among the compounds evaluated, seven compounds exhibited IC50 values <0.01 µM for MAO-B inhibition, with the most selective compound being 17,000-fold selective for MAO-B over the MAO-A isoform. Analyses of the structure–activity relationships for MAO inhibition show that substitution on the C5 position of the 2-acetylphenol moiety is a requirement for MAO-B inhibition, and the benzyloxy substituent is particularly favorable in this regard. This study concludes that C5-substituted 2-acetylphenol analogs are potent and selective MAO-B inhibitors, appropriate for the design of therapies for neurodegenerative disorders such as Parkinson’s disease.Keywords: monoamine oxidase, MAO, inhibition, 2-acetylphenol, structure–activity relationship

  6. Biodegradation of phenolic compounds with oxidases from sorghum and non-defined mixed bacterium media

    International Nuclear Information System (INIS)

    Obame, C. E. L.; Savadogo, P. W.; Mamoudou, D. H.; Dembele, R. H.; Traore, A. S.


    The biodegradation of the phenolic compounds is performed using oxidative enzymes, e. g. polyphenol oxidases (PPOs) and peroxidases (POXs). These oxidases displaying a wide spectrum for the oxidation of phenolic compounds were isolated either from sorghum or mixed bacteria. Spectrophotometric methods were used to assess the monophenolase and diphenolase activities of PPOs as well as the hydrogen-dependant oxidation of POXs. (Author)

  7. Study on the preparation of immobilized glucose oxidase membrane and its application in clinic analysis

    International Nuclear Information System (INIS)

    Yu Ye; Cao Jin; Su Zongxian; Chen Zixiong


    The paper deals with the preparation of immobilized glucose oxidase membrane by using two steps irradiation (irradiation gratfting, irradiation entrapping). Some properties of membrane were discussed. The immobilized glucose oxidase membrane with oxygen electrode and oxygen analyser can be satisfied with the clinic analysis for the determination of serum glucose

  8. Switching an O2 sensitive glucose oxidase bioelectrode into an almost insensitive one by cofactor redesign. (United States)

    Tremey, Emilie; Suraniti, Emmanuel; Courjean, Olivier; Gounel, Sébastien; Stines-Chaumeil, Claire; Louerat, Frédéric; Mano, Nicolas


    In the 5-8 mM glucose concentration range, of particular interest for diabetes management, glucose oxidase bioelectrodes are O2 dependent, which decrease their efficiencies. By replacing the natural cofactor of glucose oxidase, we succeeded in turning an O2 sensitive bioelectrode into an almost insensitive one.

  9. Hydroxychavicol: a potent xanthine oxidase inhibitor obtained from the leaves of betel, Piper betle. (United States)

    Murata, Kazuya; Nakao, Kikuyo; Hirata, Noriko; Namba, Kensuke; Nomi, Takao; Kitamura, Yoshihisa; Moriyama, Kenzo; Shintani, Takahiro; Iinuma, Munekazu; Matsuda, Hideaki


    The screening of Piperaceous plants for xanthine oxidase inhibitory activity revealed that the extract of the leaves of Piper betle possesses potent activity. Activity-guided purification led us to obtain hydroxychavicol as an active principle. Hydroxychavicol is a more potent xanthine oxidase inhibitor than allopurinol, which is clinically used for the treatment of hyperuricemia.

  10. Analysis of cellulase and polyphenol oxidase production by southern pine beetle associated fungi (United States)

    Abduvali Valiev; Zumrut B. Ogel; Dier D. Klepzig


    In this study, the production of extracellular enzymes by fungi associated with southern pine beetle was investigated for the first time. Cellulase and polyphenol oxidase production were analyzed for three beetle associated fungi. Only the mutualistic symbiont Entomocorticium sp. A was found to produce cellulases and polyphenol oxidase....

  11. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    NARCIS (Netherlands)

    Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.


    BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The

  12. Purification, characterization and decolorization of bilirubin oxidase from Myrothecium verrucaria 3.2190 (United States)

    Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...

  13. Biodegradation of phenolic compounds with oxidases from sorghum and non-defined mixed bacterium media

    Energy Technology Data Exchange (ETDEWEB)

    Obame, C. E. L.; Savadogo, P. W.; Mamoudou, D. H.; Dembele, R. H.; Traore, A. S.


    The biodegradation of the phenolic compounds is performed using oxidative enzymes, e. g. polyphenol oxidases (PPOs) and peroxidases (POXs). These oxidases displaying a wide spectrum for the oxidation of phenolic compounds were isolated either from sorghum or mixed bacteria. Spectrophotometric methods were used to assess the monophenolase and diphenolase activities of PPOs as well as the hydrogen-dependant oxidation of POXs. (Author)

  14. Streptococcus mutans NADH oxidase lies at the intersection of overlapping regulons controlled by oxygen and NAD+ levels. (United States)

    Baker, J L; Derr, A M; Karuppaiah, K; MacGilvray, M E; Kajfasz, J K; Faustoferri, R C; Rivera-Ramos, I; Bitoun, J P; Lemos, J A; Wen, Z T; Quivey, R G


    NADH oxidase (Nox, encoded by nox) is a flavin-containing enzyme used by the oral pathogen Streptococcus mutans to reduce diatomic oxygen to water while oxidizing NADH to NAD(+). The critical nature of Nox is 2-fold: it serves to regenerate NAD(+), a carbon cycle metabolite, and to reduce intracellular oxygen, preventing formation of destructive reactive oxygen species (ROS). As oxygen and NAD(+) have been shown to modulate the activity of the global transcription factors Spx and Rex, respectively, Nox is potentially poised at a critical junction of two stress regulons. In this study, microarray data showed that either addition of oxygen or loss of nox resulted in altered expression of genes involved in energy metabolism and transport and the upregulation of genes encoding ROS-metabolizing enzymes. Loss of nox also resulted in upregulation of several genes encoding transcription factors and signaling molecules, including the redox-sensing regulator gene rex. Characterization of the nox promoter revealed that nox was regulated by oxygen, through SpxA, and by Rex. These data suggest a regulatory loop in which the roles of nox in reduction of oxygen and regeneration of NAD(+) affect the activity levels of Spx and Rex, respectively, and their regulons, which control several genes, including nox, crucial to growth of S. mutans under conditions of oxidative stress. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. Alternative Oxidase: A Mitochondrial Respiratory Pathway to Maintain Metabolic and Signaling Homeostasis during Abiotic and Biotic Stress in Plants

    Directory of Open Access Journals (Sweden)

    Greg C. Vanlerberghe


    Full Text Available Alternative oxidase (AOX is a non-energy conserving terminal oxidase in the plant mitochondrial electron transport chain. While respiratory carbon oxidation pathways, electron transport, and ATP turnover are tightly coupled processes, AOX provides a means to relax this coupling, thus providing a degree of metabolic homeostasis to carbon and energy metabolism. Beside their role in primary metabolism, plant mitochondria also act as “signaling organelles”, able to influence processes such as nuclear gene expression. AOX activity can control the level of potential mitochondrial signaling molecules such as superoxide, nitric oxide and important redox couples. In this way, AOX also provides a degree of signaling homeostasis to the organelle. Evidence suggests that AOX function in metabolic and signaling homeostasis is particularly important during stress. These include abiotic stresses such as low temperature, drought, and nutrient deficiency, as well as biotic stresses such as bacterial infection. This review provides an introduction to the genetic and biochemical control of AOX respiration, as well as providing generalized examples of how AOX activity can provide metabolic and signaling homeostasis. This review also examines abiotic and biotic stresses in which AOX respiration has been critically evaluated, and considers the overall role of AOX in growth and stress tolerance.

  16. Loss of the smallest subunit of cytochrome c oxidase, COX8A, causes Leigh-like syndrome and epilepsy. (United States)

    Hallmann, Kerstin; Kudin, Alexei P; Zsurka, Gábor; Kornblum, Cornelia; Reimann, Jens; Stüve, Burkhard; Waltz, Stephan; Hattingen, Elke; Thiele, Holger; Nürnberg, Peter; Rüb, Cornelia; Voos, Wolfgang; Kopatz, Jens; Neumann, Harald; Kunz, Wolfram S


    Isolated cytochrome c oxidase (complex IV) deficiency is one of the most frequent respiratory chain defects in humans and is usually caused by mutations in proteins required for assembly of the complex. Mutations in nuclear-encoded structural subunits are very rare. In a patient with Leigh-like syndrome presenting with leukodystrophy and severe epilepsy, we identified a homozygous splice site mutation in COX8A, which codes for the ubiquitously expressed isoform of subunit VIII, the smallest nuclear-encoded subunit of complex IV. The mutation, affecting the last nucleotide of intron 1, leads to aberrant splicing, a frame-shift in the highly conserved exon 2, and decreased amount of the COX8A transcript. The loss of the wild-type COX8A protein severely impairs the stability of the entire cytochrome c oxidase enzyme complex and manifests in isolated complex IV deficiency in skeletal muscle and fibroblasts, similar to the frequent c.845_846delCT mutation in the assembly factor SURF1 gene. Stability and activity of complex IV could be rescued in the patient's fibroblasts by lentiviral expression of wild-type COX8A. Our findings demonstrate that COX8A is indispensable for function of human complex IV and its mutation causes human disease. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email:

  17. Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity. (United States)

    Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A


    Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).

  18. [Experimental rationale for the parameters of a rapid method for oxidase activity determination]. (United States)

    Butorina, N N


    Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.

  19. A Biocatalytic One-Pot Approach for the Preparation of Lignin Oligomers Using an Oxidase/Peroxidase Cascade Enzyme System

    NARCIS (Netherlands)

    Habib, Mohamed H. M.; Deuss, Peter J.; Loncar, Nikola; Trajkovic, Milos; Fraaije, Marco W.


    Synthetic lignin was prepared biocatalytically in a one-pot, two-step reaction using an oxidase/peroxidase cascade enzyme system. Using eugenol in combination with eugenol oxidase and a peroxidase, lignin-like material was produced. The cascade reaction takes advantage of the ability of the oxidase

  20. The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y

    Directory of Open Access Journals (Sweden)

    Simon Auer


    Full Text Available NADPH oxidases of human cells are not only functional in defense against invading microorganisms and for oxidative reactions needed for specialized biosynthetic pathways but also during the past few years have been established as signaling modules. It has been shown that human Nox4 is expressed in most somatic cell types and produces hydrogen peroxide, which signals to remodel the actin cytoskeleton. This correlates well with the function of Yno1, the only NADPH oxidase of yeast cells. Using two established tumor cell lines, which are derived from hepatic and neuroblastoma tumors, respectively, we are showing here that in both tumor models Nox4 is expressed in the ER (like the yeast NADPH oxidase, where according to published literature, it produces hydrogen peroxide. Reducing this biochemical activity by downregulating Nox4 transcription leads to loss of F-actin stress fibers. This phenotype is reversible by adding hydrogen peroxide to the cells. The effect of the Nox4 silencer RNA is specific for this gene as it does not influence the expression of Nox2. In the case of the SH-SY5Y neuronal cell line, Nox4 inhibition leads to loss of cell mobility as measured in scratch assays. We propose that inhibition of Nox4 (which is known to be strongly expressed in many tumors could be studied as a new target for cancer treatment, in particular for inhibition of metastasis.

  1. Antibacterial properties of the mammalian L-amino acid oxidase IL4I1.

    Directory of Open Access Journals (Sweden)

    Marie-Line Puiffe

    Full Text Available L-amino acid oxidases (LAAO are flavoproteins that catalyze the oxidative deamination of L-amino acids to a keto-acid along with the production of H₂O₂ and ammonia. Interleukin 4 induced gene 1 (IL4I1 is a secreted LAAO expressed by macrophages and dendritic cells stimulated by microbial derived products or interferons, which is endowed with immunoregulatory properties. It is the first LAAO described in mammalian innate immune cells. In this work, we show that this enzyme blocks the in vitro and in vivo growth of Gram negative and Gram positive bacteria. This antibiotic effect is primarily mediated by H₂O₂ production but is amplified by basification of the medium due to the accumulation of ammonia. The depletion of phenylalanine (the primary amino acid catabolized by IL4I1 may also participate in the in vivo inhibition of staphylococci growth. Thus, IL4I1 plays a distinct role compared to other antibacterial enzymes produced by mononuclear phagocytes.

  2. Estimation of Anadara tuberculosa genetic diversity in five mangroves from Tumaco, using Cytochrome oxidase I enzyme

    Directory of Open Access Journals (Sweden)

    Esmeralda Chamorro L


    Full Text Available Objective. To estimate the genetic diversity of the Anadara tuberculosa en five mangrove swams of Tumaco, Nariño, Colombia using as a mitocondrial molecular marker the cytochromo oxidase sub-unit I (COI. Materials and methods. A total of 50 individuals were collected from the San Jorge, La Tiburonera, El Pajal, La Playa y Bajito Vaquería mangrove swamps, randomly selecting 10 specimens of each zone. The tissue sample was worked with absolute alcohol at ambient temperature in microtubes. DNA was extracted, and the mitocondrial DNA was amplified using the PCR technique (polymerase chain reaction. The amplified and quantified products of PCR were sequenced on both sides (Macrogen. Each one of the obtained sequences was edited and aligned. Later, the parameters of genetic diversity (haplotypical and nucleotidical were measured, and the analysis of distribution between frequency pairs (Mistmach distribution was elaborated. Finally, the analysis of nucleotidic variation and population structure (AMOVA was completed. Results. The amplified product gene weighed 710 bp. The haplotypical diversity reported for all the populations was high (0.683±0.060 and the reported nucleotídical diversity was low for all the populations (0.040±0.020. The AMOVA results indicate that the variance amongst populations is low (4.20% and that the variance within populations is high (95.80%. Conclusions. The studied populations are not structured and although there is a decrease of natural banks, the genetic diversity is high.

  3. Functional mechanism of neuroprotection by inhibitors of type B monoamine oxidase in Parkinson's disease. (United States)

    Naoi, Makoto; Maruyama, Wakako


    Neuroprotective therapy has been proposed for age-related neurodegenerative disorders, including Parkinson's disease. Inhibitors of type B monoamine oxidase (MAOB-Is), rasagiline and (-)deprenyl, are the most promising candidate neuroprotective drugs. Clinical trials of rasagiline in patients with Parkinson's disease suggest that rasagiline may have some disease-modifying effects. Results using animal and cellular models have proved that the MAOB-Is protect neurons by the intervention of 'intrinsic' mitochondrial apoptotic cascade and the induction of prosurvival antiapoptotic Bcl-2 and neurotrophic factors. Rasagiline-related MAOB-Is prevent mitochondrial permeability transition induced by various insults and activation of subsequent apoptotic cascades: cytochrome c release, casapase activation, and condensation and fragmentation of nuclear DNA. MAOB-Is increase transcription of prosurvival genes through activating the nuclear transcription factor-(NF) system. Rasagiline increases the protein and mRNA levels of GDNF in dopaminergic SH-SY5Y cells, whereas (-)deprenyl increases those of BDNF. Systemic administration of (-)deprenyl and rasagiline increases these neurotrophic factors in the cerebrospinal fluid from patients with Parkinson's disease and nonhuman primates. This review presents recent advances in our understanding of the neuroprotection offered by MAOB-Is and possible evaluation of neuroprotective efficacy in clinical samples is discussed.

  4. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode. (United States)

    Françoso, E; Arias, M C


    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  5. Inducing the Alternative Oxidase Forms Part of the Molecular Strategy of Anoxic Survival in Freshwater Bivalves

    Directory of Open Access Journals (Sweden)

    Maria S. Yusseppone


    Full Text Available Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O2/L, hypoxia (2 mg O2/L, and normoxia (9 mg O2/L. Specifically, we investigated the expression of an alternative oxidase (AOX pathway assumed to shortcut the regular mitochondrial electron transport system (ETS during metabolic rate depression (MRD in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP and succinate dehydrogenase (SDH in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis. Oxidative stress [protein carbonylation, glutathione peroxidase (GPx expression] and apoptotic intensity (caspase 3/7 activity decreased, whereas an unfolded protein response (HSP90 was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks.

  6. Inducing the Alternative Oxidase Forms Part of the Molecular Strategy of Anoxic Survival in Freshwater Bivalves (United States)

    Yusseppone, Maria S.; Rocchetta, Iara; Sabatini, Sebastian E.; Luquet, Carlos M.; Ríos de Molina, Maria del Carmen; Held, Christoph; Abele, Doris


    Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O2/L), hypoxia (2 mg O2/L), and normoxia (9 mg O2/L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis. Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks. PMID:29527172

  7. NDUFA4 Mutations Underlie Dysfunction of a Cytochrome c Oxidase Subunit Linked to Human Neurological Disease

    Directory of Open Access Journals (Sweden)

    Robert D.S. Pitceathly


    Full Text Available The molecular basis of cytochrome c oxidase (COX, complex IV deficiency remains genetically undetermined in many cases. Homozygosity mapping and whole-exome sequencing were performed in a consanguineous pedigree with isolated COX deficiency linked to a Leigh syndrome neurological phenotype. Unexpectedly, affected individuals harbored homozygous splice donor site mutations in NDUFA4, a gene previously assigned to encode a mitochondrial respiratory chain complex I (NADH:ubiquinone oxidoreductase subunit. Western blot analysis of denaturing gels and immunocytochemistry revealed undetectable steady-state NDUFA4 protein levels, indicating that the mutation causes a loss-of-function effect in the homozygous state. Analysis of one- and two-dimensional blue-native polyacrylamide gels confirmed an interaction between NDUFA4 and the COX enzyme complex in control muscle, whereas the COX enzyme complex without NDUFA4 was detectable with no abnormal subassemblies in patient muscle. These observations support recent work in cell lines suggesting that NDUFA4 is an additional COX subunit and demonstrate that NDUFA4 mutations cause human disease. Our findings support reassignment of the NDUFA4 protein to complex IV and suggest that patients with unexplained COX deficiency should be screened for NDUFA4 mutations.

  8. Improvement Strategies, Cost Effective Production, and Potential Applications of Fungal Glucose Oxidase (GOD): Current Updates. (United States)

    Dubey, Manish K; Zehra, Andleeb; Aamir, Mohd; Meena, Mukesh; Ahirwal, Laxmi; Singh, Siddhartha; Shukla, Shruti; Upadhyay, Ram S; Bueno-Mari, Ruben; Bajpai, Vivek K


    Fungal glucose oxidase (GOD) is widely employed in the different sectors of food industries for use in baking products, dry egg powder, beverages, and gluconic acid production. GOD also has several other novel applications in chemical, pharmaceutical, textile, and other biotechnological industries. The electrochemical suitability of GOD catalyzed reactions has enabled its successful use in bioelectronic devices, particularly biofuel cells, and biosensors. Other crucial aspects of GOD such as improved feeding efficiency in response to GOD supplemental diet, roles in antimicrobial activities, and enhancing pathogen defense response, thereby providing induced resistance in plants have also been reported. Moreover, the medical science, another emerging branch where GOD was recently reported to induce several apoptosis characteristics as well as cellular senescence by downregulating Klotho gene expression. These widespread applications of GOD have led to increased demand for more extensive research to improve its production, characterization, and enhanced stability to enable long term usages. Currently, GOD is mainly produced and purified from Aspergillus niger and Penicillium species, but the yield is relatively low and the purification process is troublesome. It is practical to build an excellent GOD-producing strain. Therefore, the present review describes innovative methods of enhancing fungal GOD production by using genetic and non-genetic approaches in-depth along with purification techniques. The review also highlights current research progress in the cost effective production of GOD, including key advances, potential applications and limitations. Therefore, there is an extensive need to commercialize these processes by developing and optimizing novel strategies for cost effective GOD production.

  9. Genome wide association mapping for the tolerance to the polyamine oxidase inhibitor guazatine in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Kostadin Evgeniev eAtanasov


    Full Text Available Guazatine is a potent inhibitor of polyamine oxidase (PAO activity. In agriculture, guazatine is used as non-systemic contact fungicide efficient in the protection of cereals and citrus fruits against disease. The composition of guazatine is complex, mainly constituted by a mixture of synthetic guanidated polyamines (polyaminoguanidines. Here we have studied the effects from exposure to guazatine in the weed Arabidopsis thaliana. We report that micromolar concentrations of guazatine are sufficient to inhibit growth of Arabidopsis seedlings and induce chlorosis, whereas germination is barely affected. We observed the occurrence of quantitative variation in the response to guazatine between 107 randomly chosen Arabidopsis accessions. This enabled us to undertake genome-wide association (GWA mapping that identified a locus on chromosome one associated with guazatine tolerance. CHLOROPHYLLASE 1 (CLH1 within this locus was studied as candidate gene, together with its paralog (CLH2. The analysis of independent clh1-2, clh1-3, clh2-3, clh2-2 and double clh1-2 clh2-3 mutant alleles indicated that CLH1 and/or CLH2 loss-of-function or expression down-regulation promote guazatine tolerance in Arabidopsis. We report a natural mechanism by which Arabidopsis populations can overcome toxicity by the fungicide guazatine.

  10. Oxidized low-density lipoproteins upregulate proline oxidase to initiate ROS-dependent autophagy. (United States)

    Zabirnyk, Olga; Liu, Wei; Khalil, Shadi; Sharma, Anit; Phang, James M


    Epidemiological studies showed that high levels of oxidized low-density lipoproteins (oxLDLs) are associated with increased cancer risk. We examined the direct effect of physiologic concentrations oxLDL on cancer cells. OxLDLs were cytotoxic and activate both apoptosis and autophagy. OxLDLs have ligands for peroxisome proliferator-activated receptor gamma and upregulated proline oxidase (POX) through this nuclear receptor. We identified 7-ketocholesterol (7KC) as a main component responsible for the latter. To elucidate the role of POX in oxLDL-mediated cytotoxicity, we knocked down POX via small interfering RNA and found that this (i) further reduced viability of cancer cells treated with oxLDL; (ii) decreased oxLDL-associated reactive oxygen species generation; (iii) decreased autophagy measured via beclin-1 protein level and light-chain 3 protein (LC3)-I into LC3-II conversion. Using POX-expressing cell model, we established that single POX overexpression was sufficient to activate autophagy. Thus, it led to autophagosomes accumulation and increased conversion of LC3-I into LC3-II. Moreover, beclin-1 gene expression was directly dependent on POX catalytic activity, namely the generation of POX-dependent superoxide. We conclude that POX is critical in the cellular response to the noxious effects of oxLDL by activating protective autophagy.

  11. Association of altered collagen content and lysyl oxidase expression in degenerative mitral valve disease. (United States)

    Purushothaman, K-Raman; Purushothaman, Meerarani; Turnbull, Irene C; Adams, David H; Anyanwu, Anelechi; Krishnan, Prakash; Kini, Annapoorna; Sharma, Samin K; O'Connor, William N; Moreno, Pedro R

    Collagen cross-linking is mediated by lysyl oxidase (LOX) enzyme in the extracellular matrix (ECM) of mitral valve leaflets. Alterations in collagen content and LOX protein expression in the ECM of degenerative mitral valve may enhance leaflet expansion and disease severity. Twenty posterior degenerative mitral valve leaflets from patients with severe mitral regurgitation were obtained at surgery. Five normal posterior mitral valve leaflets procured during autopsy served as controls. Valvular interstitial cells (VICs) density was quantified by immunohistochemistry, collagen Types I and III by picro-sirius red staining and immunohistochemistry, and proteoglycans by alcian blue staining. Protein expression of LOX and its mediator TGFβ1 were quantified by immunofluorescence and gene expression by PCR. VIC density was increased, structural Type I collagen density was reduced, while reparative Type III collagen and proteoglycan densities were increased (PDegenerative Mitral Valve Disease may be secondary to alterations in LOX protein expression, contributing to disorganization of ECM and disease severity. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Mam33 promotes cytochrome c oxidase subunit I translation in Saccharomyces cerevisiae mitochondria. (United States)

    Roloff, Gabrielle A; Henry, Michael F


    Three mitochondrial DNA-encoded proteins, Cox1, Cox2, and Cox3, comprise the core of the cytochrome c oxidase complex. Gene-specific translational activators ensure that these respiratory chain subunits are synthesized at the correct location and in stoichiometric ratios to prevent unassembled protein products from generating free oxygen radicals. In the yeast Saccharomyces cerevisiae, the nuclear-encoded proteins Mss51 and Pet309 specifically activate mitochondrial translation of the largest subunit, Cox1. Here we report that Mam33 is a third COX1 translational activator in yeast mitochondria. Mam33 is required for cells to adapt efficiently from fermentation to respiration. In the absence of Mam33, Cox1 translation is impaired, and cells poorly adapt to respiratory conditions because they lack basal fermentative levels of Cox1. © 2015 Roloff and Henry. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (

  13. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase. (United States)

    Jung, Sunyo; Back, Kyoungwhan


    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

  14. Molecular phylogeny of the Oriental butterfly genus Arhopala (Lycaenidae, Theclinae) inferred from mitochondrial and nuclear genes

    NARCIS (Netherlands)

    Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.


    We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42

  15. Isolation of a candidate gene for Norrie disease by positional cloning

    NARCIS (Netherlands)

    Berger, W.; Meindl, A.; van de Pol, T. J.; Cremers, F. P.; Ropers, H. H.; Döerner, C.; Monaco, A.; Bergen, A. A.; Lebo, R.; Warburg, M.


    The gene for Norrie disease, an X-linked disorder characterized by progressive atrophy of the eyes, mental disturbances and deafness, has been mapped to chromosome Xp11.4 close to DXS7 and the monoamine oxidase (MAO) genes. By subcloning a YAC with a 640 kilobases (kb) insert which spans the

  16. Facile direct electron transfer in glucose oxidase modified electrodes

    International Nuclear Information System (INIS)

    Wang Dan; Chen Liwei


    Glucose oxidase (GOx) is widely used in the glucose biosensor industry. However, mediatorless direct electron transfer (DET) from GOx to electrode surfaces is very slow. Recently, mediatorless DET has been reported via the incorporation of nanomaterials such as carbon nanotubes and nanoparticles in the modification of electrodes. Here we report GOx electrodes showing DET without the need for any nanomaterials. The enzyme after immobilization with poly-L-lysine (PLL) and Nafion retains the biocatalytic activities and oxidizes glucose efficiently. The amperometric response of Nafion-PLL-GOx modified electrode is linearly proportional to the concentration of glucose up to 10 mM with a sensitivity of 0.75 μA/mM at a low detection potential (-0.460 V vs. Ag/AgCl). The methodology developed in this study will have impact on glucose biosensors and biofuel cells and may potentially simplify enzyme immobilization in other biosensing systems.

  17. Low platelet monoamine oxidase activity in pathological gambling

    International Nuclear Information System (INIS)

    Carrasco, J.L.; Saiz-Ruiz, J.; Hollander, E.; Cesar, J.; Lopez-Ibor, J.J. Jr.


    Decreased platelet monoamine oxidase (MAO) activity has been reported in association with sensation-seeking personality type and in some mental disorders associated with a lack of impulse control. Pathological gambling itself has been related with both sensation-seeking and reduced impulse control. Platelet MAO activity was investigated in 15 DSM-III-R pathological gamblers from our outpatient clinic. Gamblers had a significantly lower platelet MAO activity than a group of 25 healthy controls. The range of MAO levels in gamblers was also significantly shorter than in controls. In controls, platelet MAO levels showed the previously described negative correlations with sensation-seeking scores but not in gamblers. The findings are consistent with previous studies showing an association of low platelet MAO activity with impulse control disorders and raise some interesting therapeutic alternatives for pathological gambling. (au) (40 refs.)

  18. Dual oxidase in mucosal immunity and host-microbe homeostasis. (United States)

    Bae, Yun Soo; Choi, Myoung Kwon; Lee, Won-Jae


    Mucosal epithelia are in direct contact with microbes, which range from beneficial symbionts to pathogens. Accordingly, hosts must have a conflicting strategy to combat pathogens efficiently while tolerating symbionts. Recent progress has revealed that dual oxidase (DUOX) plays a key role in mucosal immunity in organisms that range from flies to humans. Information from the genetic model of Drosophila has advanced our understanding of the regulatory mechanism of DUOX and its role in mucosal immunity. Further investigations of DUOX regulation in response to symbiotic or non-symbiotic bacteria and the in vivo consequences in host physiology will give a novel insight into the microbe-controlling system of the mucosa. Copyright 2010 Elsevier Ltd. All rights reserved.

  19. Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects

    Directory of Open Access Journals (Sweden)

    Francesca Taranto


    Full Text Available Enzymatic browning is a colour reaction occurring in plants, including cereals, fruit and horticultural crops, due to oxidation during postharvest processing and storage. This has a negative impact on the colour, flavour, nutritional properties and shelf life of food products. Browning is usually caused by polyphenol oxidases (PPOs, following cell damage caused by senescence, wounding and the attack of pests and pathogens. Several studies indicated that PPOs play a role in plant immunity, and emerging evidence suggested that PPOs might also be involved in other physiological processes. Genomic investigations ultimately led to the isolation of PPO homologs in several crops, which will be possibly characterized at the functional level in the near future. Here, focusing on the botanic families of Poaceae and Solanaceae, we provide an overview on available scientific literature on PPOs, resulting in useful information on biochemical, physiological and genetic aspects.

  20. The Membrane Modulates Internal Proton Transfer in Cytochrome c Oxidase

    DEFF Research Database (Denmark)

    Öjemyr, Linda Nasvik; Ballmoos, Christoph von; Faxén, Kristina


    The functionality of membrane proteins is often modulated by the surrounding membrane. Here, we investigated the effect of membrane reconstitution of purified cytochrome c oxidase (CytcO) on the kinetics and thermodynamics of internal electron and proton-transfer reactions during O-2 reduction...... DOPC lipids. In conclusion, the data show that the membrane significantly modulates internal charge-transfer reactions and thereby the function of the membrane-bound enzyme.......-glycerol) (DOPG). In addition, a small Change in the internal Cu-A-heme a electron equilibrium constant was observed. This effect was lipid-dependent and explained in terms of a lower electrostatic potential within the membrane-spanning part of the protein with the anionic DOPG lipids than with the zwitterionic...

  1. Purification and characterization of amine oxidase from soybean seedlings. (United States)

    Vianello, F; Di Paolo, M L; Stevanato, R; Gasparini, R; Rigo, A


    A simple and rapid procedure for purification of soybean seedling amine oxidase is reported. The crude enzyme, obtained by ammonium sulfate fractionation was purified by ion-exchange chromatography on a cellulose phosphate column and batch affinity chromatography on 6-aminohexyl-Sepharose. Cyclohexylamine, a competitive inhibitor, was utilized to elute the enzyme. A homogeneous enzyme was obtained with a yield higher than 25%, the content of minor components being lauryl sulfate-polyacrylamide gel electrophoresis. The enzyme is a dimer and contains two Cu2+ ion per molecule. Its EPR spectrum is typical of Cu2+ in a tetragonal symmetry. The enzyme oxidizes cadaverine at high rate, the specific activity being 4.3 mukat/mg. Molecular, spectroscopic, and kinetic properties of this enzyme are reported.

  2. Low platelet monoamine oxidase activity in pathological gambling

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco, J.L. [Department of Psychiatry, Centro de Salud Mental, Parla Madrid (Spain); Saiz-Ruiz, J. [Department of Psychiatry and Haematology, Hospital Ramon y Cajal, Madrid (Spain); Hollander, E. [Department of Psychiatry, Mount Sinai School of Medicine, Queens Hospital Center, New York (United States); Cesar, J. [Department of Haematology, Hospital Ramon y Cajal, Madrid (Spain); Lopez-Ibor, J.J. Jr. [Department of Psychiatry, Hospital San Carlos, Complutense University, Madrid (Spain)


    Decreased platelet monoamine oxidase (MAO) activity has been reported in association with sensation-seeking personality type and in some mental disorders associated with a lack of impulse control. Pathological gambling itself has been related with both sensation-seeking and reduced impulse control. Platelet MAO activity was investigated in 15 DSM-III-R pathological gamblers from our outpatient clinic. Gamblers had a significantly lower platelet MAO activity than a group of 25 healthy controls. The range of MAO levels in gamblers was also significantly shorter than in controls. In controls, platelet MAO levels showed the previously described negative correlations with sensation-seeking scores but not in gamblers. The findings are consistent with previous studies showing an association of low platelet MAO activity with impulse control disorders and raise some interesting therapeutic alternatives for pathological gambling. (au) (40 refs.).

  3. Optical characterization of porous silicon microcavities for glucose oxidase biosensing (United States)

    Palestino, G.; Agarwal, V.; Garcia, D. B.; Legros, R.; Pérez, E.; Gergely, C.


    PSi microcavity (PSiMc) is characterized by a narrow resonance peak in the optical spectrum that is very sensitive to small changes in the refractive index. We report that the resonant optical cavities of PSi structures can be used to enhance the detection of labeled fluorescent biomolecules. Various PSi configurations were tested in order to compare the optical response of the PSi devices to the capture of organic molecules. Morphological and topographical analyses were performed on PSiMc using Atomic Force (AFM) and Scanning Electron (SEM) microscopies. The heterogeneity in pores lengths resulting from etching process assures a better penetration of larger molecules into the pores and sensor sensitivity depends on the pore size. Molecular detection is monitored by the successive red shifts in the reflectance spectra after the stabilization of PSiMc with 3-aminopropyltriethoxysilane (APTES). The glucose oxidase was cross linked into the PSiMc structures following a silane-glutaraldehyde (GTA) chemistry.

  4. Magnetic field effects on brain monoamine oxidase activity

    Energy Technology Data Exchange (ETDEWEB)

    Borets, V.M.; Ostrovskiy, V.Yu.; Bankovskiy, A.A.; Dudinskaya, T.F.


    In view of the increasing use of magnetotherapy, studies were conducted on the effects of 35 mTesla magnetic fields on monoamine oxidase activity in the rat brain. Under in vitro conditions a constant magnetic field in the continuous mode was most effective in inhibiting deamination of dopamine following 1 min exposure, while in vivo studies with 8 min or 10 day exposures showed that inhibition was obtained only with a variable field in the continuous mode. However, inhibition of dopamine deamination was only evident within the first 24 h after exposure was terminated. In addition, in none of the cases was norepinephrine deamination inhibited. The effects of the magnetic fields were, therefore, transient and selective with the CNS as the target system. 9 references.

  5. Suicide attempts, platelet monoamine oxidase and the average evoked response

    International Nuclear Information System (INIS)

    Buchsbaum, M.S.; Haier, R.J.; Murphy, D.L.


    The relationship between suicides and suicide attempts and two biological measures, platelet monoamine oxidase levels (MAO) and average evoked response (AER) augmenting was examined in 79 off-medication psychiatric patients and in 68 college student volunteers chosen from the upper and lower deciles of MAO activity levels. In the patient sample, male individuals with low MAO and AER augmenting, a pattern previously associated with bipolar affective disorders, showed a significantly increased incidence of suicide attempts in comparison with either non-augmenting low MAO or high MAO patients. Within the normal volunteer group, all male low MAO probands with a family history of suicide or suicide attempts were AER augmenters themselves. Four completed suicides were found among relatives of low MAO probands whereas no high MAO proband had a relative who committed suicide. These findings suggest that the combination of low platelet MAO activity and AER augmenting may be associated with a possible genetic vulnerability to psychiatric disorders. (author)

  6. Reengineered glucose oxidase for amperometric glucose determination in diabetes analytics. (United States)

    Arango Gutierrez, Erik; Mundhada, Hemanshu; Meier, Thomas; Duefel, Hartmut; Bocola, Marco; Schwaneberg, Ulrich


    Glucose oxidase is an oxidoreductase exhibiting a high β-D-glucose specificity and high stability which renders glucose oxidase well-suited for applications in diabetes care. Nevertheless, GOx activity is highly oxygen dependent which can lead to inaccuracies in amperometric β-D-glucose determinations. Therefore a directed evolution campaign with two rounds of random mutagenesis (SeSaM followed by epPCR), site saturation mutagenesis studies on individual positions, and one simultaneous site saturation library (OmniChange; 4 positions) was performed. A diabetes care well suited mediator (quinone diimine) was selected and the GOx variant (T30V I94V) served as starting point. For directed GOx evolution a microtiter plate detection system based on the quinone diimine mediator was developed and the well-known ABTS-assay was applied in microtiter plate format to validate oxygen independency of improved GOx variants. Two iterative rounds of random diversity generation and screening yielded to two subsets of amino acid positions which mainly improved activity (A173, A332) and oxygen independency (F414, V560). Simultaneous site saturation of all four positions with a reduced subset of amino acids using the OmniChange method yielded finally variant V7 with a 37-fold decreased oxygen dependency (mediator activity: 7.4 U/mg WT, 47.5 U/mg V7; oxygen activity: 172.3 U/mg WT, 30.1 U/mg V7). V7 is still highly β-D-glucose specific, highly active with the quinone diimine mediator and thermal resistance is retained (prerequisite for GOx coating of diabetes test stripes). The latter properties and V7's oxygen insensitivity make V7 a very promising candidate to replace standard GOx in diabetes care applications. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Molecular Dynamic Studies of the Complex Polyethylenimine and Glucose Oxidase. (United States)

    Szefler, Beata; Diudea, Mircea V; Putz, Mihai V; Grudzinski, Ireneusz P


    Glucose oxidase (GOx) is an enzyme produced by Aspergillus, Penicillium and other fungi species. It catalyzes the oxidation of β-d-glucose (by the molecular oxygen or other molecules, like quinones, in a higher oxidation state) to form d-glucono-1,5-lactone, which hydrolyses spontaneously to produce gluconic acid. A coproduct of this enzymatic reaction is hydrogen peroxide (H₂O₂). GOx has found several commercial applications in chemical and pharmaceutical industries including novel biosensors that use the immobilized enzyme on different nanomaterials and/or polymers such as polyethylenimine (PEI). The problem of GOx immobilization on PEI is retaining the enzyme native activity despite its immobilization onto the polymer surface. Therefore, the molecular dynamic (MD) study of the PEI ligand (C14N8_07_B22) and the GOx enzyme (3QVR) was performed to examine the final complex PEI-GOx stabilization and the affinity of the PEI ligand to the docking sites of the GOx enzyme. The docking procedure showed two places/regions of major interaction of the protein with the polymer PEI: (LIG1) of -5.8 kcal/mol and (LIG2) of -4.5 kcal/mol located inside the enzyme and on its surface, respectively. The values of enthalpy for the PEI-enzyme complex, located inside of the protein (LIG1) and on its surface (LIG2) were computed. Docking also discovered domains of the GOx protein that exhibit no interactions with the ligand or have even repulsive characteristics. The structural data clearly indicate some differences in the ligand PEI behavior bound at the two places/regions of glucose oxidase.

  8. Apocynin: Chemical and Biophysical Properties of a NADPH Oxidase Inhibitor

    Directory of Open Access Journals (Sweden)

    Valdecir F. Ximenes


    Full Text Available Apocynin is the most employed inhibitor of NADPH oxidase (NOX, a multienzymatic complex capable of catalyzing the one-electron reduction of molecular oxygen to the superoxide anion. Despite controversies about its selectivity, apocynin has been used as one of the most promising drugs in experimental models of inflammatory and neurodegenerative diseases. Here, we aimed to study the chemical and biophysical properties of apocynin. The oxidation potential was determined by cyclic voltammetry (Epa = 0.76V, the hydrophobicity index was calculated (logP = 0.83 and the molar absorption coefficient was determined (e275nm = 1.1 × 104 M−1 cm−1. Apocynin was a weak free radical scavenger (as measured using the DPPH, peroxyl radical and nitric oxide assays when compared to protocatechuic acid, used here as a reference antioxidant. On the other hand, apocynin was more effective than protocatechuic acid as scavenger of the non-radical species hypochlorous acid. Apocynin reacted promptly with the non-radical reactive species H2O2 only in the presence of peroxidase. This finding is relevant, since it represents a new pathway for depleting H2O2 in cellular experimental models, besides the direct inhibition of NADPH oxidase. This could be relevant for its application as an inhibitor of NOX4, since this isoform produces H2O2 and not superoxide anion. The binding parameters calculated by fluorescence quenching showed that apocynin binds to human serum albumin (HSA with a binding affinity of 2.19 × 104 M−1. The association did not alter the secondary and tertiary structure of HSA, as verified by synchronous fluorescence and circular dichroism. The displacement of fluorescent probes suggested that apocynin binds to site I and site II of HSA. Considering the current biomedical applications of this phytochemical, the dissemination of these chemical and biophysical properties can be very helpful for scientists and physicians interested in the use of apocynin.

  9. Molecular Dynamic Studies of the Complex Polyethylenimine and Glucose Oxidase

    Directory of Open Access Journals (Sweden)

    Beata Szefler


    Full Text Available Glucose oxidase (GOx is an enzyme produced by Aspergillus, Penicillium and other fungi species. It catalyzes the oxidation of β-d-glucose (by the molecular oxygen or other molecules, like quinones, in a higher oxidation state to form d-glucono-1,5-lactone, which hydrolyses spontaneously to produce gluconic acid. A coproduct of this enzymatic reaction is hydrogen peroxide (H2O2. GOx has found several commercial applications in chemical and pharmaceutical industries including novel biosensors that use the immobilized enzyme on different nanomaterials and/or polymers such as polyethylenimine (PEI. The problem of GOx immobilization on PEI is retaining the enzyme native activity despite its immobilization onto the polymer surface. Therefore, the molecular dynamic (MD study of the PEI ligand (C14N8_07_B22 and the GOx enzyme (3QVR was performed to examine the final complex PEI-GOx stabilization and the affinity of the PEI ligand to the docking sites of the GOx enzyme. The docking procedure showed two places/regions of major interaction of the protein with the polymer PEI: (LIG1 of −5.8 kcal/mol and (LIG2 of −4.5 kcal/mol located inside the enzyme and on its surface, respectively. The values of enthalpy for the PEI-enzyme complex, located inside of the protein (LIG1 and on its surface (LIG2 were computed. Docking also discovered domains of the GOx protein that exhibit no interactions with the ligand or have even repulsive characteristics. The structural data clearly indicate some differences in the ligand PEI behavior bound at the two places/regions of glucose oxidase.

  10. Isolation and genome sequencing of four Arctic marine Psychrobacter strains exhibiting multicopper oxidase activity. (United States)

    Moghadam, Morteza Shojaei; Albersmeier, Andreas; Winkler, Anika; Cimmino, Lorenzo; Rise, Kjersti; Hohmann-Marriott, Martin Frank; Kalinowski, Jörn; Rückert, Christian; Wentzel, Alexander; Lale, Rahmi


    Marine cold-temperature environments are an invaluable source of psychrophilic microbial life for new biodiscoveries. An Arctic marine bacterial strain collection was established consisting of 1448 individual isolates originating from biota, water and sediment samples taken at a various depth in the Barents Sea, North of mainland Norway, with an all year round seawater temperature of 4 °C. The entire collection was subjected to high-throughput screening for detection of extracellular laccase activity with guaiacol as a substrate. In total, 13 laccase-positive isolates were identified, all belonging to the Psychrobacter genus. From the most diverse four strains, based on 16S rRNA gene sequence analysis, all originating from the same Botryllus sp. colonial ascidian tunicate sample, genomic DNA was isolated and genome sequenced using a combined approach of whole genome shotgun and 8 kb mate-pair library sequencing on an Illumina MiSeq platform. The genomes were assembled and revealed genome sizes between 3.29 and 3.52 Mbp with an average G + C content of around 42%, with one to seven plasmids present in the four strains. Bioinformatics based genome mining was performed to describe the metabolic potential of these four strains and to identify gene candidates potentially responsible for the observed laccase-positive phenotype. Up to two different laccase-like multicopper oxidase (LMCO) encoding gene candidates were identified in each of the four strains. Heterologous expression of P11F6-LMCO and P11G5-LMCO2 in Escherichia coli BL21 (DE3) resulted in recombinant proteins exhibiting 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid (ABTS) and guaiacol oxidizing activity. Thirteen Psychrobacter species with laccase-positive phenotype were isolated from a collection of Arctic marine bacteria. Four of the isolates were genome sequenced. The overall genome features were similar to other publicly available Psychrobacter genome sequences except for P11G5 harboring seven

  11. Identification of the bovine Arachnomelia mutation by massively parallel sequencing implicates sulfite oxidase (SUOX in bone development.

    Directory of Open Access Journals (Sweden)

    Cord Drögemüller


    Full Text Available Arachnomelia is a monogenic recessive defect of skeletal development in cattle. The causative mutation was previously mapped to a ∼7 Mb interval on chromosome 5. Here we show that array-based sequence capture and massively parallel sequencing technology, combined with the typical family structure in livestock populations, facilitates the identification of the causative mutation. We re-sequenced the entire critical interval in a healthy partially inbred cow carrying one copy of the critical chromosome segment in its ancestral state and one copy of the same segment with the arachnomelia mutation, and we detected a single heterozygous position. The genetic makeup of several partially inbred cattle provides extremely strong support for the causality of this mutation. The mutation represents a single base insertion leading to a premature stop codon in the coding sequence of the SUOX gene and is perfectly associated with the arachnomelia phenotype. Our findings suggest an important role for sulfite oxidase in bone development.

  12. Identification of the Bovine Arachnomelia Mutation by Massively Parallel Sequencing Implicates Sulfite Oxidase (SUOX) in Bone Development (United States)

    Drögemüller, Cord; Tetens, Jens; Sigurdsson, Snaevar; Gentile, Arcangelo; Testoni, Stefania; Lindblad-Toh, Kerstin; Leeb, Tosso


    Arachnomelia is a monogenic recessive defect of skeletal development in cattle. The causative mutation was previously mapped to a ∼7 Mb interval on chromosome 5. Here we show that array-based sequence capture and massively parallel sequencing technology, combined with the typical family structure in livestock populations, facilitates the identification of the causative mutation. We re-sequenced the entire critical interval in a healthy partially inbred cow carrying one copy of the critical chromosome segment in its ancestral state and one copy of the same segment with the arachnomelia mutation, and we detected a single heterozygous position. The genetic makeup of several partially inbred cattle provides extremely strong support for the causality of this mutation. The mutation represents a single base insertion leading to a premature stop codon in the coding sequence of the SUOX gene and is perfectly associated with the arachnomelia phenotype. Our findings suggest an important role for sulfite oxidase in bone development. PMID:20865119

  13. The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy. (United States)

    Elmer, Lawrence W; Bertoni, John M


    The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.

  14. Molecular Basis for Converting (2S-Methylsuccinyl-CoA Dehydrogenase into an Oxidase

    Directory of Open Access Journals (Sweden)

    Simon Burgener


    Full Text Available Although flavoenzymes have been studied in detail, the molecular basis of their dioxygen reactivity is only partially understood. The members of the flavin adenosine dinucleotide (FAD-dependent acyl-CoA dehydrogenase and acyl-CoA oxidase families catalyze similar reactions and share common structural features. However, both enzyme families feature opposing reaction specificities in respect to dioxygen. Dehydrogenases react with electron transfer flavoproteins as terminal electron acceptors and do not show a considerable reactivity with dioxygen, whereas dioxygen serves as a bona fide substrate for oxidases. We recently engineered (2S-methylsuccinyl-CoA dehydrogenase towards oxidase activity by rational mutagenesis. Here we characterized the (2S-methylsuccinyl-CoA dehydrogenase wild-type, as well as the engineered (2S-methylsuccinyl-CoA oxidase, in detail. Using stopped-flow UV-spectroscopy and liquid chromatography-mass spectrometry (LC-MS based assays, we explain the molecular base for dioxygen reactivity in the engineered oxidase and show that the increased oxidase function of the engineered enzyme comes at a decreased dehydrogenase activity. Our findings add to the common notion that an increased activity for a specific substrate is achieved at the expense of reaction promiscuity and provide guidelines for rational engineering efforts of acyl-CoA dehydrogenases and oxidases.

  15. Alternative oxidase (AOX) constitutes a small family of proteins in Citrus clementina and Citrus sinensis L. Osb. (United States)

    Araújo Castro, Jacqueline; Gomes Ferreira, Monique Drielle; Santana Silva, Raner José; Andrade, Bruno Silva; Micheli, Fabienne


    The alternative oxidase (AOX) protein is present in plants, fungi, protozoa and some invertebrates. It is involved in the mitochondrial respiratory chain, providing an alternative route for the transport of electrons, leading to the reduction of oxygen to form water. The present study aimed to characterize the family of AOX genes in mandarin (Citrus clementina) and sweet orange (Citrus sinensis) at nucleotide and protein levels, including promoter analysis, phylogenetic analysis and C. sinensis gene expression. This study also aimed to do the homology modeling of one AOX isoform (CcAOXd). Moreover, the molecular docking of the CcAOXd protein with the ubiquinone (UQ) was performed. Four AOX genes were identified in each citrus species. These genes have an open reading frame (ORF) ranging from 852 bp to 1150 bp and a number of exons ranging from 4 to 9. The 1500 bp-upstream region of each AOX gene contained regulatory cis-elements related to internal and external response factors. CsAOX genes showed a differential expression in citrus tissues. All AOX proteins were predicted to be located in mitochondria. They contained the conserved motifs LET, NERMHL, LEEEA and RADE-H as well as several putative post-translational modification sites. The CcAOXd protein was modeled by homology to the AOX of Trypanosona brucei (45% of identity). The 3-D structure of CcAOXd showed the presence of two hydrophobic helices that could be involved in the anchoring of the protein in the inner mitochondrial membrane. The active site of the protein is located in a hydrophobic environment deep inside the AOX structure and contains a diiron center. The molecular docking of CcAOXd with UQ showed that the binding site is a recessed pocket formed by the helices and submerged in the membrane. These data are important for future functional studies of citrus AOX genes and/or proteins, as well as for biotechnological approaches leading to AOX inhibition using UQ homologs.

  16. Angiotensin II inhibits the Na+-K+ pump via PKC-dependent activation of NADPH oxidase. (United States)

    White, Caroline N; Figtree, Gemma A; Liu, Chia-Chi; Garcia, Alvaro; Hamilton, Elisha J; Chia, Karin K M; Rasmussen, Helge H


    The sarcolemmal Na(+)-K(+) pump, pivotal in cardiac myocyte function, is inhibited by angiotensin II (ANG II). Since ANG II activates NADPH oxidase, we tested the hypothesis that NADPH oxidase mediates the pump inhibition. Exposure to 100 nmol/l ANG II increased superoxide-sensitive fluorescence of isolated rabbit ventricular myocytes. The increase was abolished by pegylated superoxide dismutase (SOD), by the NADPH oxidase inhibitor apocynin, and by myristolated inhibitory peptide to epsilon-protein kinase C (epsilonPKC), previously implicated in ANG II-induced Na(+)-K(+) pump inhibition. A role for epsilonPKC was also supported by an ANG II-induced increase in coimmunoprecipitation of epsilonPKC with the receptor for the activated kinase and with the cytosolic p47(phox) subunit of NADPH oxidase. ANG II decreased electrogenic Na(+)-K(+) pump current in voltage-clamped myocytes. The decrease was abolished by SOD, by the gp91ds inhibitory peptide that blocks assembly and activation of NADPH oxidase, and by epsilonPKC inhibitory peptide. Since colocalization should facilitate NADPH oxidase-dependent regulation of the Na(+)-K(+) pump, we examined whether there is physical association between the pump subunits and NADPH oxidase. The alpha(1)-subunit coimmunoprecipitated with caveolin 3 and with membrane-associated p22(phox) and cytosolic p47(phox) NADPH oxidase subunits at baseline. ANG II had no effect on alpha(1)/caveolin 3 or alpha(1)/p22(phox) interaction, but it increased alpha(1)/p47(phox) coimmunoprecipitation. We conclude that ANG II inhibits the Na(+)-K(+) pump via PKC-dependent NADPH oxidase activation.

  17. Kaempferol modulates pro-inflammatory NF-κB activation by suppressing advanced glycation endproducts-induced NADPH oxidase (United States)

    Kim, Ji Min; Lee, Eun Kyeong; Kim, Dae Hyun; Yu, Byung Pal


    Advanced glycation endproducts (AGE) are oxidative products formed from the reaction between carbohydrates and a free amino group of proteins that are provoked by reactive species (RS). It is also known that AGE enhance the generation of RS and that the binding of AGE to a specific AGE receptor (RAGE) induces the activation of the redox-sensitive, pro-inflammatory transcription factor, nuclear factor-kappa B (NF-ĸB). In this current study, we investigated the anti-oxidative effects of short-term kaempferol supplementation on the age-related formation of AGE and the binding activity of RAGE in aged rat kidney. We further investigated the suppressive action of kaempferol against AGE's ability to stimulate activation of pro-inflammatory NF-ĸB and its molecular mechanisms. For this study, we utilized young (6 months old), old (24 months old), and kaempferol-fed (2 and 4 mg/kg/day for 10 days) old rats. In addition, for the molecular work, the rat endothelial cell line, YPEN-1 was used. The results show that AGE and RAGE were increased during aging and that these increases were blunted by kaempferol. In addition, dietary kaempferol reduced age-related increases in NF-κB activity and NF-ĸB-dependant pro-inflammatory gene activity. The most significant new finding from this study is that kaempferol supplementation prevented age-related NF-κB activation by suppressing AGE-induced nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Taken together, our results demonstrated that dietary kaempferol exerts its anti-oxidative and anti-inflammatory actions by modulating the age-related NF-κB signaling cascade and its pro-inflammatory genes by suppressing AGE-induced NADPH oxidase activation. Based on these data, dietary kaempferol is proposed as a possible anti-AGE agent that may have the potential for use in anti-inflammation therapies. PMID:20431987

  18. Heterologous Expression of Phanerochaete chrysoporium Glyoxal Oxidase and its Application for the Coupled Reaction with Manganese Peroxidase to Decolorize Malachite Green (United States)

    Son, Yu-Lim; Kim, Hyoun-Young; Thiyagarajan, Saravanakumar; Xu, Jing Jing


    cDNA of the glx1 gene encoding glyoxal oxidase (GLX) from Phanerochaete chrysosporium was isolated and expressed in Pichia pastoris. The recombinant GLX (rGLX) produces H2O2 over 7.0 nmol/min/mL using methyl glyoxal as a substrate. Use of rGLX as a generator of H2O2 improved the coupled reaction with recombinant manganese peroxidase resulting in decolorization of malachite green up to 150 µM within 90 min. PMID:23323052

  19. Cytochrome oxidase-I sequence based studies of commercially available Pangasius hypophthalmus in Italy

    Directory of Open Access Journals (Sweden)

    Federica Bellagamba


    Full Text Available Pangasius hypophthalmus is one of the fish consumed in the Italian diet. It is farmed and imported from Mekong delta region of Vietnam. Among several types of Pangasius, Tra (Pangasius hypophthalmus is permitted for sales by the European Union. Since these fish species are often allegedly substituted with other morphologically similar fish due to commercial benefits, authentication of the products in the international markets become often necessary to prevent fraud and safety issues. In addition, this fish is imported as fillets without skin and bone, thus leaving the consumer’s at the risk of buying a substandard nutritional food. In this article we present the molecular approach we developed to identify Pangasius hypophthalmus from other closely related species based on cytochrome oxidase-I (COI mitochondrial barcoding gene and further described the variants in the studied population genetic of this species. Fifty-one samples of Pangasius hypophthalmus fillets labelled as Pangasio were obtained from various markets around Milan and their COI mitochondrial barcoding gene was sequenced and studied in our bioinformatics pipeline. All samples were successfully amplified and Basic Local Alignment Search Tool results of the amplified region confirmed that all sequences analysed belonged to Pangasius hypophthalmus. Based on the variations in their barcoding region single nucleotide polymorphisms were identified and delineative statistics was calculated on the sequences. Although Pangasius hypophthalmus is considered as a monophyly, seven polymorphisms were identified. The neighbour-joining tree and the Median-joining network of haplotypes showed for all the identified haplotypes a unique cluster, with the exception of one sample.

  20. Characterization of three multicopper oxidases in the filamentous fungus Podospora anserina: A new role of an ABR1-like protein in fungal development? (United States)

    Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Herbert, Eric; Ferrari, Roselyne; Chapeland-Leclerc, Florence


    The Podospora anserina genome contains a large family of 15 multicopper oxidases (MCOs), including three genes encoding a FET3-like protein, an ABR1-like protein and an ascorbate oxidase (AO)-like protein. FET3, ABR1 and AO1 are involved in global laccase-like activity since deletion of the relevant genes led to a decrease of activity when laccase substrate (ABTS) was used as substrate. However, contrary to the P. anserina MCO proteins previously characterized, none of these three MCOs seemed to be involved in lignocellulose degradation and in resistance to phenolic compounds and oxidative stress. We showed that the bulk of ferroxidase activity was clearly due to ABR1, and only in minor part to FET3, although ABR1 does not contain all the residues typical of FET3 proteins. Moreover, we showed that ABR1, related to the Aspergillus fumigatus ABR1 protein, was clearly and specifically involved in pigmentation of ascospores. Surprisingly, phenotypes were more severe in mutants lacking both abr1 and ao1. Deletion of the ao1 gene led to an almost total loss of AO activity. No direct involvement of AO1 in fungal developmental process in P. anserina was evidenced, except in a abr1 Δ background. Overall, unlike other previously characterized MCOs, we thus evidence a clear involvement of ABR1 protein in fungal development. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. The Cytochrome bd Oxidase of Porphyromonas gingivalis Contributes to Oxidative Stress Resistance and Dioxygen Tolerance.

    Directory of Open Access Journals (Sweden)

    Julia Leclerc

    Full Text Available Porphyromonas gingivalis is an etiologic agent of periodontal disease in humans. The disease is associated with the formation of a mixed oral biofilm which is exposed to oxygen and environmental stress, such as oxidative stress. To investigate possible roles for cytochrome bd oxidase in the growth and persistence of this anaerobic bacterium inside the oral biofilm, mutant strains deficient in cytochrome bd oxidase activity were characterized. This study demonstrated that the cytochrome bd oxidase of Porphyromonas gingivalis, encoded by cydAB, was able to catalyse O2 consumption and was involved in peroxide and superoxide resistance, and dioxygen tolerance.

  2. Intramolecular electron transfer in ascorbate oxidase is enhanced in the presence of oxygen

    DEFF Research Database (Denmark)

    Farver, O; Wherland, S; Pecht, I


    Intramolecular electron transfer from the type 1 copper center to the type 3 copper(II) pair is induced in the multi-copper enzyme, ascorbate oxidase, following pulse radiolytic reduction of the type 1 Cu(II) ion. In the presence of a slight excess of dioxygen over ascorbate oxidase, interaction...... between the trinuclear copper center and O2 is observed even with singly reduced ascorbate oxidase molecules. Under these conditions, the rate constant for intramolecular electron transfer from type 1 Cu(I) to type 3 Cu(II) increases 5-fold to 1100 +/- 300 s-1 (20 degrees C, pH 5.8) as compared...

  3. Association study of serotonin transporter and monoamine oxidase A genes polymorphisms with antisocial personality disorder in Han Chinese male%5-羟色胺转运体基因和单胺氧化酶A基因多态性与汉族男性反社会人格障碍患者的关联分析

    Institute of Scientific and Technical Information of China (English)

    茆正洪; 谭钊安; 柯晓燕; 郑大同; 曾彦英; 张建平; 李树明


    目的 探讨5-羟色胺转运体基因(5-HTT)第2内含子的一个可变数串联重复序列(Stin2.VNTR)和单胺氧化酶A(MAOA)基因14外显子上的一种限制性片段长度多态性(EcoRV-RFLP)与汉族男性反社会人格障碍(APD),尤其是具有高度冲动性APD的遗传易感性的关系.方法 (1)APD组:对南京地区某监狱男性服刑人员进行人格诊断问卷(PDQ-4+)调查,在PDQ得分为阳性的可疑人群中由临床医师以美国精神障碍诊断与统计手册第4版(DSM-Ⅳ)关于APD诊断标准进一步确诊,入组118例;全部进行Barratt冲动量表(BIS-11)评分,以冲动总分中位值为界,划分为高冲动APD组和低冲动APD组.(2)监狱对照组:经PDQ排除人格障碍的250名服刑人员作为监狱内对照.(3)正常对照组:同时期医院健康体检者300名设为正常对照.取所有人员血液标本提取DNA,应用聚合酶链反应(PCR)和限制性片段长度多态性方法,对等位基因频率和基因型频率进行对比分析.结果 (1)APD组与正常对照组比较,5-HTT-VNTR基因型多态、MAOA-EcoRV-RFLP多态差异无统计学意义(x2=2.819,P=0.244;x2=2.347,P=0.126).(2)高冲动APD组与正常对照组比较,5-HTT-VNTR基因型多态差异有统计学意义(x2=7.422,P=0.024),MAOA-EcoRV-RFLP的等位基因频率有统计学意义(x2=5.478,P=0.019).(3)2个位点的联合分析中,APD组和高冲动APD组分别与对照组比较,12/12/-多倍体型的差异均有统计学意义(x2=7.164,P=0.007;x2=9.590,P=0.002);12/10/+仅在高冲动APD组与正常对照组间差异有统计学意义(x2=5.378,P=0.020).结论 5-HTT基因第2内含子VNTR多态、MAOA基因EcoRV-RFLP多态与具有高冲动的APD关联,12/12/-多倍体型与中国汉族男性APD发病风险可能有关.%Objective To investigate whether the 5-HTT-VNTR, the EcoRV polymorphism of MAOA gene was associated with antisocial personality disorder (APD) in Han Chinese male criminal offenders. Method In a prison in Jiangsu, the male

  4. Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass

    Directory of Open Access Journals (Sweden)

    Jonathan M. LaMantia


    Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.

  5. Functional analysis of fructosyl-amino acid oxidases of Aspergillus oryzae. (United States)

    Akazawa, Shin-Ichi; Karino, Tetsuya; Yoshida, Nobuyuki; Katsuragi, Tohoru; Tani, Yoshiki


    Three active fractions of fructosyl-amino acid oxidase (FAOD-Ao1, -Ao2a, and -Ao2b) were isolated from Aspergillus oryzae strain RIB40. N-terminal and internal amino acid sequences of FAOD-Ao2a corresponded to those of FAOD-Ao2b, suggesting that these two isozymes were derived from the same protein. FAOD-Ao1 and -Ao2 were different in substrate specificity and subunit assembly; FAOD-Ao2 was active toward N(epsilon)-fructosyl N(alpha)-Z-lysine and fructosyl valine (Fru-Val), whereas FAOD-Ao1 was not active toward Fru-Val. The genes encoding the FAOD isozymes (i.e., FAOAo1 and FAOAo2) were cloned by PCR with an FAOD-specific primer set. The deduced amino acid sequences revealed that FAOD-Ao1 was 50% identical to FAOD-Ao2, and each isozyme had a peroxisome-targeting signal-1, indicating their localization in peroxisomes. The genes was expressed in Escherichia coli and rFaoAo2 showed the same characteristics as FAOD-Ao2, whereas rFaoAo1 was not active. FAOAo2 disruptant was obtained by using ptrA as a selective marker. Wild-type strain grew on the medium containing Fru-Val as the sole carbon and nitrogen sources, but strain Delta faoAo2 did not grow. Addition of glucose or (NH(4))(2)SO(4) to the Fru-Val medium did not affect the assimilation of Fru-Val by wild-type, indicating glucose and ammonium repressions did not occur in the expression of the FAOAo2 gene. Furthermore, conidia of the wild-type strain did not germinate on the medium containing Fru-Val and NaNO(2) as the sole carbon and nitrogen sources, respectively, suggesting that Fru-Val may also repress gene expression of nitrite reductase. These results indicated that FAOD is needed for utilization of fructosyl-amino acids as nitrogen sources in A. oryzae.

  6. Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase. (United States)

    Thrower, J S; Blalock, R; Klinman, J P


    1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.

  7. In vivo oxalate degradation by liposome encapsulated oxalate oxidase in rat model of hyperoxaluria

    Directory of Open Access Journals (Sweden)

    Tulika Dahiya


    Interpretation & conclusions: EMA-oxalate oxidase encapsulated liposome caused oxalate degradation in experimental hyperoxaluria indicating that the enzyme could be used as a therapeutic agent in hyperoxaluria leading to urinary stones.

  8. Action of DCCD on the H+/O stoichiometry of mitoplast cytochrome c oxidase. (United States)

    Lehninger, A L; Reynafarje, B; Costa, L


    The mechanistic H+/O ejection stoichiometry of the cytochrome c oxidase reaction in rat liver mitoplasts is close to 4 at level flow when the reduced oxidase is pulsed with O2. Dicyclohexylcarbodiimide (DCCD) up to 30 nmol/mg protein fails to influence the rate of electron flow through the mitoplast oxidase, but inhibits H+ ejection. The inhibition of H+ ejection appears to be biphasic; ejection of 2-3 H+ per O is completely inhibited by very low DCCD, whereas inhibition of the remaining H+ ejection requires very much higher concentrations of DCCD. This effect suggests the occurrence of two types of H+ pumps in the native cytochrome oxidase of mitoplasts.

  9. Production of a new D-amino acid oxidase from the fungus Fusarium oxysporum. (United States)

    Gabler, M; Fischer, L


    The fungus Fusarium oxysporum produced a D-amino acid oxidase (EC 1. 4.3.3) in a medium containing glucose as the carbon and energy source and ammonium sulfate as the nitrogen source. The specific D-amino acid oxidase activity was increased up to 12.5-fold with various D-amino acids or their corresponding derivatives as inducers. The best inducers were D-alanine (2.7 microkat/g of dry biomass) and D-3-aminobutyric acid (2.6 microkat/g of dry biomass). The addition of zinc ions was necessary to permit the induction of peroxisomal D-amino acid oxidase. Bioreactor cultivations were performed on a 50-liter scale, yielding a volumetric D-amino acid oxidase activity of 17 microkat liter(-1) with D-alanine as an inducer. Under oxygen limitation, the volumetric activity was increased threefold to 54 microkat liter(-1) (3,240 U liter(-1)).

  10. Interferon gamma/NADPH oxidase defence system in immunity and cancer

    Czech Academy of Sciences Publication Activity Database

    Hodný, Zdeněk; Reiniš, Milan; Hubáčková, Soňa; Vašicová, Pavla; Bartek, Jiří

    -, 01 Sep (2015) ISSN 2162-4011 Institutional support: RVO:68378050 ; RVO:61388971 Keywords : IFNγ * NADPH oxidase * immunity * cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.266, year: 2014

  11. Studies on the relationship between cyanide-resistant respi-ration and expression of alternative oxidase in mung bean using antibodies prepared by synthetic polypeptide

    Institute of Scientific and Technical Information of China (English)

    LI; Chijun; (


    [1]Liang, Z., Liang, H. G., The respiratory metabolism of plants, in Plant Physiology and Molecular Biology (eds. Yu, S. W., Tang, Z. C.) (in Chinese), 2nd ed., Beijing: Science Press, 1998, 344-365.[2]Lü, C. S., Liang, H. G., Induced respiration in melon fruits, Scientia Sinica, 1963, 12(4): 616.[3]Liang, H. G., Lü, C. S., A comparative study of CN-resistant respiration in different cultures of tobacco callus, Plant Physiol., 1984, 75: 876.[4]Elthon, T. E., McIntosh, L., Identification of the alternative terminal oxidase of higher plant mitochondria, Proc. Natl. Acad. Sci. USA, 1987, 84: 8399.[5]Elthon, T. E., Nickels, R. L., McIntosh, L., Monoclonal antibodies to the alternative oxidase of higher plant mitochondria, Plant Physiol., 1989, 89: 1311.[6]Liang, W. S., Liang, H. G., Progress of the alternative oxidase, Chinese Bulletin of Botany (in Chinese), 1997, 14(2): 9.[7]Liang, W. S., Liang, H. G., Induction of alternative oxidase expression by endogenous ethylene in aging potato slices, Acta Phytophysiol. Sin. (in Chinese), 1999, 25(2): 205.[8]He, J. X., Wei, Z. Q., Liang, H. G., Effects of water stress on development, and operation and gene expression of cyanide-resistant respiratory pathway in wheat, Science in China, Ser. C, 1999, 42(3): 300.[9]McIntosh, L., Molecular biology of the alternative oxidase, Plant Physiol., 1994, 105: 781.[10] Wang, J., Zhang, L. X., Liu, Z. L. et al., A possible calcium binding site in D1 protein: A fluorescence and FTIR study of the interaction between lanthanides and a synthetic peptide, Photosynthesis Research, 1995, 44: 297.[11] Li, X. P., Du, L. F., Liang, H. G. et al., Preparation and identification of antidodecapeptide of polypeptide D1 or photosys-tem II reaction center, Prog. Biochem. Biophys. (in Chinese), 1997, 24(3): 283.[12] Wen, J. Q., Liang, H. G., Studies on energy status and mitochondria respiration during growth and senescence of mung bean cotyledons, Physiol

  12. The influence of monoamine oxidase variants on the risk of betel quid-associated oral and pharyngeal cancer. (United States)

    Chen, Ping-Ho; Huang, Bin; Shieh, Tien-Yu; Wang, Yan-Hsiung; Chen, Yuk-Kwan; Wu, Ju-Hui; Huang, Jhen-Hao; Chen, Chun-Chia; Lee, Ka-Wo


    Betel quid (BQ) and areca nut (AN) (major BQ ingredient) are group I human carcinogens illustrated by International Agency for Research on Cancer and are closely associated with an elevated risk of oral potentially malignant disorders (OPMDs) and cancers of the oral cavity and pharynx. The primary alkaloid of AN, arecoline, can be metabolized via the monoamine oxidase (MAO) gene by inducing reactive oxygen species (ROS). The aim of this study was to investigate whether the variants of the susceptible candidate MAO genes are associated with OPMDs and oral and pharyngeal cancer. A significant trend of MAO-A mRNA expression was found in in vitro studies. Using paired human tissues, we confirmed the significantly decreased expression of MAO-A and MAO-B in cancerous tissues when compared with adjacent noncancerous tissues. Moreover, we determined that MAO-A single nucleotide polymorphism variants are significantly linked with oral and pharyngeal cancer patients in comparison to OPMDs patients [rs5953210 risk G-allele, odds ratio = 1.76; 95% confidence interval = 1.02-3.01]. In conclusion, we suggested that susceptible MAO family variants associated with oral and pharyngeal cancer may be implicated in the modulation of MAO gene activity associated with ROS.

  13. The Influence of Monoamine Oxidase Variants on the Risk of Betel Quid-Associated Oral and Pharyngeal Cancer

    Directory of Open Access Journals (Sweden)

    Ping-Ho Chen


    Full Text Available Betel quid (BQ and areca nut (AN (major BQ ingredient are group I human carcinogens illustrated by International Agency for Research on Cancer and are closely associated with an elevated risk of oral potentially malignant disorders (OPMDs and cancers of the oral cavity and pharynx. The primary alkaloid of AN, arecoline, can be metabolized via the monoamine oxidase (MAO gene by inducing reactive oxygen species (ROS. The aim of this study was to investigate whether the variants of the susceptible candidate MAO genes are associated with OPMDs and oral and pharyngeal cancer. A significant trend of MAO-A mRNA expression was found in in vitro studies. Using paired human tissues, we confirmed the significantly decreased expression of MAO-A and MAO-B in cancerous tissues when compared with adjacent noncancerous tissues. Moreover, we determined that MAO-A single nucleotide polymorphism variants are significantly linked with oral and pharyngeal cancer patients in comparison to OPMDs patients [rs5953210 risk G-allele, odds ratio = 1.76; 95% confidence interval = 1.02-3.01]. In conclusion, we suggested that susceptible MAO family variants associated with oral and pharyngeal cancer may be implicated in the modulation of MAO gene activity associated with ROS.

  14. Metavanadate causes cellular accumulation of copper and decreased lysyl oxidase activity

    International Nuclear Information System (INIS)

    Cui, Changtai T.; Uriu-Adams, Janet Y.; Tchaparian, Eskouhie H.; Keen, Carl L.; Rucker, Robert B.


    Selected indices of copper metabolism in weanling rats and fibroblast cultures were progressively altered in response to increased levels of sodium metavanadate. In diets, vanadium was added in amounts ranging from 0 to 80 μg V/g of diet, that is, 0-1.6 μmol V/g of diet. In fibroblast cultures, vanadium ranged from 0 to 400 nmol V/ml. The inhibition of P-ATPase-7A activity by metavanadate, important to copper egress from cells, was a primary focus. In skin, and tendon, the copper concentration was increased in response to increased dietary levels of metavanadate, whereas lysyl oxidase activity, a secreted cuproprotein, was reduced. The reduction in lysyl oxidase activity was also accompanied by reduced redox cycling potential of isolated fractions of lysyl oxidase, presumably due to reduced lysyltyrosyl quinone (LTQ) formation at the active site of lysyl oxidase. In contrast, liver copper concentrations and plasma ceruloplasmin activity were not affected by metavanadate exposure. However, semicarbazide-sensitive benzylamine oxidase (SCBO) activity, which was taken as an indirect measure of vascular adhesive protein-1 (VAP-1), was increased. In cultured fibroblasts, cellular copper was also increased and lysyl oxidase decreased in response to metavanadate. Moreover, the steady-state levels of atp7a and lysyl oxidase mRNAs were not affected by addition of metavanadate to culture medium up to 200 nmol/ml. Taken together, these data suggest that pathways involving copper egress and lysyl oxidase activation are particularly sensitive to metavanadate exposure through processes that are predominately posttranslational

  15. Herbivore-plant interactions: mixed-function oxidases and secondary plant substances. (United States)

    Brattsten, L B; Wilkinson, C F; Eisner, T


    The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.

  16. Process technology for the application of d-amino acid oxidases in pharmaceutical intermediate manufacturing

    DEFF Research Database (Denmark)

    Tindal, Stuart; Carr, Reuben; Archer, Ian V. J.


    Recent advances in biocatalysis have seen increased interest in the use of D-amino acid oxidase to synthesize optically pure amino acids. However, the creation of a genuine oxidase based platform technology will require suitable process technology as well as an understanding of the challenges...... and opportunities of a wider portfolio of synthetic targets. In this article we address some of the recent progress in process technology to enable the future development of a generic platform technology....

  17. Biphenyl Modulates the Expression and Function of Respiratory Oxidases in the Polychlorinated-Biphenyls Degrader Pseudomonas pseudoalcaligenes KF707

    Directory of Open Access Journals (Sweden)

    Federica Sandri


    Full Text Available Pseudomonas pseudoalcaligenes KF707 is a soil bacterium which is known for its capacity to aerobically degrade harmful organic compounds such as polychlorinated biphenyls (PCBs using biphenyl as co-metabolite. Here we provide the first genetic and functional analysis of the KF707 respiratory terminal oxidases in cells grown with two different carbon sources: glucose and biphenyl. We identified five terminal oxidases in KF707: two c(caa3 type oxidases (Caa3 and Ccaa3, two cbb3 type oxidases (Cbb31 and Cbb32, and one bd type cyanide-insensitive quinol oxidase (CIO. While the activity and expression of both Cbb31 and Cbb32 oxidases was prevalent in glucose grown cells as compared to the other oxidases, the activity and expression of the Caa3 oxidase increased considerably only when biphenyl was used as carbon source in contrast to the Cbb32 oxidase which was repressed. Further, the respiratory activity and expression of CIO was up-regulated in a Cbb31 deletion strain as compared to W.T. whereas the CIO up-regulation was not present in Cbb32 and C(caa3 deletion mutants. These results, together, reveal that both function and expression of cbb3 and caa3 type oxidases in KF707 are modulated by biphenyl which is the co-metabolite needed for the activation of the PCBs-degradation pathway.

  18. Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity (United States)

    Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji


    Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056

  19. Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

    Directory of Open Access Journals (Sweden)

    Koji Sode


    Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

  20. Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity. (United States)

    Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji


    Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

  1. Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen

    International Nuclear Information System (INIS)

    Pasqualini, Stefania; Tedeschini, Emma; Frenguelli, Giuseppe; Wopfner, Nicole; Ferreira, Fatima; D'Amato, Gennaro; Ederli, Luisa


    Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O 3 ) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O 3 fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O 3 fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O 3 , determined from the mRNA levels of the major allergens. We conclude that O 3 can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: → O 3 reduces the viability of ragweed pollen. → ROS and allergens of ragweed pollen were not affected by O 3 exposure. → O 3 enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. → O 3 increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.

  2. A decade of crystallization drops: crystallization of the cbb3 cytochrome c oxidase from Pseudomonas stutzeri. (United States)

    Buschmann, Sabine; Richers, Sebastian; Ermler, Ulrich; Michel, Hartmut


    The cbb3 cytochrome c oxidases are distant members of the superfamily of heme copper oxidases. These terminal oxidases couple O2 reduction with proton transport across the plasma membrane and, as a part of the respiratory chain, contribute to the generation of an electrochemical proton gradient. Compared with other structurally characterized members of the heme copper oxidases, the recently determined cbb3 oxidase structure at 3.2 Å resolution revealed significant differences in the electron supply system, the proton conducting pathways and the coupling of O2 reduction to proton translocation. In this paper, we present a detailed report on the key steps for structure determination. Improvement of the protein quality was achieved by optimization of the number of lipids attached to the protein as well as the separation of two cbb3 oxidase isoenzymes. The exchange of n-dodecyl-β-D-maltoside for a precisely defined mixture of two α-maltosides and decanoylsucrose as well as the choice of the crystallization method had a most profound impact on crystal quality. This report highlights problems frequently encountered in membrane protein crystallization and offers meaningful approaches to improve crystal quality. © 2014 The Protein Society.

  3. Blockade of TGF-β 1 Signalling Inhibits Cardiac NADPH Oxidase Overactivity in Hypertensive Rats

    Directory of Open Access Journals (Sweden)

    José Luis Miguel-Carrasco


    Full Text Available NADPH oxidases constitute a major source of superoxide anion (⋅O2 - in hypertension. Several studies suggest an important role of NADPH oxidases in different effects mediated by TGF-β 1. In this study we show that chronic administration of P144, a peptide synthesized from type III TGF-β 1 receptor, significantly reduced the cardiac NADPH oxidase expression and activity as well as in the nitrotyrosine levels observed in control spontaneously hypertensive rats (V-SHR to levels similar to control normotensive Wistar Kyoto rats. In addition, P144 was also able to reduce the significant increases in the expression of collagen type I protein and mRNA observed in hearts from V-SHR. In addition, positive correlations between collagen expression, NADPH oxidase activity, and nitrotyrosine levels were found in all animals. Finally, TGF-β 1-stimulated Rat-2 exhibited significant increases in NADPH oxidase activity that was inhibited in the presence of P144. It could be concluded that the blockade of TGF-β 1 with P144 inhibited cardiac NADPH oxidase in SHR, thus adding new data to elucidate the involvement of this enzyme in the profibrotic actions of TGF-β 1.

  4. Proline Oxidase (POX) as A Target for Cancer Therapy. (United States)

    Kononczuk, Joanna; Czyzewska, Urszula; Moczydlowska, Joanna; Surażyński, Arkadiusz; Palka, Jerzy; Miltyk, Wojciech


    Proline dehydrogenase/proline oxidase (PRODH/POX) is an enzyme catalyzing the first step of proline degradation, during which ROS and/or ATP is generated. POX is widely distributed in living organisms and is responsible for a number of regulatory processes such as redox homeostasis, osmotic adaptation, cell signaling and oxidative stress. Recent data provided evidence that POX plays an important role in carcinogenesis and tumor growth. POX may induce apoptosis in both intrinsic and extrinsic way. Due to ROS generation, POX may induce caspase-9 activity, which mediates mitochondrial apoptosis (intrinsic apoptosis pathway). POX can also stimulate TRAIL (tumor necrosis factorrelated apoptosis inducing ligand) and DR5 (death receptor 5) expression, resulting in cleavage of procaspase-8 and thus extrinsic apoptotic pathway. However, this tumor suppressor in certain environmental conditions may act as a prosurvival factor. Genotoxic, inflammatory and metabolic stress may switch POX from tumor growth inhibiting to tumor growth supporting factor. The potential mechanisms which may regulate switching of POX mode are discussed in this review.

  5. Glucose Oxidase Immobilization on TMAH-Modified Bentonite

    Directory of Open Access Journals (Sweden)

    Ruth Chrisnasari


    Full Text Available The influence of bentonite modification by tetramethyl ammonium hydroxide (TMAH on its capability to immobilize glucose oxidase (GOX was studied. Modification of bentonite was conducted by the adding of 0-5% (v/v TMAH. The observed results show that the different concentrations of TMAH affect the percentage of immobilized enzyme. The results of this study show that the best concentration of TMAH is 5% (v/v which can immobilize up to 84.71% of GOX. X-ray diffraction (XRD and Fourier Transforms Infrared Spectroscopy (FTIR studies have been carried out to observe the structural changes in bentonite due to TMAH modification. The obtained immobilized GOX show the optimum catalytic activity on reaction temperature of 40-50 °C and pH of 7. The immobilized GOX kinetics at the optimum conditions determined the Km and Vmax value to be 4.96x10-2 mM and 4.99x10-3 mM.min-1 respectively. In addition, the immobilized GOX on TMAH-modified bentonite is stable enough so it could be re-used six times before its activity decreased by 39.44%.

  6. Introducing inducible fluorescent split cholesterol oxidase to mammalian cells. (United States)

    Chernov, Konstantin G; Neuvonen, Maarit; Brock, Ivonne; Ikonen, Elina; Verkhusha, Vladislav V


    Cholesterol oxidase (COase) is a bacterial enzyme catalyzing the first step in the biodegradation of cholesterol. COase is an important biotechnological tool for clinical diagnostics and production of steroid drugs and insecticides. It is also used for tracking intracellular cholesterol; however, its utility is limited by the lack of an efficient temporal control of its activity. To overcome this we have developed a regulatable fragment complementation system for COase cloned from Chromobacterium sp. The enzyme was split into two moieties that were fused to FKBP (FK506-binding protein) and FRB (rapamycin-binding domain) pair and split GFP fragments. The addition of rapamycin reconstituted a fluorescent enzyme, termed split GFP-COase, the fluorescence level of which correlated with its oxidation activity. A rapid decrease of cellular cholesterol induced by intracellular expression of the split GFP-COase promoted the dissociation of a cholesterol biosensor D4H from the plasma membrane. The process was reversible as upon rapamycin removal, the split GFP-COase fluorescence was lost, and cellular cholesterol levels returned to normal. These data demonstrate that the split GFP-COase provides a novel tool to manipulate cholesterol in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Characterization of polyphenol oxidase from blueberry (Vaccinium corymbosum L.). (United States)

    Siddiq, M; Dolan, K D


    Polyphenol oxidase (PPO) was extracted and characterized from high-bush blueberries. PPO showed an optimum activity at pH 6.1-6.3 and 35°C, with the enzyme showing significant activity over a wide temperature range (25-60°C). Catechol was the most readily oxidized substrate followed by 4-methylcatechol, DL-DOPA, and dopamine. Blueberry PPO showed a K m of 15mM and V max of 2.57 ΔA 420 nm/min×10 -1 , determined with catechol. PPO was completely inactivated in 20min at 85°C, however, after 30minat 75°C it showed about 10% residual activity. Thermal treatment at 55 and 65°C for 30min resulted in the partial inactivation of PPO. Ascorbic acid, sodium diethyldithiocarbamic acid, L-cysteine, and sodium metabisulfite were effective inhibitors of PPO at 1.0mM. Benzoic acid and cinnamic acid series inhibitors showed relatively weak inhibition of PPO (21.8-27.6%), even at as high as 2.0mM concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Monoamine oxidase A (MAO A) inhibitors decrease glioma progression (United States)

    Vaikari, Vijaya Pooja; Kota, Rajesh; Chen, Kevin; Yeh, Tzu-Shao; Jhaveri, Niyati; Groshen, Susan L.; Olenyuk, Bogdan Z.; Chen, Thomas C.; Hofman, Florence M.; Shih, Jean C.


    Glioblastoma (GBM) is an aggressive brain tumor which is currently treated with temozolomide (TMZ). Tumors usually become resistant to TMZ and recur; no effective therapy is then available. Monoamine Oxidase A (MAO A) oxidizes monoamine neurotransmitters resulting in reactive oxygen species which cause cancer. This study shows that MAO A expression is increased in human glioma tissues and cell lines. MAO A inhibitors, clorgyline or the near-infrared-dye MHI-148 conjugated to clorgyline (NMI), were cytotoxic for glioma and decreased invasion in vitro. Using the intracranial TMZ-resistant glioma model, clorgyline or NMI alone or in combination with low-dose TMZ reduced tumor growth and increased animal survival. NMI was localized specifically to the tumor. Immunocytochemistry studies showed that the MAO A inhibitor reduced proliferation, microvessel density and invasion, and increased macrophage infiltration. In conclusion, we have identified MAO A inhibitors as potential novel stand-alone drugs or as combination therapy with low dose TMZ for drug-resistant gliomas. NMI can also be used as a non-invasive imaging tool. Thus has a dual function for both therapy and diagnosis. PMID:26871599

  9. Spermine oxidase promotes bile canalicular lumen formation through acrolein production. (United States)

    Uemura, Takeshi; Takasaka, Tomokazu; Igarashi, Kazuei; Ikegaya, Hiroshi


    Spermine oxidase (SMOX) catalyzes oxidation of spermine to generate spermidine, hydrogen peroxide (H 2 O 2 ) and 3-aminopropanal, which is spontaneously converted to acrolein. SMOX is induced by a variety of stimuli including bacterial infection, polyamine analogues and acetaldehyde exposure. However, the physiological functions of SMOX are not yet fully understood. We investigated the physiological role of SMOX in liver cells using human hepatocellular carcinoma cell line HepG2. SMOX localized to the bile canalicular lumen, as determined by F-actin staining. Knockdown of SMOX reduced the formation of bile canalicular lumen. We also found that phospho-Akt (phosphorylated protein kinase B) was localized to canalicular lumen. Treatment with Akt inhibitor significantly reduced the formation of bile canalicular lumen. Acrolein scavenger also inhibited the formation of bile canalicular lumen. PTEN, phosphatase and tensin homolog and an inhibitor of Akt, was alkylated in a SMOX-dependent manner. Our results suggest that SMOX plays a central role in the formation of bile canalicular lumen in liver cells by activating Akt pathway through acrolein production.

  10. Polyphenol Oxidase as a Biochemical Seed Defense Mechanism

    Directory of Open Access Journals (Sweden)

    E. Patrick Fuerst


    Full Text Available Seed dormancy and resistance to decay are fundamental survival strategies, which allow a population of seeds to germinate over long periods of time. Seeds have physical, chemical, and biological defense mechanisms that protect their food reserves from decay-inducing organisms and herbivores. Here, we hypothesize that seeds also possess enzyme-based biochemical defenses, based on induction of the plant defense enzyme, polyphenol oxidase (PPO, when wild oat (Avena fatua L. caryopses and seeds were challenged with seed-decaying Fusarium fungi. These studies suggest that dormant seeds are capable of mounting a defense response to pathogens. The pathogen-induced PPO activity from wild oat was attributed to a soluble isoform of the enzyme that appeared to result, at least in part, from proteolytic activation of a latent PPO isoform. PPO activity was also induced in wild oat hulls (lemma and palea, non-living tissues that cover and protect the caryopsis. These results are consistent with the hypothesis that seeds possess inducible enzyme-based biochemical defenses arrayed on the exterior of seeds and these defenses represent a fundamental mechanism of seed survival and longevity in the soil. Enzyme-based biochemical defenses may have broader implications since they may apply to other defense enzymes as well as to a diversity of plant species and ecosystems.

  11. Characterization of active site residues of nitroalkane oxidase. (United States)

    Valley, Michael P; Fenny, Nana S; Ali, Shah R; Fitzpatrick, Paul F


    The flavoenzyme nitroalkane oxidase catalyzes the oxidation of primary and secondary nitroalkanes to the corresponding aldehydes and ketones plus nitrite. The structure of the enzyme shows that Ser171 forms a hydrogen bond to the flavin N5, suggesting that it plays a role in catalysis. Cys397 and Tyr398 were previously identified by chemical modification as potential active site residues. To more directly probe the roles of these residues, the S171A, S171V, S171T, C397S, and Y398F enzymes have been characterized with nitroethane as substrate. The C397S and Y398 enzymes were less stable than the wild-type enzyme, and the C397S enzyme routinely contained a substoichiometric amount of FAD. Analysis of the steady-state kinetic parameters for the mutant enzymes, including deuterium isotope effects, establishes that all of the mutations result in decreases in the rate constants for removal of the substrate proton by approximately 5-fold and decreases in the rate constant for product release of approximately 2-fold. Only the S171V and S171T mutations alter the rate constant for flavin oxidation. These results establish that these residues are not involved in catalysis, but rather are required for maintaining the protein structure. 2009 Elsevier Inc. All rights reserved.

  12. A study of monoamine oxidase activity in fetal membranes. (United States)

    Sekizawa, A; Ishikawa, H; Morimoto, T; Hirose, K; Suzuki, A; Saito, H; Yanaihara, T; Arai, Y; Oguchi, K


    To study the role of decidual monoamine oxidase (MAO)-A and -B activities before delivery, the relationship between MAO activity in fetal membranes and catecholamine (CA) concentration in amniotic fluid (AF) was determined. Fetal membranes and AF were obtained at the time of elective Cesarean section (CS group, n = 11) and Cesarean section due to fetal distress without labor pains (FD group, n = 5). MAO-A and -B activities were radiometrically measured using 14C-5-hydroxytriptamine for MAO-A substrate and 14C-benzylamine for MAO-B substrate. CA concentrations in AF were measured by high performance liquid chromatograph with an electro-chemical detector. Both MAO-A and -B activities in decidua obtained from CS were significantly lower than those obtained from FD. Both norepinephrine (NE) and epinephrine (EP) concentrations were significantly lower in the CS group than the FD group. A significant positive correlation between decidual MAO-A activity and NE concentration in AF was observed. No significant correlation was observed between MAO-B activity and the concentration of NE in AF. There was no correlation between EP concentrations and MAO activities. These results suggest that CA concentration in AF may be related to the activity of MAO in fetal membranes, determined by certain physiological processes during pregnancy. It has been suggested that metabolism of monoamines in fetal membranes also plays an important role in reducing monoamine influx into maternal myometrium from the AF.

  13. ABTS assay of phenol oxidase activity in soil. (United States)

    Floch, Carine; Alarcon-Gutiérrez, Enrique; Criquet, Stéven


    Phenol oxidases (PO) are involved in degradation of many recalcitrant aromatic compounds and may be sensitive to some pollutants. Hence, their activities may be a useful indicator for evaluating soil quality and health. To this end, the aim of this study was to develop a simple method to assay PO activity directly in bulk samples by spectrophotometric test using 2,2'-azinobis-(-3 ethylbenzothiazoline-6-sulfononic acid) diammonium salt (ABTS) as the substrate. Three Mediterranean soils were used as models. For each soil, we studied the kinetic parameters and the effects of certain factors (i.e. amount of soil, pH, temperature, incubation time and substrate concentration) in order to determine the optimum conditions for the ABTS assay. Results showed that PO attain their optimum activities when incubating 0.1 g of soil at 30 degrees C for 5 min with 10 ml of a Modified Universal Buffer (MUB) at pH 2 and 200 microl of a 0.1 M ABTS solution.

  14. Xanthine Oxidase Inhibitory Activity of a Plectranthus saccatus aqueous extract

    Directory of Open Access Journals (Sweden)

    Caldeira F


    Full Text Available Gout is a disease with high prevalence in developed countries, resulting from the deposition of uric acid crystals in various locations, particularly at the joints. The pharmacotherapeutic approach to chronic gout essentially consists of administration of uric acid-lowering agents. The main mechanism of action of these agents is the inhibition of xanthine oxidase (XO, the enzyme responsible for the formation of uric acid. The therapeutic alternatives available for this purpose are limited, thus justifying the interest of the discovery of potential new uric acidlowering drugs. In this regard, an aqueous extract of the plant Plectranthus saccatus has been studied for its ability to inhibit XO. The composition of the extract was determined by HPLC and rosmarinic acid was identified as the major constituent. Both the extract and rosmarinic acid have demonstrated the ability to inhibit the production of uric acid by interfering with XO activity. The results obtained herein support the continuation of the study of their uric acid-lowering properties in cell-based and in vivo models to further explore their potential in gout therapy.

  15. The NADPH oxidase inhibitor apocynin (acetovanillone) induces oxidative stress

    International Nuclear Information System (INIS)

    Riganti, Chiara; Costamagna, Costanzo; Bosia, Amalia; Ghigo, Dario


    Apocynin (acetovanillone) is often used as a specific inhibitor of NADPH oxidase. In N11 glial cells, apocynin induced, in a dose-dependent way, a significant increase of both malonyldialdehyde level (index of lipid peroxidation) and lactate dehydrogenase release (index of a cytotoxic effect). Apocynin evoked also, in a significant way, an increase of H 2 O 2 concentration and a decrease of the intracellular glutathione/glutathione disulfide ratio, accompanied by augmented efflux of glutathione and glutathione disulfide. Apocynin induced the activation of both pentose phosphate pathway and tricarboxylic acid cycle, which was blocked when the cells were incubated with glutathione together with apocynin. The cell incubation with glutathione prevented also the apocynin-induced increase of malonyldialdehyde generation and lactate dehydrogenase leakage. Apocynin exerted an oxidant effect also in a cell-free system: indeed, in aqueous solution, it evoked a faster oxidation of the thiols glutathione and dithiothreitol, and elicited the generation of reactive oxygen species, mainly superoxide anions. Our results suggest that apocynin per se can induce an oxidative stress and exert a cytotoxic effect in N11 cells and other cell types, and that some effects of apocynin in in vitro and in vivo experimental models should be interpreted with caution

  16. Indanones as high-potency reversible inhibitors of monoamine oxidase. (United States)

    Mostert, Samantha; Petzer, Anél; Petzer, Jacobus P


    Recent reports document that α-tetralone (3,4-dihydro-2H-naphthalen-1-one) is an appropriate scaffold for the design of high-potency monoamine oxidase (MAO) inhibitors. Based on the structural similarity between α-tetralone and 1-indanone, the present study involved synthesis of 34 1-indanone and related indane derivatives as potential inhibitors of recombinant human MAO-A and MAO-B. The results show that C6-substituted indanones are particularly potent and selective MAO-B inhibitors, with IC50 values ranging from 0.001 to 0.030 μM. C5-Substituted indanone and indane derivatives are comparatively weaker MAO-B inhibitors. Although the 1-indanone and indane derivatives are selective inhibitors of the MAO-B isoform, a number of homologues are also potent MAO-A inhibitors, with three homologues possessing IC50 values 1-indanone as a reversible MAO inhibitor with a competitive mode of inhibition. It may be concluded that 1-indanones are promising leads for the design of therapies for neurodegenerative and neuropsychiatric disorders such as Parkinson's disease and depression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Xanthine oxidase activity regulates human embryonic brain cells growth

    Directory of Open Access Journals (Sweden)

    Kevorkian G. A.


    Full Text Available Aim. Involvement of Xanthine Oxidase (XO; EC1.1.3.22 in cellular proliferation and differentiation has been suggested by the numerous investigations. We have proposed that XO might have undoubtedly important role during the development, maturation as well as the death of human embryos brain cells. Methods. Human abortion material was utilized for the cultivation of brain cells (E90. XO activity was measured by the formation of uric acid in tissue. Cell death was detected by the utility of Trypan Blue dye. Results. Allopurinol suppressed the XO activity in the brain tissue (0.12 ± 0.02; 0.20 ± 0.03 resp., p < 0.05. On day 12th the number of cells in the culture treated with the Allopurinol at the early stage of development was higher in comparison with the Control (2350.1 ± 199.0 vs 2123 ± 96 and higher in comparison with the late period of treatment (1479.6 ± 103.8, p < < 0.05. In all groups, the number of the dead cells was less than in Control, indicating the protective nature of Allopurinol as an inhibitor of XO. Conclusions. Allopurinol initiates cells proliferation in case of the early treatment of the human brain derived cell culture whereas at the late stages it has an opposite effect.

  18. Reye's syndrome: salicylate and mitochondrial monoamine oxidase function

    International Nuclear Information System (INIS)

    Faraj, B.A.; Caplan, D.; Lolies, P.


    It has been suggested that aspirin is somehow linked with the onset of Reye's syndrome (RS). A general feature of Reye's syndrome is severe impairment of mitochondrial monoamine oxidase (MAO) function. The main objective of this investigation was to study the effect of salicylate on platelet mitochondrial MAO activity in three groups: group A (healthy children, n = 21) and group C (healthy adults, n = 10). Platelet MAO was measured by radio-enzymatic technique with 14 C-tyramine as a substrate. The results showed that salicyclate (10 mM) had a 20 to 60 percent inhibitory effect on platelet MAO function in only 1, 3 and 2 of the subjects in group A, B and C. Furthermore, there was an association between low enzyme activity and salicylate MAO inhibitory effect in these subjects. These preliminary findings suggest that salicylate may induce deterioration in mitochondrial function in susceptible individuals and that the assessment of salicylate MAO inhibitory effect may identify those who may be at risk to develop aspirin poisoning and Reye's syndrome

  19. Assays of D-Amino Acid Oxidase Activity

    Directory of Open Access Journals (Sweden)

    Elena Rosini


    Full Text Available D-amino acid oxidase (DAAO is a well-known flavoenzyme that catalyzes the oxidative FAD-dependent deamination of D-amino acids. As a result of the absolute stereoselectivity and broad substrate specificity, microbial DAAOs have been employed as industrial biocatalysts in the production of semi-synthetic cephalosporins and enantiomerically pure amino acids. Moreover, in mammals, DAAO is present in specific brain areas and degrades D-serine, an endogenous coagonist of the N-methyl-D-aspartate receptors (NMDARs. Dysregulation of D-serine metabolism due to an altered DAAO functionality is related to pathological NMDARs dysfunctions such as in amyotrophic lateral sclerosis and schizophrenia. In this protocol paper, we describe a variety of direct assays based on the determination of molecular oxygen consumption, reduction of alternative electron acceptors, or α-keto acid production, of coupled assays to detect the hydrogen peroxide or the ammonium production, and an indirect assay of the α-keto acid production based on a chemical derivatization. These analytical assays allow the determination of DAAO activity both on recombinant enzyme preparations, in cells, and in tissue samples.

  20. Selective inhibition of monoamine oxidase A by purpurin, an anthraquinone. (United States)

    Lee, Hyun Woo; Ryu, Hyung Won; Kang, Myung-Gyun; Park, Daeui; Oh, Sei-Ryang; Kim, Hoon


    Monoamine oxidase (MAO) catalyzes the oxidation of monoamines that act as neurotransmitters. During a target-based screening of natural products using two isoforms of recombinant human MAO-A and MAO-B, purpurin (an anthraquinone derivative) was found to potently and selectively inhibit MAO-A, with an IC 50 value of 2.50μM, and not to inhibit MAO-B. Alizarin (also an anthraquinone) inhibited MAO-A less potently with an IC 50 value of 30.1μM. Furthermore, purpurin was a reversible and competitive inhibitor of MAO-A with a K i value of 0.422μM. A comparison of their chemical structures suggested the 4-hydroxy group of purpurin might play an important role in its inhibition of MAO-A. Molecular docking simulation showed that the binding affinity of purpurin for MAO-A (-40.0kcal/mol) was higher than its affinity for MAO-B (-33.9kcal/mol), and that Ile 207 and Gly 443 of MAO-A were key residues for hydrogen bonding with purpurin. The findings of this study suggest purpurin is a potent, selective, reversible inhibitor of MAO-A, and that it be considered a new potential lead compound for development of novel reversible inhibitors of MAO-A (RIMAs). Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Inactivating mutations in the gene for thyroid oxidase 2 (THOX2) and congenital hypothyroidism

    NARCIS (Netherlands)

    Moreno, José C.; Bikker, Hennie; Kempers, Marlies J. E.; van Trotsenburg, A. S. Paul; Baas, Frank; de Vijlder, Jan J. M.; Vulsma, Thomas; Ris-Stalpers, C.


    Background Several genetic defects are associated with permanent congenital hypothyroidism. Immunologic, environmental, and iatrogenic (but not genetic) factors are known to induce transient congenital hypothyroidism, which spontaneously resolves within the first months of life. We hypothesized that

  2. Contribution of NADPH Oxidase to Membrane CD38 Internalization and Activation in Coronary Arterial Myocytes (United States)

    Xu, Ming; Li, Xiao-Xue; Ritter, Joseph K.; Abais, Justine M.; Zhang, Yang; Li, Pin-Lan


    The CD38-ADP-ribosylcyclase-mediated Ca2+ signaling pathway importantly contributes to the vasomotor response in different arteries. Although there is evidence indicating that the activation of CD38-ADP-ribosylcyclase is associated with CD38 internalization, the molecular mechanism mediating CD38 internalization and consequent activation in response to a variety of physiological and pathological stimuli remains poorly understood. Recent studies have shown that CD38 may sense redox signals and is thereby activated to produce cellular response and that the NADPH oxidase isoform, NOX1, is a major resource to produce superoxide (O2 ·−) in coronary arterial myocytes (CAMs) in response to muscarinic receptor agonist, which uses CD38-ADP-ribosylcyclase signaling pathway to exert its action in these CAMs. These findings led us hypothesize that NOX1-derived O2 ·− serves in an autocrine fashion to enhance CD38 internalization, leading to redox activation of CD38-ADP-ribosylcyclase activity in mouse CAMs. To test this hypothesis, confocal microscopy, flow cytometry and a membrane protein biotinylation assay were used in the present study. We first demonstrated that CD38 internalization induced by endothelin-1 (ET-1) was inhibited by silencing of NOX1 gene, but not NOX4 gene. Correspondingly, NOX1 gene silencing abolished ET-1-induced O2 ·− production and increased CD38-ADP-ribosylcyclase activity in CAMs, while activation of NOX1 by overexpression of Rac1 or Vav2 or administration of exogenous O2 ·− significantly increased CD38 internalization in CAMs. Lastly, ET-1 was found to markedly increase membrane raft clustering as shown by increased colocalization of cholera toxin-B with CD38 and NOX1. Taken together, these results provide direct evidence that Rac1-NOX1-dependent O2 ·− production mediates CD38 internalization in CAMs, which may represent an important mechanism linking receptor activation with CD38 activity in these cells. PMID:23940720

  3. Molecular mechanism of cell death induced by king cobra (Ophiophagus hannah) venom l-amino acid oxidase. (United States)

    Fung, Shin Yee; Lee, Mui Li; Tan, Nget Hong


    Snake venom LAAOs have been reported to exhibit a wide range of pharmacological activities, including cytotoxic, edema-inducing, platelet aggregation-inducing/platelet aggregation-inhibiting, bactericidal and antiviral activities. A heat-stable form of l-amino acid oxidase isolated from king cobra (Ophiophagus hannah) venom (OH-LAAO) has been shown to exhibit very potent cytotoxicity against human tumorigenic cells but not in their non-tumorigenic counterparts, and the cytotoxicity was due to the apoptosis-inducing effect of the enzyme. In this work, the molecular mechanism of cell death induced by OH-LAAO was investigated. The enzyme exerts its apoptosis-inducing effect presumably via both intrinsic and extrinsic pathways as suggested by the increase in caspase-8 and -9 activities. Oligonucleotide microarray analysis showed that the expression of a total of 178 genes was significantly altered as a result of oxidative stress induced by the hydrogen peroxide generated by the enzyme. Of the 178 genes, at least 27 genes are involved in apoptosis and cell death. These alterations of gene expression was presumably caused by the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidative modifications of signaling molecules that eventually lead to apoptosis and cell death. The very substantial up-regulation of cytochrome P450 genes may also contribute to the potent cytotoxic action of OH-LAAO by producing excessive reactive oxygen species (ROS). In conclusion, the potent apoptosis inducing activity of OH-LAAO was likely due to the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidation of signalling molecules. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana. (United States)

    Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying


    Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  5. CYP714B1 and CYP714B2 encode gibberellin 13-oxidases that reduce gibberellin activity in rice. (United States)

    Magome, Hiroshi; Nomura, Takahito; Hanada, Atsushi; Takeda-Kamiya, Noriko; Ohnishi, Toshiyuki; Shinma, Yuko; Katsumata, Takumi; Kawaide, Hiroshi; Kamiya, Yuji; Yamaguchi, Shinjiro


    Bioactive gibberellins (GAs) control many aspects of growth and development in plants. GA(1) has been the most frequently found bioactive GA in various tissues of flowering plants, but the enzymes responsible for GA(1) biosynthesis have not been fully elucidated due to the enzymes catalyzing the 13-hydroxylation step not being identified. Because of the lack of mutants defective in this enzyme, biological significance of GA 13-hydroxylation has been unknown. Here, we report that two cytochrome P450 genes, CYP714B1 and CYP714B2, encode GA 13-oxidase in rice. Transgenic Arabidopsis plants that overexpress CYP714B1 or CYP714B2 show semidwarfism. There was a trend that the levels of 13-OH GAs including GA(1) were increased in these transgenic plants. Functional analysis using yeast or insect cells shows that recombinant CYP714B1 and CYP714B2 proteins can convert GA(12) into GA(53) (13-OH GA(12)) in vitro. Moreover, the levels of 13-OH GAs including GA(1) were decreased, whereas those of 13-H GAs including GA(4) (which is more active than GA(1)) were increased, in the rice cyp714b1 cyp714b2 double mutant. These results indicate that CYP714B1 and CYP714B2 play a predominant role in GA 13-hydroxylation in rice. The double mutant plants appear phenotypically normal until heading, but show elongated uppermost internode at the heading stage. Moreover, CYP714B1 and CYP714B2 expression was up-regulated by exogenous application of bioactive GAs. Our results suggest that GA 13-oxidases play a role in fine-tuning plant growth by decreasing GA bioactivity in rice and that they also participate in GA homeostasis.

  6. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase (United States)

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.


    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

  7. Radio-isotopic determination of platelet monoamine oxidase and regulation of its activity by an indigenous drug

    International Nuclear Information System (INIS)

    Dubey, G.P.; Srivastava, V.K.; Agrawal, A.; Udupa, K.N.


    Platelet monoamine oxidase is a mitochondrial enzyme taking part in the deamination reaction of total catecholamine. Recent studies of monoamine oxidase inhibitors have gained its importance in the control of variety of psychosomatic disorders like mental depression, arterial hypertension and anxiety neurosis. 30 apparently normal individuals and 42 diagnosed cases of essential hypertension were selected for the present study. The platelet monoamine oxidase activity was measured by using 14 C-tryptamine bisuccinate. Comparatively low activity of platelet monoamine oxidase was noticed in hypertension cases than in the normal. After oral administration of an indigenous drug 'Geriforte' for three months, a significant rise in platelet monoamine oxidase activity was noticed in hypertension cases. It can be concluded that this indigenous formulation has the capacity to regulate the monoamine oxidase activity, as such, it may provide an alternative remedy in the management of psychosomatic disorders. (author). 11 refs

  8. Significance of membrane bioreactor design on the biocatalytic performance of glucose oxidase and catalase: Free vs. immobilized enzyme systems

    DEFF Research Database (Denmark)

    Morthensen, Sofie Thage; Meyer, Anne S.; Jørgensen, Henning


    Membrane separation of xylose and glucose can be accomplished via oxidation of glucose to gluconic acid by enzymatic glucose oxidase catalysis. Oxygen for this reaction can be supplied via decomposition of hydrogen peroxide by enzymatic catalase catalysis. In order to maximize the biocatalytic...... productivity of glucose oxidase and catalase (gluconic acid yield per total amount of enzyme) the following system set-ups were compared: immobilization of glucose oxidase alone; co-immobilization of glucose oxidase and catalase; glucose oxidase and catalase free in the membrane bioreactor. Fouling......-induced enzyme immobilization in the porous support of an ultrafiltration membrane was used as strategy for entrapment of glucose oxidase and catalase. The biocatalytic productivity of the membrane reactor was found to be highly related to the oxygen availability, which in turn depended on the reactor...

  9. Improvement Strategies, Cost Effective Production, and Potential Applications of Fungal Glucose Oxidase (GOD: Current Updates

    Directory of Open Access Journals (Sweden)

    Manish K. Dubey


    Full Text Available Fungal glucose oxidase (GOD is widely employed in the different sectors of food industries for use in baking products, dry egg powder, beverages, and gluconic acid production. GOD also has several other novel applications in chemical, pharmaceutical, textile, and other biotechnological industries. The electrochemical suitability of GOD catalyzed reactions has enabled its successful use in bioelectronic devices, particularly biofuel cells, and biosensors. Other crucial aspects of GOD such as improved feeding efficiency in response to GOD supplemental diet, roles in antimicrobial activities, and enhancing pathogen defense response, thereby providing induced resistance in plants have also been reported. Moreover, the medical science, another emerging branch where GOD was recently reported to induce several apoptosis characteristics as well as cellular senescence by downregulating Klotho gene expression. These widespread applications of GOD have led to increased demand for more extensive research to improve its production, characterization, and enhanced stability to enable long term usages. Currently, GOD is mainly produced and purified from Aspergillus niger and Penicillium species, but the yield is relatively low and the purification process is troublesome. It is practical to build an excellent GOD-producing strain. Therefore, the present review describes innovative methods of enhancing fungal GOD production by using genetic and non-genetic approaches in-depth along with purification techniques. The review also highlights current research progress in the cost effective production of GOD, including key advances, potential applications and limitations. Therefore, there is an extensive need to commercialize these processes by developing and optimizing novel strategies for cost effective GOD production.

  10. Sterol Methyl Oxidases Affect Embryo Development via Auxin-Associated Mechanisms. (United States)

    Zhang, Xia; Sun, Shuangli; Nie, Xiang; Boutté, Yohann; Grison, Magali; Li, Panpan; Kuang, Susu; Men, Shuzhen


    Sterols are essential molecules for multiple biological processes, including embryogenesis, cell elongation, and endocytosis. The plant sterol biosynthetic pathway is unique in the involvement of two distinct sterol 4α-methyl oxidase (SMO) families, SMO1 and SMO2, which contain three and two isoforms, respectively, and are involved in sequential removal of the two methyl groups at C-4. In this study, we characterized the biological functions of members of the SMO2 gene family. SMO2-1 was strongly expressed in most tissues during Arabidopsis (Arabidopsis thaliana) development, whereas SMO2-2 showed a more specific expression pattern. Although single smo2 mutants displayed no obvious phenotype, the smo2-1 smo2-2 double mutant was embryonic lethal, and the smo2-1 smo2-2/+ mutant was dwarf, whereas the smo2-1/+ smo2-2 mutant exhibited a moderate phenotype. The phenotypes of the smo2 mutants resembled those of auxin-defective mutants. Indeed, the expression of DR5rev:GFP, an auxin-responsive reporter, was reduced and abnormal in smo2-1 smo2-2 embryos. Furthermore, the expression and subcellular localization of the PIN1 auxin efflux facilitator also were altered. Consistent with these observations, either the exogenous application of auxin or endogenous auxin overproduction (YUCCA9 overexpression) partially rescued the smo2-1 smo2-2 embryonic lethality. Surprisingly, the dwarf phenotype of smo2-1 smo2-2/+ was completely rescued by YUCCA9 overexpression. Gas chromatography-mass spectrometry analysis revealed a substantial accumulation of 4α-methylsterols, substrates of SMO2, in smo2 heterozygous double mutants. Together, our data suggest that SMO2s are important for correct sterol composition and function partially through effects on auxin accumulation, auxin response, and PIN1 expression to regulate Arabidopsis embryogenesis and postembryonic development. © 2016 American Society of Plant Biologists. All Rights Reserved.

  11. Sterol Methyl Oxidases Affect Embryo Development via Auxin-Associated Mechanisms1 (United States)

    Zhang, Xia; Sun, Shuangli; Nie, Xiang; Boutté, Yohann; Grison, Magali; Li, Panpan; Kuang, Susu


    Sterols are essential molecules for multiple biological processes, including embryogenesis, cell elongation, and endocytosis. The plant sterol biosynthetic pathway is unique in the involvement of two distinct sterol 4α-methyl oxidase (SMO) families, SMO1 and SMO2, which contain three and two isoforms, respectively, and are involved in sequential removal of the two methyl groups at C-4. In this study, we characterized the biological functions of members of the SMO2 gene family. SMO2-1 was strongly expressed in most tissues during Arabidopsis (Arabidopsis thaliana) development, whereas SMO2-2 showed a more specific expression pattern. Although single smo2 mutants displayed no obvious phenotype, the smo2-1 smo2-2 double mutant was embryonic lethal, and the smo2-1 smo2-2/+ mutant was dwarf, whereas the smo2-1/+ smo2-2 mutant exhibited a moderate phenotype. The phenotypes of the smo2 mutants resembled those of auxin-defective mutants. Indeed, the expression of DR5rev:GFP, an auxin-responsive reporter, was reduced and abnormal in smo2-1 smo2-2 embryos. Furthermore, the expression and subcellular localization of the PIN1 auxin efflux facilitator also were altered. Consistent with these observations, either the exogenous application of auxin or endogenous auxin overproduction (YUCCA9 overexpression) partially rescued the smo2-1 smo2-2 embryonic lethality. Surprisingly, the dwarf phenotype of smo2-1 smo2-2/+ was completely rescued by YUCCA9 overexpression. Gas chromatography-mass spectrometry analysis revealed a substantial accumulation of 4α-methylsterols, substrates of SMO2, in smo2 heterozygous double mutants. Together, our data suggest that SMO2s are important for correct sterol composition and function partially through effects on auxin accumulation, auxin response, and PIN1 expression to regulate Arabidopsis embryogenesis and postembryonic development. PMID:27006488

  12. NADPH Oxidase Contributes to Photoreceptor Degeneration in Constitutively Active RAC1 Mice (United States)

    Song, Hongman; Vijayasarathy, Camasamudram; Zeng, Yong; Marangoni, Dario; Bush, Ronald A.; Wu, Zhijian; Sieving, Paul A.


    Purpose The active form of small GTPase RAC1 is required for activation of NADPH oxidase (NOX), which in turn generates reactive oxygen species (ROS) in nonphagocytic cells. We explored whether NOX-induced oxidative stress contributes to rod degeneration in retinas expressing constitutively active (CA) RAC1. Methods Transgenic (Tg)–CA-RAC1 mice were given apocynin (10 mg/kg, intraperitoneal), a NOX inhibitor, or vehicle daily for up to 13 weeks. Superoxide production and oxidative damage were assessed by dihydroethidium staining and by protein carbonyls and malondialdehyde levels, respectively. Outer nuclear layer (ONL) cells were counted and electroretinogram (ERG) amplitudes measured in Tg-CA-RAC1 mice. Outer nuclear layer cells were counted in wild-type (WT) mice after transfer of CA-Rac1 gene by subretinal injection of AAV8-pOpsin-CA Rac1-GFP. Results Transgenic-CA-RAC1 retinas had significantly fewer photoreceptor cells and more apoptotic ONL cells than WT controls from postnatal week (Pw) 3 to Pw13. Superoxide accumulation and protein and lipid oxidation were increased in Tg-CA-RAC1 retinas and were reduced in mice treated with apocynin. Apocynin reduced the loss of photoreceptors and increased the rod ERG a- and b-wave amplitudes when compared with vehicle-injected transgenic controls. Photoreceptor loss was also observed in regions of adult WT retina transduced with AAV8-pOpsin-CA Rac1-GFP but not in neighboring regions that were not transduced or in AAV8-pOpsin-GFP–transduced retinas. Conclusions Constitutively active RAC1 promotes photoreceptor cell death by oxidative damage that occurs, at least partially, through NOX-induced ROS. Reactive oxygen species are likely involved in multiple forms of retinal degenerations, and our results support investigating RAC1 inhibition as a therapeutic approach that targets this disease pathway. PMID:27233035

  13. Monoamine oxidase A polymorphism moderates stability of attention problems and susceptibility to life stress during adolescence. (United States)

    Zohsel, K; Bianchi, V; Mascheretti, S; Hohm, E; Schmidt, M H; Esser, G; Brandeis, D; Banaschewski, T; Nobile, M; Laucht, M


    Attention problems affect a substantial number of children and adolescents and are predictive of academic underachievement and lower global adaptive functioning. Considerable variability has been observed with regard to the individual development of attention problems over time. In particular, the period of adolescence is characterized by substantial maturation of executive functioning including attentional processing, with the influence of genetic and environmental factors on individual trajectories not yet well understood. In the present investigation, we evaluated whether the monoamine oxidase A functional promoter polymorphism, MAOA-LPR, plays a role in determining continuity of parent-rated attention problems during adolescence. At the same time, a potential effect of severe life events (SLEs) was taken into account. A multi-group path analysis was used in a sample of 234 adolescents (149 males, 85 females) who took part in an epidemiological cohort study at the ages of 11 and 15 years. Attention problems during early adolescence were found to be a strong predictor of attention problems in middle adolescence. However, in carriers of the MAOA-LPR low-activity variant (MAOA-L), stability was found to be significantly higher than in carriers of the high-activity variant (MAOA-H). Additionally, only in MAOA-L carriers did SLEs during adolescence significantly impact on attention problems at the age of 15 years, implying a possible gene × environment interaction. To conclude, we found evidence that attention problems during adolescence in carriers of the MAOA-L allele are particularly stable and malleable to life stressors. The present results underline the usefulness of applying a more dynamic GxE perspective. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  14. Biofabrication Using Pyrrole Electropolymerization for the Immobilization of Glucose Oxidase and Lactate Oxidase on Implanted Microfabricated Biotransducers

    Directory of Open Access Journals (Sweden)

    Christian N. Kotanen


    Full Text Available The dual responsive Electrochemical Cell-on-a-Chip Microdisc Electrode Array (ECC MDEA 5037 is a recently developed electrochemical transducer for use in a wireless, implantable biosensor system for the continuous measurement of interstitial glucose and lactate. Fabrication of the biorecognition membrane via pyrrole electropolymerization and both in vitro and in vivo characterization of the resulting biotransducer is described. The influence of EDC-NHS covalent conjugation of glucose oxidase with 4-(3-pyrrolyl butyric acid (monomerization and with 4-sulfobenzoic acid (sulfonization on biosensor performance was examined. As the extent of enzyme conjugation was increased sensitivity decreased for monomerized enzymes but increased for sulfonized enzymes. Implanted biotransducers were examined in a Sprague-Dawley rat hemorrhage model. Resection after 4 h and subsequent in vitro re-characterization showed a decreased sensitivity from 0.68 (±0.40 to 0.22 (±0.17 µA·cm−2·mM−1, an increase in the limit of detection from 0.05 (±0.03 to 0.27 (±0.27 mM and a six-fold increase in the response time from 41 (±18 to 244 (±193 s. This evidence reconfirms the importance of biofouling at the bio-abio interface and the need for mitigation strategies to address the foreign body response.

  15. Interactions of Desmethoxyyangonin, a Secondary Metabolite from Renealmia alpinia, with Human Monoamine Oxidase-A and Oxidase-B

    Directory of Open Access Journals (Sweden)

    Narayan D. Chaurasiya


    Full Text Available Renealmia alpinia (Zingiberaceae, a medicinal plant of tropical rainforests, is used to treat snakebites and other injuries and also as a febrifuge, analgesic, antiemetic, antiulcer, and anticonvulsant. The dichloromethane extract of R. alpinia leaves showed potent inhibition of human monoamine oxidases- (MAOs- A and B. Phytochemical studies yielded six known compounds, including pinostrobin 1, 4′-methyl ether sakuranetin 2, sakuranetin 3, pinostrobin chalcone 4, yashabushidiol A 5, and desmethoxyyangonin 6. Compound 6 displayed about 30-fold higher affinity for MAO-B than MAO-A, with Ki values of 31 and 922 nM, respectively. Kinetic analysis of inhibition and equilibrium-dialysis dissociation assay of the enzyme-inhibitor complex showed reversible binding of desmethoxyyangonin 6 with MAO-A and MAO-B. The binding interactions of compound 6 in the active site of the MAO-A and MAO-B isoenzymes, investigated through molecular modeling algorithms, confirmed preferential binding of desmethoxyyangonin 6 with MAO-B compared to MAO-A. Selective reversible inhibitors of MAO-B, like desmethoxyyangonin 6, may have important therapeutic significance for the treatment of neurodegenerative disorders, such as Parkinson’s disease and Alzheimer’s disease.

  16. Presteady-state and steady-state kinetic properties of human cytochrome c oxidase. Identification of rate-limiting steps in mammalian cytochrome c oxidase

    NARCIS (Netherlands)

    van Kuilenburg, A. B.; Gorren, A. C.; Dekker, H. L.; Nieboer, P.; van Gelder, B. F.; Muijsers, A. O.


    Human cytochrome c oxidase was purified in a fully active form from heart and skeletal muscle. The enzyme was selectively solubilised with octylglucoside and KCl from submitochondrial particles followed by ammonium sulphate fractionation. The presteady-state and steady-state kinetic properties of

  17. Phospholipid alterations in cardiac sarcoplasmic reticulum induced by xanthine oxidase: contamination of commercial preparations of xanthine oxidase by phospholipase A2

    International Nuclear Information System (INIS)

    Gamache, D.A.; Kornberg, L.J.; Bartolf, M.; Franson, R.C.


    Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1- 14 C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A 2 (PLA 2 ) activity (64.3-545.6 nmols/min/mg). The PLA 2 was maximally active in the neutral-alkaline pH range, was Ca 2+ -dependent, and was unaffected by the addition of xanthine. PLA 2 activity was totally inhibited by 1mM EDTA whereas radical production by optimal concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA 2 activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca 2+ -dependent PLA 2 measured in various tissue homogenates (≤ 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA 2 may have influenced previously published reports, and such studies should be interpreted cautiously

  18. A point mutation of valine-311 to methionine in Bacillus subtilis protoporphyrinogen oxidase does not greatly increase resistance to the diphenyl ether herbicide oxyfluorfen. (United States)

    Jeong, Eunjoo; Houn, Thavrak; Kuk, Yongin; Kim, Eun-Seon; Chandru, Hema Kumar; Baik, Myunggi; Back, Kyoungwhan; Guh, Ja-Ock; Han, Oksoo


    In an effort to asses the effect of Val311Met point mutation of Bacillus subtilis protoporphyrinogen oxidase on the resistance to diphenyl ether herbicides, a Val311Met point mutant of B. subtilis protoporphyrinogen oxidase was prepared, heterologously expressed in Escherichia coli, and the purified recombinant Val311Met mutant protoporphyrinogen oxidase was kinetically characterized. The mutant protoporphyrinogen oxidase showed very similar kinetic patterns to wild type protoporphyrinogen oxidase, with slightly decreased activity dependent on pH and the concentrations of NaCl, Tween 20, and imidazole. When oxyfluorfen was used as a competitive inhibitor, the Val311Met mutant protoporphyrinogen oxidase showed an increased inhibition constant about 1.5 times that of wild type protoporphyrinogen oxidase. The marginal increase of the inhibition constant indicates that the Val311Met point mutation in B. subtilis protoporphyrinogen oxidase may not be an important determinant in the mechanism that protects protoporphyrinogen oxidase against diphenyl ether herbicides.

  19. The substrate oxidation mechanism of pyranose 2-oxidase and other related enzymes in the glucose-methanol-choline superfamily. (United States)

    Wongnate, Thanyaporn; Chaiyen, Pimchai


    Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.

  20. Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis. (United States)

    Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L


    Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (Ppenis. Apocynin treatment of sickle mice reversed (P0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in the SCD mouse penis. © 2012 International Society for Sexual Medicine.

  1. Intracellular lysyl oxidase: Effect of a specific inhibitor on nuclear mass in proliferating cells

    Energy Technology Data Exchange (ETDEWEB)

    Saad, Fawzy A. [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Torres, Marie [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Wang, Hao [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Graham, Lila, E-mail: [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States)


    LOX, the principal enzyme involved in crosslinking of collagen, was the first of several lysyl oxidase isotypes to be characterized. Its active form was believed to be exclusively extracellular. Active LOX was later reported to be present in cell nuclei; its function there is unknown. LOX expression opposes the effect of mutationally activated Ras, which is present in about 30% of human cancers. The mechanism of LOX in countering the action of Ras is also unknown. In the present work, assessment of nuclear protein for possible effects of lysyl oxidase activity led to the discovery that proliferating cells dramatically increase their nuclear protein content when exposed to BAPN ({beta}-aminopropionitrile), a highly specific lysyl oxidase inhibitor that reportedly blocks LOX inhibition of Ras-induced oocyte maturation. In three cell types (PC12 cells, A7r5 smooth muscle cells, and NIH 3T3 fibroblasts), BAPN caused a 1.8-, 1.7-, and 2.1-fold increase in total nuclear protein per cell, respectively, affecting all major components in both nuclear matrix and chromatin fractions. Since nuclear size is correlated with proliferative status, enzyme activity restricting nuclear growth may be involved in the lysyl oxidase tumor suppressive effect. Evidence is also presented for the presence of apparent lysyl oxidase isotype(s) containing a highly conserved LOX active site sequence in the nuclei of PC12 cells, which do not manufacture extracellular lysyl oxidase substrates. Results reported here support the hypothesis that nuclear lysyl oxidase regulates nuclear growth, and thereby modulates cell proliferation.

  2. Comparative study between dimethyl sulfoxide (dmso), allopurinol and urate oxidase administration in nephrotoxic rats induced with

    International Nuclear Information System (INIS)

    Heibashy, M.I.A.; El-Nahla, A.M.; Ibrahim, A.I.; Saleh, Sh.Y.A.


    This study was conducted to show whether DMSO, allopurinol and urate oxidase could offer ameliorating effects against abnormal alterations in kidney function tests in gentamicin (GM) induced nephrotoxic rats . Two experiments were carried out, the first one showed that daily injection of 80 mg GM/kg b. wt interapertonealy (I.P) for two weeks induced acute renal failure indicated by significant elevation in serum urea, creatinine, uric acid, potassium, inorganic phosphorus, TBARS and PTH and a significant decline in serum sodium, total and ionized calcium when compared with their corresponding values in saline injected rats. In the second experiment, comparisons were made between GM induced nephrotoxic rats and other nephrotoxic groups received daily pf I.P injection of DMSO (4 ml/kg b.wt), allopurinol (1.5 mg/100 g b.wt) and urate oxidase (10 mg/100 g b.wt) for 30 days after the incidence of nephrotoxicity. At all intervals, 10,20 and 30 days; serum urea, creatinine, uric acid, potassium, inorganic phosphorus, TBARS and PTH in DMSO, allopurinol and urate oxidase treated groups exhibited significant reduction than nephrotoxic untreated rats. During the same intervals, the levels of serum total and ionized calcium showed an opposite trend. serum sodium level did not show any significant difference between all treated groups except after 20 days , it was increased significantly in urate oxidase treated group and after 30 days in both allopurinol and urate oxidase treated groups. in term time intervals, a significant correction was recorded on the level of most measured parameters. in nephritic rats, the administration of DMSO, allopurinol or urate oxidase led to a significant amelioration effects in the kidney function tests and urate oxidase was the best protective.

  3. Prognostic relevance of cytochrome C oxidase in primary glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Corinne E Griguer

    Full Text Available Patients with primary glioblastoma multiforme (GBM have one of the lowest overall survival rates among cancer patients, and reliable biomarkers are necessary to predict patient outcome. Cytochrome c oxidase (CcO promotes the switch from glycolytic to OXPHOS metabolism, and increased CcO activity in tumors has been associated with tumor progression after chemotherapy failure. Thus, we investigated the relationship between tumor CcO activity and the survival of patients diagnosed with primary GBM. A total of 84 patients with grade IV glioma were evaluated in this retrospective cohort study. Cumulative survival was calculated by the Kaplan-Meier method and analyzed by the log-rank test, and univariate and multivariate analyses were performed with the Cox regression model. Mitochondrial CcO activity was determined by spectrophotometrically measuring the oxidation of cytochrome c. High CcO activity was detected in a subset of glioma tumors (∼30%, and was an independent prognostic factor for shorter progression-free survival and overall survival [P = 0.0087 by the log-rank test, hazard ratio = 3.57 for progression-free survival; P<0.001 by the log-rank test, hazard ratio = 10.75 for overall survival]. The median survival time for patients with low tumor CcO activity was 14.3 months, compared with 6.3 months for patients with high tumor CcO activity. High CcO activity occurs in a significant subset of high-grade glioma patients and is an independent predictor of poor outcome. Thus, CcO activity may serve as a useful molecular marker for the categorization and targeted therapy of GBMs.

  4. Scanning tunneling microscopy studies of glucose oxidase on gold surface

    International Nuclear Information System (INIS)

    Losic, D.; Shapter, J.G.; Gooding, J.J.


    Full text: Three immobilization methods have been used for scanning tunneling microscopy (STM) studies of glucose oxidase (GOD) on gold. They are based on a) physical adsorption from solution, b) microcontact printing and c) covalent bonding onto self-assembled monolayers (SAM) of 3-mercaptopropionic acid (MPA). The STM images are used to provide information about the organization of individual GOD molecules and more densely packed monolayers of GOD on electrode surfaces, thus providing information of the role of interfacial structure on biosensor performance. The use of atomically flat gold substrates enables easy distinction of deposited enzyme features from the flat gold substrate. Microcontact printing is found to be a more reliable method than adsorption from solution for preparing individual GOD molecules on the gold surface STM images of printed samples reveal two different shapes of native GOD molecules. One is a butterfly shape with dimensions of 10 ± 1 nm x 6 ± 1 nm, assigned to the lying position of molecule while the second is an approximately spherical shape with dimensions of 6.5 ± 1 nm x 5 ± 1nm assigned to a standing position. Isolated clusters of 5 to 6 GOD molecules are also observed. With monolayer coverage, GOD molecules exhibit a tendency to organize themselves into a two dimensional array with adequate sample stability to obtain high-resolution STM images. Within these two-dimensional arrays are clearly seen repeating clusters of five to six enzyme molecules in a unit STM imaging of GOD monolayers covalently immobilized onto SAM (MPA) are considerably more difficult than when the enzyme is adsorbed directly onto the metal. Cluster structures are observed both high and low coverage despite the fact that native GOD is a negatively charged molecule. Copyright (2002) Australian Society for Electron Microscopy Inc

  5. Development of new radiopharmaceuticals for imaging monoamine oxidase B

    International Nuclear Information System (INIS)

    Vasdev, Neil; Sadovski, Oleg; Moran, Matthew D.; Parkes, Jun; Meyer, Jeffrey H.; Houle, Sylvain; Wilson, Alan A.


    Introduction: Imaging monoamine oxidase B (MAO-B) in the central nervous system with PET is an important goal for psychiatric studies. We here report an improved and automated radiosynthesis of N-(6-[ 18 F]-fluorohexyl)-N-methylpropargylamine ([ 18 F]FHMP; [ 18 F]-1), as well as the radiosynthesis of two new promising candidates for imaging cerebral MAO-B, namely, carbon-11-labeled 3-(4-[ 11 C]-methoxyphenyl)-6-methyl-2H-1-benzopyran-2-one ([ 11 C]-2) and N-((1H-pyrrol-2-yl)methyl)-N-[ 11 C]-methyl-1-phenylmethanamine ([ 11 C]-3). Methods: Fluorine-18-labeled 1 was prepared via a tosyloxy precursor in 29%±5% uncorrected radiochemical yield, relative to [ 18 F]-fluoride. Both carbon-11-labeled compounds were prepared with [ 11 C]CH 3 I using the 'LOOP' method in 11% and 18% uncorrected radiochemical yields, respectively, relative to starting [ 11 C]CO 2 . All radiotracers had specific activities >37 GBq/μmol and were >98% radiochemically pure at end of synthesis ( 18 F]-1. While [ 11 C]-2 had moderate brain penetration and good clearance from normal brain tissue, distribution of radioactivity in brain was indicative of free and nonspecific binding. Good brain uptake was observed with [ 11 C]-3 (0.8%-1.4% injected dose per gram at 5 min postinjection), binding appeared to be reversible and distribution conformed with regional distribution of MAO-B in the rat brain. Preinjection of 3 or L-deprenyl showed a modest reduction (up to 25%) of brain activity. Conclusion: Carbon-11-labeled 3 was found to have the most favorable properties of the radiotracers evaluated; however, the signal-to-noise ratio was too low to warrant further in vivo imaging studies. Alternative radiotracers for imaging MAO-B are under development.

  6. Monamine oxidase inhibitors: current and emerging agents for Parkinson disease. (United States)

    Fernandez, Hubert H; Chen, Jack J


    Monoamine oxidase type B (MAO-B) is the predominant isoform responsible for the metabolic breakdown of dopamine in the brain. Selective inhibition of brain MAO-B results in elevation of synaptosomal dopamine concentrations. Data have been reported regarding the selective MAO-B inhibitors, rasagiline and selegiline, for the symptomatic treatment of Parkinson disease (PD). Selegiline has demonstrated efficacy as monotherapy in patients with early PD (Deprenyl and Tocopherol Antioxidative Therapy of Parkinsonism study), but evidence of selegiline efficacy as adjunctive treatment in levodopa-treated PD patients with motor fluctuations is equivocal. A new formulation of selegiline (Zydis selegiline) has been evaluated in 2 small, placebo-controlled studies as adjunctive therapy to levodopa. The Zydis formulation allows pregastric absorption of selegiline, minimizing first-pass metabolism, and thereby increasing selegiline bioavailability and reducing the concentration of amphetamine metabolites. Rasagiline is a selective, second-generation, irreversible MAO-B inhibitor, with at least 5 times the potency of selegiline in vitro and in animal models. Rasagiline has demonstrated efficacy in 1 large, randomized, double-blind, placebo-controlled trial (TVP-1012 in Early Monotherapy for Parkinson's Disease Outpatients) as initial monotherapy in patients with early PD, and in 2 large, controlled trials (Parkinson's Rasagiline: Efficacy and Safety in the Treatment of "Off," Lasting Effect in Adjunct Therapy With Rasagiline Given Once Daily) as adjunctive treatment in levodopa-treated PD patients with motor fluctuations. Unlike selegiline, rasagiline is an aminoindan derivative with no amphetamine metabolites. A randomized clinical trial is underway to confirm preclinical and preliminary clinical data suggesting rasagiline has disease-modifying effects.

  7. NADPH Oxidase, NOX1, Mediates Vascular Injury in Ischemic Retinopathy (United States)

    Deliyanti, Devy; Rana, Indrajeetsinh; Miller, Antonia G.; Agrotis, Alex; Armani, Roksana; Szyndralewiez, Cédric; Wingler, Kirstin; Touyz, Rhian M.; Cooper, Mark E.; Jandeleit-Dahm, Karin A.; Schmidt, Harald H.H.W.


    Abstract Aims: Ischemic retinal diseases such as retinopathy of prematurity are major causes of blindness due to damage to the retinal microvasculature. Despite this clinical situation, retinopathy of prematurity is mechanistically poorly understood. Therefore, effective preventative therapies are not available. However, hypoxic-induced increases in reactive oxygen species (ROS) have been suggested to be involved with NADPH oxidases (NOX), the only known dedicated enzymatic source of ROS. Our major aim was to determine the contribution of NOX isoforms (1, 2, and 4) to a rodent model of retinopathy of prematurity. Results: Using a genetic approach, we determined that only mice with a deletion of NOX1, but not NOX2 or NOX4, were protected from retinal neovascularization and vaso-obliteration, adhesion of leukocytes, microglial accumulation, and the increased generation of proangiogenic and proinflammatory factors and ROS. We complemented these studies by showing that the specific NOX inhibitor, GKT137831, reduced vasculopathy and ROS levels in retina. The source of NOX isoforms was evaluated in retinal vascular cells and neuro-glial elements. Microglia, the immune cells of the retina, expressed NOX1, 2, and 4 and responded to hypoxia with increased ROS formation, which was reduced by GKT137831. Innovation: Our studies are the first to identify the NOX1 isoform as having an important role in the pathogenesis of retinopathy of prematurity. Conclusions: Our findings suggest that strategies targeting NOX1 have the potential to be effective treatments for a range of ischemic retinopathies. Antioxid. Redox Signal. 20, 2726–2740. PMID:24053718

  8. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.


    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  9. Novel thidiazuron-derived inhibitors of cytokinin oxidase/dehydrogenase. (United States)

    Nisler, Jaroslav; Kopečný, David; Končitíková, Radka; Zatloukal, Marek; Bazgier, Václav; Berka, Karel; Zalabák, David; Briozzo, Pierre; Strnad, Miroslav; Spíchal, Lukáš


    Two new TDZ derivatives (HETDZ and 3FMTDZ) are very potent inhibitors of CKX and are promising candidates for in vivo studies. Cytokinin hormones regulate a wide range of essential processes in plants. Thidiazuron (N-phenyl-N'-1,2,3-thiadiazol-5-yl urea, TDZ), formerly registered as a cotton defoliant, is a well known inhibitor of cytokinin oxidase/dehydrogenase (CKX), an enzyme catalyzing the degradation of cytokinins. TDZ thus increases the lifetime of cytokinins and their effects in plants. We used in silico modeling to design, synthesize and characterize twenty new TDZ derivatives with improved inhibitory properties. Two compounds, namely 1-[1,2,3]thiadiazol-5-yl-3-(3-trifluoromethoxy-phenyl)urea (3FMTDZ) and 1-[2-(2-hydroxyethyl)phenyl]-3-(1,2,3-thiadiazol-5-yl)urea (HETDZ), displayed up to 15-fold lower IC 50 values compared with TDZ for AtCKX2 from Arabidopsis thaliana and ZmCKX1 and ZmCKX4a from Zea mays. Binding modes of 3FMTDZ and HETDZ were analyzed by X-ray crystallography. Crystal structure complexes, solved at 2.0 Å resolution, revealed that HETDZ and 3FMTDZ bound differently in the active site of ZmCKX4a: the thiadiazolyl ring of 3FMTDZ was positioned over the isoalloxazine ring of FAD, whereas that of HETDZ had the opposite orientation, pointing toward the entrance of the active site. The compounds were further tested for cytokinin activity in several cytokinin bioassays. We suggest that the combination of simple synthesis, lowered cytokinin activity, and enhanced inhibitory effects on CKX isoforms, makes 3FMTDZ and HETDZ suitable candidates for in vivo studies.

  10. Alterations of sirtuins in mitochondrial cytochrome c-oxidase deficiency.

    Directory of Open Access Journals (Sweden)

    Arne Björn Potthast

    Full Text Available Sirtuins are NAD+ dependent deacetylases, which regulate mitochondrial energy metabolism as well as cellular response to stress. The NAD/NADH-system plays a crucial role in oxidative phosphorylation linking sirtuins and the mitochondrial respiratory chain. Furthermore, sirtuins are able to directly deacetylate and activate different complexes of the respiratory chain. This prompted us to analyse sirtuin levels in skin fibroblasts from patients with cytochrome c-oxidase (COX deficiency and to test the impact of different pharmaceutical activators of sirtuins (SRT1720, paeonol to modulate sirtuins and possibly respiratory chain enzymes in patient cells in vitro.We assayed intracellular levels of sirtuin 1 and the mitochondrial sirtuins SIRT3 and SIRT4 in human fibroblasts from patients with COX- deficiency. Furthermore, sirtuins were measured after inhibiting complex IV in healthy control fibroblasts by cyanide and after incubation with activators SRT1720 and paeonol. To determine the effect of sirtuin inhibition at the cellular level we measured total cellular acetylation (control and patient cells, with and without treatment by Western blot.We observed a significant decrease in cellular levels of all three sirtuins at the activity, protein and transcriptional level (by 15% to 50% in COX-deficient cells. Additionally, the intracellular concentration of NAD+ was reduced in patient cells. We mimicked the biochemical phenotype of COX- deficiency by incubating healthy fibroblasts with cyanide and observed reduced sirtuin levels. A pharmacological activation of sirtuins resulted in normalized sirtuin levels in patient cells. Hyper acetylation was also reversible after treatment with sirtuin activators. Pharmacological modulation of sirtuins resulted in altered respiratory chain complex activities.We found inhibition of situins 1, 3 and 4 at activity, protein and transcriptional levels in fibroblasts from patient with COX-deficiency. Pharmacological

  11. Insomnia, platelet serotonin and platelet monoamine oxidase in chronic alcoholism. (United States)

    Nenadic Sviglin, Korona; Nedic, Gordana; Nikolac, Matea; Mustapic, Maja; Muck-Seler, Dorotea; Borovecki, Fran; Pivac, Nela


    Insomnia is a common sleep disorder frequently occurring in chronic alcoholic patients. Neurobiological basis of insomnia, as well as of alcoholism, is associated with disrupted functions of the main neurotransmitter systems, including the serotonin (5-hydroxytryptamine, 5-HT) system. Blood platelets are considered a limited peripheral model for the central 5-HT neurons, since both platelets and central 5-HT synaptosomes have similar dynamics of 5-HT. Platelet 5-HT concentration and platelet monoamine oxidase type B (MAO-B) are assumed to represent biomarkers for particular symptoms and behaviors in psychiatric disorders. The hypothesis of this study was that platelet 5-HT concentration and platelet MAO-B activity will be altered in chronic alcoholic patients with insomnia compared to comparable values in patients without insomnia. The study included 498 subjects: 395 male and 103 female medication-free patients with alcohol dependence and 502 healthy control subjects: 325 men and 177 women. The effects of early, middle and late insomnia (evaluated using the Hamilton Depression Rating Scale), as well as sex, age and smoking on platelet 5-HT concentration and platelet MAO-B activity were evaluated using one-way ANOVA and multiple regression analysis by the stepwise method. Platelet 5-HT concentration, but not platelet MAO-B activity, was significantly reduced in alcoholic patients with insomnia compared to patients without insomnia. Multiple regression analysis revealed that platelet 5-HT concentration was affected by middle insomnia, smoking and sex, while platelet MAO activity was affected only by sex and age. The present and previous data suggest that platelet 5-HT concentration might be used, after controlling for sex and smoking, as a biomarker for insomnia in alcoholism, PTSD and in rotating shift workers. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  12. The Role of NADPH Oxidase in the Inhibition of Trichophyton rubrum by 420-nm Intense Pulsed Light

    Directory of Open Access Journals (Sweden)

    Hao Huang


    Full Text Available Objectives: To evaluate the effect of intense pulsed light (IPL on Trichophyton rubrum and investigate its mechanism of action.Methods: The viability of fungi treated with IPL alone and with IPL combined with an NADPH oxidase inhibitor (DPI pretreatment was determined by MTT assays. The reactive oxygen species (ROS were quantified with a DCFH-DA fluorescent probe. Malondialdehyde (MDA content and superoxide dismutase (SOD and glutathione peroxidase (GSH-Px activities were determined by commercial kits. The transcription of the Nox gene was quantified using quantitative real-time PCR (qRT-PCR analysis, and micromorphology was observed using scanning electron microscopy (SEM. In addition, fungal keratinase activity was detected by measuring dye release from keratin azure.Results: The growth declined with statistical significance after 6 h of treatment (P < 0.001. The ROS and MDA content increased after IPL treatment, whereas the SOD and GSH-Px activity decreased. Nox gene expression was upregulated, and the micromorphology was damaged. Keratinase activity decreased. Fungi that received DPI pretreatment exhibited contrasting outcomes.Conclusion: We found that 420-nm IPL significantly inhibited the growth and pathogenicity of T. rubrum in vitro. A suggested mechanism involves Nox as a factor that mediates 420-nm IPL-induced oxidative damage of T. rubrum.

  13. Reduction of NADPH-oxidase activity ameliorates the cardiovascular phenotype in a mouse model of Williams-Beuren Syndrome.

    Directory of Open Access Journals (Sweden)

    Victoria Campuzano


    Full Text Available A hallmark feature of Williams-Beuren Syndrome (WBS is a generalized arteriopathy due to elastin deficiency, presenting as stenoses of medium and large arteries and leading to hypertension and other cardiovascular complications. Deletion of a functional NCF1 gene copy has been shown to protect a proportion of WBS patients against hypertension, likely through reduced NADPH-oxidase (NOX-mediated oxidative stress. DD mice, carrying a 0.67 Mb heterozygous deletion including the Eln gene, presented with a generalized arteriopathy, hypertension, and cardiac hypertrophy, associated with elevated angiotensin II (angII, oxidative stress parameters, and Ncf1 expression. Genetic (by crossing with Ncf1 mutant and/or pharmacological (with ang II type 1 receptor blocker, losartan, or NOX inhibitor apocynin reduction of NOX activity controlled hormonal and biochemical parameters in DD mice, resulting in normalized blood pressure and improved cardiovascular histology. We provide strong evidence for implication of the redox system in the pathophysiology of the cardiovascular disease in a mouse model of WBS. The phenotype of these mice can be ameliorated by either genetic or pharmacological intervention reducing NOX activity, likely through reduced angII-mediated oxidative stress. Therefore, anti-NOX therapy merits evaluation to prevent the potentially serious cardiovascular complications of WBS, as well as in other cardiovascular disorders mediated by similar pathogenic mechanism.

  14. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne


    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  15. Impact of SO(2) on Arabidopsis thaliana transcriptome in wildtype and sulfite oxidase knockout plants analyzed by RNA deep sequencing. (United States)

    Hamisch, Domenica; Randewig, Dörte; Schliesky, Simon; Bräutigam, Andrea; Weber, Andreas P M; Geffers, Robert; Herschbach, Cornelia; Rennenberg, Heinz; Mendel, Ralf R; Hänsch, Robert


    High concentrations of sulfur dioxide (SO(2) ) as an air pollutant, and its derivative sulfite, cause abiotic stress that can lead to cell death. It is currently unknown to what extent plant fumigation triggers specific transcriptional responses. To address this question, and to test the hypothesis that sulfite oxidase (SO) is acting in SO(2) detoxification, we compared Arabidopsis wildtype (WT) and SO knockout lines (SO-KO) facing the impact of 600 nl l(-1) SO(2) , using RNAseq to quantify absolute transcript abundances. These transcriptome data were correlated to sulfur metabolism-related enzyme activities and metabolites obtained from identical samples in a previous study. SO-KO plants exhibited remarkable and broad regulative responses at the mRNA level, especially in transcripts related to sulfur metabolism enzymes, but also in those related to stress response and senescence. Focusing on SO regulation, no alterations were detectable in the WT, whereas in SO-KO plants we found up-regulation of two splice variants of the SO gene, although this gene is not functional in this line. Our data provide evidence for the highly specific coregulation between SO and sulfur-related enzymes like APS reductase, and suggest two novel candidates for involvement in SO(2) detoxification: an apoplastic peroxidase, and defensins as putative cysteine mass storages. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  16. Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

    International Nuclear Information System (INIS)

    Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin; Wei, Ling; Liu, Yutong; Liao, Jieying; Gao, Hui-Ming; Zhou, Hui


    Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm 2 induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm 2 ) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91 phox , p47 phox and p40 phox ); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47 phox and p67 phox translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to oxidative damage to DA neurons. Our

  17. Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China); Wei, Ling [Beijing Center for Physical & Chemical Analysis, Beijing 100089 (China); Liu, Yutong [School of Life Science, Beijing Normal University, Beijing 100875 (China); Liao, Jieying [Department of Translational Medicine, Xiamen Institute of Rare Earth Materials, Chinese Academy of Sciences, Xiamen 361024 (China); Gao, Hui-Ming [Model Animal Research Center of Nanjing University, Nanjing 211800 (China); Zhou, Hui, E-mail: [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China)


    Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm{sup 2} induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm{sup 2}) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91{sup phox}, p47{sup phox} and p40{sup phox}); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47{sup phox} and p67{sup phox} translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to

  18. Structural alterations in a component of cytochrome c oxidase and molecular evolution of pathogenic Neisseria in humans.

    Directory of Open Access Journals (Sweden)

    Marina Aspholm


    Full Text Available Three closely related bacterial species within the genus Neisseria are of importance to human disease and health. Neisseria meningitidis is a major cause of meningitis, while Neisseria gonorrhoeae is the agent of the sexually transmitted disease gonorrhea and Neisseria lactamica is a common, harmless commensal of children. Comparative genomics have yet to yield clear insights into which factors dictate the unique host-parasite relationships exhibited by each since, as a group, they display remarkable conservation at the levels of nucleotide sequence, gene content and synteny. Here, we discovered two rare alterations in the gene encoding the CcoP protein component of cytochrome cbb(3 oxidase that are phylogenetically informative. One is a single nucleotide polymorphism resulting in CcoP truncation that acts as a molecular signature for the species N. meningitidis. We go on to show that the ancestral ccoP gene arose by a unique gene duplication and fusion event and is specifically and completely distributed within species of the genus Neisseria. Surprisingly, we found that strains engineered to express either of the two CcoP forms conditionally differed in their capacity to support nitrite-dependent, microaerobic growth mediated by NirK, a nitrite reductase. Thus, we propose that changes in CcoP domain architecture and ensuing alterations in function are key traits in successive, adaptive radiations within these metapopulations. These findings provide a dramatic example of how rare changes in core metabolic proteins can be connected to significant macroevolutionary shifts. They also show how evolutionary change at the molecular level can be linked to metabolic innovation and its reversal as well as demonstrating how genotype can be used to infer alterations of the fitness landscape within a single host.

  19. Browning in Annona cherimola fruit: role of polyphenol oxidase and characterization of a coding sequence of the enzyme. (United States)

    Prieto, Humberto; Utz, Daniella; Castro, Alvaro; Aguirre, Carlos; González-Agüero, Mauricio; Valdés, Héctor; Cifuentes, Nicolas; Defilippi, Bruno G; Zamora, Pablo; Zúñiga, Gustavo; Campos-Vargas, Reinaldo


    Cherimoya (Annona cherimola Mill.) fruit is an attractive candidate for food processing applications as fresh cut. However, along with its desirable delicate taste, cherimoya shows a marked susceptibility to browning. This condition is mainly attributed to polyphenol oxidase activity (PPO). A general lack of knowledge regarding PPO and its role in the oxidative loss of quality in processed cherimoya fruit requires a better understanding of the mechanisms involved. The work carried out included the cloning of a full-length cDNA, an analysis of its properties in the deduced amino sequence, and linkage of its mRNA levels with enzyme activity in mature and ripe fruits after wounding. The results showed one gene different at the nucleotide level when compared with previously reported genes, but a well-conserved protein, either in functional and in structural terms. Cherimoya PPO gene (Ac-ppo, GenBank DQ990911) showed to be present apparently in one copy of the genome, and its transcripts could be significantly detected in leaves and less abundantly in flowers and fruits. Analysis of wounded matured and ripened fruits revealed an inductive behavior for mRNA levels in the flesh of mature cherimoya after 16 h. Although the highest enzymatic activity was observed on rind, a consistent PPO activity was detected on flesh samples. A lack of correlation between PPO mRNA level and PPO activity was observed, especially in flesh tissue. This is probably due to the presence of monophenolic substrates inducing a lag period, enzyme inhibitors and/or diphenolic substrates causing suicide inactivation, and proenzyme or latent isoforms of PPO. To our knowledge this is the first report of a complete PPO sequence in cherimoya. Furthermore, the gene is highly divergent from known nucleotide sequences but shows a well conserved protein in terms of its function, deduced structure, and physiological role.

  20. A new methodology for the determination of enzyme activity based on carbon nanotubes and glucose oxidase. (United States)

    Yeşiller, Gülden; Sezgintürk, Mustafa Kemal


    In this research, a novel enzyme activity analysis methodology is introduced as a new perspective for this area. The activity of elastase enzyme, which is a digestive enzyme mostly of found in the digestive system of vertebrates, was determined by an electrochemical device composed of carbon nanotubes and a second enzyme, glucose oxidase, which was used as a signal generator enzyme. In this novel methodology, a complex bioactive layer was constructed by using carbon nanotubes, glucose oxidase and a supporting protein, gelatin on a solid, conductive substrate. The activity of elastase was determined by monitoring the hydrolysis rate of elastase enzyme in the bioactive layer. As a result of this hydrolysis of elastase, glucose oxidase was dissociated from the bioactive layer, and following this the electrochemical signal due to glucose oxidase was decreased. The progressive elastase-catalyzed digestion of the bioactive layer containing glucose oxidase decreased the layer's enzymatic efficiency, resulting in a decrease of the glucose oxidation current as a function of the enzyme activity. The ratio of the decrease was correlated to elastase activity level. In this study, optimization experiments of bioactive components and characterization of the resulting new electrochemical device were carried out. A linear calibration range from 0.0303U/mL to 0.0729U/mL of elastase was reported. Real sample analyses were also carried out by the new electrochemical device. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Lower growth temperature increases alternative pathway capacity and alternative oxidase protein in tobacco. (United States)

    Vanlerberghe, G C; McIntosh, L


    Suspension cells of NT1 tobacco (Nicotiana tabacum L. cv bright yellow) have been used to study the effect of growth temperature on the CN-resistant, salicylhydroxamic acid-sensitive alternative pathway of respiration. Mitochondria isolated from cells maintained at 30 degrees C had a low capacity to oxidize succinate via the alternative pathway, whereas mitochondria isolated from cells 24 h after transfer to 18 degrees C displayed, on average, a 5-fold increase in this capacity (from 7 to 32 nanoatoms oxygen per milligram protein per minute). This represented an increase in alternative pathway capacity from 18 to 45% of the total capacity of electron transport. This increased capacity was lost upon transfer of cells back to 30 degrees C. A monoclonal antibody to the terminal oxidase of the alternative pathway (the alternative oxidase) from Sauromatum guttatum (T.E. Elthon, R.L. Nickels, L. McIntosh [1989] Plant Physiology 89: 1311-1317) recognized a 35-kilodalton mitochondrial protein in tobacco. There was an excellent correlation between the capacity of the alternative path in isolated tobacco mitochondria and the levels of this 35-kilodalton alternative oxidase protein. Cycloheximide could inhibit both the increased level of the 35-kilodalton alternative oxidase protein and the increased alternative pathway capacity normally seen upon transfer to 18 degrees C. We conclude that transfer of tobacco cells to the lower temperature increases the capacity of the alternative pathway due, at least in part, to de novo synthesis of the 35-kilodalton alternative oxidase protein.

  2. NADPH oxidases as novel pharmacologic targets against influenza A virus infection. (United States)

    Vlahos, Ross; Selemidis, Stavros


    Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

  3. Smoking induces long-lasting effects through a monoamine-oxidase epigenetic regulation.

    Directory of Open Access Journals (Sweden)

    Jean-Marie Launay

    Full Text Available BACKGROUND: Postulating that serotonin (5-HT, released from smoking-activated platelets could be involved in smoking-induced vascular modifications, we studied its catabolism in a series of 115 men distributed as current smokers (S, never smokers (NS and former smokers (FS who had stopped smoking for a mean of 13 years. METHODOLOGY/PRINCIPAL FINDINGS: 5-HT, monoamine oxidase (MAO-B activities and amounts were measured in platelets, and 5-hydroxyindolacetic acid (5-HIAA--the 5-HT/MAO catabolite--in plasma samples. Both platelet 5-HT and plasma 5-HIAA levels were correlated with the 10-year cardiovascular Framingham relative risk (P<0.01, but these correlations became non-significant after adjustment for smoking status, underlining that the determining risk factor among those taken into account in the Framingham risk calculation was smoking. Surprisingly, the platelet 5-HT content was similar in S and NS but lower in FS with a parallel higher plasma level of 5-HIAA in FS. This was unforeseen since MAO-B activity was inhibited during smoking (P<0.00001. It was, however, consistent with a higher enzyme protein concentration found in S and FS than in NS (P<0.001. It thus appears that MAO inhibition during smoking was compensated by a higher synthesis. To investigate the persistent increase in MAO-B protein concentration, a study of the methylation of its gene promoter was undertaken in a small supplementary cohort of similar subjects. We found that the methylation frequency of the MAOB gene promoter was markedly lower (P<0.0001 for S and FS vs. NS due to cigarette smoke-induced increase of nucleic acid demethylase activity. CONCLUSIONS/SIGNIFICANCE: This is one of the first reports that smoking induces an epigenetic modification. A better understanding of the epigenome may help to further elucidate the physiopathology and the development of new therapeutic approaches to tobacco addiction. The results could have a larger impact than cardiovascular

  4. ATP mediates NADPH oxidase/ROS generation and COX-2/PGE2 expression in A549 cells: role of P2 receptor-dependent STAT3 activation.

    Directory of Open Access Journals (Sweden)

    Shin-Ei Cheng

    Full Text Available BACKGROUND: Up-regulation of cyclooxygenase (COX-2 and its metabolite prostaglandin E(2 (PGE(2 are frequently implicated in lung inflammation. Extracellular nucleotides, such as ATP have been shown to act via activation of P2 purinoceptors, leading to COX-2 expression in various inflammatory diseases, such as lung inflammation. However, the mechanisms underlying ATP-induced COX-2 expression and PGE(2 release remain unclear. PRINCIPAL FINDINGS: Here, we showed that ATPγS induced COX-2 expression in A549 cells revealed by western blot and real-time PCR. Pretreatment with the inhibitors of P2 receptor (PPADS and suramin, PKC (Gö6983, Gö6976, Ro318220, and Rottlerin, ROS (Edaravone, NADPH oxidase [diphenyleneiodonium chloride (DPI and apocynin], Jak2 (AG490, and STAT3 [cucurbitacin E (CBE] and transfection with siRNAs of PKCα, PKCι, PKCμ, p47(phox, Jak2, STAT3, and cPLA(2 markedly reduced ATPγS-induced COX-2 expression and PGE(2 production. In addition, pretreatment with the inhibitors of P2 receptor attenuated PKCs translocation from the cytosol to the membrane in response to ATPγS. Moreover, ATPγS-induced ROS generation and p47(phox translocation was also reduced by pretreatment with the inhibitors of P2 receptor, PKC, and NADPH oxidase. On the other hand, ATPγS stimulated Jak2 and STAT3 activation which were inhibited by pretreatment with PPADS, suramin, Gö6983, Gö6976, Ro318220, GF109203X, Rottlerin, Edaravone, DPI, and apocynin in A549 cells. SIGNIFICANCE: Taken together, these results showed that ATPγS induced COX-2 expression and PGE(2 production via a P2 receptor/PKC/NADPH oxidase/ROS/Jak2/STAT3/cPLA(2 signaling pathway in A549 cells. Increased understanding of signal transduction mechanisms underlying COX-2 gene regulation will create opportunities for the development of anti-inflammation therapeutic strategies.

  5. Functional Analysis of Polyphenol Oxidases by Antisense/Sense Technology

    Directory of Open Access Journals (Sweden)

    Jutharat Attajarusit


    Full Text Available Polyphenol oxidases (PPOs catalyze the oxidation of phenolics to quinones, the secondary reactions of which lead to oxidative browning and postharvest losses of many fruits and vegetables. PPOs are ubiquitous in angiosperms, are inducible by both biotic and abiotic stresses, and have been implicated in several physiological processes including plant defense against pathogens and insects, the Mehler reaction, photoreduction of molecular oxygen by PSI, regulation of plastidic oxygen levels, aurone biosynthesis and the phenylpropanoid pathway. Here we review experiments in which the roles of PPO in disease and insect resistance as well as in the Mehler reaction were investigated using transgenic tomato (Lycopersicon esculentum plants with modified PPO expression levels (suppressed PPO and overexpressing PPO. These transgenic plants showed normal growth, development and reproduction under laboratory, growth chamber and greenhouse conditions. Antisense PPO expression dramatically increased susceptibility while PPO overexpression increased resistance of tomato plants to Pseudomonas syringae. Similarly, PPO-overexpressing transgenic plants showed an increase in resistance to various insects, including common cutworm (Spodoptera litura (F., cotton bollworm (Helicoverpa armigera (Hübner and beet army worm (Spodoptera exigua (Hübner, whereas larvae feeding on plants with suppressed PPO activity had higher larval growth rates and consumed more foliage. Similar increases in weight gain, foliage consumption, and survival were also observed with Colorado potato beetles (Leptinotarsa decemlineata (Say feeding on antisense PPO transgenic tomatoes. The putative defensive mechanisms conferred by PPO and its interaction with other defense proteins are discussed. In addition, transgenic plants with suppressed PPO exhibited more favorable water relations and decreased photoinhibition compared to nontransformed controls and transgenic plants

  6. Sulfite oxidase activity of cytochrome c: Role of hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Murugesan Velayutham


    occur to humans born with molybdenum cofactor and sulfite oxidase deficiencies.

  7. Development of new radiopharmaceuticals for imaging monoamine oxidase B

    Energy Technology Data Exchange (ETDEWEB)

    Vasdev, Neil, E-mail:; Sadovski, Oleg; Moran, Matthew D.; Parkes, Jun; Meyer, Jeffrey H.; Houle, Sylvain; Wilson, Alan A.


    Introduction: Imaging monoamine oxidase B (MAO-B) in the central nervous system with PET is an important goal for psychiatric studies. We here report an improved and automated radiosynthesis of N-(6-[{sup 18}F]-fluorohexyl)-N-methylpropargylamine ([{sup 18}F]FHMP; [{sup 18}F]-1), as well as the radiosynthesis of two new promising candidates for imaging cerebral MAO-B, namely, carbon-11-labeled 3-(4-[{sup 11}C]-methoxyphenyl)-6-methyl-2H-1-benzopyran-2-one ([{sup 11}C]-2) and N-((1H-pyrrol-2-yl)methyl)-N-[{sup 11}C]-methyl-1-phenylmethanamine ([{sup 11}C]-3). Methods: Fluorine-18-labeled 1 was prepared via a tosyloxy precursor in 29%{+-}5% uncorrected radiochemical yield, relative to [{sup 18}F]-fluoride. Both carbon-11-labeled compounds were prepared with [{sup 11}C]CH{sub 3}I using the 'LOOP' method in 11% and 18% uncorrected radiochemical yields, respectively, relative to starting [{sup 11}C]CO{sub 2}. All radiotracers had specific activities >37 GBq/{mu}mol and were >98% radiochemically pure at end of synthesis (<40 min). All radiotracers were evaluated by ex vivo biodistribution studies in conscious rodents. Results: A major radioactive metabolite in the rodent brain was observed following administration of [{sup 18}F]-1. While [{sup 11}C]-2 had moderate brain penetration and good clearance from normal brain tissue, distribution of radioactivity in brain was indicative of free and nonspecific binding. Good brain uptake was observed with [{sup 11}C]-3 (0.8%-1.4% injected dose per gram at 5 min postinjection), binding appeared to be reversible and distribution conformed with regional distribution of MAO-B in the rat brain. Preinjection of 3 or L-deprenyl showed a modest reduction (up to 25%) of brain activity. Conclusion: Carbon-11-labeled 3 was found to have the most favorable properties of the radiotracers evaluated; however, the signal-to-noise ratio was too low to warrant further in vivo imaging studies. Alternative radiotracers for imaging MAO

  8. Surface reconstitution of glucose oxidase onto a norbornylogous bridge self-assembled monolayer

    International Nuclear Information System (INIS)

    Liu Jingquan; Paddon-Row, Michael N.; Gooding, J. Justin


    An electrode construct was fabricated in which a self-assembled monolayer containing a novel norbornylogous bridge was covalently attached to flavin adenine dinucleotide (FAD), the redox active centre of several oxidase enzymes. The electrochemistry of the construct was investigated before and after the reconstitution of glucose oxidase around the surface bound FAD. Rapid rates of electron transfer were observed both before and after the reconstitution of biocatalytically active enzyme. However, no biocatalytic activity was observed under anaerobic conditions suggesting the a lack of enzyme turnover through direct electron transfer. It is proposed that a decrease in the electronic coupling between the redox active FAD and the electrode following reconstitution of the glucose oxidase - a probable consequence of the FAD being immersed in a protein environment - was responsible for the inability of the enzyme to be turned over under anaerobic conditions

  9. Carbon Nanotube Modified Screen Printed Electrodes: Pyranose Oxidase Immobilization Platform for Amperometric Enzyme Sensors

    Directory of Open Access Journals (Sweden)



    Full Text Available Here, a novel enzymatic biosensor was developed using multiwalled carbon nanotube including screen printed electrodes (MWCNT-SPE. Pyranose oxidase (PyOx was immobilized on the electrode surface by way of gelatin membrane and then cross-linked using glutaraldehyde. Glucose was detected at -0.7 V (vs. Ag/AgCl by watching consumed oxygen in enzymatic reaction after addition substrate. After optimization of pH and enzyme loading, the linearity was found in the range of 0.1–1.0 mM of glucose. After that, the effect of MCNT on the current was tested. Also the enzymatic biosensor including glucose oxidase instead of pyranose oxidase was prepared and the biosensor response followed for glucose. Furthermore, this system was tested for glucose analysis in soft drinks.

  10. Ratiometric glucose sensing based on fluorescent oxygen films and glucose oxidase

    Directory of Open Access Journals (Sweden)

    Fengyu Su


    Full Text Available A new two-layer sensor film was constructed for sensing glucose based on glucose oxidase and oxygen sensing material. The first layer of film containing the oxygen sensor and intra-reference material was polymerized, then the second layer of glucose oxidase and glutaraldehyde was formed on the oxygen sensor layer. The two-layer sensor film has a resolution up to 0.05 mM and a detection range from 0 to 5 mM to glucose. The effects of pH and temperature on the sensing performance were systematically investigated. The selective detection of glucose among other monosaccharides, such as fructose, mannose and galactose indicated that the sensing film has excellent selectivity. The prepared sensor was successfully applied for glucose sample detection of glucose concentration in artificial tears. Keywords: Glucose sensor, Glucose oxidase, Fluorescence, Oxygen film, Diabetes

  11. Layer-by-Layer Assembly of Glucose Oxidase on Carbon Nanotube Modified Electrodes. (United States)

    Suroviec, Alice H


    The use of enzymatically modified electrodes for the detection of glucose or other non-electrochemically active analytes is becoming increasingly common. Direct heterogeneous electron transfer to glucose oxidase has been shown to be kinetically difficult, which is why electron transfer mediators or indirect detection is usually used for monitoring glucose with electrochemical sensors. It has been found, however, that electrodes modified with single or multi-walled carbon nanotubes (CNTs) demonstrate fast heterogeneous electron transfer kinetics as compared to that found for traditional electrodes. Incorporating CNTs into the assembly of electrochemical glucose sensors, therefore, affords the possibility of facile electron transfer to glucose oxidase, and a more direct determination of glucose. This chapter describes the methods used to use CNTs in a layer-by-layer structure along with glucose oxidase to produce an enzymatically modified electrode with high turnover rates, increased stability and shelf-life.

  12. Xanthine oxidase activity and free radical generation in patients with sepsis syndrome

    DEFF Research Database (Denmark)

    Galley, H F; Davies, Michael Jonathan; Webster, N R


    OBJECTIVE: To determine xanthine oxidase activity, free radical concentrations, and lipid peroxidation in patients with sepsis syndrome compared with noninfected critically ill patients. DESIGN: A prospective observational study. SETTING: A nine-bed intensive care unit in a university teaching......). CONCLUSIONS: Patients with sepsis have xanthine oxidase activation, high free-radical concentrations, and evidence of free radical damage. The finding that xanthine oxidase activity was lower in those patients who died, coupled with increased lactate concentrations implies more severe ischemia with incomplete...... to the Acute Physiology and Chronic Health Evaluation (APACHE) II score or to the presence of organ dysfunction. The mean ascorbyl radical concentration (arbitrary units) determined by electron paramagnetic resonance following spin trapping was increased in patients compared with healthy subjects (p

  13. Erv2p: characterization of the redox behavior of a yeast sulfhydryl oxidase

    DEFF Research Database (Denmark)

    Wang, Wenzhong; Winther, Jakob R; Thorpe, Colin


    centers that facilitate the transfer of reducing equivalents from the dithiol substrates of these oxidases to the isoalloxazine ring where the reaction with molecular oxygen occurs. The present study examines yeast Erv2p and compares the redox behavior of this ER luminal protein with the augmenter...... and with unfolded proteins. Rapid reaction studies confirm that reduction of the flavin center of Erv2p is rate-limiting during turnover with molecular oxygen. This comparison of the redox properties between members of the ERV/ALR family of sulfhydryl oxidases provides insights into their likely roles in oxidative......The FAD prosthetic group of the ERV/ALR family of sulfhydryl oxidases is housed at the mouth of a 4-helix bundle and communicates with a pair of juxtaposed cysteine residues that form the proximal redox active disulfide. Most of these enzymes have one or more additional distal disulfide redox...

  14. Monoamine oxidase deficiency in males with an X chromosome deletion. (United States)

    Sims, K B; de la Chapelle, A; Norio, R; Sankila, E M; Hsu, Y P; Rinehart, W B; Corey, T J; Ozelius, L; Powell, J F; Bruns, G


    Mapping of the human MAOA gene to chromosomal region Xp21-p11 prompted our study of two affected males in a family previously reported to have Norrie disease resulting from a submicroscopic deletion in this chromosomal region. In this investigation we demonstrate in these cousins deletion of the MAOA gene, undetectable levels of MAO-A and MAO-B activities in their fibroblasts and platelets, respectively, loss of mRNA for MAO-A in fibroblasts, and substantial alterations in urinary catecholamine metabolites. The present study documents that a marked deficiency of MAO activity is compatible with life and that genes for MAO-A and MAO-B are near each other in this Xp chromosomal region. Some of the clinical features of these MAO deletion patients may help to identify X-linked MAO deficiency diseases in humans.

  15. Functional Assembly of Soluble and Membrane Recombinant Proteins of Mammalian NADPH Oxidase Complex. (United States)

    Souabni, Hajer; Ezzine, Aymen; Bizouarn, Tania; Baciou, Laura


    Activation of phagocyte cells from an innate immune system is associated with a massive consumption of molecular oxygen to generate highly reactive oxygen species (ROS) as microbial weapons. This is achieved by a multiprotein complex, the so-called NADPH oxidase. The activity of phagocyte NADPH oxidase relies on an assembly of more than five proteins, among them the membrane heterodimer named flavocytochrome b 558 (Cytb 558 ), constituted by the tight association of the gp91 phox (also named Nox2) and p22 phox proteins. The Cytb 558 is the membrane catalytic core of the NADPH oxidase complex, through which the reducing equivalent provided by NADPH is transferred via the associated prosthetic groups (one flavin and two hemes) to reduce dioxygen into superoxide anion. The other major proteins (p47 phox , p67 phox , p40 phox , Rac) requisite for the complex activity are cytosolic proteins. Thus, the NADPH oxidase functioning relies on a synergic multi-partner assembly that in vivo can be hardly studied at the molecular level due to the cell complexity. Thus, a cell-free assay method has been developed to study the NADPH oxidase activity that allows measuring and eventually quantifying the ROS generation based on optical techniques following reduction of cytochrome c. This setup is a valuable tool for the identification of protein interactions, of crucial components and additives for a functional enzyme. Recently, this method was improved by the engineering and the production of a complete recombinant NADPH oxidase complex using the combination of purified proteins expressed in bacterial and yeast host cells. The reconstitution into artificial membrane leads to a fully controllable system that permits fine functional studies.

  16. Functional heterogeneity of NADPH oxidase-mediated contractions to endothelin with vascular aging. (United States)

    Meyer, Matthias R; Barton, Matthias; Prossnitz, Eric R


    Aging, a physiological process and main risk factor for cardiovascular and renal diseases, is associated with endothelial cell dysfunction partly resulting from NADPH oxidase-dependent oxidative stress. Because increased formation of endothelium-derived endothelin-1 (ET-1) may contribute to vascular aging, we studied the role of NADPH oxidase function in age-dependent contractions to ET-1. Renal arteries and abdominal aortas from young and old C57BL6 mice (4 and 24 months of age) were prepared for isometric force measurements. Contractions to ET-1 (0.1-100 nmol/L) were determined in the presence and absence of the NADPH oxidase-selective inhibitor gp91ds-tat (3 μmol/L). To exclude age-dependent differential effects of NO bioactivity between vascular beds, all experiments were conducted in the presence of the NO synthase inhibitor L-NAME (300 μmol/L). In young animals, ET-1-induced contractions were 6-fold stronger in the renal artery than in the aorta (prenal artery and aorta, respectively (pAging had no effect on NADPH oxidase-dependent and -independent contractions to ET-1 in the renal artery. In contrast, contractions to ET-1 were markedly reduced in the aged aorta (5-fold, page-dependent heterogeneity of NADPH oxidase-mediated vascular contractions to ET-1, demonstrating an inherent resistance to functional changes in the renal artery but not in the aorta with aging. Thus, local activity of NADPH oxidase differentially modulates responses to ET-1 with aging in distinct vascular beds. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen

    Energy Technology Data Exchange (ETDEWEB)

    Pasqualini, Stefania, E-mail: [Department of Applied Biology, University of Perugia, Perugia (Italy); Tedeschini, Emma; Frenguelli, Giuseppe [Department of Applied Biology, University of Perugia, Perugia (Italy); Wopfner, Nicole; Ferreira, Fatima [Department of Molecular Biology, CD Laboratory for Allergy Diagnosis and Therapy, University of Salzburg, Salzburg (Austria); D' Amato, Gennaro [Division of Respiratory and Allergic Diseases, ' A. Cardarelli' High Speciality Hospital, Naples (Italy); Ederli, Luisa [Department of Applied Biology, University of Perugia, Perugia (Italy)


    Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O{sub 3}) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O{sub 3} fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O{sub 3} fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O{sub 3}, determined from the mRNA levels of the major allergens. We conclude that O{sub 3} can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: > O{sub 3} reduces the viability of ragweed pollen. > ROS and allergens of ragweed pollen were not affected by O{sub 3} exposure. > O{sub 3} enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. > O{sub 3} increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.

  18. Ratiometric glucose sensing based on fluorescent oxygen films and glucose oxidase


    Fengyu Su; Liqiang Zhang; Xiangxing Kong; Fred Lee; Yanqing Tian; Deirdre R. Meldrum


    A new two-layer sensor film was constructed for sensing glucose based on glucose oxidase and oxygen sensing material. The first layer of film containing the oxygen sensor and intra-reference material was polymerized, then the second layer of glucose oxidase and glutaraldehyde was formed on the oxygen sensor layer. The two-layer sensor film has a resolution up to 0.05 mM and a detection range from 0 to 5 mM to glucose. The effects of pH and temperature on the sensing performance were systemati...

  19. A new procedure for the purification of monodisperse highly active cytochrome c oxidase from bovine heart.


    Li, Y; Naqui, A; Frey, T G; Chance, B


    A simple and rapid method for the isolation of a large quantity of cytochrome c oxidase from bovine heart mitochondria was developed, based on selective solubilization of mitochondrial protein with first Triton and then lauryl maltoside. Gel filtration shows that the lauryl maltoside-solubilized oxidase preparation is in a hydrodynamically homogeneous state with a Stokes radius of 7.5 +/- 0.2 nm. It contains 8.0 mumol of haem (with an a/a3 ratio of 1)/g of protein. The catalytic constant (max...

  20. Cytochrome oxidase as an indicator of ice storage and frozen storage

    DEFF Research Database (Denmark)

    Godiksen, Helene; Jessen, Flemming


    in different cods was 21%, and the coefficient of variation of different analyses on the same homogenate was 5%. It was shown that ice storage of muscle samples before they were frozen and thawed resulted in a major freezing-induced activation of cytochrome oxidase activity. The enzyme may therefore be used...... as an indicator of frozen fish to determine if the fish has been stored on ice before freezing. Cytochrome oxidase activity showed also potential as an indicator of frozen storage, as it was possible to distinguish between the frozen storage temperatures -9, -20, and -40 degreesC....